#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CFAP74	85452	broad.mit.edu	37	1	1854900	1854900	+	IGR	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:1854900A>C								TMEM52 (4188 upstream) : C1orf222 (64662 downstream)														p.C142W(1)									TCATGTGCTGACAGGCGGCAC	0.627																																							uc001aik.2		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(424-426)TGT>TGG		RecName: Full=Uncharacterized protein C1orf222;							31.0	32.0	32.0					1																	1854900		2197	4296	6493	SO:0001628	intergenic_variant	0							g.chr1:1854900A>C																													1.37:g.1854900A>C						uc001ail.2_Missense_Mutation_p.C142W	p.C142W							8	1276	-									Missense_Mutation	SNP		37	c.426T>G		.	.	.	.	.	.	.	.	.	.	A	1.516	-0.548117	0.04024	.	.	ENSG00000142609	ENST00000493964	T	0.20463	2.07	3.07	-6.14	0.02111	.	0.325184	0.23139	N	0.051497	T	0.09291	0.0229	N	0.03608	-0.345	0.19945	N	0.999944	P	0.44946	0.846	P	0.52554	0.702	T	0.33420	-0.9869	10	0.37606	T	0.19	.	1.3657	0.02200	0.1512:0.195:0.1836:0.4702	.	142	Q69YW0	CA222_HUMAN	W	759	ENSP00000417061:C759W	ENSP00000417061:C759W	C	-	3	2	C1orf222	1844760	0.000000	0.05858	0.083000	0.20561	0.038000	0.13279	-4.863000	0.00176	-2.559000	0.00474	0.260000	0.18958	TGT	0	0.627									7	9	0	0	0	0.004482	0	7	9				
MEGF6	1953	broad.mit.edu	37	1	3511967	3511967	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:3511967G>T	ENST00000356575.4	-	3	537	c.311C>A	c.(310-312)gCc>gAc	p.A104D		NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	104	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.A104D(1)		cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CACGGTCCGGGCCTCCGTGGT	0.642																																					Ovarian(73;978 3658)	Ovarian(73;978 3658)	uc001akl.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(310-312)GCC>GAC		EGF-like-domain, multiple 3 precursor							35.0	42.0	40.0					1																	3511967		2017	4175	6192	SO:0001583	missense	1953					extracellular region	calcium ion binding	g.chr1:3511967G>T	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.311C>A	1.37:g.3511967G>T	ENSP00000348982:p.Ala104Asp						p.A104D	NM_001409	NP_001400	O75095	MEGF6_HUMAN		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)	3	538	-	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	104			EMI.		Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	c.311C>A	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	g	5.665	0.307272	0.10733	.	.	ENSG00000162591	ENST00000356575	D	0.84730	-1.89	3.92	3.92	0.45320	EMI domain (1);	1.040370	0.07639	U	0.930001	T	0.77896	0.4199	L	0.44542	1.39	0.27564	N	0.950087	P	0.34462	0.454	B	0.26202	0.067	T	0.63350	-0.6657	10	0.12103	T	0.63	-7.4891	12.1288	0.53932	0.0:0.0:1.0:0.0	.	104	O75095	MEGF6_HUMAN	D	104	ENSP00000348982:A104D	ENSP00000348982:A104D	A	-	2	0	MEGF6	3501827	1.000000	0.71417	0.548000	0.28192	0.266000	0.26442	2.348000	0.44045	2.126000	0.65437	0.486000	0.48141	GCC		0.642	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409		13	25	1	0	0.00498961	0.00499	0.00533343	13	25				
AJAP1	55966	broad.mit.edu	37	1	4829965	4829965	+	Silent	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:4829965A>T	ENST00000378191.4	+	3	1263	c.882A>T	c.(880-882)atA>atT	p.I294I	AJAP1_ENST00000378190.3_Silent_p.I294I	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	294					cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I294I(1)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		TCATGGTCATAGCTGCTCTCA	0.527																																							uc001alm.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(880-882)ATA>ATT		adherens junction associated protein 1							214.0	199.0	204.0					1																	4829965		2203	4300	6503	SO:0001819	synonymous_variant	55966				cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane		g.chr1:4829965A>T	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.882A>T	1.37:g.4829965A>T						AJAP1_uc001aln.2_Silent_p.I294I	p.I294I	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)	3	1263	+	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)	294			Helical; Signal-anchor for type III membrane protein; (Potential).		Q9Y229	Silent	SNP	ENST00000378191.4	37	c.882A>T	CCDS54.1																																																																																				0.527	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836		17	79	0	0	0	0.007413	0	17	79				
H6PD	9563	broad.mit.edu	37	1	9324728	9324728	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:9324728C>G	ENST00000377403.2	+	5	2478	c.2176C>G	c.(2176-2178)Cac>Gac	p.H726D	H6PD_ENST00000602477.1_Missense_Mutation_p.H737D	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	726	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)	p.H726D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CTCCCAGCCACACCGCCGCAT	0.647																																							uc001apt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2176-2178)CAC>GAC		hexose-6-phosphate dehydrogenase precursor	NADH(DB00157)						33.0	31.0	31.0					1																	9324728		2202	4298	6500	SO:0001583	missense	9563					endoplasmic reticulum lumen	6-phosphogluconolactonase activity|glucose 1-dehydrogenase|glucose-6-phosphate dehydrogenase activity|NADP binding	g.chr1:9324728C>G	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.2176C>G	1.37:g.9324728C>G	ENSP00000366620:p.His726Asp						p.H726D	NM_004285	NP_004276	O95479	G6PE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)	5	2449	+	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	726			6-phosphogluconolactonase.		Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	ENST00000377403.2	37	c.2176C>G	CCDS101.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.007388	0.35415	.	.	ENSG00000049239	ENST00000377403	T	0.40476	1.03	5.72	-0.426	0.12314	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.339904	0.38272	N	0.001747	T	0.41673	0.1169	M	0.77486	2.375	0.41963	D	0.990713	P	0.35821	0.523	B	0.36418	0.224	T	0.37314	-0.9711	10	0.52906	T	0.07	-17.9408	10.7053	0.45952	0.0:0.6786:0.0:0.3214	.	726	O95479	G6PE_HUMAN	D	726	ENSP00000366620:H726D	ENSP00000366620:H726D	H	+	1	0	H6PD	9247315	0.756000	0.28383	0.002000	0.10522	0.906000	0.53458	1.490000	0.35573	-0.336000	0.08438	0.561000	0.74099	CAC		0.647	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285		6	10	0	0	0	0.003163	0	6	10				
PLEKHM2	23207	broad.mit.edu	37	1	16057111	16057111	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:16057111T>A	ENST00000375799.3	+	15	2520	c.2293T>A	c.(2293-2295)Tgc>Agc	p.C765S	RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Missense_Mutation_p.C745S|PLEKHM2_ENST00000477849.1_3'UTR	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	765	Interaction with sifA.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)	p.C868S(1)|p.C765S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GCCCTGCCACTGCTCACCCCC	0.652																																							uc010obo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2293-2295)TGC>AGC		pleckstrin homology domain containing, family M							40.0	48.0	45.0					1																	16057111		2109	4222	6331	SO:0001583	missense	23207				Golgi organization	cytoplasm	kinesin binding	g.chr1:16057111T>A	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.2293T>A	1.37:g.16057111T>A	ENSP00000364956:p.Cys765Ser						p.C765S	NM_015164	NP_055979	Q8IWE5	PKHM2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)	15	2520	+		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	765			Interaction with sifA.		O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	ENST00000375799.3	37	c.2293T>A	CCDS44063.1	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638879	0.29157	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.44482	0.92;0.92	5.49	5.49	0.81192	.	0.303746	0.37906	N	0.001886	T	0.22244	0.0536	N	0.03608	-0.345	0.38245	D	0.94144	B	0.06786	0.001	B	0.04013	0.001	T	0.12785	-1.0534	10	0.21014	T	0.42	-16.2525	15.5895	0.76517	0.0:0.0:0.0:1.0	.	765	Q8IWE5	PKHM2_HUMAN	S	765;745	ENSP00000364956:C765S;ENSP00000364950:C745S	ENSP00000364950:C745S	C	+	1	0	PLEKHM2	15929698	0.972000	0.33761	1.000000	0.80357	0.767000	0.43475	3.654000	0.54453	2.096000	0.63516	0.533000	0.62120	TGC		0.652	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164		3	3	0	0	0	0.004672	0	3	3				
NBPF1	55672	broad.mit.edu	37	1	16892237	16892237	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:16892237A>C	ENST00000430580.2	-	27	3842	c.2955T>G	c.(2953-2955)tgT>tgG	p.C985W		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	985	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GAGTTGAATAACATCTATCCA	0.473																																							uc009vos.1		NA																	0					0						c.(3178-3180)TGT>TGG		hypothetical protein LOC55672							26.0	22.0	23.0					1																	16892237		1485	2604	4089	SO:0001583	missense	55672					cytoplasm		g.chr1:16892237A>C	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2955T>G	1.37:g.16892237A>C	ENSP00000474456:p.Cys985Trp					uc001ayw.2_5'Flank	p.C1060W	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)	28	4068	-			1060			NBPF 7.		Q8N4E8|Q9C0H0	Missense_Mutation	SNP	ENST00000430580.2	37	c.3180T>G																																																																																					0.473	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940		9	876	0	0	0	0.004482	0	9	876				
TMCO4	255104	broad.mit.edu	37	1	20082238	20082238	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:20082238C>T	ENST00000294543.6	-	7	645	c.404G>A	c.(403-405)aGa>aAa	p.R135K	TMCO4_ENST00000375127.1_Missense_Mutation_p.R135K|TMCO4_ENST00000375122.2_Missense_Mutation_p.R135K	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	135						integral component of membrane (GO:0016021)		p.R135K(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		AACGAGGACTCTGGCCCGGGC	0.478																																							uc001bcn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(403-405)AGA>AAA		transmembrane and coiled-coil domains 4							95.0	97.0	96.0					1																	20082238		2203	4300	6503	SO:0001583	missense	255104					integral to membrane		g.chr1:20082238C>T		CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.404G>A	1.37:g.20082238C>T	ENSP00000294543:p.Arg135Lys					TMCO4_uc001bcm.2_Missense_Mutation_p.R135K|TMCO4_uc001bco.1_Missense_Mutation_p.R135K|TMCO4_uc001bcp.1_Missense_Mutation_p.R135K|TMCO4_uc009vpn.1_Missense_Mutation_p.R135K|TMCO4_uc001bcq.1_Missense_Mutation_p.R135K	p.R135K	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)	7	646	-		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)	135					Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Missense_Mutation	SNP	ENST00000294543.6	37	c.404G>A	CCDS198.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645458	0.87859	.	.	ENSG00000162542	ENST00000294543;ENST00000375127;ENST00000375122	T;T;T	0.64991	0.08;0.16;-0.13	5.27	4.34	0.51931	.	0.052725	0.85682	D	0.000000	T	0.74313	0.3700	M	0.73962	2.25	0.39798	D	0.97252	D;D	0.67145	0.996;0.995	P;P	0.59115	0.754;0.852	T	0.79162	-0.1917	10	0.87932	D	0	-0.1263	12.9559	0.58427	0.1633:0.8367:0.0:0.0	.	135;135	Q5TGY1;Q5TGY1-2	TMCO4_HUMAN;.	K	135	ENSP00000294543:R135K;ENSP00000364269:R135K;ENSP00000364264:R135K	ENSP00000294543:R135K	R	-	2	0	TMCO4	19954825	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	5.988000	0.70579	1.187000	0.43000	0.650000	0.86243	AGA		0.478	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007658.1	NM_181719		22	59	0	0	0	0.002299	0	22	59				
OTUD3	23252	broad.mit.edu	37	1	20216956	20216956	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:20216956G>T	ENST00000375120.3	+	2	301	c.300G>T	c.(298-300)gtG>gtT	p.V100V	OTUD3_ENST00000466697.1_3'UTR	NM_015207.1	NP_056022.1	Q5T2D3	OTUD3_HUMAN	OTU deubiquitinase 3	100	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K11-linked deubiquitination (GO:0035871)|protein K6-linked deubiquitination (GO:0044313)		ubiquitin-specific protease activity (GO:0004843)	p.V100V(1)		breast(1)|kidney(2)|large_intestine(4)|lung(1)|skin(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGGAGACAGTGGACTACATGA	0.443																																							uc001bcs.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(298-300)GTG>GTT		OTU domain containing 3							213.0	200.0	204.0					1																	20216956		1983	4172	6155	SO:0001819	synonymous_variant	23252							g.chr1:20216956G>T	AB007928	CCDS41279.1	1p36.13	2014-02-24	2014-02-24		ENSG00000169914	ENSG00000169914		"""OTU domain containing"""	29038	protein-coding gene	gene with protein product		611758	"""OTU domain containing 3"""			9455484, 23827681	Standard	NM_015207		Approved	KIAA0459, DUBA4	uc001bcs.4	Q5T2D3	OTTHUMG00000002696	ENST00000375120.3:c.300G>T	1.37:g.20216956G>T							p.V100V	NM_015207	NP_056022	Q5T2D3	OTUD3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	2	419	+		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	100			OTU.		O75047	Silent	SNP	ENST00000375120.3	37	c.300G>T	CCDS41279.1																																																																																				0.443	OTUD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007655.1			37	72	1	0	4.11147e-13	0.003755	6.21116e-13	37	72				
IL22RA1	58985	broad.mit.edu	37	1	24463712	24463712	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:24463712G>A	ENST00000270800.1	-	3	302	c.264C>T	c.(262-264)ctC>ctT	p.L88L		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	88	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)	p.L88L(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		AGAGCTCCGTGAGGTTGCCCG	0.612																																							uc001biq.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(262-264)CTC>CTT		interleukin 22 receptor, alpha 1 precursor							85.0	75.0	78.0					1																	24463712		2203	4300	6503	SO:0001819	synonymous_variant	58985					integral to membrane	interferon receptor activity	g.chr1:24463712G>A	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.264C>T	1.37:g.24463712G>A						IL22RA1_uc010oeg.1_5'UTR|IL22RA1_uc009vrb.1_5'UTR|IL22RA1_uc010oeh.1_Silent_p.L88L	p.L88L	NM_021258	NP_067081	Q8N6P7	I22R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)	3	303	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	88			Extracellular (Potential).|Fibronectin type-III 1.		A8K839|B2R9Y9|Q9HB22	Silent	SNP	ENST00000270800.1	37	c.264C>T	CCDS247.1																																																																																				0.612	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1			7	35	0	0	0	0.00308	0	7	35				
RHCE	6006	broad.mit.edu	37	1	25717390	25717390	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:25717390C>A	ENST00000294413.7	-	5	709	c.651G>T	c.(649-651)tgG>tgT	p.W217C	RHCE_ENST00000374352.2_Missense_Mutation_p.W201C|RHCE_ENST00000243186.6_Missense_Mutation_p.W217C|RHCE_ENST00000349320.3_Missense_Mutation_p.W201C|RHCE_ENST00000413854.1_Missense_Mutation_p.W217C|RHCE_ENST00000340849.4_Intron|RHCE_ENST00000349438.4_Missense_Mutation_p.W217C|RHCE_ENST00000455194.1_Intron|RHCE_ENST00000346452.4_Intron|RHCE_ENST00000425135.1_Missense_Mutation_p.W217C	NM_020485.4	NP_065231	P18577	RHCE_HUMAN	Rh blood group, CcEe antigens	217				W -> R (in Ref. 13; ACK75569). {ECO:0000305}.		integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)	p.W217C(1)		endometrium(8)|large_intestine(6)|lung(3)	17		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		GCCAGAACATCCACAAGAAGA	0.527																																							uc001bkf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(649-651)TGG>TGT		Rhesus blood group, CcEe antigens isoform 1							132.0	124.0	127.0					1																	25717390		2203	4300	6503	SO:0001583	missense	6006					integral to plasma membrane		g.chr1:25717390C>A	BC075081	CCDS30634.1, CCDS30635.1, CCDS30636.1, CCDS30637.1	1p36.11	2014-09-17	2006-02-23		ENSG00000188672	ENSG00000188672		"""CD molecules"", ""Blood group antigens"""	10008	protein-coding gene	gene with protein product		111700	"""Rhesus blood group, CcEe antigens"""	RH		8220426	Standard	NM_138618		Approved	CD240CE	uc001bkf.3	P18577	OTTHUMG00000007650	ENST00000294413.7:c.651G>T	1.37:g.25717390C>A	ENSP00000294413:p.Trp217Cys					RHCE_uc001bkg.2_Missense_Mutation_p.W217C|RHCE_uc001bkh.2_Intron|RHCE_uc001bki.2_Intron|RHCE_uc001bkj.2_Missense_Mutation_p.W201C	p.W217C	NM_020485	NP_065231	P18577	RHCE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)	5	737	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	217	W -> R (in Ref. 13; ACK75569).		Helical; (Potential).		A7DW68|B7UDF3|B7UDF4|B7UDF5|B7UDF6|B7UDF7|B7UDF8|B7UDF9|B7UDG0|B7UDG1|B7UDG2|B7UDG3|Q02163|Q02164|Q02165|Q16160|Q2MJW0|Q2VC86|Q3LTM6|Q6AZX5|Q6J2U3|Q7RU06|Q8IZT2|Q8IZT3|Q8IZT4|Q8IZT5|Q9UD13|Q9UD14|Q9UD15|Q9UD16|Q9UD73|Q9UD74|Q9UEC2|Q9UEC3|Q9UPN0	Missense_Mutation	SNP	ENST00000294413.7	37	c.651G>T	CCDS30635.1	.	.	.	.	.	.	.	.	.	.	c	16.47	3.133704	0.56828	.	.	ENSG00000188672	ENST00000413854;ENST00000374352;ENST00000243186;ENST00000425135;ENST00000349320;ENST00000294413;ENST00000447203;ENST00000349438	T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4	4.08	4.08	0.47627	Ammonium transporter AmtB-like (3);	0.000000	0.85682	D	0.000000	T	0.68007	0.2954	H	0.94222	3.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.999	T	0.76900	-0.2788	10	0.87932	D	0	-9.9241	11.9685	0.53049	0.0:1.0:0.0:0.0	.	201;217;217	Q5VSJ9;Q5VSJ8;P18577	.;.;RHCE_HUMAN	C	217;201;217;217;201;217;217;217	ENSP00000415417:W217C;ENSP00000363472:W201C;ENSP00000243186:W217C;ENSP00000392809:W217C;ENSP00000311185:W201C;ENSP00000294413:W217C;ENSP00000334570:W217C	ENSP00000243186:W217C	W	-	3	0	RHCE	25589977	1.000000	0.71417	0.997000	0.53966	0.911000	0.54048	5.010000	0.64004	2.248000	0.74166	0.591000	0.81541	TGG		0.527	RHCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020312.2	NM_020485		17	93	1	0	9.16793e-09	0.00499	1.21223e-08	17	93				
AHDC1	27245	broad.mit.edu	37	1	27877205	27877205	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:27877205C>A	ENST00000247087.5	-	5	2018	c.1422G>T	c.(1420-1422)atG>atT	p.M474I	AHDC1_ENST00000374011.2_Missense_Mutation_p.M474I			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	474							DNA binding (GO:0003677)	p.M474I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		TCTTCACCACCATGCGCCGCA	0.627																																							uc009vsy.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1420-1422)ATG>ATT		AT hook, DNA binding motif, containing 1							25.0	24.0	24.0					1																	27877205		2202	4299	6501	SO:0001583	missense	27245						DNA binding	g.chr1:27877205C>A	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1422G>T	1.37:g.27877205C>A	ENSP00000247087:p.Met474Ile					AHDC1_uc009vsz.1_Missense_Mutation_p.M474I	p.M474I	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)	6	2391	-		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	474					Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	c.1422G>T	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648085	0.47258	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.41758	0.99;0.99	5.52	5.52	0.82312	.	0.270493	0.27866	U	0.017524	T	0.28001	0.0690	N	0.08118	0	0.46078	D	0.998858	B	0.19706	0.038	B	0.23574	0.047	T	0.06463	-1.0825	10	0.29301	T	0.29	-13.6229	18.3783	0.90442	0.0:1.0:0.0:0.0	.	474	Q5TGY3	AHDC1_HUMAN	I	474	ENSP00000247087:M474I;ENSP00000363123:M474I	ENSP00000247087:M474I	M	-	3	0	AHDC1	27749792	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.296000	0.59055	2.875000	0.98604	0.643000	0.83706	ATG		0.627	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3			11	12	1	0	3.03607e-14	0.001368	4.74433e-14	11	12				
ZSCAN20	7579	broad.mit.edu	37	1	33945125	33945126	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:33945125_33945126GG>TT	ENST00000361328.3	+	2	389_390	c.236_237GG>TT	c.(235-237)tGG>tTT	p.W79F	ZSCAN20_ENST00000480917.1_3'UTR|ZSCAN20_ENST00000373413.2_Missense_Mutation_p.W79F	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	79	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W79F(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGCTGTCGTTGGCTGAGGCCGG	0.624																																							uc001bxj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(235-237)TGG>TTT		zinc finger protein 31																																				SO:0001583	missense	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33945125_33945126GG>TT	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	Exception_encountered	1.37:g.33945125_33945126delinsTT	ENSP00000355053:p.Trp79Phe					ZSCAN20_uc001bxk.2_Missense_Mutation_p.W79F|ZSCAN20_uc009vui.2_Missense_Mutation_p.W79F	p.W79F	NM_145238	NP_660281	P17040	ZSC20_HUMAN			2	403_404	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	79			SCAN box.		A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	DNP	ENST00000361328.3	37	c.236_237GG>TT	CCDS41300.1																																																																																				0.624	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		6	29	0	0	0	0.004672	0	6	29				
MACF1	23499	broad.mit.edu	37	1	39893130	39893130	+	Silent	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:39893130A>G	ENST00000372915.3	+	61	16422	c.16335A>G	c.(16333-16335)caA>caG	p.Q5445Q	MACF1_ENST00000361689.2_Silent_p.Q3378Q|MACF1_ENST00000289893.4_Silent_p.Q3880Q|MACF1_ENST00000545844.1_Silent_p.Q3378Q|MACF1_ENST00000567887.1_Silent_p.Q5477Q|MACF1_ENST00000317713.7_Silent_p.Q3378Q|MACF1_ENST00000564288.1_Silent_p.Q5440Q|MACF1_ENST00000539005.1_Silent_p.Q3357Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5445					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.Q3378Q(1)|p.Q3880Q(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTGTAGGCAAAAACAGCTGG	0.383																																							uc010oiu.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(11638-11640)CAA>CAG		microfilament and actin filament cross-linker							92.0	98.0	96.0					1																	39893130		2203	4300	6503	SO:0001819	synonymous_variant	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39893130A>G	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16335A>G	1.37:g.39893130A>G						MACF1_uc010ois.1_Silent_p.Q3378Q|MACF1_uc001cda.1_Silent_p.Q3265Q|MACF1_uc001cdc.1_Silent_p.Q2444Q	p.Q3880Q	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		26	11771	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	5445			Spectrin 7.		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37	c.11640A>G		.	.	.	.	.	.	.	.	.	.	A	6.377	0.437625	0.12104	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.7	0.824	0.18818	.	.	.	.	.	T	0.51329	0.1668	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36529	-0.9744	4	.	.	.	.	5.4295	0.16446	0.6201:0.0:0.2565:0.1234	.	.	.	.	E	2491	.	.	K	+	1	0	MACF1	39665717	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	0.966000	0.29331	0.099000	0.17552	0.455000	0.32223	AAA		0.383	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		26	58	0	0	0	0.007291	0	26	58				
YBX1	4904	broad.mit.edu	37	1	43162350	43162350	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:43162350T>C	ENST00000321358.7	+	5	531	c.392T>C	c.(391-393)gTt>gCt	p.V131A	YBX1_ENST00000467957.1_3'UTR	NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	131					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.V131A(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTGGTGGTGTTCCAGTTCAA	0.438																																							uc001chs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)	5						c.(391-393)GTT>GCT		nuclease sensitive element binding protein 1							73.0	77.0	76.0					1																	43162350		2203	4300	6503	SO:0001583	missense	4904				CRD-mediated mRNA stabilization|negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|positive regulation of cell division|transcription from RNA polymerase II promoter	CRD-mediated mRNA stability complex|extracellular region|histone pre-mRNA 3'end processing complex|nucleoplasm|stress granule|U12-type spliceosomal complex	double-stranded DNA binding|protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding	g.chr1:43162350T>C	BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.392T>C	1.37:g.43162350T>C	ENSP00000361626:p.Val131Ala						p.V131A	NM_004559	NP_004550	P67809	YBOX1_HUMAN			5	563	+	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	131					P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	ENST00000321358.7	37	c.392T>C	CCDS470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.06|16.06	3.014658|3.014658	0.54468|0.54468	.|.	.|.	ENSG00000065978|ENSG00000065978	ENST00000436427|ENST00000321358;ENST00000332220;ENST00000318612	.|T;T	.|0.33865	.|1.54;1.39	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	.|0.161415	.|0.53938	.|D	.|0.000045	T|T	0.39145|0.39145	0.1067|0.1067	M|M	0.72576|0.72576	2.205|2.205	0.58432|0.58432	D|D	0.999994|0.999994	.|B	.|0.22541	.|0.071	.|B	.|0.20184	.|0.028	T|T	0.24799|0.24799	-1.0150|-1.0150	5|10	.|0.41790	.|T	.|0.15	-0.4394|-0.4394	13.372|13.372	0.60719|0.60719	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|131	.|P67809	.|YBOX1_HUMAN	L|A	181|131;101;127	.|ENSP00000361626:V131A;ENSP00000405937:V101A	.|ENSP00000361621:V127A	F|V	+|+	1|2	0|0	YBX1|YBX1	42934937|42934937	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	7.459000|7.459000	0.80802|0.80802	2.101000|2.101000	0.63845|0.63845	0.460000|0.460000	0.39030|0.39030	TTC|GTT		0.438	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559		22	26	0	0	0	0.002299	0	22	26				
YBX1	4904	broad.mit.edu	37	1	43166670	43166670	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:43166670A>T	ENST00000321358.7	+	7	1098	c.959A>T	c.(958-960)cAg>cTg	p.Q320L		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	320					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.Q320L(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GAGGCTGAGCAGGGCGGGGCT	0.547																																							uc001chs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)	5						c.(958-960)CAG>CTG		nuclease sensitive element binding protein 1							41.0	41.0	41.0					1																	43166670		2203	4300	6503	SO:0001583	missense	4904				CRD-mediated mRNA stabilization|negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|positive regulation of cell division|transcription from RNA polymerase II promoter	CRD-mediated mRNA stability complex|extracellular region|histone pre-mRNA 3'end processing complex|nucleoplasm|stress granule|U12-type spliceosomal complex	double-stranded DNA binding|protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding	g.chr1:43166670A>T	BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.959A>T	1.37:g.43166670A>T	ENSP00000361626:p.Gln320Leu						p.Q320L	NM_004559	NP_004550	P67809	YBOX1_HUMAN			7	1130	+	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	320					P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	ENST00000321358.7	37	c.959A>T	CCDS470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.9|23.9	4.473734|4.473734	0.84640|0.84640	.|.	.|.	ENSG00000065978|ENSG00000065978	ENST00000321358;ENST00000318612|ENST00000436427	T|.	0.35421|.	1.31|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.174531|.	0.53938|.	D|.	0.000042|.	T|T	0.78470|0.78470	0.4288|0.4288	M|M	0.86420|0.86420	2.815|2.815	0.80722|0.80722	D|D	1|1	D|.	0.54601|.	0.967|.	P|.	0.62382|.	0.901|.	T|T	0.81495|0.81495	-0.0907|-0.0907	10|5	0.87932|.	D|.	0|.	-3.957|-3.957	13.3596|13.3596	0.60648|0.60648	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	320|.	P67809|.	YBOX1_HUMAN|.	L|W	320;310|370	ENSP00000361626:Q320L|.	ENSP00000361621:Q310L|.	Q|R	+|+	2|1	0|2	YBX1|YBX1	42939257|42939257	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.530000|8.530000	0.90606|0.90606	2.027000|2.027000	0.59764|0.59764	0.455000|0.455000	0.32223|0.32223	CAG|AGG		0.547	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559		15	20	0	0	0	0.006122	0	15	20				
SZT2	23334	broad.mit.edu	37	1	43870102	43870102	+	Missense_Mutation	SNP	C	C	T	rs150074610		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:43870102C>T	ENST00000562955.1	+	4	379	c.379C>T	c.(379-381)Cgc>Tgc	p.R127C	SZT2_ENST00000310739.4_Missense_Mutation_p.R127C|SZT2_ENST00000372450.4_Missense_Mutation_p.R125C	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	127					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.R127C(1)|p.R125C(1)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						TGCCCTGTCCCGCTGCTTAGG	0.547																																							uc009vws.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(379-381)CGC>TGC		Homo sapiens mRNA for KIAA0467 protein, partial cds.		C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	101.0	95.0	97.0		379	5.9	1.0	1	dbSNP_134	97	0,8600		0,0,4300	no	missense	SZT2	NM_015284.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		127/3376	43870102	1,13005	2203	4300	6503	SO:0001583	missense	23334					peroxisome		g.chr1:43870102C>T	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.379C>T	1.37:g.43870102C>T	ENSP00000457168:p.Arg127Cys					C1orf84_uc001cjh.2_Missense_Mutation_p.R125C|C1orf84_uc001cji.1_RNA	p.R127C			Q5T011	SZT2_HUMAN			4	463	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	127					A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	c.379C>T	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815792	0.90790	2.27E-4	0.0	ENSG00000223526	ENST00000372450;ENST00000310739;ENST00000357658	T;T	0.22134	1.97;1.97	5.91	5.91	0.95273	.	.	.	.	.	T	0.39963	0.1098	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;0.999	P;P	0.62014	0.897;0.855	T	0.05784	-1.0864	9	0.87932	D	0	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	127;125	Q5T011-4;Q5T011-7	.;.	C	125;127;127	ENSP00000361528:R125C;ENSP00000312234:R127C	ENSP00000312234:R127C	R	+	1	0	AL139289.1	43642689	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.525000	0.53502	2.793000	0.96121	0.655000	0.94253	CGC		0.547	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284		11	55	0	0	0	0.000978	0	11	55				
STIL	6491	broad.mit.edu	37	1	47746154	47746154	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:47746154G>A	ENST00000360380.3	-	13	2339	c.1976C>T	c.(1975-1977)tCa>tTa	p.S659L	STIL_ENST00000371877.3_Missense_Mutation_p.S659L|STIL_ENST00000396221.2_Missense_Mutation_p.S659L|STIL_ENST00000337817.5_Missense_Mutation_p.S659L|STIL_ENST00000243182.6_Missense_Mutation_p.S659L	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	659	PIN1-binding. {ECO:0000250}.				cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.S659L(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				AGGACTACTTGAAGAACAGAA	0.468																																							uc001crc.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(1)	3						c.(1975-1977)TCA>TTA		SCL/TAL1 interrupting locus isoform 2							148.0	136.0	140.0					1																	47746154		2203	4300	6503	SO:0001583	missense	6491				cell proliferation|multicellular organismal development	centrosome|cytosol		g.chr1:47746154G>A	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1976C>T	1.37:g.47746154G>A	ENSP00000353544:p.Ser659Leu					TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Missense_Mutation_p.S612L|STIL_uc010omo.1_Missense_Mutation_p.S659L|STIL_uc001crd.1_Missense_Mutation_p.S659L|STIL_uc001cre.1_Missense_Mutation_p.S659L|STIL_uc001crf.1_Missense_Mutation_p.S272L|STIL_uc001crg.1_Missense_Mutation_p.S612L	p.S659L	NM_003035	NP_003026	Q15468	STIL_HUMAN			12	2131	-		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)	659			PIN1-binding (By similarity).		Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	c.1976C>T	CCDS548.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132647	0.77662	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.49720	2.13;2.13;2.13;2.11;2.13;0.77	4.79	4.79	0.61399	.	0.558491	0.18922	N	0.127460	T	0.49321	0.1550	L	0.29908	0.895	0.43462	D	0.99566	D;D;D;D;D	0.56287	0.975;0.975;0.975;0.975;0.975	P;P;P;P;P	0.53146	0.719;0.719;0.719;0.719;0.719	T	0.44817	-0.9303	10	0.40728	T	0.16	-13.3678	16.2159	0.82217	0.0:0.0:1.0:0.0	.	659;612;659;659;659	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	L	659;659;659;659;659;612	ENSP00000353544:S659L;ENSP00000337367:S659L;ENSP00000360944:S659L;ENSP00000379523:S659L;ENSP00000243182:S659L;ENSP00000411664:S612L	ENSP00000243182:S659L	S	-	2	0	STIL	47518741	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.301000	0.59086	2.500000	0.84329	0.650000	0.86243	TCA		0.468	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035		5	79	0	0	0	0.000602	0	5	79				
SPATA6	54558	broad.mit.edu	37	1	48918776	48918776	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:48918776C>G	ENST00000371847.3	-	2	243	c.79G>C	c.(79-81)Gac>Cac	p.D27H	SPATA6_ENST00000463938.1_5'UTR|SPATA6_ENST00000371843.3_Missense_Mutation_p.D27H|SPATA6_ENST00000396199.3_5'UTR	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	27					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)		p.D27H(2)		breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TCCTCTTTGTCTTTAAGCACG	0.388																																							uc001crr.1		NA																	2	Substitution - Missense(2)		upper_aerodigestive_tract(1)|lung(1)	ovary(1)	1						c.(79-81)GAC>CAC		spermatogenesis associated 6 precursor							132.0	125.0	127.0					1																	48918776		2203	4300	6503	SO:0001583	missense	54558				cell differentiation|multicellular organismal development|spermatogenesis	extracellular region		g.chr1:48918776C>G	AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.79G>C	1.37:g.48918776C>G	ENSP00000360913:p.Asp27His					SPATA6_uc001crs.1_Missense_Mutation_p.D27H|SPATA6_uc010omv.1_Missense_Mutation_p.D27H|SPATA6_uc001crt.2_5'UTR	p.D27H	NM_019073	NP_061946	Q9NWH7	SPAT6_HUMAN			2	244	-			27					Q5T3N7|Q8WUE6	Missense_Mutation	SNP	ENST00000371847.3	37	c.79G>C	CCDS551.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309300	0.60414	.	.	ENSG00000132122	ENST00000371847;ENST00000371843	T;T	0.13089	2.64;2.62	5.12	5.12	0.69794	.	0.278938	0.34932	N	0.003565	T	0.28433	0.0703	L	0.41824	1.3	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.67382	0.951;0.951	T	0.00934	-1.1509	10	0.62326	D	0.03	.	16.0466	0.80724	0.0:1.0:0.0:0.0	.	27;27	Q9NWH7-2;Q9NWH7	.;SPAT6_HUMAN	H	27	ENSP00000360913:D27H;ENSP00000360909:D27H	ENSP00000360909:D27H	D	-	1	0	SPATA6	48691363	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.465000	0.45075	2.407000	0.81776	0.555000	0.69702	GAC		0.388	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021347.1	NM_019073		9	51	0	0	0	0.006214	0	9	51				
CC2D1B	200014	broad.mit.edu	37	1	52819274	52819274	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:52819274C>A	ENST00000371586.2	-	24	2632	c.2494G>T	c.(2494-2496)Gtg>Ttg	p.V832L	CC2D1B_ENST00000460261.1_5'UTR|RP11-155O18.6_ENST00000606527.1_RNA|CC2D1B_ENST00000284376.3_Missense_Mutation_p.V826L	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	832						nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.V832L(1)		breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						CGCAGCCTCACCTTCACCTCC	0.612																																							uc001ctq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2494-2496)GTG>TTG		coiled-coil and C2 domain containing 1B							43.0	39.0	40.0					1																	52819274		2203	4300	6503	SO:0001583	missense	200014							g.chr1:52819274C>A	AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.2494G>T	1.37:g.52819274C>A	ENSP00000360642:p.Val832Leu					CC2D1B_uc001ctr.2_Missense_Mutation_p.V372L|CC2D1B_uc001cts.2_Splice_Site_p.K516_splice	p.V832L	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN			24	2632	-			832					Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	ENST00000371586.2	37	c.2494G>T	CCDS30714.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	21.1|21.1|21.1	4.092910|4.092910|4.092910	0.76756|0.76756|0.76756	.|.|.	.|.|.	ENSG00000154222|ENSG00000154222|ENSG00000154222	ENST00000438021;ENST00000371573|ENST00000450942|ENST00000371586;ENST00000284376	.|.|T;T	.|.|0.79845	.|.|-1.31;-1.31	4.97|4.97|4.97	4.97|4.97|4.97	0.65823|0.65823|0.65823	.|.|.	.|.|0.210998	.|.|0.39985	.|.|N	.|.|0.001215	.|D|D	.|0.86024|0.86024	.|0.5834|0.5834	M|M|M	0.71206|0.71206|0.71206	2.165|2.165|2.165	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;P	.|.|0.56035	.|.|0.974;0.956	.|.|P;P	.|.|0.52881	.|.|0.712;0.615	.|D|D	.|0.87589|0.87589	.|0.2489|0.2489	.|5|10	.|.|0.62326	.|.|D	.|.|0.03	.|-9.969|-9.969	18.4442|18.4442|18.4442	0.90678|0.90678|0.90678	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|826;832	.|.|Q5T0F9-2;Q5T0F9	.|.|.;C2D1B_HUMAN	.|S|L	-1|745|832;826	.|.|ENSP00000360642:V832L;ENSP00000284376:V826L	.|.|ENSP00000284376:V826L	.|R|V	-|-|-	.|3|1	.|2|0	CC2D1B|CC2D1B|CC2D1B	52591862|52591862|52591862	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	5.613000|5.613000|5.613000	0.67688|0.67688|0.67688	2.583000|2.583000|2.583000	0.87209|0.87209|0.87209	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	.|AGG|GTG		0.612	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022189.1	NM_032449		7	10	1	0	0.000274275	0.004482	0.000309838	7	10				
FOXD3	27022	broad.mit.edu	37	1	63789229	63789229	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:63789229T>A	ENST00000371116.2	+	1	500	c.500T>A	c.(499-501)aTc>aAc	p.I167N	RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	167					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I167N(1)		breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						CTGAGCGGCATCTGCGAGTTC	0.582																																					Pancreas(68;276 1750 11966 31252)	Pancreas(68;276 1750 11966 31252)	uc001dax.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(499-501)ATC>AAC		forkhead box D3							72.0	79.0	77.0					1																	63789229		2203	4300	6503	SO:0001583	missense	27022				axon extension involved in axon guidance|branching involved in ureteric bud morphogenesis|cartilage development|embryonic placenta development|enteric nervous system development|iridophore differentiation|kidney development|lateral line nerve glial cell development|melanocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development|trophectodermal cell differentiation	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr1:63789229T>A	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.500T>A	1.37:g.63789229T>A	ENSP00000360157:p.Ile167Asn						p.I167N	NM_012183	NP_036315	Q9UJU5	FOXD3_HUMAN			1	500	+			167			Fork-head.		Q9BYM2|Q9UDD1	Missense_Mutation	SNP	ENST00000371116.2	37	c.500T>A	CCDS624.1	.	.	.	.	.	.	.	.	.	.	T	18.55	3.648364	0.67358	.	.	ENSG00000187140	ENST00000371116	D	0.97752	-4.52	2.9	2.9	0.33743	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	U	0.000000	D	0.99199	0.9722	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98429	1.0581	10	0.87932	D	0	.	11.6249	0.51139	0.0:0.0:0.0:1.0	.	167	Q9UJU5	FOXD3_HUMAN	N	167	ENSP00000360157:I167N	ENSP00000360157:I167N	I	+	2	0	FOXD3	63561817	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.919000	0.75793	1.558000	0.49541	0.332000	0.21555	ATC		0.582	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1			4	75	0	0	0	0.009096	0	4	75				
CACHD1	57685	broad.mit.edu	37	1	65098382	65098382	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:65098382G>C	ENST00000371073.2	+	6	745	c.745G>C	c.(745-747)Gac>Cac	p.D249H	CACHD1_ENST00000290039.5_Missense_Mutation_p.D198H|CACHD1_ENST00000495994.1_Intron			Q5VU97	CAHD1_HUMAN	cache domain containing 1	249	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.D198H(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GATTGCCAAGGACGCTGCTCA	0.522																																							uc001dbo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(592-594)GAC>CAC		cache domain containing 1							98.0	100.0	99.0					1																	65098382		2107	4227	6334	SO:0001583	missense	57685				calcium ion transport	integral to membrane		g.chr1:65098382G>C	AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.745G>C	1.37:g.65098382G>C	ENSP00000360113:p.Asp249His					CACHD1_uc001dbp.1_Intron|CACHD1_uc001dbq.1_5'UTR	p.D198H	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN			6	697	+			249			Extracellular (Potential).|VWFA.		Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37	c.592G>C		.	.	.	.	.	.	.	.	.	.	G	26.9	4.777553	0.90195	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.24350	1.86;1.86	5.67	5.67	0.87782	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	T	0.29976	0.0750	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.04360	-1.0957	10	0.38643	T	0.18	-30.5327	19.773	0.96379	0.0:0.0:1.0:0.0	.	249	Q5VU97	CAHD1_HUMAN	H	249;198	ENSP00000360113:D249H;ENSP00000290039:D198H	ENSP00000290039:D198H	D	+	1	0	CACHD1	64870970	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	9.434000	0.97515	2.677000	0.91161	0.655000	0.94253	GAC		0.522	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925		20	24	0	0	0	0.001882	0	20	24				
JAK1	3716	broad.mit.edu	37	1	65323453	65323453	+	Silent	SNP	G	G	A	rs570451668		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:65323453G>A	ENST00000342505.4	-	10	1592	c.1344C>T	c.(1342-1344)taC>taT	p.Y448Y		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	448	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.Y448Y(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TATTGATGGCGTATTCTGTAC	0.517			Mis		ALL								G|||	1	0.000199681	0.0	0.0	5008	,	,		21159	0.001		0.0	False		,,,				2504	0.0						uc001dbu.1		NA		Dom	yes		1	1p32.3-p31.3	3716	Mis	Janus kinase 1			L			ALL		1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61						c.(1342-1344)TAC>TAT		janus kinase 1							102.0	104.0	103.0					1																	65323453		2036	4183	6219	SO:0001819	synonymous_variant	3716				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity	g.chr1:65323453G>A	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1344C>T	1.37:g.65323453G>A						JAK1_uc009wam.1_Silent_p.Y436Y	p.Y448Y	NM_002227	NP_002218	P23458	JAK1_HUMAN		BRCA - Breast invasive adenocarcinoma(111;0.0485)	10	1593	-			448			SH2.		Q59GQ2|Q9UD26	Silent	SNP	ENST00000342505.4	37	c.1344C>T	CCDS41346.1																																																																																				0.517	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227		6	24	0	0	0	0.001984	0	6	24				
SGIP1	84251	broad.mit.edu	37	1	67155937	67155937	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:67155937C>A	ENST00000371037.4	+	17	1585	c.1508C>A	c.(1507-1509)gCt>gAt	p.A503D	SGIP1_ENST00000371036.3_Missense_Mutation_p.A303D|SGIP1_ENST00000371035.3_Missense_Mutation_p.A293D|SGIP1_ENST00000237247.6_Missense_Mutation_p.A534D|SGIP1_ENST00000371039.1_Missense_Mutation_p.A304D	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	503					endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)	p.A304D(1)|p.A503D(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TTAGCGCGGGCTGAAAGCACT	0.458																																							uc001dcr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1507-1509)GCT>GAT		SH3-domain GRB2-like (endophilin) interacting							159.0	152.0	155.0					1																	67155937		2203	4300	6503	SO:0001583	missense	84251				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding	g.chr1:67155937C>A	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1508C>A	1.37:g.67155937C>A	ENSP00000360076:p.Ala503Asp					SGIP1_uc010opd.1_Missense_Mutation_p.A103D|SGIP1_uc001dcs.2_Missense_Mutation_p.A103D|SGIP1_uc001dct.2_Missense_Mutation_p.A103D|SGIP1_uc009wat.2_Missense_Mutation_p.A297D	p.A503D	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN			17	1725	+			503					A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	c.1508C>A	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	C	34	5.335744	0.95758	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T	0.03524	3.9;3.9;3.9;3.9;3.9	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.12860	0.0312	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.998;0.999	D;D;D;D	0.83275	0.996;0.987;0.987;0.996	T	0.01998	-1.1232	10	0.36615	T	0.2	-17.586	20.5792	0.99380	0.0:1.0:0.0:0.0	.	533;103;293;503	A6NEV3;B3KR01;B7Z5H8;Q9BQI5	.;.;.;SGIP1_HUMAN	D	534;304;293;533;506;303;503	ENSP00000237247:A534D;ENSP00000360078:A304D;ENSP00000360074:A293D;ENSP00000360075:A303D;ENSP00000360076:A503D	ENSP00000237247:A534D	A	+	2	0	SGIP1	66928525	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.456000	0.80751	2.873000	0.98535	0.561000	0.74099	GCT		0.458	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291		23	91	1	0	1.66031e-10	0.003954	2.34136e-10	23	91				
LRRC7	57554	broad.mit.edu	37	1	70452024	70452024	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:70452024C>A	ENST00000035383.5	+	8	802	c.772C>A	c.(772-774)Ctc>Atc	p.L258I	LRRC7_ENST00000415775.2_5'UTR|LRRC7_ENST00000310961.5_Missense_Mutation_p.L263I	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	258						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.L258I(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CCTTGAGGACCTCTTATTGTC	0.328																																							uc001dep.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(772-774)CTC>ATC		leucine rich repeat containing 7							98.0	94.0	95.0					1																	70452024		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70452024C>A		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.772C>A	1.37:g.70452024C>A	ENSP00000035383:p.Leu258Ile					LRRC7_uc009wbg.2_5'UTR	p.L258I	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN			8	802	+			258			LRR 11.		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.772C>A	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674324	0.47781	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.80566	-1.39;-1.39	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.80347	0.4606	M	0.80422	2.495	0.80722	D	1	P	0.35507	0.506	B	0.39152	0.292	T	0.82864	-0.0246	10	0.87932	D	0	.	17.6337	0.88116	0.0:1.0:0.0:0.0	.	258	Q96NW7	LRRC7_HUMAN	I	263;258;81	ENSP00000309245:L263I;ENSP00000035383:L258I	ENSP00000035383:L258I	L	+	1	0	LRRC7	70224612	1.000000	0.71417	1.000000	0.80357	0.377000	0.30045	5.658000	0.68003	2.840000	0.97914	0.655000	0.94253	CTC		0.328	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		3	35	1	0	0.00909568	0.009096	0.00960939	3	35				
LRRC40	55631	broad.mit.edu	37	1	70618156	70618156	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:70618156C>A	ENST00000370952.3	-	12	1478	c.1399G>T	c.(1399-1401)Gag>Tag	p.E467*		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	467						membrane (GO:0016020)		p.E467*(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						ACACATAACTCCAAGGATATA	0.289																																							uc001der.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1399-1401)GAG>TAG		leucine rich repeat containing 40							73.0	72.0	72.0					1																	70618156		2203	4299	6502	SO:0001587	stop_gained	55631							g.chr1:70618156C>A		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.1399G>T	1.37:g.70618156C>A	ENSP00000359990:p.Glu467*						p.E467*	NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN			12	1451	-			467			LRR 15.		Q9BTR7|Q9NSK1|Q9NXC1	Nonsense_Mutation	SNP	ENST00000370952.3	37	c.1399G>T	CCDS646.1	.	.	.	.	.	.	.	.	.	.	C	37	5.981617	0.97168	.	.	ENSG00000066557	ENST00000370952	.	.	.	5.55	5.55	0.83447	.	0.277086	0.40469	N	0.001083	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	12.7975	0.57567	0.0:0.9251:0.0:0.0749	.	.	.	.	X	467	.	ENSP00000359990:E467X	E	-	1	0	LRRC40	70390744	0.990000	0.36364	0.899000	0.35326	0.985000	0.73830	4.487000	0.60293	2.616000	0.88540	0.650000	0.86243	GAG		0.289	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768		14	19	1	0	9.16793e-09	0.00499	1.21223e-08	14	19				
COL24A1	255631	broad.mit.edu	37	1	86590978	86590978	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:86590978G>A	ENST00000370571.2	-	3	1407	c.1041C>T	c.(1039-1041)ttC>ttT	p.F347F	COL24A1_ENST00000436319.1_Silent_p.F347F	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	347					extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.F347F(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTGACAGGCTGAAATTTGTCT	0.413																																							uc001dlj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1039-1041)TTC>TTT		collagen, type XXIV, alpha 1 precursor							129.0	114.0	119.0					1																	86590978		1934	4132	6066	SO:0001819	synonymous_variant	255631				cell adhesion	collagen	extracellular matrix structural constituent	g.chr1:86590978G>A	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1041C>T	1.37:g.86590978G>A						COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Silent_p.F347F	p.F347F	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN		all cancers(265;0.0627)|Epithelial(280;0.0689)	3	1083	-			347					C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Silent	SNP	ENST00000370571.2	37	c.1041C>T	CCDS41353.1																																																																																				0.413	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890		16	67	0	0	0	0.00499	0	16	67				
GBP5	115362	broad.mit.edu	37	1	89730567	89730567	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:89730567C>G	ENST00000370459.3	-	7	1078	c.951G>C	c.(949-951)ttG>ttC	p.L317F	GBP5_ENST00000343435.5_Missense_Mutation_p.L317F|RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000471171.1_5'Flank			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	317						cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.L317F(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		CTCTCTGAGCCAAGGCCAGGA	0.522																																							uc001dnc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(949-951)TTG>TTC		guanylate-binding protein 5							96.0	83.0	88.0					1																	89730567		2203	4300	6503	SO:0001583	missense	115362					plasma membrane	GTP binding|GTPase activity	g.chr1:89730567C>G	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.951G>C	1.37:g.89730567C>G	ENSP00000359488:p.Leu317Phe					GBP5_uc001dnd.2_Missense_Mutation_p.L317F|GBP5_uc001dne.1_Missense_Mutation_p.L317F	p.L317F	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN		all cancers(265;0.00784)|Epithelial(280;0.0286)	8	1488	-			317					B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	c.951G>C	CCDS722.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.373855	0.61624	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.04502	3.61;3.61;3.61	4.96	4.96	0.65561	Guanylate-binding protein, C-terminal (3);	0.075758	0.53938	D	0.000051	T	0.20700	0.0498	M	0.90705	3.14	0.37558	D	0.918956	D	0.89917	1.0	D	0.91635	0.999	T	0.02431	-1.1160	10	0.87932	D	0	-2.5543	16.1641	0.81743	0.0:1.0:0.0:0.0	.	317	Q96PP8	GBP5_HUMAN	F	317	ENSP00000340396:L317F;ENSP00000359488:L317F;ENSP00000403010:L317F	ENSP00000340396:L317F	L	-	3	2	GBP5	89503155	1.000000	0.71417	0.946000	0.38457	0.153000	0.21895	2.861000	0.48380	2.759000	0.94783	0.556000	0.70494	TTG		0.522	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942		28	33	0	0	0	0.004656	0	28	33				
EPHX4	253152	broad.mit.edu	37	1	92511171	92511171	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:92511171G>T	ENST00000370383.4	+	4	656	c.558G>T	c.(556-558)gtG>gtT	p.V186V		NM_173567.4	NP_775838.3	Q8IUS5	EPHX4_HUMAN	epoxide hydrolase 4	186						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.V186V(1)		central_nervous_system(1)|large_intestine(3)|lung(8)	12						CTGAAATGGTGATGAAGCTTA	0.373																																					GBM(140;473 1857 5172 22066 49719)	GBM(140;473 1857 5172 22066 49719)	uc001don.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(556-558)GTG>GTT		abhydrolase domain containing 7							225.0	192.0	203.0					1																	92511171		2203	4300	6503	SO:0001819	synonymous_variant	253152					integral to membrane	hydrolase activity	g.chr1:92511171G>T	AK074822	CCDS736.1	1p22.1	2011-10-05	2009-04-06	2009-04-06	ENSG00000172031	ENSG00000172031		"""Abhydrolase domain containing"""	23758	protein-coding gene	gene with protein product			"""abhydrolase domain containing 7"""	ABHD7		12477932	Standard	NM_173567		Approved	EPHXRP, FLJ90341	uc001don.2	Q8IUS5	OTTHUMG00000010114	ENST00000370383.4:c.558G>T	1.37:g.92511171G>T							p.V186V	NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN			4	662	+			186					Q8NCC6	Silent	SNP	ENST00000370383.4	37	c.558G>T	CCDS736.1																																																																																				0.373	EPHX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027985.1	NM_173567		33	50	1	0	2.47316e-13	0.003271	3.77275e-13	33	50				
KIAA1324	57535	broad.mit.edu	37	1	109737059	109737059	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:109737059A>G	ENST00000369939.3	+	15	2147	c.1964A>G	c.(1963-1965)tAc>tGc	p.Y655C	KIAA1324_ENST00000529753.1_Missense_Mutation_p.Y568C|KIAA1324_ENST00000369938.1_3'UTR	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	655					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)	p.Y655C(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		TCTCTGTGCTACAACGATTGC	0.577																																							uc001dwq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5						c.(1963-1965)TAC>TGC		hypothetical protein LOC57535 precursor							118.0	94.0	102.0					1																	109737059		2203	4300	6503	SO:0001583	missense	57535				macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane		g.chr1:109737059A>G	AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.1964A>G	1.37:g.109737059A>G	ENSP00000358955:p.Tyr655Cys					KIAA1324_uc009wex.1_Missense_Mutation_p.Y605C|KIAA1324_uc009wey.2_Missense_Mutation_p.Y568C|KIAA1324_uc010ovg.1_Missense_Mutation_p.Y553C|KIAA1324_uc001dwr.2_Missense_Mutation_p.Y305C	p.Y655C	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)	16	2100	+		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)	655			Extracellular (Potential).		Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Missense_Mutation	SNP	ENST00000369939.3	37	c.1964A>G	CCDS794.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.950700	0.53186	.	.	ENSG00000116299	ENST00000369939;ENST00000457623;ENST00000529753	T;T;T	0.63744	-0.06;-0.06;-0.06	5.68	3.19	0.36642	Growth factor, receptor (1);	0.509864	0.21161	N	0.079151	T	0.47655	0.1457	L	0.36672	1.1	0.30488	N	0.77168	D;D;D;D	0.61697	0.99;0.975;0.99;0.99	P;P;P;P	0.55999	0.789;0.707;0.789;0.789	T	0.40924	-0.9537	10	0.42905	T	0.14	-14.4197	9.5034	0.39031	0.6:0.0:0.0:0.4	.	655;568;655;655	Q6UXG2-4;Q6UXG2-3;C9J810;Q6UXG2	.;.;.;K1324_HUMAN	C	655;605;568	ENSP00000358955:Y655C;ENSP00000393964:Y605C;ENSP00000434595:Y568C	ENSP00000358955:Y655C	Y	+	2	0	KIAA1324	109538582	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	0.987000	0.29603	0.941000	0.37499	0.482000	0.46254	TAC		0.577	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775		3	29	0	0	0	0.001168	0	3	29				
GPR61	83873	broad.mit.edu	37	1	110086428	110086428	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:110086428C>G	ENST00000527748.1	+	2	1467	c.784C>G	c.(784-786)Cgc>Ggc	p.R262G	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.R262G(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		TCTCAGCAGCCGCTCCACGAT	0.682																																							uc001dxy.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(784-786)CGC>GGC		G protein-coupled receptor 61							46.0	54.0	51.0					1																	110086428		2203	4300	6503	SO:0001583	missense	83873					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:110086428C>G	AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.784C>G	1.37:g.110086428C>G	ENSP00000432456:p.Arg262Gly						p.R262G	NM_031936	NP_114142	Q9BZJ8	GPR61_HUMAN		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)	2	1467	+		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)	262			Cytoplasmic (Potential).		A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Missense_Mutation	SNP	ENST00000527748.1	37	c.784C>G	CCDS801.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.772719	0.69992	.	.	ENSG00000156097	ENST00000527748;ENST00000286603	T	0.39229	1.09	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.39708	0.1088	L	0.37750	1.13	0.53005	D	0.999966	D	0.63046	0.992	P	0.59288	0.855	T	0.10042	-1.0647	10	0.41790	T	0.15	-28.7844	14.3954	0.67007	0.1482:0.8518:0.0:0.0	.	262	Q9BZJ8	GPR61_HUMAN	G	262;390	ENSP00000432456:R262G	ENSP00000286603:R390G	R	+	1	0	GPR61	109887951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.025000	0.49681	2.718000	0.92993	0.650000	0.86243	CGC		0.682	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385575.1			21	76	0	0	0	0.001882	0	21	76				
TRIM33	51592	broad.mit.edu	37	1	114969832	114969832	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:114969832G>A	ENST00000358465.2	-	8	1470	c.1387C>T	c.(1387-1389)Ccc>Tcc	p.P463S	TRIM33_ENST00000369543.2_Missense_Mutation_p.P463S|TRIM33_ENST00000450349.2_Missense_Mutation_p.P71S	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	463					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P463S(1)		breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGAAGGTGGGATCACAATGG	0.368			T	RET	papillary thyroid																																		uc001eew.2		NA		Dom	yes		1	1p13	51592	T	""" tripartite motif-containing 33 (PTC7,TIF1G)"""			E	RET		papillary thyroid		1	Substitution - Missense(1)		lung(1)	lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11						c.(1387-1389)CCC>TCC		tripartite motif-containing 33 protein isoform							101.0	101.0	101.0					1																	114969832		2203	4300	6503	SO:0001583	missense	51592				negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding	g.chr1:114969832G>A	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1387C>T	1.37:g.114969832G>A	ENSP00000351250:p.Pro463Ser					TRIM33_uc010owr.1_Missense_Mutation_p.P71S|TRIM33_uc010ows.1_Missense_Mutation_p.P71S|TRIM33_uc001eex.2_Missense_Mutation_p.P463S	p.P463S	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	8	1471	-	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	463					O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	c.1387C>T	CCDS872.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911078	0.72983	.	.	ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349	T;T;T	0.76186	-0.76;-0.67;-1.0	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.74786	0.3762	L	0.41710	1.295	0.80722	D	1	D;D;D;B	0.89917	0.997;0.997;1.0;0.066	D;D;D;B	0.87578	0.986;0.986;0.998;0.035	T	0.70710	-0.4797	10	0.18710	T	0.47	-5.6171	17.8648	0.88793	0.0:0.0:1.0:0.0	.	71;71;463;463	E7EN20;B3KN30;Q9UPN9-2;Q9UPN9	.;.;.;TRI33_HUMAN	S	463;463;71	ENSP00000351250:P463S;ENSP00000358556:P463S;ENSP00000412077:P71S	ENSP00000351250:P463S	P	-	1	0	TRIM33	114771355	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.592000	0.82676	2.228000	0.72767	0.563000	0.77884	CCC		0.368	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906		13	51	0	0	0	0.001855	0	13	51				
IGSF3	3321	broad.mit.edu	37	1	117122093	117122093	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:117122093C>A	ENST00000369486.3	-	10	4020	c.3255G>T	c.(3253-3255)tgG>tgT	p.W1085C	IGSF3_ENST00000318837.6_Missense_Mutation_p.W1105C|IGSF3_ENST00000369483.1_Missense_Mutation_p.W1105C	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1085	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.W1105C(1)|p.W1085C(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGCTGGGCAGCCACTCCTCCA	0.592																																							uc001egr.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(3253-3255)TGG>TGT		immunoglobulin superfamily, member 3 isoform 2							54.0	56.0	55.0					1																	117122093		2203	4300	6503	SO:0001583	missense	3321					integral to membrane		g.chr1:117122093C>A	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3255G>T	1.37:g.117122093C>A	ENSP00000358498:p.Trp1085Cys					IGSF3_uc001egq.1_Missense_Mutation_p.W1105C	p.W1085C	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)	10	3960	-	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)	1085			Ig-like C2-type 8.|Extracellular (Potential).		A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	c.3255G>T	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.754021	0.69648	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.22134	1.97;1.97;1.97	4.61	4.61	0.57282	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.18304	-1.0341	10	0.87932	D	0	-24.6464	14.9725	0.71246	0.0:1.0:0.0:0.0	.	1085;1105	O75054;A6NJZ6	IGSF3_HUMAN;.	C	1085;1105;1105	ENSP00000358498:W1085C;ENSP00000358495:W1105C;ENSP00000321184:W1105C	ENSP00000321184:W1105C	W	-	3	0	IGSF3	116923616	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.803000	0.75180	2.386000	0.81285	0.462000	0.41574	TGG		0.592	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542		17	29	1	0	1.5739e-10	0.004007	2.24439e-10	17	29				
VTCN1	79679	broad.mit.edu	37	1	117699283	117699283	+	Missense_Mutation	SNP	C	C	T	rs144508898	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:117699283C>T	ENST00000369458.3	-	3	436	c.358G>A	c.(358-360)Gtg>Atg	p.V120M	VTCN1_ENST00000539893.1_Missense_Mutation_p.V25M|VTCN1_ENST00000359008.4_Missense_Mutation_p.V123M|VTCN1_ENST00000328189.3_Intron|VTCN1_ENST00000463461.1_5'UTR	NM_024626.3	NP_078902.2			V-set domain containing T cell activation inhibitor 1									p.V120M(1)		large_intestine(7)|lung(4)|upper_aerodigestive_tract(1)	12	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		GTGAGTTGCACGTTTTTCAGC	0.448																																							uc001ehb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(358-360)GTG>ATG		V-set domain containing T cell activation		C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	93.0	90.0	91.0		358	6.1	1.0	1	dbSNP_134	91	0,8600		0,0,4300	yes	missense	VTCN1	NM_024626.2	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	120/283	117699283	1,13005	2203	4300	6503	SO:0001583	missense	79679					integral to membrane|plasma membrane		g.chr1:117699283C>T	BX648021	CCDS894.1, CCDS58019.1, CCDS58020.1	1p12	2013-01-29			ENSG00000134258	ENSG00000134258		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28873	protein-coding gene	gene with protein product	"""B7 family member, H4"", ""B7 superfamily member 1"""	608162				12818165, 12818166	Standard	NM_024626		Approved	B7-H4, FLJ22418, B7S1, B7X, B7H4	uc001ehb.3	Q7Z7D3	OTTHUMG00000012118	ENST00000369458.3:c.358G>A	1.37:g.117699283C>T	ENSP00000358470:p.Val120Met					VTCN1_uc001ehc.2_Missense_Mutation_p.V25M|VTCN1_uc009whf.1_Intron	p.V120M	NM_024626	NP_078902	Q7Z7D3	VTCN1_HUMAN		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)	3	430	-	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)	120			Ig-like V-type 1.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000369458.3	37	c.358G>A	CCDS894.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270380	0.59540	2.27E-4	0.0	ENSG00000134258	ENST00000369458;ENST00000359008;ENST00000539893	T;T;T	0.68624	-0.34;-0.34;-0.34	6.08	6.08	0.98989	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000027	T	0.82185	0.4982	M	0.86502	2.82	0.42359	D	0.992406	D	0.76494	0.999	D	0.71870	0.975	D	0.84177	0.0437	10	0.87932	D	0	-17.2679	17.8298	0.88677	0.0:1.0:0.0:0.0	.	120	Q7Z7D3	VTCN1_HUMAN	M	120;123;25	ENSP00000358470:V120M;ENSP00000351899:V123M;ENSP00000444724:V25M	ENSP00000351899:V123M	V	-	1	0	VTCN1	117500806	0.992000	0.36948	0.979000	0.43373	0.106000	0.19336	3.081000	0.50120	2.893000	0.99171	0.637000	0.83480	GTG		0.448	VTCN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000033500.2	NM_024626		6	54	0	0	0	0.006214	0	6	54				
NBPF10	100132406	broad.mit.edu	37	1	145303954	145303954	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:145303954G>A	ENST00000369339.3	+	6	791	c.538G>A	c.(538-540)Gag>Aag	p.E180K	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Missense_Mutation_p.E180K|NBPF10_ENST00000342960.5_Missense_Mutation_p.E451K			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	451	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.E180K(1)|p.E451K(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGAGGTGGCTGAGAAAGTGCA	0.433																																							uc001end.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1351-1353)GAG>AAG		hypothetical protein LOC100132406							61.0	84.0	77.0					1																	145303954		692	1590	2282	SO:0001583	missense	100132406							g.chr1:145303954G>A	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.538G>A	1.37:g.145303954G>A	ENSP00000358345:p.Glu180Lys					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Missense_Mutation_p.E382K|NBPF9_uc010oyg.1_Missense_Mutation_p.E416K|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_5'UTR|NBPF10_uc001emq.1_Missense_Mutation_p.E180K	p.E451K	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	9	1386	+	all_hematologic(923;0.032)		396					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37	c.1351G>A		.	.	.	.	.	.	.	.	.	.	.	12.30	1.896770	0.33535	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.20069	2.1;2.1	0.811	0.811	0.18739	.	.	.	.	.	T	0.14184	0.0343	L	0.27053	0.805	0.09310	N	1	P;B;D	0.69078	0.565;0.129;0.997	P;B;D	0.79784	0.587;0.161;0.993	T	0.07751	-1.0756	9	0.66056	D	0.02	.	4.9937	0.14228	0.0:0.0:1.0:0.0	.	416;382;180	Q3BBV7;Q5U227;A8MQ30	.;.;.	K	376;180;180;451	ENSP00000358344:E180K;ENSP00000345684:E451K	ENSP00000345684:E451K	E	+	1	0	NBPF10	144015311	0.006000	0.16342	0.008000	0.14137	0.019000	0.09904	0.237000	0.17985	0.726000	0.32339	0.281000	0.19383	GAG		0.433	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703		7	300	0	0	0	0.00308	0	7	300				
NBPF10	100132406	broad.mit.edu	37	1	145304535	145304535	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:145304535G>C	ENST00000369339.3	+	7	908	c.655G>C	c.(655-657)Gac>Cac	p.D219H	RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Missense_Mutation_p.D219H|NBPF10_ENST00000342960.5_Missense_Mutation_p.D490H			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	490	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.D219H(1)|p.D490H(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGGCTCTTATGACTCCAACCA	0.468																																							uc001end.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1468-1470)GAC>CAC		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145304535G>C	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.655G>C	1.37:g.145304535G>C	ENSP00000358345:p.Asp219His					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Missense_Mutation_p.D421H|NBPF9_uc010oyg.1_Missense_Mutation_p.D455H|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Missense_Mutation_p.D29H|NBPF10_uc001emq.1_Missense_Mutation_p.D219H	p.D490H	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	10	1503	+	all_hematologic(923;0.032)		Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37	c.1468G>C		.	.	.	.	.	.	.	.	.	.	.	9.585	1.124696	0.20959	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.09163	3.01;3.01	0.811	0.811	0.18739	.	.	.	.	.	T	0.08179	0.0204	L	0.35542	1.07	0.09310	N	1	D;P;B;D	0.57257	0.979;0.956;0.234;0.978	D;D;B;P	0.69479	0.964;0.936;0.261;0.896	T	0.20140	-1.0284	9	0.87932	D	0	.	4.9937	0.14228	0.0:0.0:1.0:0.0	.	165;455;421;219	Q4VC10;Q3BBV7;Q5U227;A8MQ30	.;.;.;.	H	415;219;219;490	ENSP00000358344:D219H;ENSP00000345684:D490H	ENSP00000345684:D490H	D	+	1	0	NBPF10	144015892	0.005000	0.15991	0.002000	0.10522	0.003000	0.03518	1.654000	0.37334	0.726000	0.32339	0.281000	0.19383	GAC		0.468	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703		6	421	0	0	0	0.001984	0	6	421				
RP11-337C18.8	0	broad.mit.edu	37	1	146650133	146650133	+	RNA	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:146650133A>C	ENST00000607149.1	+	0	350				RP11-337C18.8_ENST00000606757.1_RNA|RP11-337C18.9_ENST00000606152.1_RNA|RP11-337C18.10_ENST00000606856.1_RNA																							AATTTAAGAAATTCATTAGTG	0.448																																							uc001epg.1		NA																	0					0						c.(439-441)AAA>AAC		SubName: Full=cDNA FLJ53558, highly similar to Protein disulfide-isomerase A3 (EC 5.3.4.1);																																						171423							g.chr1:146650133A>C																													1.37:g.146650133A>C							p.K147N	NR_002305						1	704	+									Missense_Mutation	SNP	ENST00000607149.1	37	c.441A>C																																																																																					0.448	RP11-337C18.8-004	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000471324.1			34	53	0	0	0	0.002836	0	34	53				
SV2A	9900	broad.mit.edu	37	1	149879341	149879341	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:149879341A>G	ENST00000369146.3	-	10	2079	c.1589T>C	c.(1588-1590)cTg>cCg	p.L530P	SV2A_ENST00000369145.1_Missense_Mutation_p.L530P	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	530					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.L530P(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CTCTTCAAACAGGGAATCCTC	0.502																																							uc001etg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(1)	7						c.(1588-1590)CTG>CCG		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						133.0	111.0	118.0					1																	149879341		2203	4300	6503	SO:0001583	missense	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149879341A>G	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1589T>C	1.37:g.149879341A>G	ENSP00000358142:p.Leu530Pro					SV2A_uc009wlk.2_5'Flank|SV2A_uc001eth.2_Missense_Mutation_p.L530P	p.L530P	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		10	2080	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		530			Extracellular (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	37	c.1589T>C	CCDS940.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.329417	0.81690	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.44881	0.91;0.91	5.26	5.26	0.73747	Major facilitator superfamily domain (1);	0.109289	0.39341	N	0.001390	T	0.54191	0.1843	M	0.80982	2.52	0.80722	D	1	D	0.57257	0.979	P	0.62649	0.905	T	0.58194	-0.7679	10	0.45353	T	0.12	-6.26	13.1692	0.59589	1.0:0.0:0.0:0.0	.	530	Q7L0J3	SV2A_HUMAN	P	530	ENSP00000358142:L530P;ENSP00000358141:L530P	ENSP00000358141:L530P	L	-	2	0	SV2A	148145965	0.978000	0.34361	0.979000	0.43373	0.990000	0.78478	9.080000	0.94040	2.213000	0.71641	0.454000	0.30748	CTG		0.502	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			19	49	0	0	0	0.008871	0	19	49				
SV2A	9900	broad.mit.edu	37	1	149884838	149884838	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:149884838C>T	ENST00000369146.3	-	2	1045	c.555G>A	c.(553-555)gtG>gtA	p.V185V	SV2A_ENST00000369145.1_Silent_p.V185V	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	185					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.V185V(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CGAAGCCCACCACAAAGACCT	0.582																																							uc001etg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|pancreas(1)	7						c.(553-555)GTG>GTA		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						118.0	112.0	114.0					1																	149884838		2203	4300	6503	SO:0001819	synonymous_variant	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149884838C>T	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.555G>A	1.37:g.149884838C>T						SV2A_uc001eth.2_Silent_p.V185V	p.V185V	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		2	1046	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		185			Helical; (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	c.555G>A	CCDS940.1																																																																																				0.582	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			20	73	0	0	0	0.010504	0	20	73				
ADAMTSL4	54507	broad.mit.edu	37	1	150529802	150529802	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:150529802T>C	ENST00000369038.2	+	10	2239	c.2038T>C	c.(2038-2040)Tgc>Cgc	p.C680R	ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.C680R|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.C703R|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.C680R			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	680					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)	p.C680R(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CTCAGCGTCCTGCGGGAAAGG	0.657																																							uc001eux.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2038-2040)TGC>CGC		thrombospondin repeat containing 1 isoform 1							35.0	34.0	34.0					1																	150529802		2202	4299	6501	SO:0001583	missense	54507				apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding	g.chr1:150529802T>C	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2038T>C	1.37:g.150529802T>C	ENSP00000358034:p.Cys680Arg					ADAMTSL4_uc001euw.2_Missense_Mutation_p.C680R|ADAMTSL4_uc009wlw.2_Missense_Mutation_p.C703R|ADAMTSL4_uc010pcg.1_Missense_Mutation_p.C641R|ADAMTSL4_uc009wlx.2_5'Flank	p.C680R	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		12	2274	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		680					B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	c.2038T>C	CCDS955.1	.	.	.	.	.	.	.	.	.	.	T	16.91	3.253413	0.59212	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000407995;ENST00000369039;ENST00000369038	T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29	5.52	5.52	0.82312	.	.	.	.	.	D	0.90335	0.6976	M	0.92923	3.36	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.92623	0.6109	9	0.87932	D	0	.	13.6034	0.62033	0.0:0.0:0.0:1.0	.	641;703;680;680	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	R	680;680;218;703;680	ENSP00000358037:C680R;ENSP00000271643:C680R;ENSP00000358035:C703R;ENSP00000358034:C680R	ENSP00000271643:C680R	C	+	1	0	ADAMTSL4	148796426	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	5.746000	0.68681	2.115000	0.64714	0.533000	0.62120	TGC		0.657	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032		4	9	0	0	0	0.000602	0	4	9				
THEM5	284486	broad.mit.edu	37	1	151824854	151824854	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:151824854G>T	ENST00000368817.5	-	2	336	c.205C>A	c.(205-207)Ctg>Atg	p.L69M	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	69					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)	p.L69M(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCTTGGTACAGGCTCAGCATG	0.502																																							uc009wnd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(205-207)CTG>ATG		thioesterase superfamily member 5							139.0	135.0	136.0					1																	151824854		2203	4300	6503	SO:0001583	missense	284486						hydrolase activity	g.chr1:151824854G>T	AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.205C>A	1.37:g.151824854G>T	ENSP00000357807:p.Leu69Met						p.L69M	NM_182578	NP_872384	Q8N1Q8	THEM5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)		2	337	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		69					Q5T1C3	Missense_Mutation	SNP	ENST00000368817.5	37	c.205C>A	CCDS1005.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190935	0.38707	.	.	ENSG00000196407	ENST00000368817	T	0.24538	1.85	5.28	0.543	0.17179	.	0.173368	0.38492	N	0.001675	T	0.09512	0.0234	M	0.62088	1.915	0.25834	N	0.984138	P	0.39748	0.686	B	0.38056	0.264	T	0.11941	-1.0567	10	0.59425	D	0.04	-19.8331	4.6291	0.12493	0.1888:0.0:0.4937:0.3174	.	69	Q8N1Q8	THEM5_HUMAN	M	69	ENSP00000357807:L69M	ENSP00000357807:L69M	L	-	1	2	THEM5	150091478	0.951000	0.32395	0.976000	0.42696	0.400000	0.30750	0.098000	0.15189	0.198000	0.20407	0.655000	0.94253	CTG		0.502	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036678.2	NM_182578		31	85	1	0	2.61193e-14	0.009535	4.0916e-14	31	85				
FLG	2312	broad.mit.edu	37	1	152277046	152277046	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:152277046C>A	ENST00000368799.1	-	3	10351	c.10316G>T	c.(10315-10317)gGg>gTg	p.G3439V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3439	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGCTTGACCCCGGGTGTCC	0.597									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(10315-10317)GGG>GTG		filaggrin							319.0	313.0	315.0					1																	152277046		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152277046C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10316G>T	1.37:g.152277046C>A	ENSP00000357789:p.Gly3439Val						p.G3439V	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	10352	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3439			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.10316G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	8.588	0.883872	0.17467	.	.	ENSG00000143631	ENST00000368799	T	0.01665	4.7	3.01	0.852	0.18995	.	.	.	.	.	T	0.03011	0.0089	M	0.77616	2.38	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.38929	-0.9638	9	0.27082	T	0.32	.	8.815	0.34989	0.0:0.5443:0.4557:0.0	.	3439	P20930	FILA_HUMAN	V	3439	ENSP00000357789:G3439V	ENSP00000357789:G3439V	G	-	2	0	FLG	150543670	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-3.561000	0.00430	-0.064000	0.13043	0.398000	0.26397	GGG		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		111	230	1	0	4.36517e-90	0.00361	8.36219e-90	111	230				
FLG2	388698	broad.mit.edu	37	1	152327656	152327656	+	Missense_Mutation	SNP	G	G	T	rs34309186	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:152327656G>T	ENST00000388718.5	-	3	2678	c.2606C>A	c.(2605-2607)tCt>tAt	p.S869Y	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	869	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S869Y(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCAAAGCCAGATGTCTGTCC	0.498																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(2605-2607)TCT>TAT		filaggrin family member 2							377.0	325.0	343.0					1																	152327656		2200	4264	6464	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152327656G>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2606C>A	1.37:g.152327656G>T	ENSP00000373370:p.Ser869Tyr					uc001ezv.2_Intron	p.S869Y	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2679	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		869			Ser-rich.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.2606C>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.296561	0.23650	.	.	ENSG00000143520	ENST00000388718	T	0.11604	2.76	3.46	3.46	0.39613	.	.	.	.	.	T	0.07503	0.0189	M	0.61703	1.905	0.09310	N	1	P	0.51791	0.948	B	0.44163	0.443	T	0.08066	-1.0740	9	0.52906	T	0.07	0.7575	12.5031	0.55966	0.0:0.0:1.0:0.0	.	869	Q5D862	FILA2_HUMAN	Y	869	ENSP00000373370:S869Y	ENSP00000373370:S869Y	S	-	2	0	FLG2	150594280	0.075000	0.21258	0.015000	0.15790	0.020000	0.10135	2.155000	0.42301	1.770000	0.52166	0.650000	0.86243	TCT		0.498	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		139	74	1	0	1.04606e-72	0.00361	1.99788e-72	139	74				
KPRP	448834	broad.mit.edu	37	1	152732371	152732371	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:152732371C>T	ENST00000606109.1	+	1	335	c.307C>T	c.(307-309)Caa>Taa	p.Q103*	KPRP_ENST00000368773.1_Nonsense_Mutation_p.Q103*			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	103	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.Q103*(1)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCCCAATCTCAAACTTCCTC	0.537																																							uc001fal.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(307-309)CAA>TAA		keratinocyte proline-rich protein							231.0	217.0	222.0					1																	152732371		2203	4300	6503	SO:0001587	stop_gained	448834					cytoplasm		g.chr1:152732371C>T	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.307C>T	1.37:g.152732371C>T	ENSP00000475216:p.Gln103*						p.Q103*	NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	365	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		103			Gln-rich.			Nonsense_Mutation	SNP	ENST00000606109.1	37	c.307C>T	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768090	0.31320	.	.	ENSG00000203786	ENST00000368773	.	.	.	4.93	2.99	0.34606	.	0.474517	0.17975	N	0.155728	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-1.1678	10.5787	0.45242	0.3452:0.6548:0.0:0.0	.	.	.	.	X	103	.	ENSP00000357762:Q103X	Q	+	1	0	KPRP	150998995	0.004000	0.15560	0.002000	0.10522	0.014000	0.08584	1.244000	0.32778	0.564000	0.29238	0.655000	0.94253	CAA		0.537	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		6	242	0	0	0	0.001168	0	6	242				
PGLYRP3	114771	broad.mit.edu	37	1	153283102	153283102	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:153283102C>A	ENST00000290722.1	-	1	92	c.40G>T	c.(40-42)Ggt>Tgt	p.G14C		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	14					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.G14C(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCCTGGAGACCCAGAATGAAG	0.502																																							uc001fbn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(40-42)GGT>TGT		peptidoglycan recognition protein 3 precursor							157.0	159.0	158.0					1																	153283102		2203	4300	6503	SO:0001583	missense	114771				defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding	g.chr1:153283102C>A	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.40G>T	1.37:g.153283102C>A	ENSP00000290722:p.Gly14Cys						p.G14C	NM_052891	NP_443123	Q96LB9	PGRP3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		1	93	-	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		14					A1A4U8|Q5SY65	Missense_Mutation	SNP	ENST00000290722.1	37	c.40G>T	CCDS1035.1	.	.	.	.	.	.	.	.	.	.	C	9.562	1.118652	0.20877	.	.	ENSG00000159527	ENST00000290722	T	0.07908	3.15	3.22	-1.72	0.08107	.	0.549745	0.15166	N	0.276907	T	0.03783	0.0107	L	0.50333	1.59	0.09310	N	1	D	0.67145	0.996	P	0.54499	0.754	T	0.28038	-1.0056	10	0.23302	T	0.38	-3.724	3.1998	0.06646	0.1927:0.4251:0.0:0.3822	.	14	Q96LB9	PGRP3_HUMAN	C	14	ENSP00000290722:G14C	ENSP00000290722:G14C	G	-	1	0	PGLYRP3	151549726	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.380000	0.20602	-0.390000	0.07774	-0.150000	0.13652	GGT		0.502	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891		44	101	1	0	1.86633e-21	0.00361	3.3249e-21	44	101				
NPR1	4881	broad.mit.edu	37	1	153660630	153660630	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:153660630T>C	ENST00000368680.3	+	15	2822	c.2350T>C	c.(2350-2352)Tgg>Cgg	p.W784R		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	784	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.W784R(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GCAGCGGTGCTGGGCTGAGGA	0.642																																					Pancreas(141;1349 1870 15144 15830 40702)	Pancreas(141;1349 1870 15144 15830 40702)	uc001fcs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|stomach(1)|breast(1)	7						c.(2350-2352)TGG>CGG		natriuretic peptide receptor 1 precursor	Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)						92.0	89.0	90.0					1																	153660630		2203	4300	6503	SO:0001583	missense	4881				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity	g.chr1:153660630T>C	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2350T>C	1.37:g.153660630T>C	ENSP00000357669:p.Trp784Arg					NPR1_uc010pdz.1_Missense_Mutation_p.W530R|NPR1_uc010pea.1_Missense_Mutation_p.W262R	p.W784R	NM_000906	NP_000897	P16066	ANPRA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		15	2771	+	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		784			Cytoplasmic (Potential).|Protein kinase.		B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	c.2350T>C	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.273408	0.40194	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	D	0.86562	-2.14	4.03	4.03	0.46877	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.94997	0.8381	H	0.97852	4.09	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.992	D	0.95812	0.8842	10	0.87932	D	0	.	11.2638	0.49099	0.0:0.0:0.0:1.0	.	263;784	B7Z4Y7;P16066	.;ANPRA_HUMAN	R	784;263	ENSP00000357669:W784R	ENSP00000357669:W784R	W	+	1	0	NPR1	151927254	1.000000	0.71417	1.000000	0.80357	0.309000	0.27889	5.927000	0.70080	1.840000	0.53500	0.379000	0.24179	TGG		0.642	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906		33	61	0	0	0	0.003271	0	33	61				
CRTC2	200186	broad.mit.edu	37	1	153920685	153920685	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:153920685T>A	ENST00000368633.1	-	14	2109	c.1982A>T	c.(1981-1983)gAg>gTg	p.E661V	DENND4B_ENST00000361217.4_5'Flank|CRTC2_ENST00000368630.3_Missense_Mutation_p.E341V	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	661					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.E661V(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GCCCAGTGGCTCCATGCGCAG	0.597																																							uc010ped.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1981-1983)GAG>GTG		CREB regulated transcription coactivator 2							113.0	106.0	108.0					1																	153920685		2203	4300	6503	SO:0001583	missense	200186				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding	g.chr1:153920685T>A	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.1982A>T	1.37:g.153920685T>A	ENSP00000357622:p.Glu661Val					DENND4B_uc001fdd.1_5'Flank|CRTC2_uc001fde.3_RNA|CRTC2_uc001fdf.3_Missense_Mutation_p.E197V	p.E661V	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		14	2052	-	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		661					Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	37	c.1982A>T	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.042305	0.75732	.	.	ENSG00000160741	ENST00000368630;ENST00000368633	T;T	0.54866	0.55;2.47	4.79	4.79	0.61399	Transducer of regulated CREB activity, C-terminal (1);	0.062144	0.64402	D	0.000006	T	0.58892	0.2154	L	0.55990	1.75	0.44402	D	0.997316	D;D	0.89917	0.999;1.0	D;D	0.87578	0.977;0.998	T	0.64214	-0.6460	10	0.72032	D	0.01	-16.3182	12.3235	0.54997	0.0:0.0:0.0:1.0	.	661;341	Q53ET0;Q5T4K5	CRTC2_HUMAN;.	V	341;661	ENSP00000357619:E341V;ENSP00000357622:E661V	ENSP00000357619:E341V	E	-	2	0	CRTC2	152187309	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.808000	0.75206	2.022000	0.59522	0.379000	0.24179	GAG		0.597	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715		31	74	0	0	0	0.009535	0	31	74				
ADAM15	8751	broad.mit.edu	37	1	155030752	155030752	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:155030752G>A	ENST00000356955.2	+	15	1853	c.1752G>A	c.(1750-1752)caG>caA	p.Q584Q	ADAM15_ENST00000355956.2_Silent_p.Q584Q|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000531455.1_Silent_p.Q594Q|ADAM15_ENST00000368410.2_Silent_p.Q290Q|ADAM15_ENST00000449910.2_Silent_p.Q584Q|ADAM15_ENST00000359280.4_Silent_p.Q584Q|ADAM15_ENST00000447332.3_Silent_p.Q568Q|ADAM15_ENST00000360674.4_Silent_p.Q584Q|ADAM15_ENST00000271836.6_Silent_p.Q584Q|ADAM15_ENST00000368413.1_Silent_p.Q290Q|ADAM15_ENST00000368412.3_Silent_p.Q584Q	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	584	Cys-rich.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.Q584Q(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TCCAGTGCCAGACAGGTAGGA	0.587																																							uc001fgr.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|skin(2)|ovary(1)	6						c.(1750-1752)CAG>CAA		a disintegrin and metalloproteinase domain 15							37.0	39.0	38.0					1																	155030752		2203	4300	6503	SO:0001819	synonymous_variant	8751				angiogenesis|cell-matrix adhesion|collagen catabolic process|proteolysis	acrosomal vesicle|adherens junction|endomembrane system|flagellum|integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding	g.chr1:155030752G>A	U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1752G>A	1.37:g.155030752G>A						ADAM15_uc001fgq.1_Silent_p.Q269Q|ADAM15_uc010pet.1_Silent_p.Q568Q|ADAM15_uc010peu.1_Silent_p.Q601Q|ADAM15_uc001fgt.1_Silent_p.Q584Q|ADAM15_uc010pev.1_Silent_p.Q594Q|ADAM15_uc001fgs.1_Silent_p.Q584Q|ADAM15_uc001fgu.1_Silent_p.Q584Q|ADAM15_uc001fgw.1_Silent_p.Q584Q|ADAM15_uc001fgv.1_Silent_p.Q584Q|ADAM15_uc001fgx.1_Silent_p.Q584Q|ADAM15_uc001fgz.1_RNA|ADAM15_uc001fgy.1_RNA|ADAM15_uc001fha.1_RNA|ADAM15_uc001fhb.1_5'UTR	p.Q584Q	NM_207197	NP_997080	Q13444	ADA15_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.000434)		15	1853	+	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		584			Extracellular (Potential).|Cys-rich.		B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Silent	SNP	ENST00000356955.2	37	c.1752G>A	CCDS1087.1																																																																																				0.587	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815		6	42	0	0	0	0.00308	0	6	42				
TRIM46	80128	broad.mit.edu	37	1	155160273	155160273	+	IGR	SNP	C	C	A	rs144273480	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:155160273C>A	ENST00000334634.4	+	0	3061				MUC1_ENST00000438413.1_Missense_Mutation_p.D90Y|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000368390.3_Missense_Mutation_p.D116Y|MUC1_ENST00000368392.3_Missense_Mutation_p.D125Y|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000338684.5_Missense_Mutation_p.D85Y|MUC1_ENST00000337604.5_Missense_Mutation_p.D134Y|MUC1_ENST00000462215.1_5'UTR|MUC1_ENST00000368393.3_Missense_Mutation_p.D134Y|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000457295.2_Missense_Mutation_p.D125Y|MUC1_ENST00000368395.1_Missense_Mutation_p.D336Y|MUC1_ENST00000368398.3_Missense_Mutation_p.D91Y|MUC1_ENST00000368396.4_Intron	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46							intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.D134Y(1)|p.D125Y(1)|p.D336Y(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTCTCCACGTCGTGGACATTG	0.542																																							uc010pfj.1		NA								T					IGH@		B-NHL		3	Substitution - Missense(3)		lung(3)	large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4						c.(631-633)GAC>TAC		SubName: Full=Mucin 1, cell surface associated;		C	TYR/ASP,TYR/ASP,,,,,TYR/ASP,TYR/ASP,TYR/ASP,TYR/ASP,TYR/ASP,TYR/ASP,TYR/ASP,TYR/ASP,TYR/ASP,TYR/ASP,,,,TYR/ASP	0,4396		0,0,2198	65.0	54.0	58.0		373,346,,,,,1006,1033,427,373,295,232,304,298,400,271,,,,400	-3.8	0.0	1	dbSNP_134	58	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense,intron,intron,intron,intron,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,intron,intron,intron,missense	MUC1	NM_001018016.2,NM_001018017.2,NM_001044390.2,NM_001044391.2,NM_001044392.2,NM_001044393.2,NM_001204285.1,NM_001204286.1,NM_001204287.1,NM_001204288.1,NM_001204289.1,NM_001204290.1,NM_001204291.1,NM_001204292.1,NM_001204293.1,NM_001204294.1,NM_001204295.1,NM_001204296.1,NM_001204297.1,NM_002456.5	160,160,,,,,160,160,160,160,160,160,160,160,160,160,,,,160	0,1,6494	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,,,,,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,,,,probably-damaging	125/265,116/256,,,,,336/476,345/485,143/283,125/220,99/239,78/218,102/242,100/240,134/199,91/231,,,,134/274	155160273	1,12989	2198	4297	6495	SO:0001628	intergenic_variant	4582					apical plasma membrane|cell surface|cytoplasm|extracellular region|integral to plasma membrane|nucleus	protein binding	g.chr1:155160273C>A		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680		1.37:g.155160273C>A						RAG1AP1_uc010pey.1_Intron|MUC1_uc001fhy.2_Missense_Mutation_p.D41Y|MUC1_uc001fhz.2_Missense_Mutation_p.D41Y|MUC1_uc010pfb.1_Missense_Mutation_p.D41Y|MUC1_uc010pfc.1_RNA|MUC1_uc009wph.2_Missense_Mutation_p.D41Y|MUC1_uc010pfd.1_Intron|MUC1_uc010pfe.1_RNA|MUC1_uc010pff.1_Intron|MUC1_uc009wpi.2_Missense_Mutation_p.D41Y|MUC1_uc010pfg.1_Intron|MUC1_uc010pfh.1_Missense_Mutation_p.D187Y|MUC1_uc010pfi.1_Missense_Mutation_p.D187Y|MUC1_uc010pfk.1_RNA|MUC1_uc010pfl.1_RNA|MUC1_uc001fin.2_Intron|MUC1_uc009wpk.2_Missense_Mutation_p.D63Y|MUC1_uc001fip.2_Intron|MUC1_uc009wqg.2_Missense_Mutation_p.D72Y|MUC1_uc009wpo.2_Missense_Mutation_p.D78Y|MUC1_uc009wps.2_Missense_Mutation_p.D99Y|MUC1_uc009wpt.2_Missense_Mutation_p.D102Y|MUC1_uc001fic.2_Missense_Mutation_p.D90Y|MUC1_uc009wpu.2_Intron|MUC1_uc009wpq.2_Missense_Mutation_p.D104Y|MUC1_uc009wpv.2_Intron|MUC1_uc001fim.2_Intron|MUC1_uc001fib.2_Intron|MUC1_uc009wpw.2_Intron|MUC1_uc001fie.2_Intron|MUC1_uc009wpr.2_Intron|MUC1_uc001fig.2_Intron|MUC1_uc001fif.2_Intron|MUC1_uc009wpx.2_Missense_Mutation_p.D100Y|MUC1_uc001fid.2_Missense_Mutation_p.D91Y|MUC1_uc009wpj.2_Intron|MUC1_uc001fij.2_Missense_Mutation_p.D125Y|MUC1_uc009wpy.2_Intron|MUC1_uc010pfm.1_Missense_Mutation_p.D41Y|MUC1_uc001fiq.2_Missense_Mutation_p.D41Y|MUC1_uc009wpz.2_Missense_Mutation_p.D143Y|MUC1_uc010pfn.1_Missense_Mutation_p.D116Y|MUC1_uc009wqa.2_Missense_Mutation_p.D199Y|MUC1_uc010pfo.1_Intron|MUC1_uc010pfp.1_Intron|MUC1_uc001fii.2_Intron|MUC1_uc001fih.2_Intron|MUC1_uc001fia.2_Missense_Mutation_p.D116Y|MUC1_uc009wqc.2_Missense_Mutation_p.D113Y|MUC1_uc009wqd.2_Missense_Mutation_p.D137Y|MUC1_uc009wqb.2_Missense_Mutation_p.D41Y|MUC1_uc010pfq.1_Missense_Mutation_p.D113Y|MUC1_uc010pfr.1_Intron|MUC1_uc001fit.2_Missense_Mutation_p.D41Y|MUC1_uc009wqe.2_Intron|MUC1_uc001fil.2_Intron|MUC1_uc009wpm.2_Missense_Mutation_p.D134Y|MUC1_uc009wpp.2_Intron|MUC1_uc010pfs.1_RNA|MUC1_uc001fik.2_Missense_Mutation_p.D134Y|MUC1_uc001fio.2_Intron|MUC1_uc009wqf.2_Intron|MUC1_uc009wpl.2_Intron|MUC1_uc009wpn.2_Missense_Mutation_p.D125Y|MUC1_uc001fis.1_Intron	p.D211Y			P15941	MUC1_HUMAN	Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		4	1037	-	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		1116	D->A: Greatly reduced formation of isoform 5/isoform 7 complex.|D->E: No effect on formation of isoform 5/isoform 7 complex.		Extracellular (Potential).|SEA.		A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	37	c.631G>T	CCDS1097.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.351343	0.41700	0.0	1.16E-4	ENSG00000185499	ENST00000368395;ENST00000338684;ENST00000368392;ENST00000438413;ENST00000457295;ENST00000368393;ENST00000425082;ENST00000368398;ENST00000368390;ENST00000337604	T;T;T;T;T;T;T;T;T	0.39787	1.06;1.35;1.06;1.06;1.06;1.06;1.35;1.06;1.06	3.82	-3.82	0.04281	.	4.561050	0.00622	N	0.000458	T	0.28896	0.0717	L	0.29908	0.895	0.09310	N	1	D;D;P;D;D;D;P;D;D;D;D;D;P;P;P;P;P;D;D;D;P;D;D;D	0.89917	0.986;0.996;0.877;1.0;0.975;1.0;0.713;0.993;0.987;0.993;0.998;0.971;0.765;0.765;0.533;0.857;0.899;0.999;0.999;1.0;0.899;0.999;1.0;0.998	P;D;B;D;P;D;B;P;D;P;D;P;P;P;B;B;B;D;D;D;B;D;D;D	0.91635	0.817;0.931;0.318;0.998;0.817;0.99;0.21;0.863;0.911;0.863;0.997;0.717;0.51;0.51;0.439;0.372;0.446;0.998;0.997;0.999;0.446;0.997;0.999;0.942	T	0.31223	-0.9951	10	0.72032	D	0.01	4.0397	3.269	0.06875	0.3109:0.2494:0.0:0.4398	.	1125;116;1113;134;1104;143;85;422;422;336;143;100;102;99;104;78;125;134;91;134;125;91;90;116	P15941-2;B6ECB2;P15941-3;P15941-8;P15941-4;B6ECA3;A5YRV1;B4DWK6;E7EUW3;B1AVQ5;A5YRU5;A6ZID7;A6ZID6;A5YRV0;A5YRU8;A5YRV2;A5YRU7;A6ZID9;P15941-6;B1AVR0;Q0VAP5;A6ZIE0;B1AVQ7;Q0VAP6	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Y	336;85;125;90;125;134;422;91;116;134	ENSP00000357380:D336Y;ENSP00000343482:D85Y;ENSP00000357377:D125Y;ENSP00000389098:D90Y;ENSP00000388172:D125Y;ENSP00000357378:D134Y;ENSP00000357383:D91Y;ENSP00000357375:D116Y;ENSP00000338983:D134Y	ENSP00000338983:D134Y	D	-	1	0	MUC1	153426897	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.813000	0.00097	-1.219000	0.02597	0.563000	0.77884	GAC		0.542	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058		8	20	1	0	0.000157383	0.00308	0.000180353	8	20				
CD5L	922	broad.mit.edu	37	1	157805829	157805829	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:157805829C>A	ENST00000368174.4	-	3	268	c.172G>T	c.(172-174)Gtg>Ttg	p.V58L	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	58	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.V58L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AACACAGCCACGTCCTTAATG	0.607																																							uc001frk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(172-174)GTG>TTG		CD5 molecule-like precursor							124.0	125.0	125.0					1																	157805829		2203	4300	6503	SO:0001583	missense	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157805829C>A	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.172G>T	1.37:g.157805829C>A	ENSP00000357156:p.Val58Leu						p.V58L	NM_005894	NP_005885	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	315	-	all_hematologic(112;0.0378)		58			SRCR 1.		A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	c.172G>T	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701866	0.68501	.	.	ENSG00000073754	ENST00000368174	T	0.34667	1.35	4.85	4.85	0.62838	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.361174	0.20045	N	0.100426	T	0.43144	0.1234	M	0.78456	2.415	0.36967	D	0.893619	D	0.58970	0.984	P	0.51355	0.667	T	0.53358	-0.8450	10	0.87932	D	0	.	15.5102	0.75776	0.0:1.0:0.0:0.0	.	58	O43866	CD5L_HUMAN	L	58	ENSP00000357156:V58L	ENSP00000357156:V58L	V	-	1	0	CD5L	156072453	0.707000	0.27866	0.009000	0.14445	0.056000	0.15407	3.580000	0.53907	2.503000	0.84419	0.563000	0.77884	GTG		0.607	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		52	109	1	0	6.4308e-24	0.00361	1.17192e-23	52	109				
OR10Z1	128368	broad.mit.edu	37	1	158577102	158577102	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:158577102C>A	ENST00000361284.1	+	1	874	c.874C>A	c.(874-876)Cta>Ata	p.L292I		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L292I(1)		endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TGTTTATAGTCTAAGGAATAG	0.463																																							uc010pio.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(874-876)CTA>ATA		olfactory receptor, family 10, subfamily Z,							188.0	191.0	190.0					1																	158577102		2203	4300	6503	SO:0001583	missense	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158577102C>A	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.874C>A	1.37:g.158577102C>A	ENSP00000354707:p.Leu292Ile						p.L292I	NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN			1	874	+	all_hematologic(112;0.0378)		292			Helical; Name=7; (Potential).		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	ENST00000361284.1	37	c.874C>A	CCDS30901.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664216	0.47572	.	.	ENSG00000198967	ENST00000361284	T	0.44881	0.91	5.19	3.32	0.38043	.	0.000000	0.30446	N	0.009601	T	0.40222	0.1108	L	0.50847	1.595	0.30750	N	0.74527	D	0.76494	0.999	D	0.70016	0.967	T	0.35076	-0.9803	10	0.87932	D	0	.	8.7033	0.34338	0.0:0.7536:0.0:0.2464	.	292	Q8NGY1	O10Z1_HUMAN	I	292	ENSP00000354707:L292I	ENSP00000354707:L292I	L	+	1	2	OR10Z1	156843726	0.000000	0.05858	1.000000	0.80357	0.750000	0.42670	-0.434000	0.06939	0.757000	0.33036	0.650000	0.86243	CTA		0.463	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		101	167	1	0	2.54621e-43	0.00361	4.79109e-43	101	167				
IFI16	3428	broad.mit.edu	37	1	159021489	159021490	+	Nonsense_Mutation	DNP	TG	TG	CT			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:159021489_159021490TG>CT	ENST00000295809.7	+	10	1941_1942	c.1686_1687TG>CT	c.(1684-1689)acTGaa>acCTaa	p.E563*	IFI16_ENST00000359709.3_Nonsense_Mutation_p.E507*|IFI16_ENST00000430894.2_Nonsense_Mutation_p.E511*|IFI16_ENST00000368131.4_Nonsense_Mutation_p.E507*|IFI16_ENST00000368132.3_Nonsense_Mutation_p.E507*|IFI16_ENST00000448393.2_Nonsense_Mutation_p.E451*|IFI16_ENST00000340979.6_Nonsense_Mutation_p.E451*			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	563	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.E507*(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					GACTGAAGACTGAACCTGAAGA	0.426																																							uc001ftg.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1516-1521)ACTGAA>ACCTAA		interferon, gamma-inducible protein 16																																				SO:0001587	stop_gained	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:159021489_159021490TG>CT	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	Exception_encountered	1.37:g.159021489_159021490delinsCT	ENSP00000295809:p.Glu563*					IFI16_uc010pis.1_Nonsense_Mutation_p.E507*|IFI16_uc001fth.2_Nonsense_Mutation_p.E50*|IFI16_uc010pit.1_Nonsense_Mutation_p.E106*	p.E507*	NM_005531	NP_005522	Q16666	IF16_HUMAN			9	1808_1809	+	all_hematologic(112;0.0429)		Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Nonsense_Mutation	DNP	ENST00000295809.7	37	c.1518_1519TG>CT																																																																																					0.426	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		26	45	0	0	0	0.004672	0	26	45				
OR10J5	127385	broad.mit.edu	37	1	159505015	159505015	+	Silent	SNP	C	C	T	rs368999566		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:159505015C>T	ENST00000334857.2	-	1	827	c.783G>A	c.(781-783)ccG>ccA	p.P261P		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P261P(2)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					TTTCTGACTTCGGCTTGAGGT	0.502																																							uc010piw.1		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	skin(2)|ovary(1)	3						c.(781-783)CCG>CCA		olfactory receptor, family 10, subfamily J,		C		0,4406		0,0,2203	84.0	82.0	83.0		783	2.1	1.0	1		83	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OR10J5	NM_001004469.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		261/310	159505015	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	127385				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159505015C>T		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.783G>A	1.37:g.159505015C>T							p.P261P	NM_001004469	NP_001004469	Q8NHC4	O10J5_HUMAN			1	783	-	all_hematologic(112;0.0429)		261			Extracellular (Potential).		B9EH35|Q6IFH2	Silent	SNP	ENST00000334857.2	37	c.783G>A	CCDS30910.1																																																																																				0.502	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469		3	68	0	0	0	0.009096	0	3	68				
ATP1A4	480	broad.mit.edu	37	1	160137163	160137163	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:160137163G>C	ENST00000368081.4	+	10	1923	c.1452G>C	c.(1450-1452)aaG>aaC	p.K484N		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	484					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.K484N(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AAAACCCCAAGGTGGCAGAGA	0.522																																							uc001fve.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1450-1452)AAG>AAC		Na+/K+ -ATPase alpha 4 subunit isoform 1							104.0	104.0	104.0					1																	160137163		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160137163G>C	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1452G>C	1.37:g.160137163G>C	ENSP00000357060:p.Lys484Asn					ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_5'UTR	p.K484N	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		10	1931	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		484			Cytoplasmic (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.1452G>C	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044298	0.55110	.	.	ENSG00000132681	ENST00000368081	T	0.80738	-1.41	4.55	2.69	0.31865	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.050446	0.85682	D	0.000000	D	0.85292	0.5663	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84942	0.0866	10	0.87932	D	0	.	6.3613	0.21431	0.2916:0.0:0.7083:0.0	.	484	Q13733	AT1A4_HUMAN	N	484	ENSP00000357060:K484N	ENSP00000357060:K484N	K	+	3	2	ATP1A4	158403787	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	1.420000	0.34804	0.558000	0.29135	0.591000	0.81541	AAG		0.522	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		37	81	0	0	0	0.004289	0	37	81				
OLFML2B	25903	broad.mit.edu	37	1	161954010	161954010	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:161954010C>A	ENST00000294794.3	-	8	2131	c.1708G>T	c.(1708-1710)Gta>Tta	p.V570L	OLFML2B_ENST00000367938.1_Missense_Mutation_p.V53L|OLFML2B_ENST00000367940.2_Missense_Mutation_p.V571L	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	570	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.V570L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CCATTGTATACCACGTGGCCT	0.577																																							uc001gbu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1708-1710)GTA>TTA		olfactomedin-like 2B precursor							97.0	84.0	88.0					1																	161954010		2203	4300	6503	SO:0001583	missense	25903							g.chr1:161954010C>A	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1708G>T	1.37:g.161954010C>A	ENSP00000294794:p.Val570Leu					OLFML2B_uc001gbt.2_Missense_Mutation_p.V53L|OLFML2B_uc010pkq.1_Missense_Mutation_p.V571L	p.V570L	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0172)		8	2132	-	all_hematologic(112;0.156)		570			Olfactomedin-like.		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	c.1708G>T	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	C	19.70	3.876852	0.72180	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.92249	-3.0;-3.0;-3.0	5.17	4.26	0.50523	Olfactomedin-like (3);	.	.	.	.	D	0.94765	0.8310	M	0.87617	2.895	0.41770	D	0.989765	D;P	0.69078	0.997;0.688	D;P	0.65874	0.939;0.62	D	0.95523	0.8596	8	0.87932	D	0	.	11.5852	0.50914	0.0:0.912:0.0:0.088	.	571;570	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	L	570;571;53	ENSP00000294794:V570L;ENSP00000356917:V571L;ENSP00000356915:V53L	ENSP00000294794:V570L	V	-	1	0	OLFML2B	160220634	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.845000	0.62853	1.165000	0.42670	0.561000	0.74099	GTA		0.577	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441		17	51	1	0	2.37509e-13	0.010504	3.6399e-13	17	51				
NUF2	83540	broad.mit.edu	37	1	163313600	163313600	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:163313600G>C	ENST00000271452.3	+	10	1026	c.747G>C	c.(745-747)gaG>gaC	p.E249D	NUF2_ENST00000367900.3_Missense_Mutation_p.E249D|NUF2_ENST00000524800.1_Missense_Mutation_p.E249D	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	249	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.E249D(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					ATTCTCCAGAGAAGTTAAAGA	0.274																																							uc001gcq.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(745-747)GAG>GAC		NUF2, NDC80 kinetochore complex component							24.0	29.0	27.0					1																	163313600		2144	4245	6389	SO:0001583	missense	83540				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding	g.chr1:163313600G>C	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.747G>C	1.37:g.163313600G>C	ENSP00000271452:p.Glu249Asp					NUF2_uc001gcp.2_Missense_Mutation_p.E249D|NUF2_uc001gcr.1_Missense_Mutation_p.E249D|NUF2_uc009wvc.1_Missense_Mutation_p.E249D	p.E249D	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN			10	1047	+	all_hematologic(923;0.101)		249			Interaction with the N-terminus of NDC80.|Potential.		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	c.747G>C	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382220	0.61845	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.36340	1.36;1.26;1.26	4.83	1.96	0.26148	.	0.000000	0.85682	D	0.000000	T	0.34250	0.0891	M	0.61703	1.905	0.45946	D	0.998773	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.14783	-1.0460	9	0.27082	T	0.32	-22.2791	6.8115	0.23807	0.3717:0.0:0.6283:0.0	.	249;249	E9PQC4;Q9BZD4	.;NUF2_HUMAN	D	249	ENSP00000436888:E249D;ENSP00000356875:E249D;ENSP00000271452:E249D	ENSP00000271452:E249D	E	+	3	2	NUF2	161580224	1.000000	0.71417	0.990000	0.47175	0.918000	0.54935	1.437000	0.34991	0.354000	0.24105	-0.237000	0.12165	GAG		0.274	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697		10	34	0	0	0	0.000978	0	10	34				
SELP	6403	broad.mit.edu	37	1	169581604	169581604	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:169581604C>T	ENST00000263686.6	-	6	849	c.812G>A	c.(811-813)gGa>gAa	p.G271E	SELP_ENST00000367791.2_Missense_Mutation_p.G271E|SELP_ENST00000367792.2_Missense_Mutation_p.G271E|SELP_ENST00000458599.2_Missense_Mutation_p.G271E|SELP_ENST00000367794.2_Missense_Mutation_p.G271E|SELP_ENST00000367788.2_Intron|SELP_ENST00000367793.2_Intron|SELP_ENST00000367786.2_Missense_Mutation_p.G271E	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	271	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.G271E(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	GGTCATGTTTCCTCGTTCAGG	0.478																																							uc001ggi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(811-813)GGA>GAA		selectin P precursor	Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)						96.0	95.0	95.0					1																	169581604		2203	4300	6503	SO:0001583	missense	6403				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding	g.chr1:169581604C>T	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.812G>A	1.37:g.169581604C>T	ENSP00000263686:p.Gly271Glu					SELP_uc001ggh.2_Missense_Mutation_p.G106E|SELP_uc009wvr.2_Missense_Mutation_p.G271E	p.G271E	NM_003005	NP_002996	P16109	LYAM3_HUMAN			6	877	-	all_hematologic(923;0.208)		271			Extracellular (Potential).|Sushi 2.		Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	c.812G>A	CCDS1282.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.498519	0.44455	.	.	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367786;ENST00000458599	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.16	5.16	0.70880	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.42821	D	0.000654	D	0.83008	0.5161	H	0.99590	4.645	0.32545	N	0.533172	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88014	0.2764	10	0.72032	D	0.01	.	12.3585	0.55188	0.1686:0.8313:0.0:0.0	.	271;271;271	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	E	271;271;270;271;271;271;271;271;271;271;256	ENSP00000263686:G271E;ENSP00000356768:G271E;ENSP00000356766:G271E;ENSP00000356765:G271E;ENSP00000356760:G271E	ENSP00000263686:G271E	G	-	2	0	SELP	167848228	0.940000	0.31905	0.835000	0.33067	0.200000	0.23975	3.831000	0.55776	2.406000	0.81754	0.650000	0.86243	GGA		0.478	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		17	42	0	0	0	0.00499	0	17	42				
TNFSF4	7292	broad.mit.edu	37	1	173176276	173176276	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:173176276C>A	ENST00000281834.3	-	1	176	c.40G>T	c.(40-42)Gca>Tca	p.A14S	TNFSF4_ENST00000367718.1_5'Flank|TNFSF4_ENST00000488053.1_5'Flank	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	14					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.A14S(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						GGCCTGGCTGCATTTCCCACA	0.507																																							uc001giw.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(40-42)GCA>TCA		tumor necrosis factor (ligand) superfamily,							143.0	124.0	131.0					1																	173176276		2203	4300	6503	SO:0001583	missense	7292				acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity	g.chr1:173176276C>A	D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.40G>T	1.37:g.173176276C>A	ENSP00000281834:p.Ala14Ser					TNFSF4_uc001giv.2_5'Flank	p.A14S	NM_003326	NP_003317	P23510	TNFL4_HUMAN			1	196	-			14			Cytoplasmic (Potential).		Q5JZA5|Q8IV74|Q9HCN9	Missense_Mutation	SNP	ENST00000281834.3	37	c.40G>T	CCDS1306.1	.	.	.	.	.	.	.	.	.	.	C	4.033	0.003576	0.07866	.	.	ENSG00000117586	ENST00000281834	.	.	.	5.15	-4.38	0.03622	.	1.724340	0.02622	N	0.103317	T	0.13329	0.0323	L	0.44542	1.39	0.09310	N	1	B	0.30068	0.267	B	0.22386	0.039	T	0.19647	-1.0299	9	0.36615	T	0.2	0.6303	7.6031	0.28087	0.0:0.2562:0.1319:0.612	.	14	P23510	TNFL4_HUMAN	S	14	.	ENSP00000281834:A14S	A	-	1	0	TNFSF4	171442899	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-1.344000	0.02639	-0.439000	0.07222	-0.345000	0.07892	GCA		0.507	TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084271.1			16	43	1	0	2.23348e-06	0.004007	2.71087e-06	16	43				
PAPPA2	60676	broad.mit.edu	37	1	176564445	176564445	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:176564445G>A	ENST00000367662.3	+	3	2869	c.1705G>A	c.(1705-1707)Gtc>Atc	p.V569I	PAPPA2_ENST00000367661.3_Missense_Mutation_p.V569I	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	569	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V569I(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GCAGCTGAGCGTCCACCAGGT	0.567																																							uc001gkz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1705-1707)GTC>ATC		pappalysin 2 isoform 1							83.0	87.0	86.0					1																	176564445		2141	4242	6383	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176564445G>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1705G>A	1.37:g.176564445G>A	ENSP00000356634:p.Val569Ile					PAPPA2_uc001gky.1_Missense_Mutation_p.V569I|PAPPA2_uc009www.2_RNA	p.V569I	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			3	2869	+			569			Metalloprotease.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1705G>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	9.405	1.078993	0.20227	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.39056	1.1;1.1	5.11	1.15	0.20763	.	0.472525	0.20997	N	0.081922	T	0.33818	0.0876	L	0.61387	1.9	0.27608	N	0.94877	B;B	0.23249	0.057;0.082	B;B	0.15052	0.012;0.008	T	0.19910	-1.0291	10	0.31617	T	0.26	-4.6024	6.6999	0.23219	0.2784:0.1166:0.605:0.0	.	569;569	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	I	569	ENSP00000356634:V569I;ENSP00000356633:V569I	ENSP00000356633:V569I	V	+	1	0	PAPPA2	174831068	0.014000	0.17966	0.473000	0.27253	0.827000	0.46813	0.129000	0.15830	-0.035000	0.13691	0.557000	0.71058	GTC		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			23	53	0	0	0	0.001882	0	23	53				
AXDND1	126859	broad.mit.edu	37	1	179347807	179347807	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:179347807A>T	ENST00000367618.3	+	5	797	c.410A>T	c.(409-411)aAa>aTa	p.K137I	AXDND1_ENST00000461179.2_3'UTR|AXDND1_ENST00000457238.2_Missense_Mutation_p.K137I	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	137								p.K137I(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						ACATATGCCAAAGGACAGACT	0.368																																							uc001gmo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(409-411)AAA>ATA		hypothetical protein LOC126859 isoform 1							118.0	98.0	105.0					1																	179347807		2203	4300	6503	SO:0001583	missense	126859							g.chr1:179347807A>T	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.410A>T	1.37:g.179347807A>T	ENSP00000356590:p.Lys137Ile					C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmn.1_5'UTR|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.K137I	p.K137I	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN			5	537	+			137					Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	c.410A>T	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.772414	0.49680	.	.	ENSG00000162779	ENST00000509175;ENST00000367618;ENST00000360322;ENST00000457238;ENST00000511889;ENST00000434088	T;T;T	0.50277	2.05;0.75;2.07	4.55	3.42	0.39159	.	0.496360	0.20773	N	0.085929	T	0.43255	0.1239	L	0.54323	1.7	0.09310	N	1	P;P	0.40050	0.7;0.7	B;B	0.41466	0.358;0.358	T	0.36890	-0.9729	10	0.66056	D	0.02	-4.6723	7.2323	0.26049	0.8953:0.0:0.1047:0.0	.	95;137	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	I	95;137;95;137;95;71	ENSP00000356590:K137I;ENSP00000416712:K137I;ENSP00000391716:K71I	ENSP00000353471:K95I	K	+	2	0	AXDND1	177614430	0.957000	0.32711	0.005000	0.12908	0.016000	0.09150	1.125000	0.31332	0.688000	0.31529	-0.605000	0.04089	AAA		0.368	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696		30	52	0	0	0	0.00632	0	30	52				
CFH	3075	broad.mit.edu	37	1	196642292	196642292	+	Splice_Site	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:196642292G>T	ENST00000359637.2	+	2	305	c.243G>T	c.(241-243)caG>caT	p.Q81H	CFH_ENST00000496761.1_3'UTR|CFH_ENST00000439155.2_Splice_Site_p.Q81H|CFH_ENST00000367429.4_Splice_Site_p.Q81H			P08603	CFAH_HUMAN	complement factor H	144	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.Q81H(1)|p.Q81Q(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GGAAATGTCAGAGTAAGTACT	0.318																																							uc001gtj.3		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	skin(4)|ovary(1)|breast(1)	6						c.(241-243)CAG>CAT		complement factor H isoform a precursor							66.0	69.0	68.0					1																	196642292		2203	4300	6503	SO:0001630	splice_region_variant	3075				complement activation, alternative pathway	extracellular space		g.chr1:196642292G>T	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.244+1G>T	1.37:g.196642292G>T						CFH_uc001gti.3_Missense_Mutation_p.Q81H|CFH_uc009wyw.2_Missense_Mutation_p.Q81H|CFH_uc009wyx.2_Missense_Mutation_p.Q81H	p.Q81H	NM_000186	NP_000177	P08603	CFAH_HUMAN			2	483	+			81			Sushi 1.		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000359637.2	37	c.243G>T		.	.	.	.	.	.	.	.	.	.	G	12.38	1.920573	0.33908	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.50001	0.76;0.76;1.5	5.12	2.0	0.26442	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	T	0.52468	0.1736	L	0.36672	1.1	0.24143	N	0.995726	B;D;B;P	0.64830	0.005;0.994;0.005;0.955	B;P;B;P	0.58780	0.004;0.845;0.006;0.826	T	0.47355	-0.9124	9	0.48119	T	0.1	.	12.7793	0.57469	0.0:0.4874:0.5126:0.0	.	81;81;81;81	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	H	81	ENSP00000356399:Q81H;ENSP00000402656:Q81H;ENSP00000352658:Q81H	ENSP00000352658:Q81H	Q	+	3	2	CFH	194908915	0.203000	0.23435	0.985000	0.45067	0.433000	0.31745	0.293000	0.19029	0.120000	0.18254	0.561000	0.74099	CAG		0.318	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186	Missense_Mutation	17	62	1	0	7.81268e-19	0.00499	1.33572e-18	17	62				
ATP2B4	493	broad.mit.edu	37	1	203669926	203669926	+	Splice_Site	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:203669926G>T	ENST00000357681.5	+	6	1899	c.776G>T	c.(775-777)gGg>gTg	p.G259V	ATP2B4_ENST00000367218.3_Splice_Site_p.G259V|ATP2B4_ENST00000367219.3_Splice_Site_p.G259V|ATP2B4_ENST00000391954.2_Splice_Site_p.G259V|ATP2B4_ENST00000341360.2_Splice_Site_p.G259V	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	259					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.G259V(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TCCCGTGTAGGGACCCATGTC	0.453																																							uc001gzw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(775-777)GGG>GTG		plasma membrane calcium ATPase 4 isoform 4b							127.0	113.0	118.0					1																	203669926		2203	4300	6503	SO:0001630	splice_region_variant	493				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr1:203669926G>T	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.776-1G>T	1.37:g.203669926G>T						ATP2B4_uc001gzv.2_Missense_Mutation_p.G259V|ATP2B4_uc009xaq.2_Missense_Mutation_p.G259V	p.G259V	NM_001684	NP_001675	P23634	AT2B4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		6	1660	+	all_cancers(21;0.071)|all_epithelial(62;0.228)		259			Cytoplasmic (Potential).		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	c.776G>T	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098151	0.76870	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51;-3.51	5.12	5.12	0.69794	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.50627	D	0.000101	D	0.98661	0.9551	H	0.99182	4.46	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.99683	1.0999	9	.	.	.	.	18.5217	0.90956	0.0:0.0:1.0:0.0	.	259;259;259	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	V	259	ENSP00000350310:G259V;ENSP00000356187:G259V;ENSP00000356188:G259V;ENSP00000375816:G259V;ENSP00000340930:G259V	.	G	+	2	0	ATP2B4	201936549	1.000000	0.71417	0.980000	0.43619	0.458000	0.32498	9.783000	0.99037	2.534000	0.85438	0.655000	0.94253	GGG		0.453	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	Missense_Mutation	7	40	1	0	0.00198382	0.001984	0.00216046	7	40				
USH2A	7399	broad.mit.edu	37	1	215848721	215848721	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:215848721G>C	ENST00000307340.3	-	63	12918	c.12532C>G	c.(12532-12534)Cct>Gct	p.P4178A	USH2A_ENST00000366943.2_Missense_Mutation_p.P4178A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4178	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.P4178A(1)|p.P4178T(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGGTTAACAGGCTCAGACCAG	0.507										HNSCC(13;0.011)																													uc001hku.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(12532-12534)CCT>GCT		usherin isoform B							89.0	89.0	89.0					1																	215848721		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215848721G>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12532C>G	1.37:g.215848721G>C	ENSP00000305941:p.Pro4178Ala	HNSCC(13;0.011)					p.P4178A	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	63	12919	-			4178			Extracellular (Potential).|Fibronectin type-III 27.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.12532C>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456152	0.84209	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	D;T	0.91124	-2.79;-0.01	5.25	5.25	0.73442	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.43579	D	0.000543	D	0.96346	0.8808	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95925	0.8934	10	0.39692	T	0.17	.	18.8573	0.92257	0.0:0.0:1.0:0.0	.	4178	O75445	USH2A_HUMAN	A	4178	ENSP00000305941:P4178A;ENSP00000355910:P4178A	ENSP00000305941:P4178A	P	-	1	0	USH2A	213915344	1.000000	0.71417	0.228000	0.23943	0.993000	0.82548	7.454000	0.80714	2.454000	0.82982	0.650000	0.86243	CCT		0.507	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		8	38	0	0	0	0.00308	0	8	38				
TGFB2	7042	broad.mit.edu	37	1	218610720	218610720	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:218610720A>G	ENST00000366930.4	+	6	1435	c.968A>G	c.(967-969)tAc>tGc	p.Y323C	TGFB2_ENST00000366929.4_Missense_Mutation_p.Y351C|TGFB2_ENST00000479322.1_3'UTR	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	323					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)	p.Y323C(1)|p.Y351C(1)		breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		CGTCCACTTTACATTGATTTC	0.408																																							uc001hlm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(967-969)TAC>TGC		transforming growth factor, beta 2 isoform 2							124.0	119.0	121.0					1																	218610720		2203	4300	6503	SO:0001583	missense	7042				activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding	g.chr1:218610720A>G	M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.968A>G	1.37:g.218610720A>G	ENSP00000355897:p.Tyr323Cys					TGFB2_uc001hln.2_Missense_Mutation_p.Y351C|TGFB2_uc010pue.1_RNA|TGFB2_uc001hlo.2_RNA	p.Y323C	NM_003238	NP_003229	P61812	TGFB2_HUMAN		all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)	6	1621	+			323					B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	37	c.968A>G	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.515910	0.85495	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.71934	-0.61;-0.61	5.82	5.82	0.92795	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.89646	0.6775	H	0.96720	3.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.93017	0.6437	10	0.87932	D	0	.	16.1818	0.81909	1.0:0.0:0.0:0.0	.	351;323	P61812-2;P61812	.;TGFB2_HUMAN	C	323;351	ENSP00000355897:Y323C;ENSP00000355896:Y351C	ENSP00000355896:Y351C	Y	+	2	0	TGFB2	216677343	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.339000	0.96797	2.225000	0.72522	0.459000	0.35465	TAC		0.408	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238		24	58	0	0	0	0.003954	0	24	58				
C1orf198	84886	broad.mit.edu	37	1	230979457	230979457	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:230979457G>C	ENST00000366663.5	-	3	710	c.570C>G	c.(568-570)ttC>ttG	p.F190L	C1orf198_ENST00000470540.1_Missense_Mutation_p.F152L|C1orf198_ENST00000523410.1_Missense_Mutation_p.F60L|C1orf198_ENST00000427697.2_5'UTR	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	190						cytoplasm (GO:0005737)		p.F190L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TGATCTTCCAGAATGACGCTT	0.637																																							uc001hub.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(568-570)TTC>TTG		hypothetical protein LOC84886 isoform 1							85.0	88.0	87.0					1																	230979457		2203	4300	6503	SO:0001583	missense	84886							g.chr1:230979457G>C	BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.570C>G	1.37:g.230979457G>C	ENSP00000355623:p.Phe190Leu					C1orf198_uc009xfh.1_Missense_Mutation_p.F60L|C1orf198_uc001huc.1_5'UTR|C1orf198_uc001hud.1_Missense_Mutation_p.F152L	p.F190L	NM_032800	NP_116189	Q9H425	CA198_HUMAN			3	614	-	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)	190					A8K8R8|B3KTW1|G5EA08	Missense_Mutation	SNP	ENST00000366663.5	37	c.570C>G	CCDS1587.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597893	0.66332	.	.	ENSG00000119280	ENST00000366663;ENST00000470540;ENST00000523410;ENST00000522201	T;T;T	0.59224	1.11;1.12;0.28	4.61	3.69	0.42338	.	0.000000	0.85682	D	0.000000	T	0.71143	0.3305	M	0.71581	2.175	0.58432	D	0.999997	D	0.76494	0.999	D	0.83275	0.996	T	0.68002	-0.5524	10	0.21540	T	0.41	-24.3947	12.4001	0.55407	0.0821:0.0:0.9179:0.0	.	190	Q9H425	CA198_HUMAN	L	190;152;60;147	ENSP00000355623:F190L;ENSP00000428172:F152L;ENSP00000430967:F60L	ENSP00000355623:F190L	F	-	3	2	C1orf198	229046080	1.000000	0.71417	0.998000	0.56505	0.262000	0.26303	3.839000	0.55835	0.924000	0.37069	0.462000	0.41574	TTC		0.637	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2	NM_032800		5	98	0	0	0	0.000602	0	5	98				
LYST	1130	broad.mit.edu	37	1	235969372	235969372	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:235969372G>T	ENST00000389794.3	-	6	3238	c.3064C>A	c.(3064-3066)Cag>Aag	p.Q1022K	LYST_ENST00000536965.1_Missense_Mutation_p.Q1022K|LYST_ENST00000389793.2_Missense_Mutation_p.Q1022K			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1022					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.Q1022K(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTTAAATCCTGGTTTTCATTT	0.338																																							uc001hxj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(4)|central_nervous_system(2)	12						c.(3064-3066)CAG>AAG		lysosomal trafficking regulator							96.0	106.0	102.0					1																	235969372		2203	4300	6503	SO:0001583	missense	1130	Chediak-Higashsyndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235969372G>T	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.3064C>A	1.37:g.235969372G>T	ENSP00000374444:p.Gln1022Lys					LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Missense_Mutation_p.Q1022K	p.Q1022K	NM_000081	NP_000072	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		6	3239	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	1022					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	c.3064C>A	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	1.010	-0.688304	0.03328	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.60797	0.16;0.16;1.3	4.9	3.92	0.45320	.	2.130700	0.01766	N	0.030878	T	0.38983	0.1061	N	0.12182	0.205	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.001	T	0.40887	-0.9539	10	0.02654	T	1	.	9.5197	0.39126	0.0:0.0:0.7747:0.2253	.	1022;1022	Q99698-3;Q99698	.;LYST_HUMAN	K	1022	ENSP00000374444:Q1022K;ENSP00000374443:Q1022K;ENSP00000438315:Q1022K	ENSP00000374443:Q1022K	Q	-	1	0	LYST	234035995	0.998000	0.40836	0.551000	0.28230	0.907000	0.53573	3.104000	0.50306	2.527000	0.85204	0.563000	0.77884	CAG		0.338	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			34	69	1	0	1.62565e-12	0.002445	2.43273e-12	34	69				
HEATR1	55127	broad.mit.edu	37	1	236727849	236727849	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:236727849C>T	ENST00000366582.3	-	32	4662	c.4548G>A	c.(4546-4548)ttG>ttA	p.L1516L	HEATR1_ENST00000366581.2_Silent_p.L1435L	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1516					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.L1516L(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AGGACACTGACAAAAATTTAA	0.348																																							uc001hyd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(4546-4548)TTG>TTA		protein BAP28							104.0	107.0	106.0					1																	236727849		2203	4300	6503	SO:0001819	synonymous_variant	55127				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding	g.chr1:236727849C>T	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.4548G>A	1.37:g.236727849C>T						HEATR1_uc009xgh.1_Silent_p.L678L	p.L1516L	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)		32	4673	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	1516					Q5T3Q8|Q6P197|Q9NW23	Silent	SNP	ENST00000366582.3	37	c.4548G>A	CCDS31066.1																																																																																				0.348	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		22	42	0	0	0	0.002299	0	22	42				
RYR2	6262	broad.mit.edu	37	1	237608780	237608780	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:237608780G>C	ENST00000366574.2	+	14	1567	c.1250G>C	c.(1249-1251)cGa>cCa	p.R417P	RYR2_ENST00000542537.1_Missense_Mutation_p.R401P|RYR2_ENST00000360064.6_Missense_Mutation_p.R415P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	417					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R415Q(1)|p.R415P(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGCACAGCCCGAGTTATCCGG	0.383																																							uc001hyl.1		NA																	2	Substitution - Missense(2)		prostate(1)|lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(1249-1251)CGA>CCA		cardiac muscle ryanodine receptor							147.0	142.0	143.0					1																	237608780		1911	4126	6037	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237608780G>C	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1250G>C	1.37:g.237608780G>C	ENSP00000355533:p.Arg417Pro						p.R417P	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		14	1370	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	417			Cytoplasmic (By similarity).		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.1250G>C	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.112617	0.56398	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96940	-4.18;-4.15;-4.17	5.84	4.93	0.64822	.	0.000000	0.53938	D	0.000046	D	0.97532	0.9192	M	0.75085	2.285	0.80722	D	1	D	0.76494	0.999	D	0.63381	0.914	D	0.97981	1.0349	10	0.72032	D	0.01	.	14.9247	0.70868	0.0686:0.0:0.9314:0.0	.	417	Q92736	RYR2_HUMAN	P	417;415;401	ENSP00000355533:R417P;ENSP00000353174:R415P;ENSP00000443798:R401P	ENSP00000353174:R415P	R	+	2	0	RYR2	235675403	1.000000	0.71417	0.384000	0.26145	0.038000	0.13279	9.781000	0.99029	1.472000	0.48140	-0.229000	0.12294	CGA		0.383	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		13	49	0	0	0	0.001368	0	13	49				
NLRP3	114548	broad.mit.edu	37	1	247587436	247587436	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:247587436G>A	ENST00000336119.3	+	3	1437	c.691G>A	c.(691-693)Ggg>Agg	p.G231R	NLRP3_ENST00000391827.2_Missense_Mutation_p.G231R|NLRP3_ENST00000366497.2_Missense_Mutation_p.G231R|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Missense_Mutation_p.G231R|NLRP3_ENST00000391828.3_Missense_Mutation_p.G231R|NLRP3_ENST00000348069.2_Missense_Mutation_p.G231R	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	231	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.G231R(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GGCAGGGATTGGGAAAACAAT	0.542																																							uc001icr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(691-693)GGG>AGG		NLR family, pyrin domain containing 3 isoform a							72.0	67.0	68.0					1																	247587436		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247587436G>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.691G>A	1.37:g.247587436G>A	ENSP00000337383:p.Gly231Arg					NLRP3_uc001ics.2_Missense_Mutation_p.G231R|NLRP3_uc001icu.2_Missense_Mutation_p.G231R|NLRP3_uc001icw.2_Missense_Mutation_p.G231R|NLRP3_uc001icv.2_Missense_Mutation_p.G231R|NLRP3_uc010pyw.1_Missense_Mutation_p.G229R|NLRP3_uc001ict.1_Missense_Mutation_p.G229R	p.G231R	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	829	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	231			ATP (Potential).|NACHT.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.691G>A	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.856170	0.51376	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.99545	-6.13;-6.13;-6.13;-6.13;-6.13;-6.13	4.07	4.07	0.47477	NACHT nucleoside triphosphatase (1);	0.000000	0.52532	D	0.000074	D	0.99725	0.9893	H	0.96662	3.86	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97255	0.9900	10	0.87932	D	0	.	12.0721	0.53622	0.0:0.0:1.0:0.0	.	231;231;231;231;231	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	R	231	ENSP00000375704:G231R;ENSP00000355453:G231R;ENSP00000337383:G231R;ENSP00000294752:G231R;ENSP00000355452:G231R;ENSP00000375703:G231R	ENSP00000337383:G231R	G	+	1	0	NLRP3	245654059	1.000000	0.71417	0.993000	0.49108	0.027000	0.11550	8.551000	0.90678	2.563000	0.86464	0.655000	0.94253	GGG		0.542	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		10	16	0	0	0	0.008291	0	10	16				
OR13G1	441933	broad.mit.edu	37	1	247836335	247836335	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:247836335G>T	ENST00000359688.2	-	1	30	c.9C>A	c.(7-9)caC>caA	p.H3Q	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H3Q(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TTACAACGCTGTGATTCATCC	0.403																																							uc001idi.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(7-9)CAC>CAA		olfactory receptor, family 13, subfamily G,							64.0	62.0	63.0					1																	247836335		2203	4300	6503	SO:0001583	missense	441933				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247836335G>T	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.9C>A	1.37:g.247836335G>T	ENSP00000352717:p.His3Gln						p.H3Q	NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	9	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		3			Extracellular (Potential).		B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	ENST00000359688.2	37	c.9C>A	CCDS31094.1	.	.	.	.	.	.	.	.	.	.	G	1.581	-0.531506	0.04112	.	.	ENSG00000197437	ENST00000359688	T	0.00449	7.37	4.33	-3.52	0.04682	.	1.156760	0.06698	N	0.770969	T	0.00109	0.0003	N	0.01109	-1.01	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.30327	-0.9982	10	0.02654	T	1	-1.4396	5.9967	0.19497	0.0833:0.4603:0.3426:0.1138	.	3	Q8NGZ3	O13G1_HUMAN	Q	3	ENSP00000352717:H3Q	ENSP00000352717:H3Q	H	-	3	2	OR13G1	245902958	0.000000	0.05858	0.000000	0.03702	0.511000	0.34104	-1.983000	0.01488	-0.850000	0.04152	-0.176000	0.13171	CAC		0.403	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487		11	41	1	0	2.27111e-07	0.001368	2.84897e-07	11	41				
OR2W3	343171	broad.mit.edu	37	1	248059478	248059478	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:248059478G>T	ENST00000360358.3	+	1	590	c.590G>T	c.(589-591)gGc>gTc	p.G197V	OR2W3_ENST00000537741.1_Missense_Mutation_p.G197V	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G197V(1)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GCCATCGAAGGCACCGTCTTT	0.592																																							uc001idp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(589-591)GGC>GTC		olfactory receptor, family 2, subfamily W,							157.0	136.0	143.0					1																	248059478		2203	4300	6503	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059478G>T	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.590G>T	1.37:g.248059478G>T	ENSP00000353516:p.Gly197Val					OR2W3_uc010pzb.1_Missense_Mutation_p.G197V	p.G197V	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	859	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		197			Helical; Name=5; (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.590G>T	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	g	2.773	-0.255302	0.05829	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.00026	8.94;8.94	5.29	1.3	0.21679	GPCR, rhodopsin-like superfamily (1);	0.475764	0.20138	N	0.098430	T	0.00039	0.0001	N	0.00403	-1.54	0.09310	N	0.999995	P	0.37276	0.589	P	0.46208	0.507	T	0.06917	-1.0800	10	0.27082	T	0.32	.	2.6571	0.05015	0.1411:0.1112:0.2997:0.448	.	197	Q7Z3T1	OR2W3_HUMAN	V	197	ENSP00000445853:G197V;ENSP00000353516:G197V	ENSP00000353516:G197V	G	+	2	0	OR2W3	246126101	0.001000	0.12720	0.070000	0.20053	0.014000	0.08584	0.897000	0.28390	0.391000	0.25143	-0.987000	0.02553	GGC		0.592	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		16	66	1	0	3.80469e-20	0.009535	6.61144e-20	16	66				
OR2AK2	391191	broad.mit.edu	37	1	248129425	248129425	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:248129425C>A	ENST00000366480.3	+	1	891	c.792C>A	c.(790-792)agC>agA	p.S264R	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S264R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTGTGGCAAGCCTGTTCTATG	0.493																																					Melanoma(45;390 1181 23848 28461 41504)	Melanoma(45;390 1181 23848 28461 41504)	uc010pzd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(790-792)AGC>AGA		olfactory receptor, family 2, subfamily AK,							177.0	137.0	151.0					1																	248129425		2203	4300	6503	SO:0001583	missense	391191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248129425C>A	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.792C>A	1.37:g.248129425C>A	ENSP00000355436:p.Ser264Arg					OR2L13_uc001ids.2_Intron	p.S264R	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	792	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		264			Helical; Name=6; (Potential).		B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	37	c.792C>A	CCDS31102.1	.	.	.	.	.	.	.	.	.	.	.	11.31	1.600128	0.28534	.	.	ENSG00000187080	ENST00000366480	T	0.38560	1.13	3.04	-3.04	0.05412	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.63616	0.2526	M	0.91038	3.17	0.09310	N	1	D	0.60575	0.988	D	0.67900	0.954	T	0.56165	-0.8024	9	0.59425	D	0.04	.	7.3065	0.26451	0.111:0.5024:0.0:0.3865	.	264	Q8NG84	O2AK2_HUMAN	R	264	ENSP00000355436:S264R	ENSP00000355436:S264R	S	+	3	2	OR2AK2	246196048	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-3.995000	0.00317	-0.985000	0.03503	-1.598000	0.00824	AGC		0.493	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491		11	33	1	0	3.86212e-05	0.008291	4.51527e-05	11	33				
OR2T3	343173	broad.mit.edu	37	1	248637201	248637201	+	Missense_Mutation	SNP	T	T	A	rs529684081		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:248637201T>A	ENST00000359594.2	+	1	575	c.550T>A	c.(550-552)Tgt>Agt	p.C184S		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C184S(1)		breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAGTTTTTTCTGTGAGACTCC	0.517																																							uc001iel.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(550-552)TGT>AGT		olfactory receptor, family 2, subfamily T,							73.0	65.0	68.0					1																	248637201		2162	4267	6429	SO:0001583	missense	343173				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248637201T>A		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.550T>A	1.37:g.248637201T>A	ENSP00000352604:p.Cys184Ser						p.C184S	NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	550	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		184			Extracellular (Potential).		B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	37	c.550T>A	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	t	17.13	3.310116	0.60414	.	.	ENSG00000196539	ENST00000359594	T	0.62364	0.03	2.37	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.85111	0.5622	H	0.98487	4.245	0.32147	N	0.584742	D	0.89917	1.0	D	0.97110	1.0	D	0.86075	0.1540	9	0.72032	D	0.01	.	9.3109	0.37903	0.0:0.0:0.0:1.0	.	184	Q8NH03	OR2T3_HUMAN	S	184	ENSP00000352604:C184S	ENSP00000352604:C184S	C	+	1	0	OR2T3	246703824	1.000000	0.71417	0.413000	0.26509	0.072000	0.16883	6.551000	0.73909	0.841000	0.35020	0.156000	0.16432	TGT		0.517	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495		17	63	0	0	0	0.008871	0	17	63				
OR2G6	391211	broad.mit.edu	37	1	248685394	248685394	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:248685394G>T	ENST00000343414.4	+	1	479	c.447G>T	c.(445-447)tgG>tgT	p.W149C		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W149C(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGGAGCATGGCTCAGCGGCC	0.582																																							uc001ien.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(445-447)TGG>TGT		olfactory receptor, family 2, subfamily G,							74.0	58.0	63.0					1																	248685394		2203	4300	6503	SO:0001583	missense	391211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248685394G>T		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.447G>T	1.37:g.248685394G>T	ENSP00000341291:p.Trp149Cys						p.W149C	NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	447	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	149			Helical; Name=4; (Potential).		B2RP33	Missense_Mutation	SNP	ENST00000343414.4	37	c.447G>T	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	N	10.45	1.355021	0.24512	.	.	ENSG00000188558	ENST00000343414	T	0.59638	0.25	3.46	2.47	0.30058	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39083	U	0.001479	T	0.75845	0.3905	M	0.87900	2.915	0.44214	D	0.997042	D	0.89917	1.0	D	0.97110	1.0	T	0.79829	-0.1638	10	0.72032	D	0.01	.	10.8694	0.46875	0.0:0.0:0.8113:0.1886	.	149	Q5TZ20	OR2G6_HUMAN	C	149	ENSP00000341291:W149C	ENSP00000341291:W149C	W	+	3	0	OR2G6	246752017	0.309000	0.24518	0.165000	0.22776	0.077000	0.17291	0.457000	0.21875	1.747000	0.51819	0.400000	0.26472	TGG		0.582	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842		7	30	1	0	0.00307968	0.00308	0.00331979	7	30				
PGBD2	267002	broad.mit.edu	37	1	249211251	249211251	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:249211251C>T	ENST00000329291.5	+	3	615	c.468C>T	c.(466-468)ttC>ttT	p.F156F	PGBD2_ENST00000462488.1_Intron|PGBD2_ENST00000539153.1_Silent_p.F153F|PGBD2_ENST00000355360.4_Intron	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	156								p.F156F(1)		NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CAATTAATTTCATTGTTAATG	0.383																																							uc001ifh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(466-468)TTC>TTT		hypothetical protein LOC267002 isoform a							89.0	97.0	94.0					1																	249211251		2203	4300	6503	SO:0001819	synonymous_variant	267002							g.chr1:249211251C>T	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.468C>T	1.37:g.249211251C>T						PGBD2_uc001ifg.2_Intron|PGBD2_uc009xhd.2_Silent_p.F153F	p.F156F	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		3	615	+	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	156					B3KVR8|Q6MZF8	Silent	SNP	ENST00000329291.5	37	c.468C>T	CCDS31128.1																																																																																				0.383	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1			8	98	0	0	0	0.006214	0	8	98				
SUV39H2	79723	broad.mit.edu	37	10	14939506	14939506	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:14939506A>C	ENST00000354919.6	+	3	839	c.839A>C	c.(838-840)tAt>tCt	p.Y280S	SUV39H2_ENST00000378325.3_Intron|DCLRE1C_ENST00000378289.4_3'UTR|SUV39H2_ENST00000313519.5_Missense_Mutation_p.Y220S	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	280	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.Y280S(1)|p.Y220S(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						GTCATGGAATATGTTGGAGAG	0.383																																							uc001inh.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|ovary(1)	3						c.(658-660)TAT>TCT		suppressor of variegation 3-9 homolog 2							63.0	60.0	61.0					10																	14939506		2203	4300	6503	SO:0001583	missense	79723				cell cycle|cell differentiation|chromatin assembly or disassembly|chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|chromosome, centromeric region|nucleus	histone methyltransferase activity (H3-K9 specific)|protein binding|zinc ion binding	g.chr10:14939506A>C	AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	ENST00000354919.6:c.839A>C	10.37:g.14939506A>C	ENSP00000346997:p.Tyr280Ser					SUV39H2_uc001ing.2_Intron|SUV39H2_uc001ini.2_Missense_Mutation_p.Y220S|SUV39H2_uc001inj.2_Missense_Mutation_p.Y220S	p.Y220S	NM_024670	NP_078946	Q9H5I1	SUV92_HUMAN			2	715	+			280			SET.		D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Missense_Mutation	SNP	ENST00000354919.6	37	c.659A>C	CCDS53494.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.299039	0.81025	.	.	ENSG00000152455	ENST00000354919;ENST00000313519;ENST00000420416	D;D;D	0.93307	-3.2;-3.2;-3.2	5.86	5.86	0.93980	SET domain (3);	0.000000	0.64402	D	0.000001	D	0.98570	0.9522	H	0.99897	4.91	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99441	1.0938	10	0.87932	D	0	.	15.7408	0.77894	1.0:0.0:0.0:0.0	.	280	Q9H5I1	SUV92_HUMAN	S	280;220;220	ENSP00000346997:Y280S;ENSP00000319208:Y220S;ENSP00000392201:Y220S	ENSP00000319208:Y220S	Y	+	2	0	SUV39H2	14979512	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.287000	0.95975	2.367000	0.80283	0.528000	0.53228	TAT		0.383	SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670		3	58	0	0	0	0.004672	0	3	58				
CUBN	8029	broad.mit.edu	37	10	16982167	16982167	+	Silent	SNP	C	C	A	rs199695111		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:16982167C>A	ENST00000377833.4	-	37	5477	c.5412G>T	c.(5410-5412)acG>acT	p.T1804T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1804	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.T1804T(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCAAGTGACCCGTGGCATTTC	0.448																																							uc001ioo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(5410-5412)ACG>ACT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						177.0	182.0	180.0					10																	16982167		2203	4300	6503	SO:0001819	synonymous_variant	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16982167C>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5412G>T	10.37:g.16982167C>A							p.T1804T	NM_001081	NP_001072	O60494	CUBN_HUMAN			37	5464	-			1804			CUB 12.		B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	c.5412G>T	CCDS7113.1																																																																																				0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		52	199	1	0	9.86064e-34	0.00361	1.83911e-33	52	199				
MRC1	4360	broad.mit.edu	37	10	17891603	17891603	+	Missense_Mutation	SNP	T	T	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:17891603T>G	ENST00000331429.2	+	7	1187	c.1084T>G	c.(1084-1086)Tgt>Ggt	p.C362G	MRC1L1_ENST00000457317.1_Missense_Mutation_p.C362G														p.C362G(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GCCTACTCACTGTCCTAGTCA	0.383																																						GBM(115;1153 1594 28187 28781 35884)	uc001ipk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1084-1086)TGT>GGT		mannose receptor C type 1 precursor							52.0	64.0	60.0					10																	17891603		2165	4165	6330	SO:0001583	missense	4360				receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity	g.chr10:17891603T>G																												ENST00000331429.2:c.1084T>G	10.37:g.17891603T>G	ENSP00000332124:p.Cys362Gly						p.C362G	NM_002438	NP_002429	P22897	MRC1_HUMAN			7	1187	+			362			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000331429.2	37	c.1084T>G		.	.	.	.	.	.	.	.	.	.	T	15.02	2.710032	0.48517	.	.	ENSG00000183748	ENST00000331429;ENST00000457317	T;T	0.39056	1.1;1.1	3.74	3.74	0.42951	.	0.000000	0.64402	U	0.000009	T	0.62889	0.2465	.	.	.	0.46478	D	0.999062	D	0.89917	1.0	D	0.87578	0.998	T	0.75196	-0.3403	8	0.87932	D	0	-24.8663	11.5084	0.50481	0.0:0.0:0.0:1.0	.	362	B9EJA8	.	G	362	ENSP00000332124:C362G;ENSP00000391843:C362G	ENSP00000332124:C362G	C	+	1	0	AL928580.1	17931609	1.000000	0.71417	0.848000	0.33437	0.645000	0.38454	6.552000	0.73914	1.691000	0.51100	0.378000	0.23410	TGT		0.383	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1			18	87	0	0	0	0.005443	0	18	87				
DNAJC1	64215	broad.mit.edu	37	10	22207776	22207776	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:22207776C>G	ENST00000376980.3	-	6	951	c.661G>C	c.(661-663)Gat>Cat	p.D221H		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	221					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D221H(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				GGAAGCAAATCATGCCACTGT	0.373																																							uc001irc.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(661-663)GAT>CAT		DnaJ (Hsp40) homolog, subfamily C, member 1							105.0	90.0	95.0					10																	22207776		2203	4300	6503	SO:0001583	missense	64215				negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding	g.chr10:22207776C>G	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.661G>C	10.37:g.22207776C>G	ENSP00000366179:p.Asp221His					DNAJC1_uc001ird.2_Missense_Mutation_p.D107H	p.D221H	NM_022365	NP_071760	Q96KC8	DNJC1_HUMAN			6	948	-		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)	221			Cytoplasmic (By similarity).		B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	ENST00000376980.3	37	c.661G>C	CCDS7136.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712598	0.89112	.	.	ENSG00000136770	ENST00000376980	T	0.43294	0.95	5.82	5.82	0.92795	.	0.088776	0.85682	D	0.000000	T	0.66636	0.2809	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.67465	-0.5664	10	0.72032	D	0.01	-9.3525	20.0856	0.97800	0.0:1.0:0.0:0.0	.	221	Q96KC8	DNJC1_HUMAN	H	221	ENSP00000366179:D221H	ENSP00000366179:D221H	D	-	1	0	DNAJC1	22247782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.975000	0.76128	2.734000	0.93682	0.655000	0.94253	GAT		0.373	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365		11	21	0	0	0	0.001368	0	11	21				
SPAG6	9576	broad.mit.edu	37	10	22680714	22680714	+	Silent	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:22680714T>A	ENST00000376624.3	+	8	1204	c.1062T>A	c.(1060-1062)gcT>gcA	p.A354A	SPAG6_ENST00000376603.2_Silent_p.A430A|SPAG6_ENST00000538630.1_Silent_p.A329A|SPAG6_ENST00000376601.1_Silent_p.A115A|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000313311.6_Silent_p.A354A	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	354					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.A354A(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						ATATTAAGGCTGCAGCTGCTT	0.483																																							uc001iri.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1060-1062)GCT>GCA		sperm associated antigen 6 isoform 1							110.0	105.0	107.0					10																	22680714		2203	4300	6503	SO:0001819	synonymous_variant	9576				cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding	g.chr10:22680714T>A	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.1062T>A	10.37:g.22680714T>A						SPAG6_uc001irj.2_Silent_p.A354A|SPAG6_uc010qct.1_Silent_p.A324A|SPAG6_uc009xkh.2_Silent_p.A332A	p.A354A	NM_012443	NP_036575	O75602	SPAG6_HUMAN			8	1204	+			354			ARM 7.		A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Silent	SNP	ENST00000376624.3	37	c.1062T>A	CCDS7139.1																																																																																				0.483	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1			12	29	0	0	0	0.004007	0	12	29				
PIP4K2A	5305	broad.mit.edu	37	10	22880696	22880696	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:22880696C>T	ENST00000376573.4	-	4	582	c.354G>A	c.(352-354)agG>agA	p.R118R	PIP4K2A_ENST00000422321.1_5'UTR|PIP4K2A_ENST00000323883.7_5'Flank|PIP4K2A_ENST00000545335.1_Silent_p.R59R	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha	118	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)	p.R118R(1)		endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						GGGGTGCGCTCCTGGTCAGGG	0.522																																							uc001irl.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(352-354)AGG>AGA		phosphatidylinositol-5-phosphate 4-kinase, type							53.0	49.0	50.0					10																	22880696		2203	4300	6503	SO:0001819	synonymous_variant	5305						1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding	g.chr10:22880696C>T	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.354G>A	10.37:g.22880696C>T						PIP4K2A_uc010qcu.1_5'UTR	p.R118R	NM_005028	NP_005019	P48426	PI42A_HUMAN			4	602	-			118			PIPK.		B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Silent	SNP	ENST00000376573.4	37	c.354G>A	CCDS7141.1																																																																																				0.522	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047193.1	NM_005028		18	26	0	0	0	0.010504	0	18	26				
LRRC37A6P	387646	broad.mit.edu	37	10	27539347	27539347	+	lincRNA	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:27539347C>G	ENST00000574842.1	+	0	616				LRRC37A6P_ENST00000284414.4_RNA																							ACAGGAGGACCTGGAGGCTCA	0.597																																							uc001its.2		NA																	0					0						c.(46-48)GGT>CGT		SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;							41.0	42.0	42.0					10																	27539347		692	1591	2283			387646							g.chr10:27539347C>G																													10.37:g.27539347C>G							p.G16R	NR_003525						1	1889	-									Missense_Mutation	SNP	ENST00000574842.1	37	c.46G>C																																																																																					0.597	RP11-85G18.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000436904.1			4	23	0	0	0	0.009096	0	4	23				
ZNF25	219749	broad.mit.edu	37	10	38246347	38246347	+	Splice_Site	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:38246347C>A	ENST00000302609.7	-	3	355		c.e3+1		ZNF25_ENST00000374633.1_Splice_Site|AL117337.1_ENST00000582458.1_RNA	NM_145011.2	NP_659448.1	P17030	ZNF25_HUMAN	zinc finger protein 25						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.?(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				GTTTTCCTCACCCACTGAGAC	0.423																																							uc001ize.1		NA																	1	Unknown(1)		lung(1)	breast(2)|ovary(1)|central_nervous_system(1)	4						c.e3+1		zinc finger protein 25							128.0	116.0	120.0					10																	38246347		2203	4300	6503	SO:0001630	splice_region_variant	219749				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:38246347C>A	AK056452	CCDS7195.1	10p11.2	2013-01-08	2006-05-10		ENSG00000175395	ENSG00000175395		"""Zinc fingers, C2H2-type"", ""-"""	13043	protein-coding gene	gene with protein product		194528	"""zinc finger protein 25 (KOX 19)"""			1639412, 8464732	Standard	NM_145011		Approved	KOX19, FLJ31890, Zfp9	uc001ize.1	P17030	OTTHUMG00000019344	ENST00000302609.7:c.142+1G>T	10.37:g.38246347C>A						ZNF25_uc001izf.1_Splice_Site_p.G12_splice	p.G48_splice	NM_145011	NP_659448	P17030	ZNF25_HUMAN			3	247	-		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)						A9Z1X5|Q8IYE3|Q8NDD6|Q96MU2	Splice_Site	SNP	ENST00000302609.7	37	c.142_splice	CCDS7195.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349098	0.41599	.	.	ENSG00000175395	ENST00000302609;ENST00000374633	.	.	.	4.36	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.575	0.56359	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF25	38286353	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	4.524000	0.60552	2.424000	0.82194	0.561000	0.74099	.		0.423	ZNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051214.1	NM_145011, NM_006966	Intron	22	68	1	0	1.66031e-10	0.003954	2.34136e-10	22	68				
ZNF485	220992	broad.mit.edu	37	10	44112805	44112805	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:44112805G>T	ENST00000361807.3	+	5	1508	c.1314G>T	c.(1312-1314)atG>atT	p.M438I	ZNF485_ENST00000374435.3_Missense_Mutation_p.M438I|ZNF485_ENST00000374437.2_Missense_Mutation_p.M347I	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M438I(1)|p.M399I(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						AAAGAGCCATGAAATGTAGTT	0.343																																							uc010qfc.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1312-1314)ATG>ATT		zinc finger protein 485							41.0	46.0	44.0					10																	44112805		2187	4291	6478	SO:0001583	missense	220992				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:44112805G>T	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.1314G>T	10.37:g.44112805G>T	ENSP00000354694:p.Met438Ile					ZNF485_uc010qfd.1_Missense_Mutation_p.M347I	p.M438I	NM_145312	NP_660355	Q8NCK3	ZN485_HUMAN			5	1508	+			438					B4DSE6|Q96CL0	Missense_Mutation	SNP	ENST00000361807.3	37	c.1314G>T	CCDS7205.2	.	.	.	.	.	.	.	.	.	.	G	1.127	-0.653672	0.03480	.	.	ENSG00000198298	ENST00000361807;ENST00000374437;ENST00000374435	T;T;T	0.06933	3.24;3.24;3.24	2.3	-3.21	0.05140	.	.	.	.	.	T	0.03390	0.0098	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40720	-0.9548	9	0.72032	D	0.01	.	5.3771	0.16172	0.0:0.2225:0.1746:0.6029	.	438	Q8NCK3	ZN485_HUMAN	I	438;347;438	ENSP00000354694:M438I;ENSP00000363560:M347I;ENSP00000363558:M438I	ENSP00000354694:M438I	M	+	3	0	ZNF485	43432811	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	-0.849000	0.04322	-0.911000	0.03843	-0.823000	0.03104	ATG		0.343	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312		13	15	1	0	3.27435e-08	0.00245	4.24132e-08	13	15				
VSTM4	196740	broad.mit.edu	37	10	50255081	50255081	+	Missense_Mutation	SNP	C	C	A	rs149594660	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:50255081C>A	ENST00000332853.4	-	7	807	c.784G>T	c.(784-786)Gcc>Tcc	p.A262S		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A262S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						AACGTGGGGGCTATCGGAGCT	0.478																																							uc001jhf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(784-786)GCC>TCC		hypothetical protein LOC196740 isoform 1							324.0	296.0	305.0					10																	50255081		2203	4300	6503	SO:0001583	missense	196740					integral to membrane|plasma membrane		g.chr10:50255081C>A	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.784G>T	10.37:g.50255081C>A	ENSP00000331062:p.Ala262Ser						p.A262S	NM_001031746	NP_001026916	Q8IW00	CJ072_HUMAN			7	813	-			262			Cytoplasmic (Potential).		B4DNI6|Q96MX7	Missense_Mutation	SNP	ENST00000332853.4	37	c.784G>T	CCDS31198.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.343242	0.41498	.	.	ENSG00000165633	ENST00000332853	T	0.08008	3.14	5.92	4.07	0.47477	.	0.491601	0.21732	N	0.069948	T	0.06872	0.0175	L	0.29908	0.895	0.23126	N	0.998255	B	0.14805	0.011	B	0.10450	0.005	T	0.28839	-1.0031	10	0.48119	T	0.1	-7.7076	8.6224	0.33868	0.1509:0.7723:0.0:0.0768	.	262	Q8IW00	VSTM4_HUMAN	S	262	ENSP00000331062:A262S	ENSP00000331062:A262S	A	-	1	0	VSTM4	49925087	0.170000	0.23016	0.002000	0.10522	0.121000	0.20230	1.087000	0.30865	0.837000	0.34925	-0.324000	0.08512	GCC		0.478	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984		37	48	1	0	2.95478e-19	0.00874	5.09279e-19	37	48				
PGBD3	267004	broad.mit.edu	37	10	50724060	50724060	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:50724060C>A	ENST00000374127.3	-	2	1302	c.1101G>T	c.(1099-1101)atG>atT	p.M367I	ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.M835I|PGBD3_ENST00000508005.2_Missense_Mutation_p.M367I|PGBD3_ENST00000603152.1_Missense_Mutation_p.M835I|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.M835I|ERCC6_ENST00000355832.5_Intron	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	367								p.M367I(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						CCTGATGTCCCATTGAACTGA	0.393																																							uc001jht.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|breast(1)|skin(1)	3						c.(1099-1101)ATG>ATT		hypothetical protein LOC267004							111.0	109.0	109.0					10																	50724060		2203	4300	6503	SO:0001583	missense	267004							g.chr10:50724060C>A	AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.1101G>T	10.37:g.50724060C>A	ENSP00000363242:p.Met367Ile					ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Missense_Mutation_p.M835I|PGBD3_uc001jhu.2_Missense_Mutation_p.M835I	p.M367I	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN			2	1356	-			367					B3KQC4|Q5W0M0|Q6PIH0	Missense_Mutation	SNP	ENST00000374127.3	37	c.1101G>T	CCDS7230.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.153049	0.57259	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	0.699	0.699	0.18093	.	.	.	.	.	T	0.07908	0.0198	N	0.17082	0.46	0.09310	N	1	B;P	0.42827	0.294;0.791	B;B	0.31812	0.063;0.136	T	0.24835	-1.0149	8	0.52906	T	0.07	-15.5484	.	.	.	.	835;367	E7EV46;Q8N328	.;PGBD3_HUMAN	I	367;367;835;835	ENSP00000363242:M367I;ENSP00000426963:M367I;ENSP00000423550:M835I;ENSP00000387966:M835I	ENSP00000387966:M835I	M	-	3	0	PGBD3;RP11-123B3.6	50394066	0.002000	0.14202	0.006000	0.13384	0.981000	0.71138	-0.461000	0.06712	0.653000	0.30826	0.491000	0.48974	ATG		0.393	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047988.1			29	49	1	0	0.000184323	0.007291	0.000210845	29	49				
DDX50	79009	broad.mit.edu	37	10	70694664	70694664	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:70694664A>T	ENST00000373585.3	+	10	1618	c.1511A>T	c.(1510-1512)gAa>gTa	p.E504V	DDX50_ENST00000466265.1_Intron	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	504	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.E504V(1)		breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						AGATATGTGGAACAAAAAGCA	0.373																																							uc001jou.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1510-1512)GAA>GTA		nucleolar protein GU2							113.0	122.0	119.0					10																	70694664		2203	4300	6503	SO:0001583	missense	79009					nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding	g.chr10:70694664A>T	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.1511A>T	10.37:g.70694664A>T	ENSP00000362687:p.Glu504Val					DDX50_uc010qjc.1_Missense_Mutation_p.E504V	p.E504V	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN			10	1618	+			504			Helicase C-terminal.		Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	c.1511A>T	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.485755	0.84854	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.05199	3.48	5.33	5.33	0.75918	Helicase, C-terminal (1);	0.096916	0.64402	D	0.000001	T	0.29190	0.0726	M	0.86028	2.79	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.06570	-1.0819	10	0.72032	D	0.01	-17.9981	15.6101	0.76710	1.0:0.0:0.0:0.0	.	504	Q9BQ39	DDX50_HUMAN	V	504	ENSP00000362687:E504V	ENSP00000362687:E504V	E	+	2	0	DDX50	70364670	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.594000	0.90836	2.142000	0.66516	0.533000	0.62120	GAA		0.373	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045		25	35	0	0	0	0.004656	0	25	35				
H2AFY2	55506	broad.mit.edu	37	10	71851628	71851628	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:71851628C>A	ENST00000373255.4	+	4	659	c.395C>A	c.(394-396)cCa>cAa	p.P132Q		NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	132	Lys-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)	p.P132Q(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						TCCCCACCCCCAGAGAAAAGA	0.597																																							uc001jqm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(394-396)CCA>CAA		H2A histone family, member Y2							77.0	70.0	72.0					10																	71851628		2203	4300	6503	SO:0001583	missense	55506				chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding	g.chr10:71851628C>A	AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.395C>A	10.37:g.71851628C>A	ENSP00000362352:p.Pro132Gln					H2AFY2_uc001jqn.2_RNA	p.P132Q	NM_018649	NP_061119	Q9P0M6	H2AW_HUMAN			4	854	+			132			Lys-rich.		Q5SQT2	Missense_Mutation	SNP	ENST00000373255.4	37	c.395C>A	CCDS7296.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007075	0.54361	.	.	ENSG00000099284	ENST00000373255	T	0.23348	1.91	5.85	4.95	0.65309	.	0.387195	0.31472	N	0.007600	T	0.24736	0.0600	L	0.27053	0.805	0.43555	D	0.995863	D	0.55172	0.97	P	0.49140	0.601	T	0.02196	-1.1197	10	0.56958	D	0.05	.	11.1198	0.48281	0.0:0.8576:0.0:0.1424	.	132	Q9P0M6	H2AW_HUMAN	Q	132	ENSP00000362352:P132Q	ENSP00000362352:P132Q	P	+	2	0	H2AFY2	71521634	0.999000	0.42202	1.000000	0.80357	0.939000	0.58152	4.569000	0.60865	1.632000	0.50472	-0.140000	0.14226	CCA		0.597	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2	NM_018649		19	17	1	0	8.10497e-08	0.010504	1.03509e-07	19	17				
LDB3	11155	broad.mit.edu	37	10	88441349	88441349	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:88441349G>T	ENST00000361373.4	+	4	499	c.478G>T	c.(478-480)Gac>Tac	p.D160Y	LDB3_ENST00000429277.2_Missense_Mutation_p.D160Y|LDB3_ENST00000458213.2_Intron|LDB3_ENST00000310944.6_Missense_Mutation_p.D160Y|LDB3_ENST00000372066.3_Intron|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000372056.4_Missense_Mutation_p.D160Y|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000542786.1_Missense_Mutation_p.D160Y	NM_007078.2	NP_009009.1			LIM domain binding 3									p.D160Y(3)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						CGAGGCCTCTGACCCTGGCCC	0.736																																							uc001kdv.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(478-480)GAC>TAC		LIM domain binding 3 isoform 1							20.0	22.0	21.0					10																	88441349		2202	4297	6499	SO:0001583	missense	11155					cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding	g.chr10:88441349G>T	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.478G>T	10.37:g.88441349G>T	ENSP00000355296:p.Asp160Tyr					LDB3_uc010qml.1_Missense_Mutation_p.D160Y|LDB3_uc010qmm.1_Missense_Mutation_p.D160Y|LDB3_uc001kdu.2_Intron|LDB3_uc009xsz.2_Intron|LDB3_uc001kdr.2_Intron|LDB3_uc009xsy.2_Missense_Mutation_p.D160Y|LDB3_uc001kds.2_Missense_Mutation_p.D160Y|LDB3_uc001kdt.2_RNA	p.D160Y	NM_007078	NP_009009	O75112	LDB3_HUMAN			4	501	+			160						Missense_Mutation	SNP	ENST00000361373.4	37	c.478G>T	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292190	0.40594	.	.	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000372056;ENST00000310944;ENST00000361373;ENST00000542786	T;T;T;T;T	0.52526	0.86;1.06;1.25;0.66;1.23	5.0	4.08	0.47627	.	.	.	.	.	T	0.52725	0.1752	L	0.43152	1.355	0.22701	N	0.998839	B;P;D;B;P	0.59767	0.119;0.759;0.986;0.119;0.889	B;P;P;B;P	0.54100	0.037;0.596;0.742;0.037;0.718	T	0.43845	-0.9366	9	0.56958	D	0.05	.	13.1222	0.59334	0.0782:0.0:0.9218:0.0	.	160;160;160;160;160	B4E3K3;F5H0C2;O75112-4;O75112;O75112-5	.;.;.;LDB3_HUMAN;.	Y	160	ENSP00000401437:D160Y;ENSP00000361126:D160Y;ENSP00000311913:D160Y;ENSP00000355296:D160Y;ENSP00000438866:D160Y	ENSP00000311913:D160Y	D	+	1	0	LDB3	88431329	1.000000	0.71417	0.858000	0.33744	0.054000	0.15201	4.652000	0.61454	2.460000	0.83146	0.563000	0.77884	GAC		0.736	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			10	31	1	0	1.58986e-06	0.008291	1.94079e-06	10	31				
PLCE1	51196	broad.mit.edu	37	10	95791904	95791904	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:95791904G>T	ENST00000371380.3	+	1	1336	c.1101G>T	c.(1099-1101)aaG>aaT	p.K367N	PLCE1_ENST00000260766.3_Missense_Mutation_p.K367N			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	367					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.K367N(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TAGATCAGAAGAGAAATGGTC	0.483																																							uc001kjk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1099-1101)AAG>AAT		phospholipase C, epsilon 1 isoform 1							80.0	80.0	80.0					10																	95791904		1921	4141	6062	SO:0001583	missense	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95791904G>T		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1101G>T	10.37:g.95791904G>T	ENSP00000360431:p.Lys367Asn					PLCE1_uc010qnx.1_Missense_Mutation_p.K367N	p.K367N	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN			2	1735	+		Colorectal(252;0.0458)	367					A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	c.1101G>T	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.134816	0.37728	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	T;T	0.72051	-0.62;-0.62	5.65	1.24	0.21308	Ras guanine nucleotide exchange factor, domain (1);	0.219723	0.30519	N	0.009451	T	0.53786	0.1818	N	0.24115	0.695	0.80722	D	1	B;B	0.23937	0.094;0.094	B;B	0.21917	0.037;0.037	T	0.51020	-0.8758	10	0.72032	D	0.01	.	10.0888	0.42434	0.3113:0.0:0.6887:0.0	.	367;367	B7ZM61;Q9P212	.;PLCE1_HUMAN	N	367	ENSP00000260766:K367N;ENSP00000360431:K367N	ENSP00000260766:K367N	K	+	3	2	PLCE1	95781894	0.999000	0.42202	0.959000	0.39883	0.836000	0.47400	0.364000	0.20325	0.337000	0.23665	0.655000	0.94253	AAG		0.483	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		17	31	1	0	1.5739e-10	0.004007	2.24439e-10	17	31				
ENTPD1	953	broad.mit.edu	37	10	97607405	97607405	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:97607405C>A	ENST00000371205.4	+	7	1299	c.1016C>A	c.(1015-1017)cCt>cAt	p.P339H	ENTPD1_ENST00000371207.3_Missense_Mutation_p.P351H|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000539125.1_Missense_Mutation_p.P201H|ENTPD1_ENST00000371203.5_Missense_Mutation_p.P201H|ENTPD1_ENST00000453258.2_Missense_Mutation_p.P346H|ENTPD1_ENST00000543964.1_Missense_Mutation_p.P231H|RP11-429G19.3_ENST00000433113.1_RNA			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	339					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.P339H(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		AGTTACTGCCCTTACTCCCAG	0.448																																							uc001klh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1015-1017)CCT>CAT		ectonucleoside triphosphate diphosphohydrolase 1							118.0	116.0	116.0					10																	97607405		2203	4300	6503	SO:0001583	missense	953				cell adhesion	integral to plasma membrane	ATP binding	g.chr10:97607405C>A	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.1016C>A	10.37:g.97607405C>A	ENSP00000360248:p.Pro339His					ENTPD1_uc001kli.3_Missense_Mutation_p.P346H|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Missense_Mutation_p.P351H|ENTPD1_uc010qok.1_Missense_Mutation_p.P231H|ENTPD1_uc010qol.1_Missense_Mutation_p.P231H|ENTPD1_uc010qom.1_Missense_Mutation_p.P298H|ENTPD1_uc010qon.1_Missense_Mutation_p.P201H|ENTPD1_uc009xva.2_Missense_Mutation_p.P201H|ENTPD1_uc009xuz.2_RNA	p.P339H	NM_001776	NP_001767	P49961	ENTP1_HUMAN		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)	7	1340	+		Colorectal(252;0.0821)	339			Extracellular (Potential).		A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Missense_Mutation	SNP	ENST00000371205.4	37	c.1016C>A	CCDS7444.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470223	0.43942	.	.	ENSG00000138185	ENST00000453258;ENST00000371207;ENST00000543964;ENST00000539125;ENST00000371203;ENST00000371205	T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67	5.77	2.68	0.31781	.	0.369001	0.30930	N	0.008598	T	0.25568	0.0622	L	0.56340	1.77	0.44995	D	0.998013	D;D;B;D	0.89917	1.0;1.0;0.303;1.0	D;D;B;D	0.80764	0.994;0.99;0.176;0.994	T	0.01259	-1.1403	10	0.45353	T	0.12	-1.7715	5.4828	0.16733	0.1834:0.6137:0.1276:0.0754	.	351;351;346;339	B4DWB9;G3XAF6;P49961-2;P49961	.;.;.;ENTP1_HUMAN	H	346;351;231;201;201;339	ENSP00000390955:P346H;ENSP00000360250:P351H;ENSP00000442968:P231H;ENSP00000440027:P201H;ENSP00000360246:P201H;ENSP00000360248:P339H	ENSP00000360246:P201H	P	+	2	0	ENTPD1	97597395	0.999000	0.42202	0.994000	0.49952	0.223000	0.24884	0.891000	0.28309	0.339000	0.23719	0.650000	0.86243	CCT		0.448	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776		28	55	1	0	6.38683e-12	0.008361	9.44657e-12	28	55				
FBXW4	6468	broad.mit.edu	37	10	103384540	103384540	+	Silent	SNP	G	G	A	rs148535514		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:103384540G>A	ENST00000331272.7	-	6	1416	c.798C>T	c.(796-798)tgC>tgT	p.C266C	FBXW4_ENST00000470093.1_5'UTR|RNU6-1165P_ENST00000410119.1_RNA	NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	266					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)		p.C266C(1)		breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		AGAAGTGCCCGCAACAAGCCG	0.517																																							uc001kto.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(796-798)TGC>TGT		F-box and WD repeat domain containing 4		G		2,4404	4.2+/-10.8	0,2,2201	77.0	68.0	71.0		798	2.0	1.0	10	dbSNP_134	71	0,8600		0,0,4300	no	coding-synonymous	FBXW4	NM_022039.3		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		266/413	103384540	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	6468				ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	ubiquitin ligase complex		g.chr10:103384540G>A	AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.798C>T	10.37:g.103384540G>A							p.C266C	NM_022039	NP_071322	P57775	FBXW4_HUMAN		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)	6	1144	-		Colorectal(252;0.123)	266					Q5SVS1|Q96IM6	Silent	SNP	ENST00000331272.7	37	c.798C>T	CCDS31271.1																																																																																				0.517	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049979.2	NM_022039		6	24	0	0	0	0.004482	0	6	24				
CFAP43	80217	broad.mit.edu	37	10	105902094	105902094	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:105902094C>T	ENST00000357060.3	-	33	4331	c.4216G>A	c.(4216-4218)Gag>Aag	p.E1406K	WDR96_ENST00000428666.1_Missense_Mutation_p.E1378K|WDR96_ENST00000479392.1_5'Flank	NM_025145.5	NP_079421.5												p.E1406K(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TCTTCCTCCTCAACTCTCTTC	0.403																																							uc001kxw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4216-4218)GAG>AAG		hypothetical protein LOC80217							192.0	177.0	182.0					10																	105902094		2203	4300	6503	SO:0001583	missense	80217							g.chr10:105902094C>T																												ENST00000357060.3:c.4216G>A	10.37:g.105902094C>T	ENSP00000349568:p.Glu1406Lys					C10orf79_uc009xxq.2_Missense_Mutation_p.E685K	p.E1406K	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	33	4332	-		Colorectal(252;0.178)	1406			Potential.			Missense_Mutation	SNP	ENST00000357060.3	37	c.4216G>A	CCDS31281.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065782	0.55539	.	.	ENSG00000197748	ENST00000357060;ENST00000428666	T;T	0.15256	2.44;2.51	5.55	5.55	0.83447	.	0.118422	0.56097	D	0.000027	T	0.22551	0.0544	L	0.52364	1.645	0.38219	D	0.940688	B;P	0.40619	0.34;0.724	B;P	0.44623	0.171;0.455	T	0.03784	-1.1004	10	0.11485	T	0.65	.	18.067	0.89394	0.0:1.0:0.0:0.0	.	1378;1406	G5E9L1;Q8NDM7	.;WDR96_HUMAN	K	1406;1378	ENSP00000349568:E1406K;ENSP00000400289:E1378K	ENSP00000349568:E1406K	E	-	1	0	WDR96	105892084	0.997000	0.39634	0.882000	0.34594	0.733000	0.41908	5.215000	0.65241	2.601000	0.87937	0.462000	0.41574	GAG		0.403	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				10	68	0	0	0	0.006214	0	10	68				
PDCD4	27250	broad.mit.edu	37	10	112641277	112641277	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:112641277G>T	ENST00000280154.7	+	3	604	c.330G>T	c.(328-330)agG>agT	p.R110S	PDCD4_ENST00000393104.2_Missense_Mutation_p.R99S	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	110					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.R110S(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GGAAAGGAAGGGGACTACCAA	0.443																																					Ovarian(115;1498 1603 9363 40056 40885)	Ovarian(115;1498 1603 9363 40056 40885)	uc001kzh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(328-330)AGG>AGT		programmed cell death 4 isoform 1							50.0	56.0	54.0					10																	112641277		2203	4300	6503	SO:0001583	missense	27250				apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding	g.chr10:112641277G>T	U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.330G>T	10.37:g.112641277G>T	ENSP00000280154:p.Arg110Ser					PDCD4_uc001kzg.2_Missense_Mutation_p.R99S|PDCD4_uc010qre.1_Missense_Mutation_p.R96S	p.R110S	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)	3	573	+		Breast(234;0.0848)|Lung NSC(174;0.238)	110					B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	ENST00000280154.7	37	c.330G>T	CCDS7567.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445593	0.63178	.	.	ENSG00000150593	ENST00000280154;ENST00000393104;ENST00000444997	T;T;T	0.34859	1.43;1.44;1.34	5.72	1.47	0.22746	.	0.000000	0.85682	D	0.000000	T	0.56307	0.1976	M	0.78049	2.395	0.80722	D	1	P;D;D	0.76494	0.761;0.999;0.999	P;D;D	0.80764	0.645;0.994;0.991	T	0.56129	-0.8030	10	0.72032	D	0.01	-14.3215	10.2326	0.43264	0.431:0.0:0.569:0.0	.	96;110;99	B4DKX4;Q53EL6;B5ME91	.;PDCD4_HUMAN;.	S	110;99;96	ENSP00000280154:R110S;ENSP00000376816:R99S;ENSP00000394668:R96S	ENSP00000280154:R110S	R	+	3	2	PDCD4	112631267	0.987000	0.35691	0.999000	0.59377	0.999000	0.98932	0.336000	0.19823	0.070000	0.16634	0.650000	0.86243	AGG		0.443	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	NM_014456		10	23	1	0	0.000442599	0.006214	0.000496461	10	23				
GRK5	2869	broad.mit.edu	37	10	121214575	121214575	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr10:121214575G>T	ENST00000392870.2	+	16	2098	c.1769G>T	c.(1768-1770)aGc>aTc	p.S590I	GRK5_ENST00000369108.3_Missense_Mutation_p.S485I	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	590					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)	p.S590I(1)		endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		ACCGGAAGCAGCTAGTTTCGG	0.552																																							uc001led.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|stomach(1)	3						c.(1768-1770)AGC>ATC		G protein-coupled receptor kinase 5							97.0	88.0	91.0					10																	121214575		2203	4300	6503	SO:0001583	missense	2869				G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity	g.chr10:121214575G>T	L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.1769G>T	10.37:g.121214575G>T	ENSP00000376609:p.Ser590Ile					GRK5_uc009xzh.2_Missense_Mutation_p.S455I	p.S590I	NM_005308	NP_005299	P34947	GRK5_HUMAN		all cancers(201;0.0227)	16	2002	+		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)	590					D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	c.1769G>T	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115962	0.56505	.	.	ENSG00000198873	ENST00000392870;ENST00000369108	T;T	0.70631	-0.47;-0.5	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000008	T	0.79650	0.4482	L	0.40543	1.245	0.58432	D	0.999999	D;D	0.61697	0.99;0.99	D;D	0.69142	0.962;0.962	T	0.81243	-0.1021	10	0.87932	D	0	-8.5537	19.3324	0.94297	0.0:0.0:1.0:0.0	.	590;590	B2R7K0;P34947	.;GRK5_HUMAN	I	590;485	ENSP00000376609:S590I;ENSP00000358104:S485I	ENSP00000358104:S485I	S	+	2	0	GRK5	121204565	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.124000	0.77185	2.571000	0.86741	0.655000	0.94253	AGC		0.552	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308		11	18	1	0	0.00136819	0.001368	0.0015003	11	18				
OSBPL5	114879	broad.mit.edu	37	11	3123481	3123481	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:3123481C>G	ENST00000263650.7	-	12	1516	c.1357G>C	c.(1357-1359)Ggg>Cgg	p.G453R	OSBPL5_ENST00000542243.1_Missense_Mutation_p.G84R|OSBPL5_ENST00000348039.5_Missense_Mutation_p.G385R|OSBPL5_ENST00000389989.3_Missense_Mutation_p.G385R|OSBPL5_ENST00000525498.1_Missense_Mutation_p.G364R	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	453					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)	p.G453R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AAGGTCTCCCCCAGGATGGGG	0.597																																							uc001lxk.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|central_nervous_system(1)	3						c.(1357-1359)GGG>CGG		oxysterol-binding protein-like protein 5 isoform							57.0	48.0	51.0					11																	3123481		2201	4298	6499	SO:0001583	missense	114879				cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding	g.chr11:3123481C>G	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.1357G>C	11.37:g.3123481C>G	ENSP00000263650:p.Gly453Arg					OSBPL5_uc010qxq.1_Missense_Mutation_p.G364R|OSBPL5_uc009ydw.2_Missense_Mutation_p.G385R|OSBPL5_uc001lxl.2_Missense_Mutation_p.G385R|OSBPL5_uc009ydx.2_Missense_Mutation_p.G477R	p.G453R	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)	12	1515	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	453					A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Missense_Mutation	SNP	ENST00000263650.7	37	c.1357G>C	CCDS31344.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568897	0.86439	.	.	ENSG00000021762	ENST00000263650;ENST00000389989;ENST00000534454;ENST00000525498;ENST00000542243;ENST00000348039;ENST00000357352	D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	3.82	3.82	0.43975	.	0.000000	0.64402	D	0.000001	D	0.95153	0.8429	H	0.99391	4.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97623	1.0137	10	0.87932	D	0	-0.6613	15.9075	0.79442	0.0:1.0:0.0:0.0	.	364;414;385;453	B4DVB0;E7EP03;Q8N596;Q9H0X9	.;.;.;OSBL5_HUMAN	R	453;385;6;364;84;385;72	ENSP00000263650:G453R;ENSP00000374639:G385R;ENSP00000431412:G6R;ENSP00000433342:G364R;ENSP00000441551:G84R;ENSP00000302872:G385R	ENSP00000263650:G453R	G	-	1	0	OSBPL5	3080057	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.060000	0.76692	1.963000	0.57068	0.491000	0.48974	GGG		0.597	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2			3	1	0	0	0	0.004672	0	3	1				
OR52N4	390072	broad.mit.edu	37	11	5776568	5776568	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:5776568T>A	ENST00000317254.3	+	1	646	c.598T>A	c.(598-600)Tat>Aat	p.Y200N	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y200N(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		CAATGCCATCTATGGTCTGAT	0.502																																							uc001mbu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(598-600)TAT>AAT		olfactory receptor, family 52, subfamily N,							188.0	177.0	181.0					11																	5776568		2179	4290	6469	SO:0001583	missense	390072				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5776568T>A	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.598T>A	11.37:g.5776568T>A	ENSP00000323224:p.Tyr200Asn					TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.Y200N	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)	1	646	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	200			Helical; Name=5; (Potential).		B2RNP8|Q6IF77	Missense_Mutation	SNP	ENST00000317254.3	37	c.598T>A	CCDS44528.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.368672	0.42003	.	.	ENSG00000181074	ENST00000317254	T	0.47869	0.83	6.1	6.1	0.99115	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	D	0.000676	T	0.76948	0.4059	M	0.93720	3.45	0.28944	N	0.890837	D	0.89917	1.0	D	0.83275	0.996	T	0.78568	-0.2154	10	0.87932	D	0	.	15.51	0.75772	0.0:0.0:0.0:1.0	.	200	Q8NGI2	O52N4_HUMAN	N	200	ENSP00000323224:Y200N	ENSP00000323224:Y200N	Y	+	1	0	OR52N4	5733144	0.049000	0.20398	0.962000	0.40283	0.224000	0.24922	1.618000	0.36954	2.340000	0.79590	0.528000	0.53228	TAT		0.502	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175		26	47	0	0	0	0.003954	0	26	47				
OR52N2	390077	broad.mit.edu	37	11	5841931	5841931	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:5841931G>T	ENST00000317037.2	+	1	388	c.366G>T	c.(364-366)ctG>ctT	p.L122L	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L122L(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCATGGCCCTGGACCGCTATG	0.537																																							uc010qzp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(364-366)CTG>CTT		olfactory receptor, family 52, subfamily N,							160.0	130.0	140.0					11																	5841931		2201	4296	6497	SO:0001819	synonymous_variant	390077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5841931G>T	AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.366G>T	11.37:g.5841931G>T						TRIM5_uc001mbq.1_Intron	p.L122L	NM_001005174	NP_001005174	Q8NGI0	O52N2_HUMAN		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	366	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	122			Helical; Name=3; (Potential).		Q6IFF9	Silent	SNP	ENST00000317037.2	37	c.366G>T	CCDS31399.1																																																																																				0.537	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401143.1	NM_001005174		8	52	1	0	5.4927e-09	0.004482	7.44853e-09	8	52				
OR56A3	390083	broad.mit.edu	37	11	5968952	5968952	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:5968952C>A	ENST00000329564.6	+	1	383	c.376C>A	c.(376-378)Cgt>Agt	p.R126S	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R126S(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCTATGATCGTTATGTAGC	0.458																																							uc010qzt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(376-378)CGT>AGT		olfactory receptor, family 56, subfamily A,							173.0	165.0	168.0					11																	5968952		2201	4296	6497	SO:0001583	missense	390083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5968952C>A		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.376C>A	11.37:g.5968952C>A	ENSP00000331572:p.Arg126Ser						p.R126S	NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	376	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	126			Cytoplasmic (Potential).		A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	37	c.376C>A	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.211708	0.39102	.	.	ENSG00000184478	ENST00000329564	T	0.77620	-1.11	5.13	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.000000	0.28119	U	0.016527	D	0.91408	0.7289	H	0.97806	4.08	0.35475	D	0.797653	D	0.57571	0.98	P	0.61874	0.895	D	0.95886	0.8903	10	0.72032	D	0.01	-10.7749	14.8789	0.70516	0.153:0.8469:0.0:0.0	.	126	Q8NH54	O56A3_HUMAN	S	126	ENSP00000331572:R126S	ENSP00000331572:R126S	R	+	1	0	OR56A3	5925528	0.983000	0.35010	1.000000	0.80357	0.124000	0.20399	2.544000	0.45761	2.687000	0.91594	0.650000	0.86243	CGT		0.458	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443		28	65	1	0	1.55811e-20	0.008361	2.72241e-20	28	65				
OR10A4	283297	broad.mit.edu	37	11	6898490	6898490	+	Silent	SNP	T	T	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:6898490T>G	ENST00000379829.2	+	1	635	c.612T>G	c.(610-612)acT>acG	p.T204T		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	204					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T204T(1)		kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGACAGCCACTGTCCTATTCA	0.522																																							uc010rat.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(610-612)ACT>ACG		olfactory receptor, family 10, subfamily A,							154.0	120.0	131.0					11																	6898490		2201	4296	6497	SO:0001819	synonymous_variant	283297				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6898490T>G	AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.612T>G	11.37:g.6898490T>G							p.T204T	NM_207186	NP_997069	Q9H209	O10A4_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	612	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	204			Helical; Name=5; (Potential).		B2RNP5|B9EH36|Q96R20	Silent	SNP	ENST00000379829.2	37	c.612T>G	CCDS7774.1																																																																																				0.522	OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1	NM_207186		11	53	0	0	0	0.000978	0	11	53				
IPO7	10527	broad.mit.edu	37	11	9459724	9459724	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:9459724C>T	ENST00000379719.3	+	22	2729	c.2587C>T	c.(2587-2589)Ccg>Tcg	p.P863S		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	863					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)	p.P863S(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		ACAGATTTTGCCGGCTTTTAT	0.398																																							uc001mho.2		NA																	1	Substitution - Missense(1)	p.P863P(1)	lung(1)	lung(1)|breast(1)	2						c.(2587-2589)CCG>TCG		importin 7							145.0	163.0	157.0					11																	9459724		2201	4294	6495	SO:0001583	missense	10527				interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity	g.chr11:9459724C>T	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.2587C>T	11.37:g.9459724C>T	ENSP00000369042:p.Pro863Ser						p.P863S	NM_006391	NP_006382	O95373	IPO7_HUMAN		all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)	22	2729	+			863					A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	37	c.2587C>T	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081390	0.55753	.	.	ENSG00000205339	ENST00000379719	T	0.66638	-0.22	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81955	0.4932	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78150	-0.2316	10	0.16420	T	0.52	.	19.0792	0.93175	0.0:1.0:0.0:0.0	.	863	O95373	IPO7_HUMAN	S	863	ENSP00000369042:P863S	ENSP00000369042:P863S	P	+	1	0	IPO7	9416300	1.000000	0.71417	1.000000	0.80357	0.002000	0.02628	7.164000	0.77533	2.507000	0.84556	0.585000	0.79938	CCG		0.398	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391		5	184	0	0	0	0.001168	0	5	184				
MYOD1	4654	broad.mit.edu	37	11	17742882	17742882	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:17742882C>A	ENST00000250003.3	+	3	1005	c.790C>A	c.(790-792)Cct>Act	p.P264T		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	264					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)	p.P264T(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						CACCGAGAGCCCTGCGGCGCC	0.726																																							uc001mni.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(790-792)CCT>ACT		myogenic differentiation 1							14.0	14.0	14.0					11																	17742882		2181	4277	6458	SO:0001583	missense	4654				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|skeletal muscle tissue development	nuclear chromatin|transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity	g.chr11:17742882C>A	AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.790C>A	11.37:g.17742882C>A	ENSP00000250003:p.Pro264Thr						p.P264T	NM_002478	NP_002469	P15172	MYOD1_HUMAN			3	1010	+			264					O75321	Missense_Mutation	SNP	ENST00000250003.3	37	c.790C>A	CCDS7826.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748788	0.69533	.	.	ENSG00000129152	ENST00000250003	D	0.97209	-4.29	4.58	3.58	0.41010	.	0.261386	0.38720	N	0.001588	D	0.92675	0.7672	L	0.48642	1.525	0.40708	D	0.982541	B	0.11235	0.004	B	0.11329	0.006	D	0.85972	0.1477	10	0.22706	T	0.39	-26.6393	3.0508	0.06168	0.2702:0.5665:0.0:0.1633	.	264	P15172	MYOD1_HUMAN	T	264	ENSP00000250003:P264T	ENSP00000250003:P264T	P	+	1	0	MYOD1	17699458	0.441000	0.25626	0.985000	0.45067	0.974000	0.67602	1.049000	0.30392	2.379000	0.81126	0.650000	0.86243	CCT		0.726	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389387.1	NM_002478		5	10	1	0	1.23904e-05	0.000602	1.47295e-05	5	10				
MRGPRX1	259249	broad.mit.edu	37	11	18955987	18955987	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:18955987G>A	ENST00000302797.3	-	1	569	c.345C>T	c.(343-345)gcC>gcT	p.A115A	MRGPRX1_ENST00000526914.1_5'UTR|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	115					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A115A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CGGTGCTCACGGCACTCAGAA	0.567																																							uc001mpg.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|central_nervous_system(1)	3						c.(343-345)GCC>GCT		MAS-related GPR, member X1							98.0	93.0	95.0					11																	18955987		2194	4286	6480	SO:0001819	synonymous_variant	259249				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18955987G>A		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.345C>T	11.37:g.18955987G>A							p.A115A	NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN			1	563	-			115			Helical; Name=3; (Potential).		Q4V9L2|Q8TDD8|Q8TDD9	Silent	SNP	ENST00000302797.3	37	c.345C>T	CCDS7846.1																																																																																				0.567	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199		16	88	0	0	0	0.003163	0	16	88				
TRAF6	7189	broad.mit.edu	37	11	36511949	36511949	+	Silent	SNP	G	G	A	rs201926351		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:36511949G>A	ENST00000526995.1	-	7	1254	c.1008C>T	c.(1006-1008)acC>acT	p.T336T	TRAF6_ENST00000348124.5_Silent_p.T336T|TRAF6_ENST00000529150.1_5'UTR	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	336	Interaction with TAX1BP1.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T336T(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				TGTCCTCAAGGGTTCGAATGG	0.423																																							uc001mwr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1006-1008)ACC>ACT		TNF receptor-associated factor 6							154.0	141.0	146.0					11																	36511949		2202	4298	6500	SO:0001819	synonymous_variant	7189				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:36511949G>A		CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.1008C>T	11.37:g.36511949G>A						uc001mwq.1_5'Flank|TRAF6_uc001mws.1_Silent_p.T336T	p.T336T	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN			8	1348	-	all_lung(20;0.211)	all_hematologic(20;0.107)	336			Potential.|Interaction with TAX1BP1.		A6NKI7|A8KAB3|D3DR16|Q8NEH5	Silent	SNP	ENST00000526995.1	37	c.1008C>T	CCDS7901.1																																																																																				0.423	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803		21	110	0	0	0	0.00278	0	21	110				
F2	2147	broad.mit.edu	37	11	46744801	46744801	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:46744801C>A	ENST00000311907.5	+	5	444	c.388C>A	c.(388-390)Cag>Aag	p.Q130K	F2_ENST00000530231.1_Missense_Mutation_p.Q130K	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	130	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)	p.Q130K(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	CATTGAGTGCCAGCTATGGAG	0.607																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)	Esophageal Squamous(147;1147 1808 2148 38609 51144)	uc001ndf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(388-390)CAG>AAG		coagulation factor II preproprotein	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)						121.0	114.0	117.0					11																	46744801		2201	4299	6500	SO:0001583	missense	2147				activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity	g.chr11:46744801C>A	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.388C>A	11.37:g.46744801C>A	ENSP00000308541:p.Gln130Lys					F2_uc001ndg.3_RNA	p.Q130K	NM_000506	NP_000497	P00734	THRB_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.146)	5	431	+		all_lung(304;0.000414)|Lung NSC(402;0.0011)	130			Kringle 1.		B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	37	c.388C>A	CCDS31476.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.895315	0.91962	.	.	ENSG00000180210	ENST00000311907;ENST00000530231;ENST00000442468	D;D;D	0.81659	-1.52;-1.52;-1.52	5.33	5.33	0.75918	Kringle (5);Kringle-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92427	0.7596	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94010	0.7283	10	0.87932	D	0	.	19.031	0.92957	0.0:1.0:0.0:0.0	.	130	P00734	THRB_HUMAN	K	130;130;120	ENSP00000308541:Q130K;ENSP00000433907:Q130K;ENSP00000387413:Q120K	ENSP00000308541:Q130K	Q	+	1	0	F2	46701377	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	6.819000	0.75262	2.502000	0.84385	0.511000	0.50034	CAG		0.607	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1			18	76	1	0	9.16793e-09	0.00499	1.21223e-08	18	76				
CKAP5	9793	broad.mit.edu	37	11	46772905	46772905	+	Silent	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:46772905T>C	ENST00000529230.1	-	39	5359	c.5313A>G	c.(5311-5313)aaA>aaG	p.K1771K	MIR5582_ENST00000579697.1_RNA|CKAP5_ENST00000415402.1_Silent_p.K1771K|CKAP5_ENST00000312055.5_Silent_p.K1711K|CKAP5_ENST00000354558.3_Silent_p.K1711K			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1771					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)		p.K1771K(1)		breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						CCTTGGGCCCTTTTAATTTGC	0.443																																					Ovarian(4;85 273 2202 4844 13323)	Ovarian(4;85 273 2202 4844 13323)	uc001ndi.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(5311-5313)AAA>AAG		colonic and hepatic tumor over-expressed protein							165.0	160.0	161.0					11																	46772905		2201	4299	6500	SO:0001819	synonymous_variant	9793				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding	g.chr11:46772905T>C		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.5313A>G	11.37:g.46772905T>C						CKAP5_uc009ylg.1_Silent_p.K1657K|CKAP5_uc001ndj.1_Silent_p.K1711K|CKAP5_uc001ndh.1_Silent_p.K700K	p.K1771K	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN			39	5423	-			1771					Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	37	c.5313A>G	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	T	8.631	0.893624	0.17613	.	.	ENSG00000175216	ENST00000525896	.	.	.	5.72	4.6	0.57074	.	.	.	.	.	T	0.57330	0.2046	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55604	-0.8115	4	.	.	.	-13.3618	7.7932	0.29133	0.0:0.1821:0.0:0.8179	.	.	.	.	G	10	.	.	R	-	1	2	CKAP5	46729481	0.978000	0.34361	1.000000	0.80357	0.988000	0.76386	0.096000	0.15147	2.183000	0.69458	0.533000	0.62120	AGG		0.443	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756		3	116	0	0	0	0.004672	0	3	116				
NR1H3	10062	broad.mit.edu	37	11	47282972	47282972	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:47282972G>T	ENST00000467728.1	+	4	1918	c.680G>T	c.(679-681)cGc>cTc	p.R227L	NR1H3_ENST00000441012.2_Missense_Mutation_p.R227L|NR1H3_ENST00000405576.1_Missense_Mutation_p.R182L|NR1H3_ENST00000407404.1_Missense_Mutation_p.R227L|NR1H3_ENST00000527949.1_Missense_Mutation_p.R136L|NR1H3_ENST00000395397.3_Missense_Mutation_p.R182L|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000405853.3_Missense_Mutation_p.R227L|NR1H3_ENST00000481889.2_Missense_Mutation_p.R182L			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	227	Ligand-binding. {ECO:0000255}.				apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R227L(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						TGTAACCGGCGCTCCTTTTCT	0.617																																							uc009ylm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(679-681)CGC>CTC		nuclear receptor subfamily 1, group H, member 3							55.0	53.0	54.0					11																	47282972		2201	4298	6499	SO:0001583	missense	10062				apoptotic cell clearance|cellular response to lipopolysaccharide|cholesterol homeostasis|negative regulation of cholesterol storage|negative regulation of inflammatory response|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of macrophage activation|negative regulation of pancreatic juice secretion|negative regulation of pinocytosis|negative regulation of secretion of lysosomal enzymes|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of cholesterol homeostasis|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor biosynthetic process|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of circadian rhythm|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to progesterone stimulus|triglyceride homeostasis	nuclear chromatin|nucleoplasm	cholesterol binding|steroid hormone receptor activity|sterol response element binding|transcription coactivator activity|zinc ion binding	g.chr11:47282972G>T	U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.680G>T	11.37:g.47282972G>T	ENSP00000420656:p.Arg227Leu					NR1H3_uc009yll.1_Missense_Mutation_p.R233L|NR1H3_uc010rhk.1_Missense_Mutation_p.R233L|NR1H3_uc001nek.2_Missense_Mutation_p.R182L|NR1H3_uc001nej.2_Missense_Mutation_p.R227L|NR1H3_uc001nel.2_Missense_Mutation_p.R182L|NR1H3_uc001nen.3_Missense_Mutation_p.R227L|NR1H3_uc001nem.2_Missense_Mutation_p.R227L|NR1H3_uc001nep.2_Missense_Mutation_p.R136L	p.R227L	NM_005693	NP_005684	Q13133	NR1H3_HUMAN			5	901	+			227			Ligand-binding (Potential).		A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	37	c.680G>T	CCDS7929.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279064	0.80692	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000531660;ENST00000407404;ENST00000441012;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;T;D;D;D;D;D	0.94650	-3.48;-3.15;-3.02;-0.1;-3.2;-3.48;-3.48;-3.2;-3.35	5.35	5.35	0.76521	Nuclear hormone receptor, ligand-binding (2);	0.151883	0.56097	D	0.000021	D	0.96839	0.8968	M	0.72894	2.215	0.33364	D	0.572727	B;D;B;P;P	0.61697	0.002;0.99;0.041;0.631;0.612	B;D;B;B;P	0.64506	0.001;0.926;0.007;0.13;0.468	D	0.98225	1.0480	10	0.66056	D	0.02	.	19.9544	0.97215	0.0:0.0:1.0:0.0	.	233;182;227;182;227	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	L	182;182;182;93;227;227;227;227;136	ENSP00000378793:R182L;ENSP00000385073:R182L;ENSP00000433271:R182L;ENSP00000434650:R93L;ENSP00000385801:R227L;ENSP00000387946:R227L;ENSP00000420656:R227L;ENSP00000384745:R227L;ENSP00000432073:R136L	ENSP00000378793:R182L	R	+	2	0	NR1H3	47239548	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	9.380000	0.97202	2.885000	0.99019	0.655000	0.94253	CGC		0.617	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3			13	23	1	0	2.31682e-05	0.003163	2.7287e-05	13	23				
CELF1	10658	broad.mit.edu	37	11	47506016	47506016	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:47506016T>C	ENST00000358597.3	-	4	369	c.370A>G	c.(370-372)Atc>Gtc	p.I124V	CELF1_ENST00000310513.5_Missense_Mutation_p.I124V|CELF1_ENST00000361904.3_Missense_Mutation_p.I124V|AC090559.1_ENST00000578625.1_RNA|CELF1_ENST00000395290.2_Missense_Mutation_p.I123V|CELF1_ENST00000395292.2_Missense_Mutation_p.I124V|CELF1_ENST00000532048.1_Missense_Mutation_p.I150V|CELF1_ENST00000531165.1_Missense_Mutation_p.I151V			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	124	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)	p.I124V(1)		central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						ATGACTCGGATGTCATTTTCA	0.403																																					Pancreas(163;1949 1966 9906 43218 43785)	Pancreas(163;1949 1966 9906 43218 43785)	uc001nfl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(370-372)ATC>GTC		CUG triplet repeat, RNA-binding protein 1							97.0	99.0	98.0					11																	47506016		2201	4298	6499	SO:0001583	missense	10658				embryo development|mRNA splice site selection|regulation of RNA splicing|RNA interference	cytoplasm|nucleus|ribonucleoprotein complex	BRE binding|mRNA binding|nucleotide binding|translation repressor activity, nucleic acid binding	g.chr11:47506016T>C	U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.370A>G	11.37:g.47506016T>C	ENSP00000351409:p.Ile124Val					CELF1_uc001nfm.2_Missense_Mutation_p.I124V|CELF1_uc001nfn.2_Missense_Mutation_p.I124V|CELF1_uc001nfo.1_Missense_Mutation_p.I150V|CELF1_uc010rhm.1_Missense_Mutation_p.I123V|CELF1_uc001nfp.2_Missense_Mutation_p.I151V|CELF1_uc001nfq.1_Missense_Mutation_p.I124V|CELF1_uc001nfr.1_Missense_Mutation_p.I124V	p.I124V	NM_001025596	NP_001020767	Q92879	CELF1_HUMAN			4	380	-			124			RRM 2.		B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Missense_Mutation	SNP	ENST00000358597.3	37	c.370A>G	CCDS31482.1	.	.	.	.	.	.	.	.	.	.	T	7.687	0.690341	0.15039	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048	T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21	5.78	5.78	0.91487	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.08088	0.0202	N	0.04245	-0.25	0.80722	D	1	B;B;B;B;B;B	0.11235	0.0;0.001;0.004;0.001;0.0;0.001	B;B;B;B;B;B	0.12837	0.005;0.008;0.002;0.002;0.005;0.004	T	0.12656	-1.0539	10	0.02654	T	1	-14.878	16.1141	0.81289	0.0:0.0:0.0:1.0	.	123;151;150;124;124;124	F8W940;G5EA30;Q92879-4;Q92879-2;Q92879-3;Q92879	.;.;.;.;.;CELF1_HUMAN	V	123;124;124;124;124;151;150	ENSP00000378705:I123V;ENSP00000351409:I124V;ENSP00000378706:I124V;ENSP00000308386:I124V;ENSP00000354639:I124V;ENSP00000436864:I151V;ENSP00000435926:I150V	ENSP00000308386:I124V	I	-	1	0	CELF1	47462592	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.276000	0.51646	2.214000	0.71695	0.528000	0.53228	ATC		0.403	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398352.1	NM_006560		21	38	0	0	0	0.010504	0	21	38				
AGBL2	79841	broad.mit.edu	37	11	47712103	47712103	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:47712103C>T	ENST00000525123.1	-	10	1441	c.1156G>A	c.(1156-1158)Gac>Aac	p.D386N	AGBL2_ENST00000298861.4_Missense_Mutation_p.D386N|AGBL2_ENST00000357610.3_Missense_Mutation_p.D386N|AGBL2_ENST00000528244.1_Missense_Mutation_p.D348N|AGBL2_ENST00000529712.1_5'UTR	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	386						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.D386N(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						GTGTCCTGGTCATATGGAAAC	0.458																																							uc001ngg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1156-1158)GAC>AAC		carboxypeptidase 2, cytosolic							178.0	151.0	160.0					11																	47712103		2201	4298	6499	SO:0001583	missense	79841				proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding	g.chr11:47712103C>T		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1156G>A	11.37:g.47712103C>T	ENSP00000435582:p.Asp386Asn					AGBL2_uc001ngf.2_RNA|AGBL2_uc010rhq.1_Missense_Mutation_p.D348N|AGBL2_uc001ngh.1_Missense_Mutation_p.D330N	p.D386N	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN			9	1256	-			386					A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	c.1156G>A	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030549	0.75504	.	.	ENSG00000165923	ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244;ENST00000532595	T;T;T;T;T	0.17854	2.92;2.91;2.92;2.91;2.25	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.18551	0.0445	L	0.41573	1.285	0.49389	D	0.999783	P;B;B	0.40931	0.733;0.125;0.249	B;B;B	0.42692	0.395;0.119;0.119	T	0.01330	-1.1383	10	0.27785	T	0.31	-26.9135	14.3683	0.66820	0.0:0.9297:0.0:0.0703	.	348;348;386	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	N	386;386;386;348;330	ENSP00000435582:D386N;ENSP00000350228:D386N;ENSP00000298861:D386N;ENSP00000436630:D348N;ENSP00000436063:D330N	ENSP00000298861:D386N	D	-	1	0	AGBL2	47668679	0.997000	0.39634	0.986000	0.45419	0.994000	0.84299	3.678000	0.54627	2.785000	0.95823	0.655000	0.94253	GAC		0.458	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783		25	47	0	0	0	0.003954	0	25	47				
OR4C46	119749	broad.mit.edu	37	11	51516184	51516184	+	Silent	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:51516184T>C	ENST00000328188.1	+	1	903	c.903T>C	c.(901-903)agT>agC	p.S301S		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S301S(1)		endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						AATTGTGTAGTAGAAAGGACA	0.358																																							uc010ric.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(901-903)AGT>AGC		olfactory receptor, family 4, subfamily C,							44.0	39.0	41.0					11																	51516184		2198	4285	6483	SO:0001819	synonymous_variant	119749				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51516184T>C		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.903T>C	11.37:g.51516184T>C							p.S301S	NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN			1	903	+			301			Cytoplasmic (Potential).			Silent	SNP	ENST00000328188.1	37	c.903T>C	CCDS31498.1																																																																																				0.358	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		16	22	0	0	0	0.00499	0	16	22				
OR5D14	219436	broad.mit.edu	37	11	55563359	55563359	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:55563359G>T	ENST00000335605.1	+	1	328	c.328G>T	c.(328-330)Gtg>Ttg	p.V110L		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V110L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CTGCACTGCTGTGGTGACAGA	0.488																																							uc010rim.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(328-330)GTG>TTG		olfactory receptor, family 5, subfamily D,							127.0	104.0	112.0					11																	55563359		2200	4296	6496	SO:0001583	missense	219436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55563359G>T	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.328G>T	11.37:g.55563359G>T	ENSP00000334456:p.Val110Leu						p.V110L	NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN			1	328	+		all_epithelial(135;0.196)	110			Helical; Name=3; (Potential).		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	37	c.328G>T	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	g	7.611	0.674741	0.14841	.	.	ENSG00000186113	ENST00000335605	T	0.01335	5.0	5.08	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.180691	0.26507	N	0.023993	T	0.01870	0.0059	L	0.52206	1.635	0.09310	N	1	B	0.23735	0.09	B	0.23852	0.049	T	0.42224	-0.9464	10	0.34782	T	0.22	-8.0028	8.2396	0.31652	0.0837:0.0:0.7607:0.1556	.	110	Q8NGL3	OR5DE_HUMAN	L	110	ENSP00000334456:V110L	ENSP00000334456:V110L	V	+	1	0	OR5D14	55319935	0.015000	0.18098	0.219000	0.23793	0.001000	0.01503	1.814000	0.38972	1.147000	0.42369	-0.148000	0.13756	GTG		0.488	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		16	21	1	0	3.45872e-05	0.004007	4.05857e-05	16	21				
OR8H2	390151	broad.mit.edu	37	11	55873241	55873241	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:55873241C>A	ENST00000313503.1	+	1	723	c.723C>A	c.(721-723)tgC>tgA	p.C241*		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C241*(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					TCTCTACTTGCGTCTCTCATC	0.378										HNSCC(53;0.14)																													uc010riy.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(721-723)TGC>TGA		olfactory receptor, family 8, subfamily H,							103.0	101.0	102.0					11																	55873241		2201	4296	6497	SO:0001587	stop_gained	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55873241C>A	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.723C>A	11.37:g.55873241C>A	ENSP00000323982:p.Cys241*	HNSCC(53;0.14)					p.C241*	NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN			1	723	+	Esophageal squamous(21;0.00693)		241			Helical; Name=6; (Potential).		Q6IFC1	Nonsense_Mutation	SNP	ENST00000313503.1	37	c.723C>A	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	c	5.141	0.211540	0.09757	.	.	ENSG00000181767	ENST00000313503	.	.	.	3.58	2.28	0.28536	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4983	0.27503	0.0:0.2756:0.0:0.7244	.	.	.	.	X	241	.	ENSP00000323982:C241X	C	+	3	2	OR8H2	55629817	0.006000	0.16342	0.358000	0.25811	0.111000	0.19643	0.054000	0.14205	0.517000	0.28361	-0.760000	0.03462	TGC		0.378	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		20	41	1	0	1.90627e-21	0.001882	3.38655e-21	20	41				
OR8J3	81168	broad.mit.edu	37	11	55904269	55904269	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:55904269C>A	ENST00000301529.1	-	1	925	c.926G>T	c.(925-927)tGt>tTt	p.C309F		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C309F(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					AAAGGAGTAACATGGATTTTC	0.313																																							uc010riz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(925-927)TGT>TTT		olfactory receptor, family 8, subfamily J,							57.0	58.0	58.0					11																	55904269		2200	4295	6495	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904269C>A		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.926G>T	11.37:g.55904269C>A	ENSP00000301529:p.Cys309Phe						p.C309F	NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN			1	926	-	Esophageal squamous(21;0.00693)		309			Cytoplasmic (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.926G>T	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	C	6.183	0.402001	0.11696	.	.	ENSG00000167822	ENST00000301529	T	0.37058	1.22	3.27	2.23	0.28157	.	0.662303	0.15426	N	0.262939	T	0.22282	0.0537	L	0.34521	1.04	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.19582	-1.0301	10	0.09590	T	0.72	.	8.6695	0.34140	0.3859:0.6141:0.0:0.0	.	309	Q8NGG0	OR8J3_HUMAN	F	309	ENSP00000301529:C309F	ENSP00000301529:C309F	C	-	2	0	OR8J3	55660845	0.000000	0.05858	0.004000	0.12327	0.066000	0.16364	-0.571000	0.05889	1.553000	0.49476	0.297000	0.19635	TGT		0.313	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		17	37	1	0	8.10497e-08	0.010504	1.03509e-07	17	37				
OR5T3	390154	broad.mit.edu	37	11	56020158	56020158	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:56020158G>A	ENST00000303059.3	+	1	483	c.483G>A	c.(481-483)ctG>ctA	p.L161L		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L161L(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					ACCCTCTCCTGTATTCAGTGA	0.413																																							uc010rjd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(481-483)CTG>CTA		olfactory receptor, family 5, subfamily T,							219.0	201.0	207.0					11																	56020158		2201	4295	6496	SO:0001819	synonymous_variant	390154				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56020158G>A	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.483G>A	11.37:g.56020158G>A							p.L161L	NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN			1	483	+	Esophageal squamous(21;0.00448)		161			Cytoplasmic (Potential).		Q6IFC7	Silent	SNP	ENST00000303059.3	37	c.483G>A	CCDS31524.1																																																																																				0.413	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747		22	127	0	0	0	0.002299	0	22	127				
EHD1	10938	broad.mit.edu	37	11	64622062	64622062	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:64622062C>T	ENST00000320631.3	-	5	1602	c.1348G>A	c.(1348-1350)Gag>Aag	p.E450K	EHD1_ENST00000359393.2_Missense_Mutation_p.E450K|EHD1_ENST00000488711.1_5'UTR	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	450	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)	p.E450K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						TAGAAGATCTCGTCGTAGGTG	0.637																																							uc001obu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1348-1350)GAG>AAG		EH-domain containing 1							192.0	156.0	168.0					11																	64622062		2201	4297	6498	SO:0001583	missense	10938				blood coagulation|cholesterol homeostasis|endocytic recycling|intracellular protein transport|low-density lipoprotein particle clearance|positive regulation of cholesterol storage|protein homooligomerization	early endosome membrane|lipid particle|plasma membrane|platelet dense tubular network membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|protein binding	g.chr11:64622062C>T	AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.1348G>A	11.37:g.64622062C>T	ENSP00000320516:p.Glu450Lys					EHD1_uc001obt.1_Missense_Mutation_p.E133K|EHD1_uc001obv.1_Missense_Mutation_p.E450K|EHD1_uc010rnq.1_Missense_Mutation_p.E464K	p.E450K	NM_006795	NP_006786	Q9H4M9	EHD1_HUMAN			5	1603	-			450			EH.		O14611|Q2M3Q4|Q9UNR3	Missense_Mutation	SNP	ENST00000320631.3	37	c.1348G>A	CCDS8084.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453174	0.63290	.	.	ENSG00000110047	ENST00000320631;ENST00000359393;ENST00000541001	T;T	0.34072	1.38;1.38	4.53	4.53	0.55603	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	N	0.22421	0.69	0.80722	D	1	P;P	0.37548	0.599;0.599	B;B	0.24006	0.05;0.05	T	0.07309	-1.0779	10	0.36615	T	0.2	.	14.7985	0.69894	0.0:1.0:0.0:0.0	.	450;450	B2R5U3;Q9H4M9	.;EHD1_HUMAN	K	450;450;426	ENSP00000320516:E450K;ENSP00000352354:E450K	ENSP00000320516:E450K	E	-	1	0	EHD1	64378638	1.000000	0.71417	0.997000	0.53966	0.906000	0.53458	7.576000	0.82467	2.355000	0.79922	0.561000	0.74099	GAG		0.637	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143229.2	NM_006795		19	32	0	0	0	0.010504	0	19	32				
RHOD	29984	broad.mit.edu	37	11	66833438	66833438	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:66833438C>T	ENST00000308831.2	+	2	289	c.204C>T	c.(202-204)caC>caT	p.H68H	RHOD_ENST00000533360.1_Silent_p.H68H|RHOD_ENST00000532559.1_Intron	NM_014578.3	NP_055393	O00212	RHOD_HUMAN	ras homolog family member D	68					actin filament bundle assembly (GO:0051017)|focal adhesion assembly (GO:0048041)|GTP catabolic process (GO:0006184)|lamellipodium assembly (GO:0030032)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.H68H(1)		lung(3)	3						TGCACCTCCACATCTGGGACA	0.622																																							uc001ojv.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(202-204)CAC>CAT		ras homolog D precursor							65.0	54.0	58.0					11																	66833438		2200	4295	6495	SO:0001819	synonymous_variant	29984				regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity	g.chr11:66833438C>T	D85815	CCDS8155.1, CCDS73330.1	11q14.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000173156	ENSG00000173156			670	protein-coding gene	gene with protein product	"""Rho-related protein HP1"", ""Rho-related GTP-binding protein RhoD"""	605781	"""ras homolog gene family, member D"""	ARHD		9116026	Standard	NM_014578		Approved	RhoHP1, RhoD, Rho	uc001ojv.3	O00212	OTTHUMG00000167102	ENST00000308831.2:c.204C>T	11.37:g.66833438C>T							p.H68H	NM_014578	NP_055393	O00212	RHOD_HUMAN			2	289	+			68						Silent	SNP	ENST00000308831.2	37	c.204C>T	CCDS8155.1																																																																																				0.622	RHOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393136.1	NM_014578		6	6	0	0	0	0.001168	0	6	6				
GSTP1	2950	broad.mit.edu	37	11	67353590	67353590	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:67353590G>T	ENST00000398606.3	+	6	601	c.352G>T	c.(352-354)Gac>Tac	p.D118Y	GSTP1_ENST00000498765.1_3'UTR|GSTP1_ENST00000398603.1_Intron	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	118	GST C-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)	p.D118Y(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	GGGCAAGGATGACTATGTGAA	0.597																																							uc001omf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(352-354)GAC>TAC		glutathione transferase	Ethacrynic acid(DB00903)|Glutathione(DB00143)						50.0	54.0	53.0					11																	67353590		2099	4213	6312	SO:0001583	missense	2950				anti-apoptosis|cellular response to lipopolysaccharide|central nervous system development|common myeloid progenitor cell proliferation|glutathione metabolic process|negative regulation of acute inflammatory response|negative regulation of ERK1 and ERK2 cascade|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 beta production|negative regulation of JUN kinase activity|negative regulation of leukocyte proliferation|negative regulation of monocyte chemotactic protein-1 production|negative regulation of necrotic cell death|negative regulation of nitric-oxide synthase 2 biosynthetic process|negative regulation of stress-activated MAPK cascade|negative regulation of tumor necrosis factor production|nitric oxide storage|positive regulation of superoxide anion generation|response to reactive oxygen species|xenobiotic metabolic process	cytosol|protein complex	dinitrosyl-iron complex binding|glutathione transferase activity|JUN kinase binding|kinase regulator activity|nitric oxide binding|S-nitrosoglutathione binding	g.chr11:67353590G>T	U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.352G>T	11.37:g.67353590G>T	ENSP00000381607:p.Asp118Tyr					GSTP1_uc001omg.1_Missense_Mutation_p.D99Y	p.D118Y	NM_000852	NP_000843	P09211	GSTP1_HUMAN			6	601	+			118			GST C-terminal.		O00460|Q15690|Q5TZY3	Missense_Mutation	SNP	ENST00000398606.3	37	c.352G>T	CCDS41679.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.910684	0.33721	.	.	ENSG00000084207	ENST00000398606	T	0.01998	4.51	5.3	1.17	0.20885	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.906641	0.09310	N	0.819729	T	0.04861	0.0131	M	0.70842	2.15	0.34849	D	0.741519	P	0.43750	0.816	P	0.46110	0.504	T	0.27606	-1.0069	9	0.66056	D	0.02	-8.0603	4.2755	0.10806	0.3146:0.2245:0.4609:0.0	.	118	P09211	GSTP1_HUMAN	Y	118	ENSP00000381607:D118Y	ENSP00000381607:D118Y	D	+	1	0	GSTP1	67110166	0.009000	0.17119	0.001000	0.08648	0.547000	0.35210	0.170000	0.16663	0.239000	0.21243	0.563000	0.77884	GAC		0.597	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852		5	6	1	0	0.000602214	0.000602	0.000668426	5	6				
PANX1	24145	broad.mit.edu	37	11	93912816	93912816	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:93912816G>T	ENST00000227638.3	+	4	979	c.594G>T	c.(592-594)caG>caT	p.Q198H	PANX1_ENST00000436171.2_Missense_Mutation_p.Q198H	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	198					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)	p.Q198H(1)		endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	TTGTGGAGCAGTACTTGAAGA	0.368																																							uc001per.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(592-594)CAG>CAT		pannexin 1							43.0	44.0	43.0					11																	93912816		2201	4298	6499	SO:0001583	missense	24145				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding	g.chr11:93912816G>T	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.594G>T	11.37:g.93912816G>T	ENSP00000227638:p.Gln198His					PANX1_uc001peq.2_Missense_Mutation_p.Q198H	p.Q198H	NM_015368	NP_056183	Q96RD7	PANX1_HUMAN			4	979	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	198			Cytoplasmic (Potential).		O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	37	c.594G>T	CCDS8296.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116369	0.56505	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.19250	2.17;2.16	5.95	3.11	0.35812	.	0.153187	0.64402	D	0.000012	T	0.25232	0.0613	M	0.64260	1.97	0.52501	D	0.999952	P;P	0.42409	0.779;0.738	B;B	0.43658	0.426;0.3	T	0.01363	-1.1374	10	0.45353	T	0.12	-31.6049	10.0255	0.42068	0.2677:0.0:0.7323:0.0	.	198;198	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	H	198	ENSP00000227638:Q198H;ENSP00000411461:Q198H	ENSP00000227638:Q198H	Q	+	3	2	PANX1	93552464	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.211000	0.42825	0.428000	0.26173	-0.150000	0.13652	CAG		0.368	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368		7	13	1	0	1.06961e-07	0.00308	1.36327e-07	7	13				
MMP10	4319	broad.mit.edu	37	11	102647152	102647152	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:102647152G>T	ENST00000279441.4	-	6	827	c.791C>A	c.(790-792)cCt>cAt	p.P264H		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	264					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P264H(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	GGCAGGGGGAGGTCCTAAAGG	0.473																																							uc001phg.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(790-792)CCT>CAT		matrix metalloproteinase 10 preproprotein							61.0	60.0	60.0					11																	102647152		2203	4299	6502	SO:0001583	missense	4319				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102647152G>T	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.791C>A	11.37:g.102647152G>T	ENSP00000279441:p.Pro264His						p.P264H	NM_002425	NP_002416	P09238	MMP10_HUMAN	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	6	813	-	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	264					B2R9X9|Q53HH9	Missense_Mutation	SNP	ENST00000279441.4	37	c.791C>A	CCDS8321.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760432	0.31137	.	.	ENSG00000166670	ENST00000279441	T	0.19250	2.16	4.27	-1.34	0.09143	Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	1.037710	0.07652	N	0.932085	T	0.10594	0.0259	N	0.08118	0	0.09310	N	1	B	0.27450	0.179	B	0.30716	0.119	T	0.38045	-0.9679	10	0.87932	D	0	.	4.7943	0.13265	0.2944:0.0:0.4698:0.2357	.	264	P09238	MMP10_HUMAN	H	264	ENSP00000279441:P264H	ENSP00000279441:P264H	P	-	2	0	MMP10	102152362	0.051000	0.20477	0.000000	0.03702	0.349000	0.29174	2.006000	0.40874	-0.055000	0.13244	-0.809000	0.03173	CCT		0.473	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398014.1			11	21	1	0	2.27111e-07	0.001368	2.84897e-07	11	21				
DSCAML1	57453	broad.mit.edu	37	11	117392117	117392117	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:117392117G>A	ENST00000321322.6	-	6	1122	c.1121C>T	c.(1120-1122)cCc>cTc	p.P374L	DSCAML1_ENST00000527706.1_Missense_Mutation_p.P104L	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	314	Ig-like C2-type 4.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.P374L(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CACATGAAGGGGATCTGGGCC	0.592																																							uc001prh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1120-1122)CCC>CTC		Down syndrome cell adhesion molecule like 1							24.0	25.0	25.0					11																	117392117		2201	4296	6497	SO:0001583	missense	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117392117G>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1121C>T	11.37:g.117392117G>A	ENSP00000315465:p.Pro374Leu					DSCAML1_uc001pri.1_Missense_Mutation_p.P178L	p.P374L	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	6	1123	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	314			Extracellular (Potential).|Ig-like C2-type 4.		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	c.1121C>T	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074196	0.76415	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.34859	1.34;1.46	4.65	4.65	0.58169	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70072	0.3182	H	0.94808	3.585	0.80722	D	1	D;P	0.62365	0.991;0.908	D;P	0.66847	0.947;0.642	T	0.80659	-0.1284	9	0.87932	D	0	.	17.707	0.88311	0.0:0.0:1.0:0.0	.	104;314	G3V1B5;Q8TD84	.;DSCL1_HUMAN	L	104;374;81	ENSP00000434335:P104L;ENSP00000315465:P374L	ENSP00000315465:P374L	P	-	2	0	DSCAML1	116897327	1.000000	0.71417	0.980000	0.43619	0.705000	0.40729	9.541000	0.98083	2.415000	0.81967	0.609000	0.83330	CCC		0.592	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		9	10	0	0	0	0.000978	0	9	10				
PIK3C2G	5288	broad.mit.edu	37	12	18719923	18719923	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:18719923C>T	ENST00000266497.5	+	27	3858	c.3820C>T	c.(3820-3822)Cac>Tac	p.H1274Y	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.H1315Y|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.H1274Y			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1274	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.H1274Y(1)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AAATTCAGATCACAGAAGATT	0.284																																							uc001rdt.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21						c.(3820-3822)CAC>TAC		phosphoinositide-3-kinase, class 2 gamma							91.0	90.0	91.0					12																	18719923		1823	4073	5896	SO:0001583	missense	5288				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity	g.chr12:18719923C>T	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3820C>T	12.37:g.18719923C>T	ENSP00000266497:p.His1274Tyr					PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.H1315Y|PIK3C2G_uc010sic.1_Missense_Mutation_p.H1093Y	p.H1274Y	NM_004570	NP_004561	O75747	P3C2G_HUMAN			28	3936	+		Hepatocellular(102;0.194)	1274			PX.		A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	c.3820C>T	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104011	0.37145	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.38887	1.11;1.11;1.11	4.01	3.11	0.35812	Phox homologous domain (5);	0.000000	0.56097	D	0.000022	T	0.50446	0.1616	L	0.34521	1.04	0.33181	D	0.549585	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.83275	0.996;0.994;0.996	T	0.63060	-0.6721	10	0.72032	D	0.01	-6.0305	11.2794	0.49186	0.1833:0.8167:0.0:0.0	.	1314;1315;1274	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	Y	1274;1274;1315	ENSP00000404845:H1274Y;ENSP00000266497:H1274Y;ENSP00000445381:H1315Y	ENSP00000266497:H1274Y	H	+	1	0	PIK3C2G	18611190	0.999000	0.42202	0.986000	0.45419	0.433000	0.31745	1.927000	0.40094	1.244000	0.43870	-0.181000	0.13052	CAC		0.284	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570		14	26	0	0	0	0.00499	0	14	26				
SLCO1C1	53919	broad.mit.edu	37	12	20870080	20870080	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:20870080G>T	ENST00000266509.2	+	7	1059	c.691G>T	c.(691-693)Gtt>Ttt	p.V231F	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.V231F|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.V113F|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.V182F|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.V231F	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	231					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.V231F(2)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TGTGCAGACGGTTGCAATTAT	0.333																																							uc001rej.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|pancreas(1)|skin(1)	7						c.(691-693)GTT>TTT		solute carrier organic anion transporter family,							200.0	180.0	187.0					12																	20870080		2203	4300	6503	SO:0001583	missense	53919				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity	g.chr12:20870080G>T	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.691G>T	12.37:g.20870080G>T	ENSP00000266509:p.Val231Phe					SLCO1C1_uc010sii.1_Missense_Mutation_p.V231F|SLCO1C1_uc010sij.1_Missense_Mutation_p.V182F|SLCO1C1_uc009zip.2_Missense_Mutation_p.V65F|SLCO1C1_uc001rei.2_Missense_Mutation_p.V231F|SLCO1C1_uc010sik.1_Missense_Mutation_p.V113F	p.V231F	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN			8	1046	+	Esophageal squamous(101;0.149)		231			Cytoplasmic (Potential).		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	c.691G>T	CCDS8683.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331757	0.41297	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.80304	0.35;0.35;0.35;0.35;-1.36	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.253767	0.39020	N	0.001497	T	0.77922	0.4203	L	0.56769	1.78	0.31265	N	0.692485	P;B;B;B	0.35600	0.511;0.049;0.218;0.052	B;B;B;B	0.37387	0.18;0.248;0.125;0.111	T	0.80921	-0.1166	10	0.49607	T	0.09	.	11.8709	0.52519	0.0:0.131:0.7331:0.1359	.	113;182;231;231	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	F	231;182;231;231;113	ENSP00000444149:V231F;ENSP00000438665:V182F;ENSP00000266509:V231F;ENSP00000370964:V231F;ENSP00000444527:V113F	ENSP00000266509:V231F	V	+	1	0	SLCO1C1	20761347	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.393000	0.52544	2.725000	0.93324	0.591000	0.81541	GTT		0.333	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435		13	26	1	0	0.000308642	0.003163	0.000346813	13	26				
SLCO1C1	53919	broad.mit.edu	37	12	20896250	20896250	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:20896250C>A	ENST00000266509.2	+	13	2113	c.1745C>A	c.(1744-1746)cCa>cAa	p.P582Q	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.P582Q|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.P464Q|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.P533Q|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.P582Q	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	582					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.P582Q(2)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TGCATTAAGCCACAGCTTAAG	0.323																																							uc001rej.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|pancreas(1)|skin(1)	7						c.(1744-1746)CCA>CAA		solute carrier organic anion transporter family,							226.0	223.0	224.0					12																	20896250		2202	4300	6502	SO:0001583	missense	53919				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity	g.chr12:20896250C>A	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1745C>A	12.37:g.20896250C>A	ENSP00000266509:p.Pro582Gln					SLCO1C1_uc010sii.1_Missense_Mutation_p.P582Q|SLCO1C1_uc010sij.1_Missense_Mutation_p.P533Q|SLCO1C1_uc009zip.2_Missense_Mutation_p.P416Q|SLCO1C1_uc001rei.2_Missense_Mutation_p.P582Q|SLCO1C1_uc010sik.1_Missense_Mutation_p.P464Q	p.P582Q	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN			14	2100	+	Esophageal squamous(101;0.149)		582			Cytoplasmic (Potential).		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	c.1745C>A	CCDS8683.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656226	0.47467	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13	4.98	4.98	0.66077	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.62221	0.2410	M	0.66297	2.02	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.998;0.989;0.989	D;D;D;D	0.73380	0.967;0.98;0.955;0.945	T	0.60865	-0.7178	10	0.41790	T	0.15	.	16.6073	0.84834	0.0:1.0:0.0:0.0	.	464;533;582;582	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	Q	582;533;582;582;464	ENSP00000444149:P582Q;ENSP00000438665:P533Q;ENSP00000266509:P582Q;ENSP00000370964:P582Q;ENSP00000444527:P464Q	ENSP00000266509:P582Q	P	+	2	0	SLCO1C1	20787517	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	6.407000	0.73280	2.590000	0.87494	0.650000	0.86243	CCA		0.323	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435		47	72	1	0	1.61004e-24	0.00361	2.94248e-24	47	72				
C12orf77	196415	broad.mit.edu	37	12	25148752	25148752	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:25148752C>T	ENST00000549828.1	-	3	600	c.396G>A	c.(394-396)ggG>ggA	p.G132G	C12orf77_ENST00000549262.1_Silent_p.G77G|C12orf77_ENST00000434912.3_Silent_p.G77G	NM_001101339.1	NP_001094809.1	C9JDV5	CL097_HUMAN	chromosome 12 open reading frame 77	132								p.G132G(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7						TGCAGTATATCCCCAACAGGA	0.418																																							uc001rgf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(394-396)GGG>GGA		hypothetical protein LOC196415							48.0	47.0	48.0					12																	25148752		1827	4083	5910	SO:0001819	synonymous_variant	196415							g.chr12:25148752C>T	BC046192	CCDS44846.1	12p12.1	2009-09-30			ENSG00000226397	ENSG00000226397			27282	protein-coding gene	gene with protein product						12477932	Standard	NM_001101339		Approved		uc001rgf.3	C9JDV5	OTTHUMG00000170185	ENST00000549828.1:c.396G>A	12.37:g.25148752C>T							p.G132G	NM_001101339	NP_001094809	C9JDV5	CL097_HUMAN			3	601	-			132						Silent	SNP	ENST00000549828.1	37	c.396G>A	CCDS44846.1																																																																																				0.418	C12orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407827.1	NM_001101339		5	12	0	0	0	0.001984	0	5	12				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		8	11	1	0	0.00307968	0.00308	0.00331979	8	11				
ADAMTS20	80070	broad.mit.edu	37	12	43858522	43858522	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:43858522C>A	ENST00000389420.3	-	10	1380	c.1381G>T	c.(1381-1383)Gaa>Taa	p.E461*	ADAMTS20_ENST00000553158.1_Nonsense_Mutation_p.E461*	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	461	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E461*(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AGAAGACATTCCCCGTAACCA	0.363																																							uc010skx.1		NA																	2	Substitution - Nonsense(2)		lung(2)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(1381-1383)GAA>TAA		a disintegrin-like and metalloprotease with							74.0	68.0	70.0					12																	43858522		2203	4300	6503	SO:0001587	stop_gained	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43858522C>A	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1381G>T	12.37:g.43858522C>A	ENSP00000374071:p.Glu461*						p.E461*	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	10	1381	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	461			Peptidase M12B.		A6NNC9|J3QT00	Nonsense_Mutation	SNP	ENST00000389420.3	37	c.1381G>T	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	31	5.067657	0.93898	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	.	.	.	4.74	4.74	0.60224	.	0.121832	0.36101	N	0.002784	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	18.6147	0.91299	0.0:1.0:0.0:0.0	.	.	.	.	X	461	.	ENSP00000374068:E461X	E	-	1	0	ADAMTS20	42144789	1.000000	0.71417	0.996000	0.52242	0.367000	0.29736	7.424000	0.80242	2.559000	0.86315	0.586000	0.80456	GAA		0.363	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		10	17	1	0	1.76689e-08	0.006214	2.30275e-08	10	17				
SCAF11	9169	broad.mit.edu	37	12	46342248	46342248	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:46342248A>C	ENST00000369367.3	-	5	603	c.370T>G	c.(370-372)Tgt>Ggt	p.C124G	SCAF11_ENST00000419565.2_Missense_Mutation_p.C124G	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	124					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C124G(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						TTTTCATGACAGGAGACCTGT	0.308																																							uc001rox.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)TGT>GGT		splicing factor, arginine/serine-rich 2,							137.0	122.0	126.0					12																	46342248		1799	4071	5870	SO:0001583	missense	9169				spliceosome assembly	nucleus	protein binding|zinc ion binding	g.chr12:46342248A>C	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.370T>G	12.37:g.46342248A>C	ENSP00000358374:p.Cys124Gly					SFRS2IP_uc001roy.1_Missense_Mutation_p.C198G	p.C124G	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)	5	657	-	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	124					A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	c.370T>G	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	A	9.754	1.168347	0.21621	.	.	ENSG00000139218	ENST00000369367;ENST00000419565;ENST00000547018	T;T;T	0.47528	0.84;0.84;0.84	5.55	4.39	0.52855	.	1.154450	0.06752	U	0.780187	T	0.33000	0.0848	N	0.19112	0.55	0.25407	N	0.988398	B	0.24675	0.109	B	0.20767	0.031	T	0.13335	-1.0513	10	0.22706	T	0.39	-0.0234	8.5043	0.33177	0.9097:0.0:0.0903:0.0	.	124	Q99590	SCAFB_HUMAN	G	124;124;64	ENSP00000358374:C124G;ENSP00000413036:C124G;ENSP00000446746:C64G	ENSP00000358374:C124G	C	-	1	0	SCAF11	44628515	0.962000	0.33011	0.996000	0.52242	0.440000	0.31957	2.035000	0.41155	2.098000	0.63641	0.460000	0.39030	TGT		0.308	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719		14	22	0	0	0	0.004007	0	14	22				
PRPF40B	25766	broad.mit.edu	37	12	50037160	50037160	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:50037160C>T	ENST00000380281.1	+	22	2361	c.2297C>T	c.(2296-2298)tCc>tTc	p.S766F	FMNL3_ENST00000335154.5_3'UTR|PRPF40B_ENST00000261897.1_Missense_Mutation_p.S753F|PRPF40B_ENST00000548825.2_Missense_Mutation_p.S787F			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	766					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.S766F(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						GGCTCCCCTTCCTCCCATCTT	0.592																																							uc001rur.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						c.(2296-2298)TCC>TTC		Huntingtin interacting protein C isoform 1							77.0	79.0	79.0					12																	50037160		2203	4300	6503	SO:0001583	missense	25766				mRNA processing|RNA splicing	nuclear speck		g.chr12:50037160C>T	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.2297C>T	12.37:g.50037160C>T	ENSP00000369634:p.Ser766Phe					FMNL3_uc001ruv.1_3'UTR|FMNL3_uc001ruw.1_3'UTR|PRPF40B_uc001rup.1_Missense_Mutation_p.S787F|PRPF40B_uc001ruq.1_Missense_Mutation_p.S753F|PRPF40B_uc001rus.1_Missense_Mutation_p.S708F|FMNL3_uc001rut.1_3'UTR|FMNL3_uc001ruu.1_3'UTR	p.S766F	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN			22	2361	+			766					O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Missense_Mutation	SNP	ENST00000380281.1	37	c.2297C>T		.	.	.	.	.	.	.	.	.	.	C	20.4	3.979415	0.74360	.	.	ENSG00000110844	ENST00000261897;ENST00000380281	T;T	0.24350	1.86;1.86	5.28	4.37	0.52481	.	0.113531	0.40064	N	0.001195	T	0.09686	0.0238	N	0.02011	-0.69	0.80722	D	1	B;B;B	0.14805	0.006;0.011;0.004	B;B;B	0.12156	0.003;0.007;0.007	T	0.08207	-1.0733	10	0.59425	D	0.04	-20.037	7.4568	0.27272	0.0:0.8308:0.0:0.1692	.	766;753;765	Q6NWY9;Q6NWY9-2;Q6NWY9-3	PR40B_HUMAN;.;.	F	753;766	ENSP00000261897:S753F;ENSP00000369634:S766F	ENSP00000261897:S753F	S	+	2	0	PRPF40B	48323427	0.870000	0.30015	1.000000	0.80357	0.984000	0.73092	1.622000	0.36997	2.649000	0.89929	0.561000	0.74099	TCC		0.592	PRPF40B-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000404838.1	NM_012272		30	38	0	0	0	0.009535	0	30	38				
KRT71	112802	broad.mit.edu	37	12	52941958	52941958	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:52941958G>T	ENST00000267119.5	-	5	1025	c.956C>A	c.(955-957)gCt>gAt	p.A319D		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	319	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.A319D(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		CAGGGCCTCAGCCTCGGCCTT	0.577																																							uc001sao.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(955-957)GCT>GAT		keratin 71							138.0	111.0	120.0					12																	52941958		2203	4300	6503	SO:0001583	missense	112802						structural molecule activity	g.chr12:52941958G>T	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.956C>A	12.37:g.52941958G>T	ENSP00000267119:p.Ala319Asp						p.A319D	NM_033448	NP_258259	Q3SY84	K2C71_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.194)	5	1026	-			319			Coil 2.|Rod.		B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	37	c.956C>A	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025012	0.75390	.	.	ENSG00000139648	ENST00000267119	T	0.80480	-1.38	4.19	4.19	0.49359	Filament (1);	0.000000	0.44902	D	0.000412	D	0.93112	0.7807	H	0.98370	4.215	0.48632	D	0.999682	D	0.76494	0.999	D	0.72625	0.978	D	0.95019	0.8159	10	0.87932	D	0	.	12.9723	0.58520	0.0832:0.0:0.9168:0.0	.	319	Q3SY84	K2C71_HUMAN	D	319	ENSP00000267119:A319D	ENSP00000267119:A319D	A	-	2	0	KRT71	51228225	1.000000	0.71417	0.634000	0.29324	0.803000	0.45373	5.352000	0.66028	2.279000	0.76181	0.655000	0.94253	GCT		0.577	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1	NM_033448		6	35	1	0	0.00307968	0.00308	0.00331979	6	35				
HOXC13	3229	broad.mit.edu	37	12	54338921	54338921	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:54338921C>G	ENST00000243056.3	+	2	1030	c.874C>G	c.(874-876)Cgc>Ggc	p.R292G		NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	292					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.R292G(1)		breast(1)|large_intestine(1)|skin(1)	3						GAAGCGCCGGCGCATCTCCGC	0.582			T	NUP98	AML																																		uc001sei.2		NA		Dom	yes		12	12q13.3	3229	T	homeo box C13			L	NUP98		AML		1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(874-876)CGC>GGC		homeobox C13							65.0	72.0	70.0					12																	54338921		2203	4300	6503	SO:0001583	missense	3229					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54338921C>G		CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.874C>G	12.37:g.54338921C>G	ENSP00000243056:p.Arg292Gly					HOXC13_uc010sop.1_RNA	p.R292G	NM_017410	NP_059106	P31276	HXC13_HUMAN			2	989	+			292			Homeobox.		Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	ENST00000243056.3	37	c.874C>G	CCDS8865.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963580	0.74016	.	.	ENSG00000123364	ENST00000243056	D	0.96365	-3.99	4.95	4.95	0.65309	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96116	0.8734	L	0.39514	1.22	0.58432	D	0.999999	P	0.47545	0.897	P	0.58577	0.841	D	0.95827	0.8855	10	0.87932	D	0	.	12.5597	0.56273	0.1666:0.8334:0.0:0.0	.	292	P31276	HXC13_HUMAN	G	292	ENSP00000243056:R292G	ENSP00000243056:R292G	R	+	1	0	HOXC13	52625188	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.887000	0.39698	2.755000	0.94549	0.655000	0.94253	CGC		0.582	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358865.2			18	28	0	0	0	0.006122	0	18	28				
B4GALNT1	2583	broad.mit.edu	37	12	58024791	58024791	+	Silent	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:58024791A>T	ENST00000341156.4	-	4	1046	c.462T>A	c.(460-462)gtT>gtA	p.V154V	B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000418555.2_Silent_p.V99V|B4GALNT1_ENST00000550764.1_Silent_p.V154V|B4GALNT1_ENST00000552350.1_Silent_p.V154V|B4GALNT1_ENST00000449184.3_Silent_p.V154V	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	154					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)	p.V154V(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TGAGGGGCTGAACTTCCACAC	0.642																																							uc001spg.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(460-462)GTT>GTA		beta-1,4-N-acetyl-galactosaminyl transferase 1							40.0	41.0	40.0					12																	58024791		2203	4300	6503	SO:0001819	synonymous_variant	2583				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity	g.chr12:58024791A>T	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.462T>A	12.37:g.58024791A>T						B4GALNT1_uc010sru.1_Silent_p.V99V|B4GALNT1_uc010srv.1_Silent_p.V154V|B4GALNT1_uc001sph.2_Silent_p.V154V|B4GALNT1_uc001spi.2_Silent_p.V154V	p.V154V	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.109)		4	894	-	Melanoma(17;0.122)		154			Lumenal (Potential).		B4DE26|Q8N636	Silent	SNP	ENST00000341156.4	37	c.462T>A	CCDS8950.1																																																																																				0.642	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	NM_001478		13	21	0	0	0	0.00245	0	13	21				
BEST3	144453	broad.mit.edu	37	12	70049458	70049458	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:70049458G>T	ENST00000330891.5	-	10	1462	c.1236C>A	c.(1234-1236)agC>agA	p.S412R	BEST3_ENST00000331471.4_Intron|BEST3_ENST00000488961.1_Missense_Mutation_p.S199R|BEST3_ENST00000553096.1_Missense_Mutation_p.S306R	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	412					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.S199R(1)|p.S412R(1)		cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GCCTCCTGTAGCTTCTTCTTC	0.562																																							uc001svg.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1234-1236)AGC>AGA		vitelliform macular dystrophy 2-like 3 isoform							109.0	117.0	114.0					12																	70049458		2082	4215	6297	SO:0001583	missense	144453					chloride channel complex|plasma membrane	chloride channel activity	g.chr12:70049458G>T	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1236C>A	12.37:g.70049458G>T	ENSP00000332413:p.Ser412Arg					BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.S199R|BEST3_uc010stm.1_Missense_Mutation_p.S306R	p.S412R	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)		10	1463	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		412			Cytoplasmic (Potential).		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	c.1236C>A	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	G	1.546	-0.540553	0.04053	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.97831	-4.21;-4.56;-4.52	5.63	3.44	0.39384	.	0.781774	0.12561	N	0.458213	D	0.93736	0.7998	L	0.29908	0.895	0.25186	N	0.990161	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	D	0.84993	0.0895	10	0.14656	T	0.56	-4.1129	10.1756	0.42937	0.2346:0.0:0.7654:0.0	.	412;199	Q8N1M1;B5MDI8	BEST3_HUMAN;.	R	199;412;306	ENSP00000433213:S199R;ENSP00000332413:S412R;ENSP00000449548:S306R	ENSP00000332413:S412R	S	-	3	2	BEST3	68335725	0.535000	0.26370	0.224000	0.23877	0.017000	0.09413	0.759000	0.26461	1.338000	0.45544	0.655000	0.94253	AGC		0.562	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439		28	34	1	0	4.22769e-11	0.00632	6.15289e-11	28	34				
TRHDE	29953	broad.mit.edu	37	12	73056892	73056892	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:73056892G>C	ENST00000261180.4	+	19	3088	c.2992G>C	c.(2992-2994)Gaa>Caa	p.E998Q		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	998					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E998Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ACGAGCTGTGGAAACTGTCGA	0.388																																							uc001sxa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2992-2994)GAA>CAA		thyrotropin-releasing hormone degrading enzyme							63.0	65.0	64.0					12																	73056892		2203	4300	6503	SO:0001583	missense	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:73056892G>C	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2992G>C	12.37:g.73056892G>C	ENSP00000261180:p.Glu998Gln						p.E998Q	NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN			19	3022	+			998			Extracellular (Potential).		A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	c.2992G>C	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573918	0.86542	.	.	ENSG00000072657	ENST00000261180	T	0.06528	3.29	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.33933	0.0880	M	0.90542	3.125	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.31806	-0.9930	10	0.87932	D	0	.	19.4305	0.94762	0.0:0.0:1.0:0.0	.	998	Q9UKU6	TRHDE_HUMAN	Q	998	ENSP00000261180:E998Q	ENSP00000261180:E998Q	E	+	1	0	TRHDE	71343159	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.834000	0.92094	2.673000	0.90976	0.557000	0.71058	GAA		0.388	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		19	18	0	0	0	0.008871	0	19	18				
DCN	1634	broad.mit.edu	37	12	91539908	91539908	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:91539908T>A	ENST00000052754.5	-	8	1508	c.1007A>T	c.(1006-1008)tAc>tTc	p.Y336F	DCN_ENST00000441303.2_Missense_Mutation_p.Y149F|DCN_ENST00000547568.2_Missense_Mutation_p.Y189F|DCN_ENST00000393155.1_Missense_Mutation_p.Y336F|DCN_ENST00000420120.2_Missense_Mutation_p.Y227F|DCN_ENST00000228329.5_Missense_Mutation_p.Y227F|DCN_ENST00000303320.3_Missense_Mutation_p.Y149F|DCN_ENST00000425043.1_Missense_Mutation_p.Y189F|DCN_ENST00000552962.1_Missense_Mutation_p.Y336F	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	336					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)	p.Y336F(1)		central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						TATCTCCCAGTACTGGACCGG	0.448																																							uc001tbs.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|lung(1)	4						c.(1006-1008)TAC>TTC		decorin isoform a preproprotein							135.0	128.0	130.0					12																	91539908		2203	4300	6503	SO:0001583	missense	1634				organ morphogenesis	extracellular space		g.chr12:91539908T>A	AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.1007A>T	12.37:g.91539908T>A	ENSP00000052754:p.Tyr336Phe					DCN_uc001tbo.2_Missense_Mutation_p.Y227F|DCN_uc001tbp.2_Missense_Mutation_p.Y189F|DCN_uc001tbq.2_Missense_Mutation_p.Y149F|DCN_uc001tbr.2_3'UTR|DCN_uc001tbt.2_Missense_Mutation_p.Y336F|DCN_uc001tbu.2_Missense_Mutation_p.Y336F	p.Y336F	NM_133503	NP_598010	P07585	PGS2_HUMAN			7	1101	-			336			LRR 12.		Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Missense_Mutation	SNP	ENST00000052754.5	37	c.1007A>T	CCDS9039.1	.	.	.	.	.	.	.	.	.	.	T	31	5.098806	0.94197	.	.	ENSG00000011465	ENST00000052754;ENST00000228329;ENST00000303320;ENST00000393155;ENST00000425043;ENST00000552962;ENST00000420120;ENST00000441303;ENST00000547568	T;T;T;T;T;T;T;T;T	0.77620	3.63;3.63;-1.11;3.63;0.32;3.63;3.63;-1.11;0.32	5.86	5.86	0.93980	.	0.056933	0.64402	D	0.000001	D	0.84497	0.5485	M	0.81942	2.565	0.80722	D	1	P;P;P;P	0.49961	0.669;0.93;0.718;0.558	P;P;P;B	0.50617	0.637;0.603;0.646;0.374	D	0.86542	0.1829	10	0.62326	D	0.03	.	16.2479	0.82454	0.0:0.0:0.0:1.0	.	336;149;189;227	P07585;P07585-4;P07585-3;P07585-2	PGS2_HUMAN;.;.;.	F	336;227;149;336;189;336;227;149;189	ENSP00000052754:Y336F;ENSP00000228329:Y227F;ENSP00000302031:Y149F;ENSP00000376862:Y336F;ENSP00000401021:Y189F;ENSP00000447654:Y336F;ENSP00000413723:Y227F;ENSP00000399815:Y149F;ENSP00000447674:Y189F	ENSP00000052754:Y336F	Y	-	2	0	DCN	90064039	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.261000	0.72509	2.241000	0.73720	0.533000	0.62120	TAC		0.448	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507		5	45	0	0	0	0.000602	0	5	45				
NT5DC3	51559	broad.mit.edu	37	12	104190758	104190758	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:104190758C>A	ENST00000392876.3	-	6	707	c.667G>T	c.(667-669)Gag>Tag	p.E223*	NT5DC3_ENST00000465502.1_5'UTR	NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	223						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.E148*(1)|p.E223*(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						AGGGTCATCTCGGGCAGGGAG	0.498																																							uc010swe.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|skin(1)	3						c.(667-669)GAG>TAG		5'-nucleotidase domain containing 3							176.0	149.0	158.0					12																	104190758		2203	4300	6503	SO:0001587	stop_gained	51559						hydrolase activity|metal ion binding	g.chr12:104190758C>A	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.667G>T	12.37:g.104190758C>A	ENSP00000376615:p.Glu223*						p.E223*	NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN			6	708	-			223					Q9NUM7|Q9P2T2|Q9P2T3	Nonsense_Mutation	SNP	ENST00000392876.3	37	c.667G>T	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	C	36	5.950574	0.97139	.	.	ENSG00000111696	ENST00000392876	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-43.3913	19.6034	0.95572	0.0:1.0:0.0:0.0	.	.	.	.	X	223	.	ENSP00000376615:E223X	E	-	1	0	NT5DC3	102714888	1.000000	0.71417	0.959000	0.39883	0.990000	0.78478	7.432000	0.80349	2.637000	0.89404	0.561000	0.74099	GAG		0.498	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575		21	24	1	0	1.64113e-05	0.010504	1.94732e-05	21	24				
MAPKAPK5	8550	broad.mit.edu	37	12	112323739	112323739	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr12:112323739G>T	ENST00000551404.2	+	10	976	c.868G>T	c.(868-870)Gag>Tag	p.E290*	MAPKAPK5_ENST00000550735.2_Nonsense_Mutation_p.E290*			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	290	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.E290*(2)		endometrium(1)|lung(11)|ovary(1)	13						GGTCAAACCGGAGGAGAGACT	0.557																																							uc001tta.2		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(2)|ovary(1)	3						c.(868-870)GAG>TAG		MAP kinase-activated protein kinase 5 isoform 2							82.0	85.0	84.0					12																	112323739		1974	4166	6140	SO:0001587	stop_gained	8550				signal transduction	cytoplasm|nucleus	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity	g.chr12:112323739G>T	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.868G>T	12.37:g.112323739G>T	ENSP00000449381:p.Glu290*					MAPKAPK5_uc001tsz.2_Nonsense_Mutation_p.E290*|MAPKAPK5_uc001ttb.2_Nonsense_Mutation_p.E223*	p.E290*	NM_139078	NP_620777	Q8IW41	MAPK5_HUMAN			10	1127	+			290			Protein kinase.		B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Nonsense_Mutation	SNP	ENST00000551404.2	37	c.868G>T	CCDS44975.1	.	.	.	.	.	.	.	.	.	.	G	45	11.538129	0.99573	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000553053;ENST00000551404	.	.	.	5.76	4.88	0.63580	.	0.045450	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9092	0.70743	0.0686:0.0:0.9314:0.0	.	.	.	.	X	290;290;290;57;290	.	ENSP00000202788:E290X	E	+	1	0	MAPKAPK5	110808122	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.383000	0.97214	1.429000	0.47314	0.655000	0.94253	GAG		0.557	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078		13	9	1	0	2.27111e-07	0.001368	2.84897e-07	13	9				
AMER2	219287	broad.mit.edu	37	13	25744194	25744194	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:25744194C>A	ENST00000515384.1	-	1	2231	c.1564G>T	c.(1564-1566)Gag>Tag	p.E522*	AMER2_ENST00000357816.2_Nonsense_Mutation_p.E403*|AMER2_ENST00000381853.3_Nonsense_Mutation_p.E403*|AMER2-AS1_ENST00000413501.1_lincRNA			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	522					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E522*(1)|p.E403*(1)									CAGTAGCCCTCGTCGCTGTTG	0.662																																							uc001uqb.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|large_intestine(1)|lung(1)	4						c.(1564-1566)GAG>TAG		hypothetical protein LOC219287 isoform 1							68.0	64.0	65.0					13																	25744194		2203	4300	6503	SO:0001587	stop_gained	219287							g.chr13:25744194C>A	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1564G>T	13.37:g.25744194C>A	ENSP00000426528:p.Glu522*					FAM123A_uc001uqa.2_Nonsense_Mutation_p.E403*|FAM123A_uc001uqc.2_Nonsense_Mutation_p.E403*	p.E522*	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	1664	-		Lung SC(185;0.0225)|Breast(139;0.0602)	522					Q5RL80|Q5VX56|Q8N593|Q96NN5	Nonsense_Mutation	SNP	ENST00000515384.1	37	c.1564G>T	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	C	44	10.609722	0.99437	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	.	.	.	4.98	1.14	0.20703	.	0.173505	0.49916	D	0.000131	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-6.7672	10.0393	0.42148	0.0:0.5344:0.3925:0.073	.	.	.	.	X	403;403;522	.	ENSP00000350469:E403X	E	-	1	0	FAM123A	24642194	0.980000	0.34600	0.938000	0.37757	0.991000	0.79684	2.482000	0.45224	-0.001000	0.14495	0.561000	0.74099	GAG		0.662	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704		19	25	1	0	2.39556e-15	0.00278	3.88668e-15	19	25				
GPR12	2835	broad.mit.edu	37	13	27333191	27333191	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:27333191C>A	ENST00000381436.2	-	1	1236	c.774G>T	c.(772-774)ggG>ggT	p.G258G	GPR12_ENST00000405846.3_Silent_p.G258G			P47775	GPR12_HUMAN	G protein-coupled receptor 12	258					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.G258G(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		CAGCAAACGTCCCCAGGATGA	0.587																																							uc010aal.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(772-774)GGG>GGT		G protein-coupled receptor 12							88.0	83.0	85.0					13																	27333191		2203	4300	6503	SO:0001819	synonymous_variant	2835					integral to plasma membrane		g.chr13:27333191C>A	U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.774G>T	13.37:g.27333191C>A						GPR12_uc010tdl.1_Silent_p.G99G	p.G258G	NM_005288	NP_005279	P47775	GPR12_HUMAN		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)	2	996	-	Colorectal(5;5.77e-05)	Breast(139;0.198)	258			Helical; Name=6; (Potential).		Q5T8P3	Silent	SNP	ENST00000381436.2	37	c.774G>T	CCDS9319.1																																																																																				0.587	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2			12	14	1	0	3.07112e-06	0.000978	3.71337e-06	12	14				
POLR1D	51082	broad.mit.edu	37	13	28240074	28240074	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:28240074G>T	ENST00000399697.3	+	3	471	c.353G>T	c.(352-354)cGg>cTg	p.R118L	POLR1D_ENST00000465887.1_3'UTR	NM_001206559.1|NM_152705.2	NP_001193488.1|NP_689918.1	Q9Y2S0	RPAC2_HUMAN	polymerase (RNA) I polypeptide D, 16kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.R118L(1)		endometrium(1)|large_intestine(1)|lung(4)|stomach(2)	8		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0758)|OV - Ovarian serous cystadenocarcinoma(117;0.1)|Epithelial(112;0.213)		TACGAAAAGCGGTCCAACCGG	0.652																																							uc001urp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(352-354)CGG>CTG		polymerase (RNA) I polypeptide D isoform 2							53.0	58.0	56.0					13																	28240074		2200	4297	6497	SO:0001583	missense	51082				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity	g.chr13:28240074G>T	AF077044, BC018528	CCDS9324.1, CCDS9325.1, CCDS73555.1	13q12.2	2013-01-21			ENSG00000186184	ENSG00000186184		"""RNA polymerase subunits"""	20422	protein-coding gene	gene with protein product		613715				11042152, 12391170	Standard	NM_015972		Approved	RPAC2, RPA16, RPO1-3, RPA9, MGC9850	uc001urp.3	Q9Y2S0	OTTHUMG00000016635	ENST00000399697.3:c.353G>T	13.37:g.28240074G>T	ENSP00000382604:p.Arg118Leu					POLR1D_uc010aam.2_Missense_Mutation_p.R90L|POLR1D_uc001urq.2_RNA	p.R118L	NM_152705	NP_689918	Q9Y2S0	RPAC2_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0758)|OV - Ovarian serous cystadenocarcinoma(117;0.1)|Epithelial(112;0.213)	3	471	+		Lung SC(185;0.0161)	Error:Variant_position_missing_in_Q9Y2S0_after_alignment					Q5TBX2|Q96BR3	Missense_Mutation	SNP	ENST00000399697.3	37	c.353G>T	CCDS9324.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988326	0.35036	.	.	ENSG00000186184	ENST00000399697	.	.	.	5.86	1.69	0.24217	.	0.478501	0.18013	U	0.154489	T	0.30355	0.0762	.	.	.	0.09310	N	0.999999	B	0.13594	0.008	B	0.12837	0.008	T	0.25950	-1.0117	8	0.66056	D	0.02	.	7.6251	0.28208	0.2596:0.0:0.6249:0.1156	.	118	Q9Y2S0-2	.	L	118	.	ENSP00000382604:R118L	R	+	2	0	POLR1D	27138074	0.102000	0.21896	0.001000	0.08648	0.167000	0.22549	2.146000	0.42216	0.396000	0.25283	0.555000	0.69702	CGG		0.652	POLR1D-004	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044306.1	NM_015972, NM_152705		11	24	1	0	2.68362e-12	0.001368	4.00653e-12	11	24				
TRPC4	7223	broad.mit.edu	37	13	38225483	38225483	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:38225483G>A	ENST00000379705.3	-	8	2855	c.1998C>T	c.(1996-1998)ctC>ctT	p.L666L	TRPC4_ENST00000379679.1_Silent_p.L493L|TRPC4_ENST00000379681.3_Silent_p.L666L|TRPC4_ENST00000355779.2_Silent_p.L666L|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000338947.5_Silent_p.L493L|TRPC4_ENST00000447043.1_Silent_p.L666L|TRPC4_ENST00000358477.2_Silent_p.L666L			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	666	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.L666L(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TCAGGTACCAGAGAGACTTGG	0.423																																							uc001uws.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)|breast(1)	6						c.(1996-1998)CTC>CTT		transient receptor potential cation channel,							133.0	130.0	131.0					13																	38225483		2203	4300	6503	SO:0001819	synonymous_variant	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38225483G>A	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1998C>T	13.37:g.38225483G>A						TRPC4_uc010abv.2_Silent_p.L246L|TRPC4_uc001uwt.2_Silent_p.L666L|TRPC4_uc010tey.1_Silent_p.L666L|TRPC4_uc010abw.2_Silent_p.L493L|TRPC4_uc010abx.2_Silent_p.L666L|TRPC4_uc010aby.2_Intron	p.L666L	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	8	2233	-			666			Binds to ITPR1, ITPR2 and ITPR3.|Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	37	c.1998C>T	CCDS9365.1																																																																																				0.423	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		7	48	0	0	0	0.00308	0	7	48				
DACH1	1602	broad.mit.edu	37	13	72049302	72049302	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:72049302C>A	ENST00000359684.2	-	11	2215	c.2216G>T	c.(2215-2217)gGc>gTc	p.G739V	DACH1_ENST00000305425.4_Missense_Mutation_p.G687V|DACH1_ENST00000313174.7_Missense_Mutation_p.G539V|DACH1_ENST00000354591.4_Missense_Mutation_p.G485V			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	739					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)	p.G687V(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		ATCTGTTCTGCCGCCACTGCG	0.408																																							uc010thn.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(2053-2055)GGC>GTC		dachshund homolog 1 isoform a							84.0	84.0	84.0					13																	72049302		1869	4109	5978	SO:0001583	missense	1602				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding	g.chr13:72049302C>A	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.2216G>T	13.37:g.72049302C>A	ENSP00000352712:p.Gly739Val					DACH1_uc010tho.1_Missense_Mutation_p.G537V|DACH1_uc010thp.1_Missense_Mutation_p.G483V	p.G685V	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN		GBM - Glioblastoma multiforme(99;0.00032)	11	2477	-		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)	737					D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37	c.2054G>T		.	.	.	.	.	.	.	.	.	.	C	15.78	2.933475	0.52866	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.31510	1.52;1.56;1.56;1.49	5.62	5.62	0.85841	.	0.160403	0.56097	D	0.000032	T	0.44307	0.1287	L	0.44542	1.39	0.45139	D	0.998151	P;D;B	0.58620	0.661;0.983;0.38	B;P;B	0.59424	0.319;0.857;0.283	T	0.23583	-1.0184	10	0.56958	D	0.05	-1.6047	15.1775	0.72924	0.0:0.8595:0.1405:0.0	.	483;537;685	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	V	687;539;485;739;739	ENSP00000304994:G687V;ENSP00000318506:G539V;ENSP00000346604:G485V;ENSP00000352712:G739V	ENSP00000304994:G687V	G	-	2	0	DACH1	70947303	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.518000	0.67068	2.643000	0.89663	0.655000	0.94253	GGC		0.408	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392		18	34	1	0	2.4624e-09	0.008871	3.3607e-09	18	34				
DACH1	1602	broad.mit.edu	37	13	72146989	72146989	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:72146989C>G	ENST00000359684.2	-	5	1443	c.1444G>C	c.(1444-1446)Gag>Cag	p.E482Q	DACH1_ENST00000305425.4_Missense_Mutation_p.E430Q|DACH1_ENST00000313174.7_Intron|DACH1_ENST00000354591.4_Intron			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	482					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)	p.E430Q(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		ACTGATGTCTCAACTCTGGAT	0.408																																							uc010thn.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1282-1284)GAG>CAG		dachshund homolog 1 isoform a							92.0	92.0	92.0					13																	72146989		1996	4187	6183	SO:0001583	missense	1602				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding	g.chr13:72146989C>G	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.1444G>C	13.37:g.72146989C>G	ENSP00000352712:p.Glu482Gln					DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	p.E428Q	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN		GBM - Glioblastoma multiforme(99;0.00032)	5	1705	-		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)	480					D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37	c.1282G>C		.	.	.	.	.	.	.	.	.	.	C	14.26	2.482801	0.44147	.	.	ENSG00000165659	ENST00000305425;ENST00000359684;ENST00000377826	T;T	0.32515	1.48;1.45	5.72	5.72	0.89469	.	0.100264	0.64402	D	0.000002	T	0.22513	0.0543	L	0.29908	0.895	0.80722	D	1	P	0.44578	0.838	B	0.34418	0.182	T	0.02837	-1.1104	10	0.20519	T	0.43	-13.5397	19.8252	0.96614	0.0:1.0:0.0:0.0	.	428	Q9UI36-2	.	Q	430;482;482	ENSP00000304994:E430Q;ENSP00000352712:E482Q	ENSP00000304994:E430Q	E	-	1	0	DACH1	71044990	1.000000	0.71417	0.996000	0.52242	0.828000	0.46876	7.346000	0.79347	2.859000	0.98148	0.591000	0.81541	GAG		0.408	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392		3	65	0	0	0	0.004672	0	3	65				
STK24	8428	broad.mit.edu	37	13	99127110	99127110	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:99127110G>A	ENST00000376547.3	-	5	743	c.598C>T	c.(598-600)Ccc>Tcc	p.P200S	STK24_ENST00000539966.1_Missense_Mutation_p.P169S|STK24_ENST00000397517.2_Missense_Mutation_p.P188S	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	200	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P200S(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			ATGACCTCGGGTGCCATCCAG	0.622																																							uc001vnm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(598-600)CCC>TCC		serine/threonine kinase 24 isoform a							92.0	97.0	95.0					13																	99127110		2203	4300	6503	SO:0001583	missense	8428				cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr13:99127110G>A	AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.598C>T	13.37:g.99127110G>A	ENSP00000365730:p.Pro200Ser					STK24_uc001vnn.1_Missense_Mutation_p.P188S|STK24_uc010tim.1_Missense_Mutation_p.P169S	p.P200S	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.233)		5	833	-	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		200			Protein kinase.		O14840|Q5JV92	Missense_Mutation	SNP	ENST00000376547.3	37	c.598C>T	CCDS9488.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.253311|5.253311	0.95336|0.95336	.|.	.|.	ENSG00000102572|ENSG00000102572	ENST00000397517;ENST00000376547;ENST00000376541;ENST00000539966;ENST00000376533;ENST00000543110|ENST00000444574	T;T;T|.	0.75154|.	-0.91;-0.91;-0.91|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.56097|.	U|.	0.000031|.	D|D	0.91243|0.91243	0.7240|0.7240	H|H	0.98883|0.98883	4.36|4.36	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.94653|0.94653	0.7841|0.7841	10|5	0.87932|.	D|.	0|.	.|.	19.1833|19.1833	0.93632|0.93632	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	169;188;200|.	B4DR80;Q5U0E6;Q9Y6E0|.	.;.;STK24_HUMAN|.	S|I	188;200;3;169;176;188|105	ENSP00000380651:P188S;ENSP00000365730:P200S;ENSP00000442539:P169S|.	ENSP00000365716:P176S|.	P|T	-|-	1|2	0|0	STK24|STK24	97925111|97925111	1.000000|1.000000	0.71417|0.71417	0.338000|0.338000	0.25549|0.25549	0.935000|0.935000	0.57460|0.57460	9.480000|9.480000	0.97931|0.97931	2.606000|2.606000	0.88127|0.88127	0.655000|0.655000	0.94253|0.94253	CCC|ACC		0.622	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045549.2	NM_003576		22	64	0	0	0	0.00333	0	22	64				
KDELC1	79070	broad.mit.edu	37	13	103443386	103443386	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:103443386T>A	ENST00000376004.4	-	6	1284	c.948A>T	c.(946-948)agA>agT	p.R316S	KDELC1_ENST00000460338.1_5'UTR	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1	316						endoplasmic reticulum lumen (GO:0005788)		p.R316S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CCAGCTCGAGTCTCTCTTTGC	0.478																																							uc001vpq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(946-948)AGA>AGT		KDEL (Lys-Asp-Glu-Leu) containing 1 precursor							81.0	82.0	82.0					13																	103443386		2203	4300	6503	SO:0001583	missense	79070					endoplasmic reticulum lumen		g.chr13:103443386T>A	BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.948A>T	13.37:g.103443386T>A	ENSP00000365172:p.Arg316Ser					KDELC1_uc001vpr.3_Missense_Mutation_p.R97S	p.R316S	NM_024089	NP_076994	Q6UW63	KDEL1_HUMAN			6	1332	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		316					Q53HL3|Q9BVD2	Missense_Mutation	SNP	ENST00000376004.4	37	c.948A>T	CCDS9504.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973556	0.74246	.	.	ENSG00000134901	ENST00000376004	T	0.54279	0.58	5.6	1.84	0.25277	.	0.000000	0.85682	D	0.000000	T	0.72581	0.3478	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72906	-0.4150	10	0.87932	D	0	.	7.7324	0.28793	0.0:0.3511:0.0:0.6489	.	316	Q6UW63	KDEL1_HUMAN	S	316	ENSP00000365172:R316S	ENSP00000365172:R316S	R	-	3	2	KDELC1	102241387	0.992000	0.36948	0.994000	0.49952	0.994000	0.84299	0.247000	0.18179	0.477000	0.27464	0.528000	0.53228	AGA		0.478	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045699.1			15	32	0	0	0	0.004007	0	15	32				
ERCC5	2073	broad.mit.edu	37	13	103520541	103520541	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:103520541G>T	ENST00000355739.4	+	12	4035	c.2612G>T	c.(2611-2613)tGt>tTt	p.C871F	ERCC5_ENST00000375954.1_Missense_Mutation_p.C104F|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.L1296F	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	871	I-domain.			EGIPTVGCV -> GNTNCGLC (in Ref. 2; BAA03812). {ECO:0000305}.	DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ACTGTGGGTTGTGTAACCGCC	0.363			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc001vpw.2		NA	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""			E		skin basal cell|skin squamous cell|melanoma			0				ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						c.(2611-2613)TGT>TTT	Direct_reversal_of_damage|NER	XPG-complementing protein							82.0	89.0	87.0					13																	103520541		2203	4300	6503	SO:0001583	missense	2073	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding	g.chr13:103520541G>T	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2612G>T	13.37:g.103520541G>T	ENSP00000347978:p.Cys871Phe					ERCC5_uc001vpu.1_Missense_Mutation_p.C1325F|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.C703F	p.C871F	NM_000123	NP_000114	P28715	ERCC5_HUMAN			12	3055	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		871	EGIPTVGCV -> GNTNCGLC (in Ref. 2; BAA03812).		I-domain.		A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	c.2612G>T	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	G	2.330	-0.353534	0.05173	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.62364	0.03;0.03	5.02	5.02	0.67125	-3&apos (1);Helix-hairpin-helix motif, class 2 (1); exonuclease, C-terminal domain (1);5&apos (1);	0.118582	0.64402	D	0.000007	T	0.40839	0.1133	L	0.27053	0.805	0.80722	D	1	B;B	0.20368	0.012;0.044	B;B	0.17098	0.003;0.017	T	0.30357	-0.9981	10	0.10111	T	0.7	-13.6348	4.9992	0.14255	0.166:0.0:0.6448:0.1891	.	871;1296	P28715;Q59FZ7	ERCC5_HUMAN;.	F	1296;871;703;104	ENSP00000347978:C871F;ENSP00000365121:C104F	ENSP00000347978:C871F	C	+	2	0	ERCC5	102318542	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.981000	0.49329	2.353000	0.79882	0.491000	0.48974	TGT		0.363	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			22	54	1	0	5.45024e-15	0.00333	8.73137e-15	22	54				
SLC10A2	6555	broad.mit.edu	37	13	103718307	103718307	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:103718307A>G	ENST00000245312.3	-	1	889	c.293T>C	c.(292-294)gTa>gCa	p.V98A		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	98			V -> I (in dbSNP:rs55971546). {ECO:0000269|PubMed:11589382, ECO:0000269|PubMed:11742882}.		bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.V98A(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GAGCACCACTACGGCCTGGAG	0.532																																							uc001vpy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(292-294)GTA>GCA		solute carrier family 10 (sodium/bile acid							96.0	92.0	93.0					13																	103718307		2203	4300	6503	SO:0001583	missense	6555				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity	g.chr13:103718307A>G	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.293T>C	13.37:g.103718307A>G	ENSP00000245312:p.Val98Ala						p.V98A	NM_000452	NP_000443	Q12908	NTCP2_HUMAN			1	890	-	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		98			Helical; (Potential).		A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	c.293T>C	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.379133	0.82682	.	.	ENSG00000125255	ENST00000245312	T	0.11169	2.8	5.25	5.25	0.73442	.	0.060392	0.64402	D	0.000003	T	0.20740	0.0499	L	0.46157	1.445	0.45415	D	0.99839	P	0.38745	0.645	P	0.50537	0.643	T	0.00728	-1.1591	10	0.48119	T	0.1	-10.0173	15.161	0.72785	1.0:0.0:0.0:0.0	.	98	Q12908	NTCP2_HUMAN	A	98	ENSP00000245312:V98A	ENSP00000245312:V98A	V	-	2	0	SLC10A2	102516308	0.993000	0.37304	0.992000	0.48379	0.842000	0.47809	7.553000	0.82203	1.985000	0.57927	0.533000	0.62120	GTA		0.532	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1			14	59	0	0	0	0.004007	0	14	59				
MYO16	23026	broad.mit.edu	37	13	109318301	109318301	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr13:109318301C>A	ENST00000357550.2	+	1	71	c.30C>A	c.(28-30)tcC>tcA	p.S10S	MYO16_ENST00000251041.5_Silent_p.S10S|MYO16_ENST00000356711.2_Silent_p.S10S	NM_001198950.1	NP_001185879.1			myosin XVI									p.S10S(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGCTAGAGTCCCTTCCCCTTG	0.522																																							uc001vqt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(28-30)TCC>TCA		myosin heavy chain Myr 8							84.0	75.0	78.0					13																	109318301		2203	4300	6503	SO:0001819	synonymous_variant	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109318301C>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.30C>A	13.37:g.109318301C>A						MYO16_uc010agk.1_Silent_p.S32S	p.S10S	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		2	156	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		10						Silent	SNP	ENST00000357550.2	37	c.30C>A	CCDS32008.1																																																																																				0.522	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		13	20	1	0	4.3838e-07	0.001855	5.45616e-07	13	20				
OR4Q3	441669	broad.mit.edu	37	14	20215940	20215940	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:20215940C>A	ENST00000331723.1	+	1	354	c.354C>A	c.(352-354)gtC>gtA	p.V118V		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V118V(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGCTGACAGTCATGGCCTATG	0.498																																							uc010tkt.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)	3						c.(352-354)GTC>GTA		olfactory receptor, family 4, subfamily Q,							93.0	94.0	94.0					14																	20215940		2203	4299	6502	SO:0001819	synonymous_variant	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20215940C>A	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.354C>A	14.37:g.20215940C>A							p.V118V	NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	354	+	all_cancers(95;0.00108)		118			Helical; Name=3; (Potential).		Q6IEX4	Silent	SNP	ENST00000331723.1	37	c.354C>A	CCDS32020.1																																																																																				0.498	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			17	69	1	0	9.16793e-09	0.00499	1.21223e-08	17	69				
OR4N2	390429	broad.mit.edu	37	14	20295622	20295622	+	Missense_Mutation	SNP	C	C	A	rs547897379	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:20295622C>A	ENST00000315947.1	+	1	15	c.15C>A	c.(13-15)aaC>aaA	p.N5K	OR4N2_ENST00000568211.1_Missense_Mutation_p.N5K	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N5K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AAAGCGAGAACAGAACAGTGA	0.373																																							uc010tkv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(13-15)AAC>AAA		olfactory receptor, family 4, subfamily N,							111.0	120.0	117.0					14																	20295622		2203	4300	6503	SO:0001583	missense	390429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20295622C>A		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.15C>A	14.37:g.20295622C>A	ENSP00000319601:p.Asn5Lys						p.N5K	NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	15	+	all_cancers(95;0.00108)		5			Extracellular (Potential).		Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	c.15C>A	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	9.527	1.109928	0.20714	.	.	ENSG00000176294	ENST00000557414;ENST00000557677;ENST00000315947	T;T;T	0.02158	4.42;4.42;4.42	4.41	0.638	0.17742	.	0.000000	0.52532	D	0.000063	T	0.09949	0.0244	M	0.91612	3.225	0.09310	N	1	D	0.58268	0.982	P	0.58454	0.839	T	0.04347	-1.0958	10	0.72032	D	0.01	-13.8445	6.141	0.20259	0.0:0.5769:0.0:0.4231	.	5	Q8NGD1	OR4N2_HUMAN	K	5	ENSP00000451462:N5K;ENSP00000452022:N5K;ENSP00000319601:N5K	ENSP00000319601:N5K	N	+	3	2	OR4N2	19365462	0.000000	0.05858	0.013000	0.15412	0.006000	0.05464	-0.859000	0.04277	0.217000	0.20800	0.591000	0.81541	AAC		0.373	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			36	116	1	0	2.51541e-25	0.004878	4.6237e-25	36	116				
OR11G2	390439	broad.mit.edu	37	14	20666456	20666456	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:20666456C>A	ENST00000357366.3	+	1	962	c.962C>A	c.(961-963)cCa>cAa	p.P321Q		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	321						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P321Q(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		gttgttaccccactgcttaac	0.403																																							uc010tlb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(961-963)CCA>CAA		olfactory receptor, family 11, subfamily G,							116.0	114.0	115.0					14																	20666456		2203	4300	6503	SO:0001583	missense	390439				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20666456C>A		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.962C>A	14.37:g.20666456C>A	ENSP00000349930:p.Pro321Gln						p.P321Q	NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)	1	962	+	all_cancers(95;0.00108)		321			Helical; Name=7; (Potential).		Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	c.962C>A	CCDS32032.1	.	.	.	.	.	.	.	.	.	.	c	20.7	4.026595	0.75390	.	.	ENSG00000196832	ENST00000357366	T	0.00344	8.02	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000204	T	0.01287	0.0042	M	0.93328	3.405	0.40794	D	0.983289	D	0.89917	1.0	D	0.97110	1.0	T	0.52668	-0.8545	10	0.87932	D	0	.	17.1038	0.86656	0.0:1.0:0.0:0.0	.	321	Q8NGC1	O11G2_HUMAN	Q	321	ENSP00000349930:P321Q	ENSP00000349930:P321Q	P	+	2	0	OR11G2	19736296	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.280000	0.78610	2.569000	0.86673	0.655000	0.94253	CCA		0.403	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1			23	58	1	0	1.10923e-09	0.00278	1.53031e-09	23	58				
OR11H6	122748	broad.mit.edu	37	14	20692663	20692663	+	Silent	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:20692663G>C	ENST00000315519.2	+	1	873	c.795G>C	c.(793-795)gtG>gtC	p.V265V		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V265V(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		ACCTAATGGTGGTGTCTCTAT	0.478																																							uc010tlc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(793-795)GTG>GTC		olfactory receptor, family 11, subfamily H,							110.0	94.0	99.0					14																	20692663		2203	4300	6503	SO:0001819	synonymous_variant	122748				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20692663G>C		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.795G>C	14.37:g.20692663G>C							p.V265V	NM_001004480	NP_001004480	Q8NGC7	O11H6_HUMAN	Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)	1	795	+	all_cancers(95;0.00108)		265			Helical; Name=6; (Potential).		Q6IF08	Silent	SNP	ENST00000315519.2	37	c.795G>C	CCDS32033.1																																																																																				0.478	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410676.1			30	44	0	0	0	0.008361	0	30	44				
RNASE3	6037	broad.mit.edu	37	14	21359949	21359949	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:21359949C>A	ENST00000304639.3	+	2	162	c.104C>A	c.(103-105)gCt>gAt	p.A35D		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	35	Required for nearly all of the bactericidal activity; partially involved in LPS-binding and bacterial membrane depolarization.				antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)	p.A35D(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	TTTACGAGGGCTCAGTGGTTT	0.498																																							uc001vyj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)GCT>GAT		ribonuclease, RNase A family, 3 (eosinophil	Pranlukast(DB01411)						105.0	112.0	110.0					14																	21359949		2191	4300	6491	SO:0001583	missense	6037				defense response to bacterium|RNA catabolic process	extracellular region|soluble fraction	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21359949C>A	X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.104C>A	14.37:g.21359949C>A	ENSP00000302324:p.Ala35Asp						p.A35D	NM_002935	NP_002926	P12724	ECP_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	2	158	+	all_cancers(95;0.00453)		35					Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Missense_Mutation	SNP	ENST00000304639.3	37	c.104C>A	CCDS9560.1	.	.	.	.	.	.	.	.	.	.	c	16.04	3.011103	0.54361	.	.	ENSG00000169397	ENST00000304639	T	0.74209	-0.82	2.56	2.56	0.30785	Ribonuclease A, domain (4);	1.217330	0.06240	U	0.690198	D	0.87712	0.6246	M	0.88512	2.96	0.27597	N	0.949089	D	0.89917	1.0	D	0.91635	0.999	T	0.70749	-0.4787	10	0.87932	D	0	.	8.8043	0.34927	0.0:1.0:0.0:0.0	.	35	P12724	ECP_HUMAN	D	35	ENSP00000302324:A35D	ENSP00000302324:A35D	A	+	2	0	RNASE3	20429789	0.968000	0.33430	0.883000	0.34634	0.035000	0.12851	2.714000	0.47202	1.763000	0.52060	0.537000	0.68136	GCT		0.498	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073795.2	NM_002935		31	60	1	0	5.91797e-21	0.002445	1.03973e-20	31	60				
RPGRIP1	57096	broad.mit.edu	37	14	21795831	21795831	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:21795831A>T	ENST00000400017.2	+	17	2760	c.2760A>T	c.(2758-2760)caA>caT	p.Q920H	RPGRIP1_ENST00000382933.4_Missense_Mutation_p.Q246H|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.Q920H|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.Q577H|RPGRIP1_ENST00000557771.1_Missense_Mutation_p.Q882H|RPGRIP1_ENST00000307974.4_Missense_Mutation_p.Q279H	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	920					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.Q920H(1)|p.Q536H(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GATCTATTCAAGTGCAACTGG	0.428																																							uc001wag.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(2)|pancreas(1)	7						c.(2758-2760)CAA>CAT		retinitis pigmentosa GTPase regulator							87.0	82.0	84.0					14																	21795831		1843	4104	5947	SO:0001583	missense	57096				response to stimulus|visual perception	cilium		g.chr14:21795831A>T	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2760A>T	14.37:g.21795831A>T	ENSP00000382895:p.Gln920His					RPGRIP1_uc001wah.2_Missense_Mutation_p.Q562H|RPGRIP1_uc001wai.2_Missense_Mutation_p.Q246H|RPGRIP1_uc001wak.2_Missense_Mutation_p.Q395H|RPGRIP1_uc010aim.2_Missense_Mutation_p.Q303H|RPGRIP1_uc001wal.2_Missense_Mutation_p.Q279H|RPGRIP1_uc001wam.2_Missense_Mutation_p.Q237H	p.Q920H	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)	17	2760	+	all_cancers(95;0.0017)	all_cancers(140;0.0973)	920					Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	c.2760A>T	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	A	6.868	0.529489	0.13127	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660;ENST00000382933;ENST00000555587;ENST00000307974	T;D;D;D;T;D;D	0.87887	-0.1;-2.31;-2.31;-2.31;-0.43;-2.31;-2.31	4.58	1.41	0.22369	.	0.413302	0.27176	N	0.020573	T	0.81650	0.4867	N	0.24115	0.695	0.09310	N	1	P;D;P;D;P;P	0.64830	0.875;0.966;0.875;0.994;0.875;0.883	P;P;P;P;P;B	0.62560	0.646;0.807;0.667;0.904;0.667;0.444	T	0.70831	-0.4765	10	0.10636	T	0.68	-6.815	3.5157	0.07723	0.3983:0.2162:0.3854:0.0	.	303;279;395;246;536;920	Q96KN7-2;Q96KN7-3;G3V3I7;Q96KN7-4;Q96KN7-5;Q96KN7	.;.;.;.;.;RPGR1_HUMAN	H	577;882;920;920;246;395;279	ENSP00000450445:Q577H;ENSP00000451219:Q882H;ENSP00000382895:Q920H;ENSP00000206660:Q920H;ENSP00000372391:Q246H;ENSP00000451262:Q395H;ENSP00000309721:Q279H	ENSP00000206660:Q920H	Q	+	3	2	RPGRIP1	20865671	0.076000	0.21285	0.375000	0.26029	0.873000	0.50193	-0.096000	0.11059	0.515000	0.28320	0.528000	0.53228	CAA		0.428	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366		19	31	0	0	0	0.010504	0	19	31				
EFS	10278	broad.mit.edu	37	14	23828659	23828659	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:23828659C>A	ENST00000216733.3	-	4	1635	c.1028G>T	c.(1027-1029)cGc>cTc	p.R343L	EFS_ENST00000429593.2_Missense_Mutation_p.R174L|RP11-124D2.3_ENST00000554010.1_RNA|EFS_ENST00000351354.3_Missense_Mutation_p.R250L	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	343	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)	p.R343L(1)		endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		ACCAGGCAGGCGGGGTGGGGG	0.692																																							uc001wjo.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1027-1029)CGC>CTC		embryonal Fyn-associated substrate isoform 1							36.0	36.0	36.0					14																	23828659		2007	3949	5956	SO:0001583	missense	10278				cell adhesion|intracellular signal transduction	cytoplasm	SH3 domain binding	g.chr14:23828659C>A	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.1028G>T	14.37:g.23828659C>A	ENSP00000216733:p.Arg343Leu					EFS_uc001wjp.2_Missense_Mutation_p.R250L|EFS_uc010tnm.1_Missense_Mutation_p.R174L	p.R343L	NM_005864	NP_005855	O43281	EFS_HUMAN		GBM - Glioblastoma multiforme(265;0.00649)	4	1636	-	all_cancers(95;7.12e-06)		343			Pro-rich.		B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	ENST00000216733.3	37	c.1028G>T	CCDS9595.1	.	.	.	.	.	.	.	.	.	.	C	6.825	0.521323	0.13005	.	.	ENSG00000100842	ENST00000216733;ENST00000351354;ENST00000429593	T;T;T	0.57595	0.39;0.95;0.98	4.69	3.77	0.43336	.	0.633406	0.16199	N	0.225022	T	0.28928	0.0718	N	0.12182	0.205	0.25923	N	0.9831	P;P;B	0.50066	0.931;0.553;0.053	B;B;B	0.39876	0.312;0.209;0.011	T	0.07927	-1.0747	10	0.08381	T	0.77	-4.9689	10.8927	0.47004	0.0:0.9027:0.0:0.0973	.	174;250;343	B4DJ56;O43281-2;O43281	.;.;EFS_HUMAN	L	343;250;174	ENSP00000216733:R343L;ENSP00000340607:R250L;ENSP00000416684:R174L	ENSP00000216733:R343L	R	-	2	0	EFS	22898499	0.969000	0.33509	1.000000	0.80357	0.739000	0.42172	0.012000	0.13287	1.146000	0.42352	0.655000	0.94253	CGC		0.692	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2			11	43	1	0	7.03913e-09	0.001368	9.4449e-09	11	43				
MYH7	4625	broad.mit.edu	37	14	23884706	23884706	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:23884706G>T	ENST00000355349.3	-	36	5329	c.5167C>A	c.(5167-5169)Ctc>Atc	p.L1723I	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1723					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.L1723I(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGGTTGATGAGGCTGGTGTTC	0.557																																							uc001wjx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(5167-5169)CTC>ATC		myosin, heavy chain 7, cardiac muscle, beta							126.0	102.0	110.0					14																	23884706		2203	4300	6503	SO:0001583	missense	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23884706G>T	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5167C>A	14.37:g.23884706G>T	ENSP00000347507:p.Leu1723Ile						p.L1723I	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	36	5273	-	all_cancers(95;2.54e-05)		1723			Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	c.5167C>A	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671098	0.67814	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.87887	-2.31	5.41	5.41	0.78517	Myosin tail (1);	.	.	.	.	D	0.92996	0.7771	M	0.87900	2.915	0.48901	D	0.999725	P	0.52170	0.951	P	0.59761	0.863	D	0.92787	0.6245	9	0.48119	T	0.1	.	14.6481	0.68774	0.0714:0.0:0.9286:0.0	.	1723	P12883	MYH7_HUMAN	I	1723;1728	ENSP00000347507:L1723I	ENSP00000347507:L1723I	L	-	1	0	MYH7	22954546	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.674000	0.46867	2.826000	0.97356	0.561000	0.74099	CTC		0.557	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		13	36	1	0	0.00136819	0.001368	0.0015003	13	36				
FOXG1	2290	broad.mit.edu	37	14	29237064	29237064	+	Silent	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:29237064C>G	ENST00000313071.4	+	1	778	c.579C>G	c.(577-579)gcC>gcG	p.A193A	RP11-966I7.1_ENST00000551395.1_RNA|RP11-966I7.1_ENST00000549487.1_RNA|RP11-966I7.1_ENST00000546560.1_RNA|FOXG1_ENST00000382535.3_Silent_p.A193A	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	193					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A193A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		TCATGATGGCCATCCGGCAGA	0.607																																							uc001wqe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(2)	4						c.(577-579)GCC>GCG		forkhead box G1							41.0	42.0	41.0					14																	29237064		2203	4300	6503	SO:0001819	synonymous_variant	2290				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr14:29237064C>G		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.579C>G	14.37:g.29237064C>G							p.A193A	NM_005249	NP_005240	P55316	FOXG1_HUMAN	LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)	1	778	+			193			Fork-head.		A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	ENST00000313071.4	37	c.579C>G	CCDS9636.1																																																																																				0.607	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3			11	22	0	0	0	0.001368	0	11	22				
FOXG1	2290	broad.mit.edu	37	14	29237494	29237494	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:29237494C>A	ENST00000313071.4	+	1	1208	c.1009C>A	c.(1009-1011)Cac>Aac	p.H337N	FOXG1_ENST00000382535.3_Missense_Mutation_p.H337N	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	337					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H337N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CTACCCCAGCCACCCCATGCC	0.652																																							uc001wqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)	4						c.(1009-1011)CAC>AAC		forkhead box G1							112.0	108.0	109.0					14																	29237494		2203	4300	6503	SO:0001583	missense	2290				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr14:29237494C>A		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1009C>A	14.37:g.29237494C>A	ENSP00000339004:p.His337Asn						p.H337N	NM_005249	NP_005240	P55316	FOXG1_HUMAN	LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)	1	1208	+			337					A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	37	c.1009C>A	CCDS9636.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435780	0.62955	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93604	-3.25;-3.25	4.21	4.21	0.49690	.	0.856041	0.10311	U	0.689972	D	0.89560	0.6750	L	0.27053	0.805	0.53688	D	0.999978	P	0.47409	0.895	B	0.41236	0.351	D	0.87198	0.2239	10	0.39692	T	0.17	.	16.5223	0.84320	0.0:1.0:0.0:0.0	.	337	P55316	FOXG1_HUMAN	N	337	ENSP00000371975:H337N;ENSP00000339004:H337N	ENSP00000339004:H337N	H	+	1	0	FOXG1	28307245	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.951000	0.70273	2.042000	0.60477	0.491000	0.48974	CAC		0.652	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3			30	94	1	0	0.000279167	0.009535	0.000314805	30	94				
RPL10L	140801	broad.mit.edu	37	14	47120456	47120456	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:47120456G>T	ENST00000298283.3	-	1	572	c.484C>A	c.(484-486)Cgc>Agc	p.R162S		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	162					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)	p.R162S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						ATCTTCTGGCGTCCAGGGAAC	0.502																																							uc001wwg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(484-486)CGC>AGC		ribosomal protein L10-like protein							93.0	93.0	93.0					14																	47120456		2203	4300	6503	SO:0001583	missense	140801				spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome	g.chr14:47120456G>T	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.484C>A	14.37:g.47120456G>T	ENSP00000298283:p.Arg162Ser						p.R162S	NM_080746	NP_542784	Q96L21	RL10L_HUMAN			1	573	-			162					Q8IUD1	Missense_Mutation	SNP	ENST00000298283.3	37	c.484C>A	CCDS32071.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.749601	0.49257	.	.	ENSG00000165496	ENST00000298283	T	0.73152	-0.72	4.57	2.77	0.32553	Ribosomal protein L10e/L16 (2);	0.109105	0.64402	D	0.000005	T	0.78253	0.4254	M	0.89658	3.05	0.80722	D	1	B	0.13145	0.007	B	0.37267	0.245	T	0.77920	-0.2407	10	0.87932	D	0	-30.0537	9.3276	0.38001	0.1767:0.0:0.8233:0.0	.	162	Q96L21	RL10L_HUMAN	S	162	ENSP00000298283:R162S	ENSP00000298283:R162S	R	-	1	0	RPL10L	46190206	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	4.813000	0.62620	0.876000	0.35872	-0.126000	0.14955	CGC		0.502	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1			23	34	1	0	4.26978e-12	0.00333	6.34481e-12	23	34				
OTUB2	78990	broad.mit.edu	37	14	94510400	94510400	+	Splice_Site	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr14:94510400C>T	ENST00000203664.5	+	4	511	c.302C>T	c.(301-303)gCt>gTt	p.A101V		NM_023112.3	NP_075601.1	Q96DC9	OTUB2_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 2	101	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular amino acid metabolic process (GO:0006520)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.A101V(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5		all_cancers(154;0.12)		Epithelial(152;0.124)|all cancers(159;0.21)|COAD - Colon adenocarcinoma(157;0.215)		TTCTTCAATGCTGTGAGTTCA	0.567																																							uc001yci.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(301-303)GCT>GTT		OTU domain, ubiquitin aldehyde binding 2							211.0	186.0	195.0					14																	94510400		2203	4300	6503	SO:0001630	splice_region_variant	78990				cellular amino acid metabolic process|protein K48-linked deubiquitination|protein K63-linked deubiquitination		omega peptidase activity|protein binding|ubiquitin-specific protease activity	g.chr14:94510400C>T	AF318378	CCDS9917.1	14q32.13-q32.2	2014-02-24	2014-02-24	2004-05-28		ENSG00000089723		"""OTU domain containing"""	20351	protein-coding gene	gene with protein product		608338	"""chromosome 14 open reading frame 137"", ""OTU domain, ubiquitin aldehyde binding 2"""	C14orf137		12704427, 19996094	Standard	NM_023112		Approved	FLJ21916, MGC3102	uc001ych.4	Q96DC9		ENST00000203664.5:c.303+1C>T	14.37:g.94510400C>T							p.A101V	NM_023112	NP_075601	Q96DC9	OTUB2_HUMAN		Epithelial(152;0.124)|all cancers(159;0.21)|COAD - Colon adenocarcinoma(157;0.215)	4	462	+		all_cancers(154;0.12)	101			OTU.		Q6IA10|Q9H6T1	Missense_Mutation	SNP	ENST00000203664.5	37	c.302C>T	CCDS9917.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023857	0.54683	.	.	ENSG00000089723	ENST00000203664	T	0.42131	0.98	5.02	5.02	0.67125	Ovarian tumour, otubain (1);	0.063205	0.64402	D	0.000004	T	0.23727	0.0574	N	0.14661	0.345	0.80722	D	1	P	0.42409	0.779	B	0.35114	0.196	T	0.05632	-1.0873	10	0.21014	T	0.42	-4.1787	14.1885	0.65623	0.0:1.0:0.0:0.0	.	101	Q96DC9	OTUB2_HUMAN	V	101	ENSP00000203664:A101V	ENSP00000203664:A101V	A	+	2	0	OTUB2	93580153	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	4.897000	0.63231	2.507000	0.84556	0.313000	0.20887	GCT		0.567	OTUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412855.1		Missense_Mutation	39	54	0	0	0	0.00623	0	39	54				
OR4M2	390538	broad.mit.edu	37	15	22369380	22369380	+	Missense_Mutation	SNP	C	C	A	rs560295024	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:22369380C>A	ENST00000332663.2	+	1	903	c.805C>A	c.(805-807)Cta>Ata	p.L269I	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L269I(1)		NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTCGTTTTCCCTAGATAAAGT	0.418																																							uc010tzu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(805-807)CTA>ATA		olfactory receptor, family 4, subfamily M,							302.0	226.0	252.0					15																	22369380		2203	4300	6503	SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22369380C>A	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.805C>A	15.37:g.22369380C>A	ENSP00000329467:p.Leu269Ile					LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.L269I	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	805	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	269			Extracellular (Potential).		B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	c.805C>A	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	4.006	-0.001627	0.07819	.	.	ENSG00000182974	ENST00000332663	T	0.00202	8.56	2.28	0.596	0.17496	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38548	N	0.001648	T	0.00109	0.0003	N	0.16307	0.4	0.25597	N	0.98664	B	0.32467	0.372	B	0.38921	0.285	T	0.22521	-1.0214	10	0.02654	T	1	-1.3616	5.8813	0.18856	0.0:0.7001:0.0:0.2999	.	269	Q8NGB6	OR4M2_HUMAN	I	269	ENSP00000329467:L269I	ENSP00000329467:L269I	L	+	1	2	OR4M2	19870744	0.000000	0.05858	0.993000	0.49108	0.719000	0.41307	-1.651000	0.01989	0.308000	0.22923	0.448000	0.29417	CTA		0.418	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			24	155	1	0	9.57634e-11	0.00333	1.37175e-10	24	155				
TUBGCP5	114791	broad.mit.edu	37	15	22864307	22864307	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:22864307G>T	ENST00000283645.4	+	16	2395	c.2265G>T	c.(2263-2265)gtG>gtT	p.V755V	TUBGCP5_ENST00000453949.2_Silent_p.V755V	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	755					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.V755V(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		GGCAGAATGTGTCTTTTCTTA	0.353																																							uc001yur.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2263-2265)GTG>GTT		tubulin, gamma complex associated protein 5							96.0	93.0	94.0					15																	22864307		2203	4300	6503	SO:0001819	synonymous_variant	114791				G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding	g.chr15:22864307G>T	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.2265G>T	15.37:g.22864307G>T						TUBGCP5_uc001yuq.2_Silent_p.V755V	p.V755V	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)	16	2395	+		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)	755					E9PB12|Q6IQ52|Q96PY8	Silent	SNP	ENST00000283645.4	37	c.2265G>T	CCDS10008.1																																																																																				0.353	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2	NM_052903		7	38	1	0	0.000157383	0.00308	0.000180353	7	38				
APBA2	321	broad.mit.edu	37	15	29346220	29346220	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:29346220G>T	ENST00000558402.1	+	5	732	c.133G>T	c.(133-135)Ggc>Tgc	p.G45C	APBA2_ENST00000561069.1_Missense_Mutation_p.G45C|APBA2_ENST00000558259.1_Missense_Mutation_p.G45C|APBA2_ENST00000558330.1_Missense_Mutation_p.G45C|APBA2_ENST00000411764.1_Missense_Mutation_p.G45C			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	45					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.G45C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		TGTGCCCGAGGGCCTGGAGCT	0.657																																							uc001zck.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(133-135)GGC>TGC		amyloid beta A4 precursor protein-binding,							46.0	55.0	52.0					15																	29346220		2203	4300	6503	SO:0001583	missense	321				nervous system development|protein transport		protein binding	g.chr15:29346220G>T	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.133G>T	15.37:g.29346220G>T	ENSP00000453293:p.Gly45Cys					APBA2_uc010azj.2_Missense_Mutation_p.G45C|APBA2_uc010uat.1_Missense_Mutation_p.G45C|APBA2_uc001zcl.2_Missense_Mutation_p.G45C|APBA2_uc010uas.1_Missense_Mutation_p.G45C	p.G45C	NM_005503	NP_005494	Q99767	APBA2_HUMAN		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)	3	340	+		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)	45					E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	37	c.133G>T	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458938	0.43634	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.48522	0.81	5.25	3.35	0.38373	.	0.612016	0.16604	N	0.207211	T	0.48169	0.1485	L	0.44542	1.39	0.09310	N	1	D;D;D	0.53151	0.958;0.958;0.958	P;P;B	0.52159	0.691;0.491;0.365	T	0.32640	-0.9899	10	0.56958	D	0.05	.	8.3441	0.32261	0.0828:0.156:0.7612:0.0	.	45;45;45	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	C	45	ENSP00000409312:G45C	ENSP00000219865:G45C	G	+	1	0	APBA2	27133512	0.843000	0.29541	0.005000	0.12908	0.665000	0.39181	2.539000	0.45718	0.569000	0.29329	0.650000	0.86243	GGC		0.657	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503		5	34	1	0	0.000602214	0.000602	0.000668426	5	34				
RYR3	6263	broad.mit.edu	37	15	33895391	33895391	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:33895391C>A	ENST00000389232.4	+	18	2060	c.1990C>A	c.(1990-1992)Ctg>Atg	p.L664M	RYR3_ENST00000415757.3_Missense_Mutation_p.L664M	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	664	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.L664M(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTACTTCGAGCTGATTATCGA	0.567																																							uc001zhi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(1990-1992)CTG>ATG		ryanodine receptor 3							129.0	135.0	133.0					15																	33895391		2018	4175	6193	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33895391C>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1990C>A	15.37:g.33895391C>A	ENSP00000373884:p.Leu664Met					RYR3_uc010bar.2_Missense_Mutation_p.L664M	p.L664M	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	18	2060	+		all_lung(180;7.18e-09)	664			Cytoplasmic (By similarity).|B30.2/SPRY 1.		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.1990C>A	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286204	0.59867	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.61040	0.14;0.14	5.42	4.49	0.54785	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000006	T	0.51143	0.1657	M	0.66939	2.045	0.47094	D	0.99931	B;B	0.31435	0.323;0.036	B;B	0.30495	0.116;0.056	T	0.55153	-0.8185	10	0.54805	T	0.06	.	5.583	0.17260	0.1611:0.6645:0.0:0.1744	.	664;664	Q15413-2;Q15413	.;RYR3_HUMAN	M	664	ENSP00000373884:L664M;ENSP00000399610:L664M	ENSP00000354735:L664M	L	+	1	2	RYR3	31682683	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	2.356000	0.44116	1.504000	0.48704	0.644000	0.83932	CTG		0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			15	97	1	0	3.45872e-05	0.004007	4.05857e-05	15	97				
RYR3	6263	broad.mit.edu	37	15	34113753	34113753	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:34113753C>A	ENST00000389232.4	+	80	11015	c.10945C>A	c.(10945-10947)Ctg>Atg	p.L3649M	RYR3_ENST00000415757.3_Missense_Mutation_p.L3644M	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3649					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.L3648M(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGTTGAGACGCTGAAGCTGGG	0.552																																							uc001zhi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(10945-10947)CTG>ATG		ryanodine receptor 3							85.0	89.0	88.0					15																	34113753		2098	4235	6333	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34113753C>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10945C>A	15.37:g.34113753C>A	ENSP00000373884:p.Leu3649Met					RYR3_uc010bar.2_Missense_Mutation_p.L3644M	p.L3649M	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	80	11015	+		all_lung(180;7.18e-09)	3649					O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.10945C>A	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576614	0.65878	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.90676	-2.71	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000003	D	0.94804	0.8322	M	0.78637	2.42	0.51767	D	0.999939	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.94849	0.8012	10	0.87932	D	0	.	13.4148	0.60961	0.0:0.9253:0.0:0.0747	.	3644;3649	Q15413-2;Q15413	.;RYR3_HUMAN	M	3649;3648;3644	ENSP00000373884:L3649M	ENSP00000354735:L3644M	L	+	1	2	RYR3	31901045	0.998000	0.40836	0.972000	0.41901	0.980000	0.70556	3.795000	0.55499	2.760000	0.94817	0.655000	0.94253	CTG		0.552	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			5	22	1	0	0.00116845	0.001168	0.00128792	5	22				
ZNF770	54989	broad.mit.edu	37	15	35273923	35273923	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:35273923G>A	ENST00000356321.4	-	3	2057	c.1713C>T	c.(1711-1713)gtC>gtT	p.V571V		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	571					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.V571V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		CTGACTCTGAGACCTCGTATT	0.398																																							uc001ziw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1711-1713)GTC>GTT		zinc finger protein 770							142.0	147.0	145.0					15																	35273923		2201	4298	6499	SO:0001819	synonymous_variant	54989				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:35273923G>A	BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.1713C>T	15.37:g.35273923G>A							p.V571V	NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)	3	2024	-		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)	571					Q6ZMZ6|Q9NWV2	Silent	SNP	ENST00000356321.4	37	c.1713C>T	CCDS10042.1																																																																																				0.398	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251896.2	NM_014106		23	122	0	0	0	0.00278	0	23	122				
PAK6	56924	broad.mit.edu	37	15	40564712	40564712	+	Silent	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:40564712A>T	ENST00000542403.2	+	4	1257	c.1146A>T	c.(1144-1146)acA>acT	p.T382T	PAK6_ENST00000441369.1_Silent_p.T382T|PAK6_ENST00000260404.4_Silent_p.T382T|PAK6_ENST00000560346.1_Silent_p.T382T|PAK6_ENST00000453867.1_Silent_p.T382T|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000455577.2_Silent_p.T382T	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	382	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T382T(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		GTGAGGACACAGGTGTTGTGA	0.647																																							uc010bbl.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(5)|large_intestine(1)|ovary(1)|skin(1)	8						c.(1144-1146)ACA>ACT		p21-activated kinase 6							67.0	56.0	60.0					15																	40564712		2203	4300	6503	SO:0001819	synonymous_variant	56924						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr15:40564712A>T	AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1146A>T	15.37:g.40564712A>T						PAK6_uc010bbm.2_Silent_p.T382T|PAK6_uc001zky.3_Silent_p.T382T|PAK6_uc010bbn.2_Silent_p.T382T|PAK6_uc001zlb.2_Silent_p.T382T	p.T382T	NM_001128628	NP_001122100	Q9NQU5	PAK6_HUMAN		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)	6	1586	+		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)	382			Linker.		A8K2G2|B3KYB0|G5E9R2	Silent	SNP	ENST00000542403.2	37	c.1146A>T	CCDS10054.1																																																																																				0.647	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			5	18	0	0	0	0.001168	0	5	18				
C15orf43	145645	broad.mit.edu	37	15	45253761	45253761	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:45253761C>A	ENST00000340827.3	+	4	344	c.327C>A	c.(325-327)gaC>gaA	p.D109E	RNU6-1332P_ENST00000516666.1_RNA	NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	109								p.D109E(1)		NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		GGGAACAAGACCAACATTTTC	0.284																																							uc001zuk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(325-327)GAC>GAA		hypothetical protein LOC145645							64.0	61.0	62.0					15																	45253761		2197	4294	6491	SO:0001583	missense	145645							g.chr15:45253761C>A	BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.327C>A	15.37:g.45253761C>A	ENSP00000340644:p.Asp109Glu						p.D109E	NM_152448	NP_689661	Q8NHR7	CO043_HUMAN		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)	4	344	+		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)	109						Missense_Mutation	SNP	ENST00000340827.3	37	c.327C>A	CCDS10115.1	.	.	.	.	.	.	.	.	.	.	C	9.120	1.008775	0.19199	.	.	ENSG00000167014	ENST00000340827	T	0.54071	0.59	4.4	0.934	0.19477	.	0.334872	0.26784	N	0.022519	T	0.31979	0.0814	N	0.24115	0.695	0.28384	N	0.919388	P	0.39181	0.663	B	0.37731	0.257	T	0.15896	-1.0421	10	0.32370	T	0.25	.	6.0826	0.19950	0.0:0.5711:0.0:0.4289	.	109	Q8NHR7	CO043_HUMAN	E	109	ENSP00000340644:D109E	ENSP00000340644:D109E	D	+	3	2	C15orf43	43041053	0.084000	0.21492	0.994000	0.49952	0.978000	0.69477	0.014000	0.13333	-0.037000	0.13646	0.549000	0.68633	GAC		0.284	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448		12	56	1	0	0.000219431	0.00245	0.000250105	12	56				
MYO1E	4643	broad.mit.edu	37	15	59553681	59553681	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:59553681C>A	ENST00000288235.4	-	3	574	c.175G>T	c.(175-177)Gtc>Ttc	p.V59F	MYO1E_ENST00000558814.1_Intron	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	59	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)	p.V59F(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		AAAGGGTTGACTGAGATTAAT	0.338																																							uc002aga.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)	3						c.(175-177)GTC>TTC		myosin IE							134.0	128.0	130.0					15																	59553681		2190	4290	6480	SO:0001583	missense	4643				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity	g.chr15:59553681C>A	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.175G>T	15.37:g.59553681C>A	ENSP00000288235:p.Val59Phe						p.V59F	NM_004998	NP_004989	Q12965	MYO1E_HUMAN		all cancers(107;0.207)	3	547	-			59			Myosin head-like.		Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	c.175G>T	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436659	0.83885	.	.	ENSG00000157483	ENST00000288235	D	0.91124	-2.79	5.93	5.01	0.66863	Myosin head, motor domain (3);	0.121727	0.56097	D	0.000021	D	0.96787	0.8951	H	0.96547	3.84	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.97903	1.0304	10	0.87932	D	0	.	14.8598	0.70372	0.0:0.9314:0.0:0.0686	.	59	Q12965	MYO1E_HUMAN	F	59	ENSP00000288235:V59F	ENSP00000288235:V59F	V	-	1	0	MYO1E	57340973	0.996000	0.38824	0.999000	0.59377	0.976000	0.68499	2.484000	0.45242	1.500000	0.48636	0.563000	0.77884	GTC		0.338	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998		24	54	1	0	3.6726e-16	0.003954	6.03559e-16	24	54				
TLE3	7090	broad.mit.edu	37	15	70358421	70358421	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:70358421C>A	ENST00000558939.1	-	7	1886	c.509G>T	c.(508-510)gGc>gTc	p.G170V	TLE3_ENST00000558201.1_Missense_Mutation_p.G176V|TLE3_ENST00000559929.1_Missense_Mutation_p.G180V|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000558379.1_Missense_Mutation_p.G170V|TLE3_ENST00000451782.2_Missense_Mutation_p.G170V|TLE3_ENST00000557907.1_Missense_Mutation_p.G170V|TLE3_ENST00000539550.1_Missense_Mutation_p.G114V|TLE3_ENST00000440567.3_Missense_Mutation_p.G163V|TLE3_ENST00000560939.1_Missense_Mutation_p.G175V|TLE3_ENST00000557997.1_Missense_Mutation_p.G170V|TLE3_ENST00000559048.1_Missense_Mutation_p.G175V|TLE3_ENST00000442299.2_Missense_Mutation_p.G170V|TLE3_ENST00000317509.8_Missense_Mutation_p.G170V|TLE3_ENST00000560589.1_Missense_Mutation_p.G114V	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	170	Gly/Pro-rich.				Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G170V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GCCCAGGGCGCCCAGTGCCAG	0.682																																							uc002asm.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(508-510)GGC>GTC		transducin-like enhancer protein 3 isoform a							29.0	32.0	31.0					15																	70358421		1907	4129	6036	SO:0001583	missense	7090				organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding	g.chr15:70358421C>A	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.509G>T	15.37:g.70358421C>A	ENSP00000452871:p.Gly170Val					TLE3_uc002ask.2_Missense_Mutation_p.G114V|TLE3_uc002asl.2_Missense_Mutation_p.G175V|TLE3_uc010ukd.1_Missense_Mutation_p.G163V|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Missense_Mutation_p.G170V|TLE3_uc002asn.2_Missense_Mutation_p.G170V|TLE3_uc002asp.2_Missense_Mutation_p.G170V|TLE3_uc002aso.2_Missense_Mutation_p.G170V|TLE3_uc010bim.1_RNA	p.G170V	NM_005078	NP_005069	Q04726	TLE3_HUMAN			7	1628	-			170			Gly/Pro-rich.		B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	ENST00000558939.1	37	c.509G>T	CCDS45293.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190620	0.58017	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550	T;T;T;T;T	0.56941	0.67;0.69;0.68;0.71;0.43	5.56	4.65	0.58169	.	0.170991	0.51477	D	0.000085	T	0.54382	0.1855	L	0.53561	1.675	0.80722	D	1	P;P;P;P;P;B;P;B	0.49307	0.905;0.498;0.576;0.922;0.735;0.193;0.731;0.423	B;P;B;P;P;B;B;B	0.46452	0.36;0.517;0.336;0.461;0.462;0.072;0.444;0.251	T	0.58567	-0.7614	10	0.56958	D	0.05	-14.4454	14.0343	0.64636	0.0:0.9267:0.0:0.0733	.	163;170;170;170;170;170;175;114	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	V	170;170;170;163;114	ENSP00000390007:G170V;ENSP00000394717:G170V;ENSP00000319233:G170V;ENSP00000415057:G163V;ENSP00000442594:G114V	ENSP00000319233:G170V	G	-	2	0	TLE3	68145475	1.000000	0.71417	0.642000	0.29436	0.932000	0.56968	7.577000	0.82486	1.350000	0.45770	0.655000	0.94253	GGC		0.682	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078		9	18	1	0	4.68919e-08	0.008291	6.0249e-08	9	18				
UNC45A	55898	broad.mit.edu	37	15	91489890	91489890	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr15:91489890C>T	ENST00000418476.2	+	10	1286	c.1246C>T	c.(1246-1248)Cag>Tag	p.Q416*	UNC45A_ENST00000394275.2_Nonsense_Mutation_p.Q401*	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	416					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.Q416*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			ACGGGCCATCCAGACGGTGTC	0.622																																							uc002bqg.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(1246-1248)CAG>TAG		smooth muscle cell associated protein-1 isoform							41.0	38.0	39.0					15																	91489890		2198	4298	6496	SO:0001587	stop_gained	55898				cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding	g.chr15:91489890C>T		CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.1246C>T	15.37:g.91489890C>T	ENSP00000407487:p.Gln416*					UNC45A_uc002bqd.2_Nonsense_Mutation_p.Q401*|UNC45A_uc010uqr.1_5'Flank|UNC45A_uc002bqi.2_5'Flank	p.Q416*	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	Lung(145;0.189)		10	1586	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		416					A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Nonsense_Mutation	SNP	ENST00000418476.2	37	c.1246C>T	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	C	38	6.888538	0.97912	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-34.5149	19.2173	0.93783	0.0:1.0:0.0:0.0	.	.	.	.	X	401;416	.	ENSP00000377816:Q401X	Q	+	1	0	UNC45A	89290894	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.936000	0.70153	2.627000	0.88993	0.456000	0.33151	CAG		0.622	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671		4	13	0	0	0	0.009096	0	4	13				
WDR90	197335	broad.mit.edu	37	16	712767	712767	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:712767A>T	ENST00000293879.4	+	34	4234	c.4234A>T	c.(4234-4236)Acc>Tcc	p.T1412S	WDR90_ENST00000549091.1_Missense_Mutation_p.T1414S|WDR90_ENST00000547944.1_5'Flank|WDR90_ENST00000315764.4_5'Flank			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1412								p.T1412S(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CGTCGTGGGCACCACGGCGGG	0.637																																							uc002cii.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4234-4236)ACC>TCC		WD repeat domain 90							44.0	47.0	46.0					16																	712767		2149	4241	6390	SO:0001583	missense	197335							g.chr16:712767A>T	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.4234A>T	16.37:g.712767A>T	ENSP00000293879:p.Thr1412Ser					WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Missense_Mutation_p.T939S|WDR90_uc002cil.1_Intron|WDR90_uc002cim.1_Missense_Mutation_p.T588S|WDR90_uc002cin.1_Missense_Mutation_p.T27S|WDR90_uc010uul.1_5'Flank|WDR90_uc002cio.1_5'Flank|WDR90_uc010bqx.1_5'Flank	p.T1412S	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN			34	4288	+		Hepatocellular(780;0.0218)	1412					Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	c.4234A>T	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399084	0.62177	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.36340	1.26;1.89	5.08	5.08	0.68730	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.068567	0.56097	N	0.000026	T	0.29524	0.0736	L	0.39898	1.24	0.80722	D	1	P;P	0.52170	0.513;0.951	B;B	0.42282	0.136;0.382	T	0.04946	-1.0916	10	0.14252	T	0.57	.	14.0403	0.64672	1.0:0.0:0.0:0.0	.	1414;1412	F8VUX9;Q96KV7	.;WDR90_HUMAN	S	1414;1412	ENSP00000448122:T1414S;ENSP00000293879:T1412S	ENSP00000293879:T1412S	T	+	1	0	WDR90	652768	1.000000	0.71417	0.761000	0.31378	0.028000	0.11728	8.728000	0.91484	1.916000	0.55485	0.402000	0.26972	ACC		0.637	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294		7	17	0	0	0	0.001984	0	7	17				
TPSD1	23430	broad.mit.edu	37	16	1306527	1306527	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:1306527G>T	ENST00000211076.3	+	2	241	c.93G>T	c.(91-93)caG>caT	p.Q31H	RP11-616M22.5_ENST00000566997.1_RNA|TPSD1_ENST00000397534.2_Missense_Mutation_p.Q24H	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	31						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.Q31H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				CCCCAGGCCAGGCCCTGCAGC	0.701																																							uc002clb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(91-93)CAG>CAT		tryptase delta 1 precursor							36.0	47.0	43.0					16																	1306527		2199	4299	6498	SO:0001583	missense	23430				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:1306527G>T	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.93G>T	16.37:g.1306527G>T	ENSP00000211076:p.Gln31His					TPSD1_uc010brm.1_Translation_Start_Site	p.Q31H	NM_012217	NP_036349	Q9BZJ3	TRYD_HUMAN			2	102	+		Hepatocellular(780;0.00369)	31					O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	ENST00000211076.3	37	c.93G>T	CCDS10432.1	.	.	.	.	.	.	.	.	.	.	-	10.97	1.501019	0.26861	.	.	ENSG00000095917	ENST00000397534;ENST00000211076	D;D	0.81659	-1.52;-1.52	2.7	-3.42	0.04825	.	0.655805	0.12529	N	0.460974	T	0.71048	0.3294	N	0.19112	0.55	0.09310	N	1	D	0.63880	0.993	P	0.56398	0.797	T	0.62220	-0.6900	10	0.44086	T	0.13	.	3.8143	0.08809	0.5193:0.2011:0.2797:0.0	.	31	Q9BZJ3	TRYD_HUMAN	H	24;31	ENSP00000380668:Q24H;ENSP00000211076:Q31H	ENSP00000211076:Q31H	Q	+	3	2	TPSD1	1246528	0.000000	0.05858	0.000000	0.03702	0.172000	0.22775	0.067000	0.14510	-0.455000	0.07054	0.185000	0.17295	CAG		0.701	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2			17	52	1	0	3.41278e-10	0.00499	4.79146e-10	17	52				
PRSS21	10942	broad.mit.edu	37	16	2868692	2868692	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:2868692G>C	ENST00000005995.3	+	4	314	c.272G>C	c.(271-273)aGt>aCt	p.S91T	PRSS21_ENST00000450020.3_Missense_Mutation_p.S91T|PRSS21_ENST00000455114.1_Missense_Mutation_p.S89T			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	91	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S91T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						AGTGACCTTAGTGATCCCTCC	0.567																																							uc002crt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(271-273)AGT>ACT		testisin isoform 1							80.0	68.0	72.0					16																	2868692		2198	4300	6498	SO:0001583	missense	10942				proteolysis	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	serine-type endopeptidase activity	g.chr16:2868692G>C	AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.272G>C	16.37:g.2868692G>C	ENSP00000005995:p.Ser91Thr					PRSS21_uc002crs.2_Missense_Mutation_p.S89T|PRSS21_uc002crr.2_Missense_Mutation_p.S91T	p.S91T	NM_006799	NP_006790	Q9Y6M0	TEST_HUMAN			4	378	+			91			Peptidase S1.		Q9NS34|Q9P2V6	Missense_Mutation	SNP	ENST00000005995.3	37	c.272G>C	CCDS10478.1	.	.	.	.	.	.	.	.	.	.	g	1.390	-0.581061	0.03854	.	.	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	T;T;T	0.81330	-1.48;-1.48;-1.48	3.09	-6.18	0.02085	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.57858	0.2082	N	0.20530	0.585	0.09310	N	1	B;B;B	0.21606	0.026;0.021;0.058	B;B;B	0.24006	0.05;0.03;0.03	T	0.31806	-0.9930	9	0.13108	T	0.6	.	3.2048	0.06662	0.1438:0.4539:0.2819:0.1204	.	91;89;91	Q9Y6M0;Q9Y6M0-2;Q9Y6M0-3	TEST_HUMAN;.;.	T	89;91;91	ENSP00000400632:S89T;ENSP00000407741:S91T;ENSP00000005995:S91T	ENSP00000005995:S91T	S	+	2	0	PRSS21	2808693	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.583000	0.05807	-4.221000	0.00064	-0.863000	0.03009	AGT		0.567	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1	NM_006799		16	49	0	0	0	0.00499	0	16	49				
NLRC3	197358	broad.mit.edu	37	16	3600416	3600416	+	RNA	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:3600416C>T	ENST00000301749.7	-	0	2838				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.L857L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGACTCACTCCAGGCTCTCCA	0.572																																							uc010btn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(2431-2433)CTG>CTA		NOD3 protein							37.0	38.0	37.0					16																	3600416		1874	4102	5976			197358				I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding	g.chr16:3600416C>T	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3600416C>T						NLRC3_uc010bto.1_Silent_p.L76L	p.L811L	NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN			12	2844	-			811			LRR 8.		Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	37	c.2433G>A																																																																																					0.572	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844		10	21	0	0	0	0.008291	0	10	21				
RBFOX1	54715	broad.mit.edu	37	16	7568325	7568325	+	Silent	SNP	C	C	A	rs184452994	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:7568325C>A	ENST00000550418.1	+	5	1192	c.204C>A	c.(202-204)ccC>ccA	p.P68P	RBFOX1_ENST00000436368.2_Silent_p.P88P|RBFOX1_ENST00000311745.5_Silent_p.P88P|RBFOX1_ENST00000355637.4_Silent_p.P88P|RBFOX1_ENST00000340209.4_Silent_p.P73P|RBFOX1_ENST00000535565.2_Silent_p.P104P|RBFOX1_ENST00000422070.4_Silent_p.P111P|RBFOX1_ENST00000547338.1_Silent_p.P68P|RBFOX1_ENST00000547372.1_Silent_p.P111P|RBFOX1_ENST00000553186.1_Silent_p.P68P|RBFOX1_ENST00000552089.1_Silent_p.P104P	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	68					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.P88P(2)|p.P68P(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TGTACCCTCCCGCCCAGACGC	0.642																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(202-204)CCC>CCA		ataxin 2-binding protein 1 isoform 4							116.0	110.0	112.0					16																	7568325		2197	4300	6497	SO:0001819	synonymous_variant	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7568325C>A	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.204C>A	16.37:g.7568325C>A						A2BP1_uc010buf.1_Silent_p.P68P|A2BP1_uc002cyr.1_Silent_p.P68P|A2BP1_uc002cyt.2_Silent_p.P68P|A2BP1_uc010uxz.1_Silent_p.P111P|A2BP1_uc010uya.1_Silent_p.P104P|A2BP1_uc002cyv.1_Silent_p.P68P|A2BP1_uc010uyb.1_Silent_p.P68P|A2BP1_uc002cyw.2_Silent_p.P88P|A2BP1_uc002cyy.2_Silent_p.P88P|A2BP1_uc002cyx.2_Silent_p.P88P|A2BP1_uc010uyc.1_Silent_p.P88P	p.P68P	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	5	1192	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	68					Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	37	c.204C>A	CCDS55983.1																																																																																				0.642	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		54	111	1	0	4.33383e-22	0.00361	7.78621e-22	54	111				
DNAH3	55567	broad.mit.edu	37	16	21011740	21011740	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:21011740G>C	ENST00000261383.3	-	43	6226	c.6227C>G	c.(6226-6228)aCa>aGa	p.T2076R	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2076	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.T2076R(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCCAGTGCCTGTGGGACCCAC	0.498																																							uc010vbe.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(6226-6228)ACA>AGA		dynein, axonemal, heavy chain 3							208.0	176.0	187.0					16																	21011740		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21011740G>C	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.6227C>G	16.37:g.21011740G>C	ENSP00000261383:p.Thr2076Arg						p.T2076R	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	43	6227	-			2076			AAA 3 (By similarity).|ATP (Potential).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.6227C>G	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752573	0.89753	.	.	ENSG00000158486	ENST00000261383	T	0.46451	0.87	5.52	5.52	0.82312	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.78097	0.4230	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85246	0.1041	10	0.87932	D	0	.	19.8041	0.96521	0.0:0.0:1.0:0.0	.	2076	Q8TD57	DYH3_HUMAN	R	2076	ENSP00000261383:T2076R	ENSP00000261383:T2076R	T	-	2	0	DNAH3	20919241	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.477000	0.97925	2.756000	0.94617	0.563000	0.77884	ACA		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		12	27	0	0	0	0.001368	0	12	27				
SCNN1B	6338	broad.mit.edu	37	16	23364156	23364156	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:23364156G>T	ENST00000343070.2	+	3	522	c.346G>T	c.(346-348)Gat>Tat	p.D116Y	SCNN1B_ENST00000569789.1_3'UTR|SCNN1B_ENST00000307331.5_Missense_Mutation_p.D161Y|SCNN1B_ENST00000568923.1_Missense_Mutation_p.D116Y|SCNN1B_ENST00000568085.1_Missense_Mutation_p.D116Y	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	116					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.D116Y(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GAAGGACCTGGATGAGCTGAT	0.502																																							uc002dln.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7						c.(346-348)GAT>TAT		sodium channel, nonvoltage-gated 1, beta	Amiloride(DB00594)|Triamterene(DB00384)						103.0	93.0	97.0					16																	23364156		2197	4300	6497	SO:0001583	missense	6338				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding	g.chr16:23364156G>T	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.346G>T	16.37:g.23364156G>T	ENSP00000345751:p.Asp116Tyr						p.D116Y	NM_000336	NP_000327	P51168	SCNNB_HUMAN		GBM - Glioblastoma multiforme(48;0.0465)	3	522	+			116			Extracellular (By similarity).		C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	c.346G>T	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132285	0.56828	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.62788	-0.0;-0.0	5.0	5.0	0.66597	.	0.871320	0.10093	N	0.716948	T	0.75510	0.3859	M	0.88105	2.93	0.52501	D	0.999954	B	0.27316	0.175	B	0.35607	0.206	T	0.74269	-0.3720	10	0.66056	D	0.02	-11.9282	17.2866	0.87143	0.0:0.0:1.0:0.0	.	116	P51168	SCNNB_HUMAN	Y	116;161	ENSP00000345751:D116Y;ENSP00000302874:D161Y	ENSP00000302874:D161Y	D	+	1	0	SCNN1B	23271657	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	6.199000	0.72112	2.290000	0.77057	0.563000	0.77884	GAT		0.502	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2			26	42	1	0	1.42536e-11	0.004656	2.10331e-11	26	42				
ARHGAP17	55114	broad.mit.edu	37	16	24981854	24981854	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:24981854C>A	ENST00000289968.6	-	4	315	c.246G>T	c.(244-246)tcG>tcT	p.S82S	ARHGAP17_ENST00000441763.2_Silent_p.S82S|ARHGAP17_ENST00000575975.1_5'UTR|ARHGAP17_ENST00000303665.5_Silent_p.S82S	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	82	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)	p.S82S(2)		breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CCAGCTGAGTCGATGCTTCTT	0.463																																							uc002dnb.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(244-246)TCG>TCT		nadrin isoform 1							226.0	215.0	219.0					16																	24981854		2197	4300	6497	SO:0001819	synonymous_variant	55114				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding	g.chr16:24981854C>A	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.246G>T	16.37:g.24981854C>A						ARHGAP17_uc002dnc.2_Silent_p.S82S|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dnf.2_5'Flank|ARHGAP17_uc002dng.1_Silent_p.S82S	p.S82S	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN		GBM - Glioblastoma multiforme(48;0.0407)	4	339	-			82			BAR.		A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Silent	SNP	ENST00000289968.6	37	c.246G>T	CCDS32409.1																																																																																				0.463	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054		55	156	1	0	5.86059e-21	0.00361	1.0325e-20	55	156				
KIAA0556	23247	broad.mit.edu	37	16	27751579	27751579	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:27751579A>G	ENST00000261588.4	+	15	1980	c.1961A>G	c.(1960-1962)gAg>gGg	p.E654G		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	654						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E654G(2)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GGGGACAAGGAGCTTGGTCTC	0.507																																							uc002dow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						c.(1960-1962)GAG>GGG		hypothetical protein LOC23247							65.0	63.0	64.0					16																	27751579		2197	4300	6497	SO:0001583	missense	23247							g.chr16:27751579A>G	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1961A>G	16.37:g.27751579A>G	ENSP00000261588:p.Glu654Gly						p.E654G	NM_015202	NP_056017	O60303	K0556_HUMAN			15	1985	+			654					A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	c.1961A>G	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.819612	0.32145	.	.	ENSG00000047578	ENST00000261588	T	0.12039	2.72	5.14	1.55	0.23275	.	0.273281	0.30260	N	0.010038	T	0.11965	0.0291	L	0.56769	1.78	0.09310	N	1	P	0.41848	0.763	B	0.39840	0.311	T	0.20371	-1.0277	10	0.66056	D	0.02	-0.1984	2.4786	0.04581	0.6078:0.1579:0.0831:0.1512	.	654	O60303	K0556_HUMAN	G	654	ENSP00000261588:E654G	ENSP00000261588:E654G	E	+	2	0	KIAA0556	27659080	0.008000	0.16893	0.000000	0.03702	0.013000	0.08279	0.982000	0.29539	-0.016000	0.14127	-0.250000	0.11733	GAG		0.507	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		9	48	0	0	0	0.006214	0	9	48				
KIAA0556	23247	broad.mit.edu	37	16	27761018	27761018	+	Missense_Mutation	SNP	C	C	T	rs150681595		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:27761018C>T	ENST00000261588.4	+	16	2756	c.2737C>T	c.(2737-2739)Cgc>Tgc	p.R913C		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	913						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R913C(2)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CCACCGGGGACGCATCTCCAA	0.642																																							uc002dow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						c.(2737-2739)CGC>TGC		hypothetical protein LOC23247		C	CYS/ARG	1,4393	2.1+/-5.4	0,1,2196	58.0	55.0	56.0		2737	3.7	1.0	16	dbSNP_134	56	0,8600		0,0,4300	no	missense	KIAA0556	NM_015202.2	180	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	probably-damaging	913/1619	27761018	1,12993	2197	4300	6497	SO:0001583	missense	23247							g.chr16:27761018C>T	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.2737C>T	16.37:g.27761018C>T	ENSP00000261588:p.Arg913Cys						p.R913C	NM_015202	NP_056017	O60303	K0556_HUMAN			16	2761	+			913					A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	c.2737C>T	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200656	0.79015	2.28E-4	0.0	ENSG00000047578	ENST00000261588	T	0.31510	1.49	4.7	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.51770	0.1694	M	0.68952	2.095	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.55075	-0.8197	10	0.87932	D	0	-1.33	12.2541	0.54615	0.3069:0.6931:0.0:0.0	.	913	O60303	K0556_HUMAN	C	913	ENSP00000261588:R913C	ENSP00000261588:R913C	R	+	1	0	KIAA0556	27668519	0.999000	0.42202	0.968000	0.41197	0.892000	0.51952	4.209000	0.58493	1.076000	0.40961	0.655000	0.94253	CGC		0.642	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		26	44	0	0	0	0.008361	0	26	44				
SEZ6L2	26470	broad.mit.edu	37	16	29889672	29889672	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:29889672C>A	ENST00000308713.5	-	10	2175	c.1648G>T	c.(1648-1650)Ggc>Tgc	p.G550C	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.G480C|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.G506C|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.G436C	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	550	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.G480C(1)|p.G550C(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAGTCTTGGCCCGGGCTATAG	0.602																																							uc002duq.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1648-1650)GGC>TGC		seizure related 6 homolog (mouse)-like 2 isoform							95.0	80.0	85.0					16																	29889672		2197	4300	6497	SO:0001583	missense	26470					endoplasmic reticulum membrane|integral to membrane|plasma membrane		g.chr16:29889672C>A	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1648G>T	16.37:g.29889672C>A	ENSP00000312550:p.Gly550Cys					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.G480C|SEZ6L2_uc002dur.3_Missense_Mutation_p.G480C|SEZ6L2_uc002dus.3_Missense_Mutation_p.G436C|SEZ6L2_uc010vec.1_Missense_Mutation_p.G550C|SEZ6L2_uc010ved.1_Missense_Mutation_p.G506C	p.G550C	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN			10	1888	-			550			CUB 3.|Extracellular (Potential).		B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	c.1648G>T	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768119	0.90020	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.42	4.47	0.54385	CUB (5);	0.000000	0.56097	D	0.000030	T	0.62551	0.2437	M	0.91300	3.195	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.999;1.0;1.0;1.0	T	0.71334	-0.4624	10	0.72032	D	0.01	.	12.9419	0.58350	0.0:0.9203:0.0:0.0797	.	506;550;436;480;550;480	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	C	480;550;436;506	ENSP00000310206:G480C;ENSP00000312550:G550C;ENSP00000319215:G436C;ENSP00000439412:G506C	ENSP00000312550:G550C	G	-	1	0	SEZ6L2	29797173	1.000000	0.71417	0.868000	0.34077	0.971000	0.66376	5.776000	0.68924	1.291000	0.44653	0.655000	0.94253	GGC		0.602	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410		9	32	1	0	7.03913e-09	0.001368	9.4449e-09	9	32				
FBXL19	54620	broad.mit.edu	37	16	30941500	30941500	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:30941500G>T	ENST00000380310.2	+	7	1114	c.956G>T	c.(955-957)cGg>cTg	p.R319L	FBXL19_ENST00000338343.4_Missense_Mutation_p.R299L|FBXL19_ENST00000562319.1_Missense_Mutation_p.R299L|FBXL19_ENST00000565690.1_Missense_Mutation_p.R183L|FBXL19_ENST00000471231.2_Missense_Mutation_p.R7L	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	319					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R319L(1)|p.R149L(1)		breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						CTGCTGGAACGGGTGCCTGAC	0.657																																							uc002eab.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|breast(1)	4						c.(955-957)CGG>CTG		F-box and leucine-rich repeat protein 19							42.0	48.0	46.0					16																	30941500		2120	4224	6344	SO:0001583	missense	54620						DNA binding|zinc ion binding	g.chr16:30941500G>T	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.956G>T	16.37:g.30941500G>T	ENSP00000369666:p.Arg319Leu					FBXL19_uc002dzz.1_Missense_Mutation_p.R7L|FBXL19_uc002eaa.1_Missense_Mutation_p.R218L	p.R319L	NM_001099784	NP_001093254	Q6PCT2	FXL19_HUMAN			7	1114	+			319					A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	37	c.956G>T	CCDS45465.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718681	0.89205	.	.	ENSG00000099364	ENST00000338343;ENST00000380310	T;T	0.31769	1.48;1.79	4.85	4.85	0.62838	.	1.103000	0.07054	N	0.832499	T	0.39682	0.1087	N	0.14661	0.345	0.53005	D	0.999963	D;D	0.67145	0.993;0.996	D;D	0.76575	0.972;0.988	T	0.19549	-1.0302	10	0.07990	T	0.79	-13.9643	17.1053	0.86660	0.0:0.0:1.0:0.0	.	319;276	Q6PCT2;Q6PCT2-2	FXL19_HUMAN;.	L	299;319	ENSP00000339712:R299L;ENSP00000369666:R319L	ENSP00000339712:R299L	R	+	2	0	FBXL19	30849001	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.862000	0.69560	2.409000	0.81822	0.655000	0.94253	CGG		0.657	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_019085		17	41	1	0	1.67942e-08	0.006122	2.20605e-08	17	41				
ITGAD	3681	broad.mit.edu	37	16	31422671	31422671	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:31422671G>T	ENST00000389202.2	+	14	1589	c.1540G>T	c.(1540-1542)Ggc>Tgc	p.G514C		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	514					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.G514C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TGGTGAGCAGGGCCACCCCTG	0.627																																							uc002ebv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1540-1542)GGC>TGC		integrin, alpha D precursor							112.0	112.0	112.0					16																	31422671		2197	4300	6497	SO:0001583	missense	3681				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr16:31422671G>T	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1540G>T	16.37:g.31422671G>T	ENSP00000373854:p.Gly514Cys					ITGAD_uc010cap.1_Missense_Mutation_p.G515C	p.G514C	NM_005353	NP_005344	Q13349	ITAD_HUMAN			14	1589	+			514			FG-GAP 6.|Extracellular (Potential).		Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	c.1540G>T	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196971	0.58126	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.36878	1.23	4.49	4.49	0.54785	.	.	.	.	.	T	0.69015	0.3064	H	0.95043	3.615	0.41423	D	0.987816	D;D	0.76494	0.999;0.999	D;D	0.74348	0.983;0.983	T	0.79257	-0.1878	9	0.87932	D	0	.	12.6781	0.56906	0.0:0.0:1.0:0.0	.	530;514	Q59H14;Q13349	.;ITAD_HUMAN	C	530;514	ENSP00000373854:G514C	ENSP00000373854:G514C	G	+	1	0	ITGAD	31330172	1.000000	0.71417	0.996000	0.52242	0.801000	0.45260	6.607000	0.74163	2.022000	0.59522	0.407000	0.27541	GGC		0.627	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353		43	97	1	0	1.68508e-10	0.009718	2.37105e-10	43	97				
SLC5A2	6524	broad.mit.edu	37	16	31500068	31500068	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:31500068G>A	ENST00000330498.3	+	10	1274	c.1255G>A	c.(1255-1257)Gac>Aac	p.D419N	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	419					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)	p.D419N(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	ACGCGCCGGCGACCGCGAGCT	0.711																																							uc002ecf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1255-1257)GAC>AAC		solute carrier family 5 (sodium/glucose							12.0	12.0	12.0					16																	31500068		2188	4291	6479	SO:0001583	missense	6524				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity	g.chr16:31500068G>A		CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1255G>A	16.37:g.31500068G>A	ENSP00000327943:p.Asp419Asn					SLC5A2_uc010car.2_Intron|C16orf58_uc002ecg.2_RNA	p.D419N	NM_003041	NP_003032	P31639	SC5A2_HUMAN			10	1274	+			419			Extracellular (Potential).		A2RRD2	Missense_Mutation	SNP	ENST00000330498.3	37	c.1255G>A	CCDS10714.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372579	0.42003	.	.	ENSG00000140675	ENST00000330498	D	0.87966	-2.32	4.46	3.51	0.40186	.	0.173453	0.49916	D	0.000132	T	0.77089	0.4079	N	0.17872	0.535	0.50313	D	0.999862	B	0.11235	0.004	B	0.09377	0.004	T	0.72027	-0.4414	10	0.51188	T	0.08	.	10.4237	0.44365	0.0955:0.0:0.9045:0.0	.	419	P31639	SC5A2_HUMAN	N	419	ENSP00000327943:D419N	ENSP00000327943:D419N	D	+	1	0	SLC5A2	31407569	1.000000	0.71417	0.027000	0.17364	0.316000	0.28119	3.892000	0.56235	1.121000	0.41925	-0.254000	0.11334	GAC		0.711	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255627.2			10	14	0	0	0	0.008291	0	10	14				
FAM101B	359845	broad.mit.edu	37	17	293213	293213	+	Silent	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:293213C>G	ENST00000329099.4	-	2	176	c.177G>C	c.(175-177)gcG>gcC	p.A59A		NM_182705.2	NP_874364.1	Q8N5W9	F101B_HUMAN	family with sequence similarity 101, member B	129					actin cytoskeleton organization (GO:0030036)|epithelial to mesenchymal transition (GO:0001837)	actin cytoskeleton (GO:0015629)	filamin binding (GO:0031005)	p.A59A(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)|urinary_tract(1)	13		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		AGGAGGCCACCGCCAGGCCCA	0.662																																							uc002frj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(175-177)GCG>GCC		hypothetical protein LOC359845							64.0	72.0	70.0					17																	293213		2170	4254	6424	SO:0001819	synonymous_variant	359845							g.chr17:293213C>G			17p13	2008-10-23			ENSG00000183688	ENSG00000183688			28705	protein-coding gene	gene with protein product		615928				12477932	Standard	NM_182705		Approved	MGC45871	uc002frj.3	Q8N5W9	OTTHUMG00000132483	ENST00000329099.4:c.177G>C	17.37:g.293213C>G							p.A59A	NM_182705	NP_874364	Q8N5W9	F101B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)	2	451	-		Myeloproliferative disorder(207;0.204)	129						Silent	SNP	ENST00000329099.4	37	c.177G>C																																																																																					0.662	FAM101B-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255652.1	NM_182705		24	26	0	0	0	0.003954	0	24	26				
TP53	7157	broad.mit.edu	37	17	7577565	7577565	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:7577565T>C	ENST00000269305.4	-	7	905	c.716A>G	c.(715-717)aAc>aGc	p.N239S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.N239S|TP53_ENST00000455263.2_Missense_Mutation_p.N239S|TP53_ENST00000445888.2_Missense_Mutation_p.N239S|TP53_ENST00000359597.4_Missense_Mutation_p.N239S|TP53_ENST00000420246.2_Missense_Mutation_p.N239S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239S(28)|p.0?(8)|p.?(5)|p.N239T(4)|p.M237_N239delMCN(4)|p.N146S(3)|p.N239_C242delNSSC(3)|p.N239fs*25(2)|p.N239_S240delNS(2)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238fs*21(1)|p.N239I(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.N239fs*>48(1)|p.N146fs*>10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGAACTGTTACACATGTA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		76	Substitution - Missense(36)|Deletion - In frame(14)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(4)|Substitution - Nonsense(1)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	p.N239D(31)|p.N239S(19)|p.N239fs*25(12)|p.0?(7)|p.N239Y(6)|p.N239K(6)|p.N239T(4)|p.N239_C242delNSSC(3)|p.N239_S240insX(2)|p.N239fs*8(2)|p.N239_S240delNS(2)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.M237_N239delMCN(1)|p.N239fs*26(1)|p.C238fs*21(1)|p.N239N(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.N239fs*0(1)|p.N239_C242del(1)	biliary_tract(10)|urinary_tract(6)|lung(6)|ovary(6)|upper_aerodigestive_tract(5)|haematopoietic_and_lymphoid_tissue(5)|oesophagus(5)|breast(5)|bone(5)|central_nervous_system(4)|large_intestine(4)|endometrium(4)|kidney(4)|stomach(3)|thyroid(1)|soft_tissue(1)|liver(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(715-717)AAC>AGC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							135.0	105.0	115.0					17																	7577565		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577565T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.716A>G	17.37:g.7577565T>C	ENSP00000269305:p.Asn239Ser	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.N239S|TP53_uc002gih.2_Missense_Mutation_p.N239S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.N107S|TP53_uc010cng.1_Missense_Mutation_p.N107S|TP53_uc002gii.1_Missense_Mutation_p.N107S|TP53_uc010cnh.1_Missense_Mutation_p.N239S|TP53_uc010cni.1_Missense_Mutation_p.N239S|TP53_uc002gij.2_Missense_Mutation_p.N239S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.N146S|TP53_uc002gio.2_Missense_Mutation_p.N107S	p.N239S	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	910	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	239		N -> Y (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> D (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.716A>G	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565663	0.86439	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	M	0.87381	2.88	0.58432	D	0.999991	D;B;D;D;D;D	0.89917	0.988;0.31;0.999;0.98;0.99;1.0	P;B;D;P;P;D	0.87578	0.826;0.104;0.981;0.815;0.891;0.998	D	0.97237	0.9888	10	0.87932	D	0	-35.9081	12.3101	0.54924	0.0:0.0:0.0:1.0	.	239;239;146;239;239;239	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	239;239;239;239;239;239;228;146;107;146	ENSP00000410739:N239S;ENSP00000352610:N239S;ENSP00000269305:N239S;ENSP00000398846:N239S;ENSP00000391127:N239S;ENSP00000391478:N239S;ENSP00000425104:N107S;ENSP00000423862:N146S	ENSP00000269305:N239S	N	-	2	0	TP53	7518290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.074000	0.62210	0.379000	0.24179	AAC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		8	11	0	0	0	0.004482	0	8	11				
C17orf59	54785	broad.mit.edu	37	17	8092736	8092736	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:8092736G>A	ENST00000389017.4	-	1	828	c.723C>T	c.(721-723)ccC>ccT	p.P241P	MIR3676_ENST00000579470.1_RNA	NM_017622.2	NP_060092.2	Q96GS4	CQ059_HUMAN	chromosome 17 open reading frame 59	241	Pro-rich.							p.P241P(1)|p.P107P(1)		large_intestine(2)|lung(3)|urinary_tract(1)	6						GCGCTGGGCAGGGCCGCGCAG	0.701																																							uc010vut.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(721-723)CCC>CCT		hypothetical protein LOC54785							16.0	15.0	15.0					17																	8092736		2181	4270	6451	SO:0001819	synonymous_variant	54785							g.chr17:8092736G>A	BC018880	CCDS11133.2	17p13.1	2005-12-16			ENSG00000196544	ENSG00000196544			25939	protein-coding gene	gene with protein product						12477932	Standard	NM_017622		Approved	FLJ20014	uc010vut.2	Q96GS4	OTTHUMG00000153930	ENST00000389017.4:c.723C>T	17.37:g.8092736G>A							p.P241P	NM_017622	NP_060092	Q96GS4	CQ059_HUMAN			1	829	-			241			Pro-rich.		Q53HS4|Q9NXW8	Silent	SNP	ENST00000389017.4	37	c.723C>T	CCDS11133.2																																																																																				0.701	C17orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333072.1	NM_017622		9	2	0	0	0	0.004482	0	9	2				
RAI1	10743	broad.mit.edu	37	17	17701461	17701461	+	Silent	SNP	G	G	T	rs146112263	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:17701461G>T	ENST00000353383.1	+	3	5668	c.5199G>T	c.(5197-5199)tcG>tcT	p.S1733S	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1733					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)	p.S1733S(1)		breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		AGGAGGCCTCGCTGCCGCTTG	0.642																																							uc002grm.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(5197-5199)TCG>TCT		retinoic acid induced 1							33.0	36.0	35.0					17																	17701461		2203	4300	6503	SO:0001819	synonymous_variant	10743					cytoplasm|nucleus	zinc ion binding	g.chr17:17701461G>T	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5199G>T	17.37:g.17701461G>T						RAI1_uc002grn.1_Silent_p.S1733S	p.S1733S	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN		READ - Rectum adenocarcinoma(1115;0.0276)	3	5668	+			1733					Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	37	c.5199G>T	CCDS11188.1																																																																																				0.642	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665		13	29	1	0	7.03913e-09	0.001368	9.4449e-09	13	29				
SPECC1	92521	broad.mit.edu	37	17	20000015	20000015	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:20000015C>T	ENST00000261503.5	+	2	102	c.51C>T	c.(49-51)caC>caT	p.H17H	SPECC1_ENST00000395527.4_Silent_p.H17H|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395529.3_Silent_p.H17H	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	17					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.H17H(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CAGGGGGCCACGGCCCAGACC	0.567																																							uc002gwq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(49-51)CAC>CAT		spectrin domain with coiled-coils 1 NSP5b3b							66.0	75.0	72.0					17																	20000015		2203	4300	6503	SO:0001819	synonymous_variant	92521					nucleus		g.chr17:20000015C>T	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.51C>T	17.37:g.20000015C>T						CYTSB_uc010cqx.2_Silent_p.H17H|CYTSB_uc002gwr.2_Silent_p.H17H|CYTSB_uc002gws.2_Silent_p.H17H	p.H17H	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN			2	196	+			17					B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Silent	SNP	ENST00000261503.5	37	c.51C>T	CCDS32590.1																																																																																				0.567	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		8	120	0	0	0	0.00308	0	8	120				
KCNJ12	3768	broad.mit.edu	37	17	21319719	21319719	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:21319719C>A	ENST00000583088.1	+	3	1960	c.1065C>A	c.(1063-1065)ccC>ccA	p.P355P	KCNJ12_ENST00000331718.5_Silent_p.P355P	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	355					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.P355P(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CCTCTACGCCCCGCTGCAGTG	0.577										Prostate(3;0.18)																													uc002gyv.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(1063-1065)CCC>CCA		potassium inwardly-rectifying channel, subfamily	Dofetilide(DB00204)						114.0	112.0	113.0					17																	21319719		2203	4300	6503	SO:0001819	synonymous_variant	3768				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity	g.chr17:21319719C>A	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1065C>A	17.37:g.21319719C>A		Prostate(3;0.18)					p.P355P	NM_021012	NP_066292	Q14500	IRK12_HUMAN		Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	3	1770	+			355			Cytoplasmic (By similarity).		O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	c.1065C>A	CCDS11219.1																																																																																				0.577	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		15	68	1	0	2.32078e-09	0.003163	3.18108e-09	15	68				
EFCAB5	374786	broad.mit.edu	37	17	28380557	28380557	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:28380557G>T	ENST00000394835.3	+	10	1777	c.1585G>T	c.(1585-1587)Ggc>Tgc	p.G529C	EFCAB5_ENST00000536908.2_Missense_Mutation_p.G473C|EFCAB5_ENST00000320856.5_Missense_Mutation_p.G529C|EFCAB5_ENST00000394832.2_Missense_Mutation_p.G529C|EFCAB5_ENST00000541045.1_Missense_Mutation_p.G186C|EFCAB5_ENST00000378738.3_Missense_Mutation_p.G529C	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	529							calcium ion binding (GO:0005509)	p.G529C(1)		breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						ACAACAACAAGGCAAAAAGCC	0.428																																							uc002het.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1585-1587)GGC>TGC		EF-hand calcium binding domain 5 isoform a							83.0	79.0	81.0					17																	28380557		1966	4155	6121	SO:0001583	missense	374786						calcium ion binding	g.chr17:28380557G>T	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1585G>T	17.37:g.28380557G>T	ENSP00000378312:p.Gly529Cys					EFCAB5_uc010wbi.1_Missense_Mutation_p.G272C|EFCAB5_uc010wbj.1_Missense_Mutation_p.G473C|EFCAB5_uc010wbk.1_Missense_Mutation_p.G186C|EFCAB5_uc010csd.2_RNA|EFCAB5_uc010cse.2_Missense_Mutation_p.G408C|EFCAB5_uc010csf.2_Missense_Mutation_p.G408C	p.G529C	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN			10	1777	+			529					B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	37	c.1585G>T	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857114	0.51376	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	T;T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14;0.14	5.58	-0.48	0.12085	.	2.547210	0.01266	N	0.009307	T	0.67468	0.2896	L	0.43152	1.355	0.09310	N	1	D;D;D;D;D;D	0.76494	0.998;0.996;0.996;0.999;0.996;0.992	P;P;P;D;P;P	0.65443	0.747;0.794;0.794;0.935;0.794;0.719	T	0.53711	-0.8400	10	0.56958	D	0.05	1.7192	8.0291	0.30454	0.1702:0.5164:0.3134:0.0	.	473;473;529;529;529;529	B4DS75;F5GYL2;A8MSY9;B5MEA3;E7EVS9;A4FU69	.;.;.;.;.;EFCB5_HUMAN	C	473;272;186;529;529;529;529;473;335	ENSP00000440619:G473C;ENSP00000445575:G186C;ENSP00000378312:G529C;ENSP00000322003:G529C;ENSP00000378309:G529C;ENSP00000368012:G529C;ENSP00000417009:G335C	ENSP00000322003:G529C	G	+	1	0	EFCAB5	25404683	0.067000	0.21026	0.007000	0.13788	0.016000	0.09150	0.164000	0.16542	-0.179000	0.10654	-0.175000	0.13238	GGC		0.428	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529		10	23	1	0	6.40141e-05	0.000978	7.47027e-05	10	23				
SLFN11	91607	broad.mit.edu	37	17	33690157	33690157	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:33690157G>T	ENST00000394566.1	-	4	942	c.670C>A	c.(670-672)Caa>Aaa	p.Q224K	SLFN11_ENST00000308377.4_Missense_Mutation_p.Q224K	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	224					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.Q224K(1)		autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACATATTCTTGGAAGTGTTTT	0.373																																							uc010ctp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(670-672)CAA>AAA		schlafen family member 11							132.0	137.0	135.0					17																	33690157		2203	4300	6503	SO:0001583	missense	91607					nucleus	ATP binding	g.chr17:33690157G>T	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.670C>A	17.37:g.33690157G>T	ENSP00000378067:p.Gln224Lys					SLFN11_uc010ctq.2_Missense_Mutation_p.Q224K|SLFN11_uc002hjh.3_Missense_Mutation_p.Q224K|SLFN11_uc002hjg.3_Missense_Mutation_p.Q224K|SLFN11_uc010ctr.2_Missense_Mutation_p.Q224K	p.Q224K	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	4	1112	-		Ovarian(249;0.17)	224					E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	ENST00000394566.1	37	c.670C>A	CCDS11294.1	.	.	.	.	.	.	.	.	.	.	G	7.535	0.659584	0.14645	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	T;T	0.26810	1.71;1.71	4.33	-0.654	0.11443	.	2.023680	0.02856	N	0.129650	T	0.16642	0.0400	N	0.25890	0.77	0.09310	N	1	B	0.20550	0.046	B	0.20384	0.029	T	0.21449	-1.0245	10	0.05833	T	0.94	.	8.6064	0.33775	0.0:0.4733:0.3653:0.1614	.	224	Q7Z7L1	SLN11_HUMAN	K	224	ENSP00000312402:Q224K;ENSP00000378067:Q224K	ENSP00000312402:Q224K	Q	-	1	0	SLFN11	30714270	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.616000	0.02053	0.076000	0.16826	0.655000	0.94253	CAA		0.373	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270		38	101	1	0	2.87052e-16	0.005524	4.72966e-16	38	101				
KRT39	390792	broad.mit.edu	37	17	39119941	39119941	+	Missense_Mutation	SNP	G	G	T	rs145339869	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:39119941G>T	ENST00000355612.2	-	3	681	c.646C>A	c.(646-648)Cta>Ata	p.L216I	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	216	Coil 1B.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.L216I(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				TGTGCCTCTAGGTCGGCCTTG	0.498																																							uc002hvo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(646-648)CTA>ATA		type I hair keratin KA35							192.0	172.0	178.0					17																	39119941		2203	4296	6499	SO:0001583	missense	390792					intermediate filament	structural molecule activity	g.chr17:39119941G>T	AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.646C>A	17.37:g.39119941G>T	ENSP00000347823:p.Leu216Ile					KRT39_uc010wfm.1_5'UTR	p.L216I	NM_213656	NP_998821	Q6A163	K1C39_HUMAN			3	682	-		Breast(137;0.00043)|Ovarian(249;0.15)	216			Rod.|Coil 1B.		B2RXK6|Q6IFU6	Missense_Mutation	SNP	ENST00000355612.2	37	c.646C>A	CCDS11382.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976270	0.74360	.	.	ENSG00000196859	ENST00000355612	D	0.93659	-3.26	5.44	4.26	0.50523	Filament (1);	0.000000	0.35495	N	0.003170	D	0.97439	0.9162	H	0.94542	3.55	0.35585	D	0.806589	D	0.89917	1.0	D	0.78314	0.991	D	0.99959	1.1692	10	0.87932	D	0	.	14.7921	0.69851	0.0829:0.0:0.9171:0.0	.	216	Q6A163	K1C39_HUMAN	I	216	ENSP00000347823:L216I	ENSP00000347823:L216I	L	-	1	2	KRT39	36373467	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	4.368000	0.59505	2.563000	0.86464	0.650000	0.86243	CTA		0.498	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257287.1	NM_213656		20	65	1	0	1.55795e-14	0.001882	2.45869e-14	20	65				
KRTAP4-8	728224	broad.mit.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																							uc010wfo.1		NA																	4	Substitution - Missense(4)		endometrium(3)|kidney(1)		0						c.(283-285)TGC>AGC		keratin associated protein 4.8							7.0	11.0	10.0					17																	39254054		685	1582	2267	SO:0001583	missense	728224					keratin filament		g.chr17:39254054A>T	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser						p.C95S	NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN			1	322	-			95			25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].|15.		A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	c.283T>A	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960		5	28	0	0	0	0.000602	0	5	28				
HAP1	9001	broad.mit.edu	37	17	39888998	39888998	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:39888998G>T	ENST00000310778.5	-	2	531	c.522C>A	c.(520-522)gtC>gtA	p.V174V	RN7SL399P_ENST00000471648.2_RNA|HAP1_ENST00000393939.2_Silent_p.V174V|JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Silent_p.V174V|HAP1_ENST00000347901.4_Silent_p.V174V			P54257	HAP1_HUMAN	huntingtin-associated protein 1	174	HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)	p.V174V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			ACATCACTTTGACGTCTTCCT	0.522																																							uc002hxm.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(520-522)GTC>GTA		huntingtin-associated protein 1 isoform 2							157.0	137.0	144.0					17																	39888998		2203	4300	6503	SO:0001819	synonymous_variant	9001				brain development|protein localization|synaptic transmission	actin cytoskeleton	protein binding	g.chr17:39888998G>T	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.522C>A	17.37:g.39888998G>T						JUP_uc010wfs.1_Intron|HAP1_uc002hxn.1_Silent_p.V174V|HAP1_uc002hxo.1_Silent_p.V174V|HAP1_uc002hxp.1_Silent_p.V174V	p.V174V	NM_177977	NP_817084	P54257	HAP1_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.0677)		2	534	-		Breast(137;0.000162)	174			HAP1 N-terminal.		A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Silent	SNP	ENST00000310778.5	37	c.522C>A																																																																																					0.522	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949		19	58	1	0	5.03518e-11	0.007413	7.27813e-11	19	58				
STAT5B	6777	broad.mit.edu	37	17	40364013	40364013	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:40364013G>A	ENST00000293328.3	-	13	1837	c.1669C>T	c.(1669-1671)Cag>Tag	p.Q557*		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	557					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.Q557*(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CTGTTGAACTGGGACCAGGAC	0.587																																							uc002hzh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|lung(2)|skin(1)	6						c.(1669-1671)CAG>TAG		signal transducer and activator of transcription	Dasatinib(DB01254)						57.0	45.0	49.0					17																	40364013		2203	4300	6503	SO:0001587	stop_gained	6777				2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity	g.chr17:40364013G>A	BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1669C>T	17.37:g.40364013G>A	ENSP00000293328:p.Gln557*						p.Q557*	NM_012448	NP_036580	P51692	STA5B_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.135)	13	1838	-		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)	557					Q8WWS8	Nonsense_Mutation	SNP	ENST00000293328.3	37	c.1669C>T	CCDS11423.1	.	.	.	.	.	.	.	.	.	.	G	39	7.902329	0.98551	.	.	ENSG00000173757	ENST00000293328	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-1.3872	19.4067	0.94649	0.0:0.0:1.0:0.0	.	.	.	.	X	557	.	ENSP00000293328:Q557X	Q	-	1	0	STAT5B	37617539	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.657000	0.98554	2.826000	0.97356	0.491000	0.48974	CAG		0.587	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448		4	10	0	0	0	0.009096	0	4	10				
MAP3K14	9020	broad.mit.edu	37	17	43368045	43368045	+	RNA	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:43368045G>A	ENST00000344686.2	-	0	175							Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase 14						cellular response to mechanical stimulus (GO:0071260)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|T cell costimulation (GO:0031295)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|NF-kappaB-inducing kinase activity (GO:0004704)|protein kinase activity (GO:0004672)	p.P23S(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TTGGCTTTGGGGAGTTCCTTC	0.592																																							uc002iiw.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|breast(2)|lung(1)|ovary(1)|stomach(1)	8						c.(67-69)CCC>TCC		mitogen-activated protein kinase kinase kinase							68.0	74.0	72.0					17																	43368045		1956	4135	6091			9020				cellular response to mechanical stimulus|I-kappaB kinase/NF-kappaB cascade|immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade|T cell costimulation	cytosol	ATP binding|MAP kinase kinase kinase activity|NF-kappaB-inducing kinase activity|protein binding	g.chr17:43368045G>A	Y10256	CCDS74079.1	17q21.31	2014-06-16			ENSG00000006062	ENSG00000006062	2.7.11.25	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6853	protein-coding gene	gene with protein product	"""serine/threonine protein-kinase"""	604655				9020361	Standard	NM_003954		Approved	NIK, HSNIK, FTDCR1B, HS	uc002iiw.1	Q99558	OTTHUMG00000180364		17.37:g.43368045G>A						MAP3K14_uc002iiv.1_5'UTR	p.P23S	NM_003954	NP_003945	Q99558	M3K14_HUMAN			2	176	-			23					A8K2D8|D3DX67|Q8IYN1	Missense_Mutation	SNP	ENST00000344686.2	37	c.67C>T		.	.	.	.	.	.	.	.	.	.	G	8.564	0.878456	0.17395	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.09	0.828	0.18841	.	0.642711	0.15327	N	0.268216	T	0.21387	0.0515	.	.	.	0.21822	N	0.99953	B	0.02656	0.0	B	0.01281	0.0	T	0.22626	-1.0211	7	0.17369	T	0.5	.	4.8754	0.13653	0.0:0.4775:0.1592:0.3633	.	23	Q99558	M3K14_HUMAN	S	23	.	ENSP00000342059:P23S	P	-	1	0	MAP3K14	40723828	0.006000	0.16342	0.973000	0.42090	0.812000	0.45895	-0.084000	0.11268	0.107000	0.17824	-0.521000	0.04368	CCC		0.592	MAP3K14-201	KNOWN	basic	processed_transcript	processed_transcript		NM_003954		14	27	0	0	0	0.004007	0	14	27				
OSBPL7	114881	broad.mit.edu	37	17	45895647	45895647	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:45895647G>A	ENST00000007414.3	-	7	777	c.586C>T	c.(586-588)Cgc>Tgc	p.R196C	OSBPL7_ENST00000392507.3_Missense_Mutation_p.R196C	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	196					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.R196C(1)		autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						TGAGAGCAGCGGTCCAGCCCA	0.622																																							uc002ilx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(586-588)CGC>TGC		oxysterol-binding protein-like protein 7							85.0	75.0	78.0					17																	45895647		2203	4300	6503	SO:0001583	missense	114881				lipid transport		lipid binding	g.chr17:45895647G>A	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.586C>T	17.37:g.45895647G>A	ENSP00000007414:p.Arg196Cys					OSBPL7_uc002ilw.1_5'Flank	p.R196C	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN			7	789	-			196					D3DTT6|Q6PIV6	Missense_Mutation	SNP	ENST00000007414.3	37	c.586C>T	CCDS11515.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.786317	0.31593	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.19669	2.13;2.13	5.97	5.97	0.96955	.	0.487974	0.22902	N	0.054258	T	0.25232	0.0613	L	0.59436	1.845	0.41478	D	0.988145	D	0.67145	0.996	B	0.43623	0.425	T	0.02098	-1.1214	10	0.66056	D	0.02	-26.4646	12.8488	0.57846	0.0:0.0:0.8373:0.1627	.	196	Q9BZF2	OSBL7_HUMAN	C	196	ENSP00000007414:R196C;ENSP00000376295:R196C	ENSP00000007414:R196C	R	-	1	0	OSBPL7	43250646	0.997000	0.39634	1.000000	0.80357	0.794000	0.44872	1.874000	0.39568	2.837000	0.97791	0.655000	0.94253	CGC		0.622	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731		16	51	0	0	0	0.006122	0	16	51				
HOXB3	3213	broad.mit.edu	37	17	46628425	46628425	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:46628425C>A	ENST00000470495.1	-	2	2014	c.567G>T	c.(565-567)aaG>aaT	p.K189N	HOXB3_ENST00000460160.1_Missense_Mutation_p.K57N|HOXB3_ENST00000489475.1_Missense_Mutation_p.K116N|HOXB3_ENST00000311626.4_Missense_Mutation_p.K189N|HOXB3_ENST00000485909.2_Missense_Mutation_p.K57N|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000508688.1_RNA|HOXB3_ENST00000472863.1_Missense_Mutation_p.K116N|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000476342.1_Missense_Mutation_p.K189N|HOXB3_ENST00000498678.1_Missense_Mutation_p.K189N|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000490677.1_Missense_Mutation_p.K55N			P14651	HXB3_HUMAN	homeobox B3	189					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K189N(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						TCCGCGCCCGCTTGGACGCCG	0.746																																							uc002inn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(565-567)AAG>AAT		homeobox B3							36.0	39.0	38.0					17																	46628425		2203	4300	6503	SO:0001583	missense	3213				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46628425C>A		CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.567G>T	17.37:g.46628425C>A	ENSP00000417207:p.Lys189Asn					HOXB3_uc010wlm.1_Missense_Mutation_p.K116N|HOXB3_uc010dbf.2_Missense_Mutation_p.K189N|HOXB3_uc010dbg.2_Missense_Mutation_p.K189N|HOXB3_uc002ino.2_Missense_Mutation_p.K189N|HOXB3_uc010wlk.1_Missense_Mutation_p.K57N|HOXB3_uc010wll.1_Missense_Mutation_p.K116N	p.K189N	NM_002146	NP_002137	P14651	HXB3_HUMAN			2	967	-			189			Homeobox.		A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	ENST00000470495.1	37	c.567G>T	CCDS11528.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745624	0.69418	.	.	ENSG00000120093	ENST00000470495;ENST00000472863;ENST00000311626;ENST00000498678;ENST00000490677;ENST00000460160;ENST00000485909;ENST00000489475;ENST00000476342	D;D;D;D;D;D;D;D;D	0.96992	-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2	4.05	0.851	0.18989	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.056474	0.64402	D	0.000001	D	0.97651	0.9230	H	0.96080	3.765	0.80722	D	1	D	0.56968	0.978	P	0.54590	0.756	D	0.96343	0.9252	10	0.87932	D	0	.	7.3222	0.26533	0.1382:0.7039:0.0:0.158	.	189	P14651	HXB3_HUMAN	N	189;116;189;189;55;57;57;116;189	ENSP00000417207:K189N;ENSP00000419676:K116N;ENSP00000308252:K189N;ENSP00000420595:K189N;ENSP00000449977:K55N;ENSP00000418035:K57N;ENSP00000438747:K57N;ENSP00000418729:K116N;ENSP00000418892:K189N	ENSP00000308252:K189N	K	-	3	2	HOXB3	43983424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.769000	0.47654	0.462000	0.27095	0.650000	0.86243	AAG		0.746	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358261.1			14	56	1	0	9.16793e-09	0.00499	1.21223e-08	14	56				
KIF2B	84643	broad.mit.edu	37	17	51900813	51900813	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:51900813G>C	ENST00000268919.4	+	1	575	c.419G>C	c.(418-420)tGt>tCt	p.C140S		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	140					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C140S(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AGCAAACCTTGTCTGATGAAG	0.572																																							uc002iua.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)	8						c.(418-420)TGT>TCT		kinesin family member 2B							56.0	59.0	58.0					17																	51900813		2203	4300	6503	SO:0001583	missense	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51900813G>C	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.419G>C	17.37:g.51900813G>C	ENSP00000268919:p.Cys140Ser					uc010wna.1_RNA	p.C140S	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN			1	575	+			140					Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	c.419G>C	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	G	0.835	-0.744044	0.03088	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.72282	-0.64	4.99	2.8	0.32819	.	0.663319	0.12551	N	0.459089	T	0.41143	0.1146	N	0.04880	-0.145	0.22112	N	0.999353	B	0.17465	0.022	B	0.11329	0.006	T	0.33292	-0.9874	10	0.06494	T	0.89	.	5.4256	0.16423	0.0933:0.0:0.5473:0.3594	.	140	Q8N4N8	KIF2B_HUMAN	S	140;63	ENSP00000268919:C140S	ENSP00000268919:C140S	C	+	2	0	KIF2B	49255812	0.532000	0.26346	0.998000	0.56505	0.951000	0.60555	0.923000	0.28757	1.401000	0.46761	0.655000	0.94253	TGT		0.572	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		23	56	0	0	0	0.00278	0	23	56				
TRIM25	7706	broad.mit.edu	37	17	54969341	54969341	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:54969341G>A	ENST00000316881.4	-	9	1662	c.1613C>T	c.(1612-1614)cCa>cTa	p.P538L	TRIM25_ENST00000537230.1_Missense_Mutation_p.P538L|RP11-670E13.5_ENST00000574826.1_RNA|TRIM25_ENST00000573108.1_5'Flank|MIR3614_ENST00000581261.1_RNA	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	538	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P538L(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					CCTGCTTTCTGGGCCCTGCCG	0.582																																							uc002iut.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)|skin(1)	3						c.(1612-1614)CCA>CTA		tripartite motif-containing 25							83.0	74.0	77.0					17																	54969341		2203	4300	6503	SO:0001583	missense	7706				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|response to virus	cell junction|cytosol|nucleus	sequence-specific DNA binding transcription factor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:54969341G>A	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.1613C>T	17.37:g.54969341G>A	ENSP00000323889:p.Pro538Leu					TRIM25_uc010dcj.2_Missense_Mutation_p.P330L	p.P538L	NM_005082	NP_005073	Q14258	TRI25_HUMAN			9	1673	-	Breast(9;6.15e-08)		538			B30.2/SPRY.			Missense_Mutation	SNP	ENST00000316881.4	37	c.1613C>T	CCDS11591.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.950699	0.53186	.	.	ENSG00000121060	ENST00000316881;ENST00000537230	T;T	0.67345	-0.26;-0.26	4.72	2.71	0.32032	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.221462	0.31989	N	0.006747	T	0.66416	0.2787	L	0.35593	1.075	0.20563	N	0.999887	D	0.63880	0.993	P	0.61940	0.896	T	0.56372	-0.7990	10	0.31617	T	0.26	.	9.0822	0.36558	0.0773:0.0:0.7754:0.1473	.	538	Q14258	TRI25_HUMAN	L	538	ENSP00000323889:P538L;ENSP00000445961:P538L	ENSP00000323889:P538L	P	-	2	0	TRIM25	52324340	1.000000	0.71417	0.930000	0.37139	0.259000	0.26198	4.597000	0.61062	0.420000	0.25954	0.511000	0.50034	CCA		0.582	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440609.1	NM_005082		30	75	0	0	0	0.002445	0	30	75				
C17orf47	284083	broad.mit.edu	37	17	56620524	56620524	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:56620524G>T	ENST00000321691.3	-	1	1205	c.1024C>A	c.(1024-1026)Cag>Aag	p.Q342K	SEPT4_ENST00000457347.2_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000412945.3_5'Flank	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	342								p.Q342K(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCTACTGACTGTACCCCTGGG	0.532																																							uc002iwq.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1024-1026)CAG>AAG		hypothetical protein LOC284083							129.0	114.0	119.0					17																	56620524		2203	4300	6503	SO:0001583	missense	284083							g.chr17:56620524G>T		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1024C>A	17.37:g.56620524G>T	ENSP00000354874:p.Gln342Lys					SEPT4_uc010wnx.1_5'Flank|SEPT4_uc010wny.1_5'Flank	p.Q342K	NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN			1	1160	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		342					Q8N821	Missense_Mutation	SNP	ENST00000321691.3	37	c.1024C>A	CCDS32691.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118683	0.37436	.	.	ENSG00000181013	ENST00000321691	T	0.34667	1.35	4.78	1.44	0.22558	.	0.820731	0.10510	N	0.666304	T	0.21227	0.0511	L	0.29908	0.895	0.09310	N	1	B	0.33103	0.397	B	0.26202	0.067	T	0.14309	-1.0477	10	0.33940	T	0.23	7.5971	5.3866	0.16222	0.2008:0.1686:0.6306:0.0	.	342	Q8NEP4	CQ047_HUMAN	K	342	ENSP00000354874:Q342K	ENSP00000354874:Q342K	Q	-	1	0	C17orf47	53975523	0.003000	0.15002	0.000000	0.03702	0.205000	0.24178	0.548000	0.23314	0.548000	0.28955	0.462000	0.41574	CAG		0.532	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445443.1	NM_001038704		8	34	1	0	0.00307968	0.00308	0.00331979	8	34				
TBX4	9496	broad.mit.edu	37	17	59560841	59560841	+	Silent	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:59560841A>T	ENST00000240335.1	+	8	1647	c.1602A>T	c.(1600-1602)tcA>tcT	p.S534S	TBX4_ENST00000393853.4_Silent_p.S535S	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	534					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S534S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AGTACCATTCAGGAATGGGGA	0.527																																							uc002izi.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(1600-1602)TCA>TCT		T-box 4							81.0	78.0	79.0					17																	59560841		2203	4300	6503	SO:0001819	synonymous_variant	9496				leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:59560841A>T	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1602A>T	17.37:g.59560841A>T						TBX4_uc010ddo.2_Silent_p.S535S|TBX4_uc010woy.1_Silent_p.S535S	p.S534S	NM_018488	NP_060958	P57082	TBX4_HUMAN			8	1647	+			534					A5PKU7|B2RMT1|B7ZLV3	Silent	SNP	ENST00000240335.1	37	c.1602A>T	CCDS11629.1																																																																																				0.527	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488		18	27	0	0	0	0.007413	0	18	27				
MRC2	9902	broad.mit.edu	37	17	60743900	60743900	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:60743900G>T	ENST00000303375.5	+	4	1181	c.779G>T	c.(778-780)aGg>aTg	p.R260M		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	260	C-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.R260M(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CTGTCGTGGAGGGAGGCCTGG	0.617																																							uc002jad.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(778-780)AGG>ATG		mannose receptor, C type 2							52.0	50.0	50.0					17																	60743900		2203	4300	6503	SO:0001583	missense	9902				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr17:60743900G>T	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.779G>T	17.37:g.60743900G>T	ENSP00000307513:p.Arg260Met					MRC2_uc002jac.2_Missense_Mutation_p.R260M	p.R260M	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN			4	1181	+			260			Extracellular (Potential).|C-type lectin 1.		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	c.779G>T	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347386	0.61183	.	.	ENSG00000011028	ENST00000303375	T	0.19394	2.15	3.97	3.97	0.46021	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.318233	0.32081	N	0.006613	T	0.23611	0.0571	L	0.28192	0.835	0.80722	D	1	P	0.51147	0.942	P	0.54544	0.755	T	0.01143	-1.1438	10	0.49607	T	0.09	-28.1593	9.7816	0.40651	0.1547:0.0:0.8453:0.0	.	260	Q9UBG0	MRC2_HUMAN	M	260	ENSP00000307513:R260M	ENSP00000307513:R260M	R	+	2	0	MRC2	58097632	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.226000	0.42963	2.048000	0.60808	0.462000	0.41574	AGG		0.617	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1			5	15	1	0	0.00198382	0.001984	0.00216046	5	15				
DNAI2	64446	broad.mit.edu	37	17	72277987	72277987	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:72277987C>A	ENST00000311014.6	+	2	98	c.31C>A	c.(31-33)Cgc>Agc	p.R11S	DNAI2_ENST00000307504.5_5'UTR|DNAI2_ENST00000579490.1_Missense_Mutation_p.R68S|DNAI2_ENST00000582036.1_Missense_Mutation_p.R11S|DNAI2_ENST00000446837.2_Missense_Mutation_p.R11S			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	11					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.R11S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CGTCAAGAAGCGCAGCGAGTT	0.632									Kartagener syndrome																														uc002jkf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(31-33)CGC>AGC		dynein, axonemal, intermediate polypeptide 2							114.0	96.0	102.0					17																	72277987		2203	4300	6503	SO:0001583	missense	64446	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity	g.chr17:72277987C>A	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.31C>A	17.37:g.72277987C>A	ENSP00000308312:p.Arg11Ser					DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	p.R11S	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN			2	130	+			11					C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	c.31C>A	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	C	32	5.124052	0.94429	.	.	ENSG00000171595	ENST00000311014;ENST00000446837	T;T	0.75050	-0.9;-0.9	5.22	5.22	0.72569	.	0.120505	0.56097	D	0.000031	D	0.89986	0.6874	H	0.94385	3.53	0.80722	D	1	D	0.76494	0.999	D	0.66979	0.948	D	0.92439	0.5960	10	0.87932	D	0	-34.5655	19.0564	0.93067	0.0:1.0:0.0:0.0	.	11	Q9GZS0	DNAI2_HUMAN	S	11	ENSP00000308312:R11S;ENSP00000400252:R11S	ENSP00000308312:R11S	R	+	1	0	DNAI2	69789582	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.088000	0.64486	2.735000	0.93741	0.650000	0.86243	CGC		0.632	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		18	42	1	0	1.45105e-14	0.006122	2.30142e-14	18	42				
GRB2	2885	broad.mit.edu	37	17	73316501	73316501	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:73316501T>A	ENST00000392562.1	-	6	1384	c.602A>T	c.(601-603)cAg>cTg	p.Q201L	GRB2_ENST00000462266.1_5'UTR|GRB2_ENST00000578961.1_Nonsense_Mutation_p.R145*|GRB2_ENST00000392563.1_Missense_Mutation_p.Q160L|GRB2_ENST00000392564.1_Missense_Mutation_p.Q201L|GRB2_ENST00000316804.5_Missense_Mutation_p.Q201L|GRB2_ENST00000316615.5_Missense_Mutation_p.Q160L			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	201	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.Q201L(1)		breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	CATGCCGGTCTGCCCGTGGCA	0.493																																							uc002jnx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(601-603)CAG>CTG		growth factor receptor-bound protein 2 isoform	Pegademase bovine(DB00061)						156.0	165.0	162.0					17																	73316501		2203	4300	6503	SO:0001583	missense	2885				axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity	g.chr17:73316501T>A		CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.602A>T	17.37:g.73316501T>A	ENSP00000376345:p.Gln201Leu					GRB2_uc002jny.3_Missense_Mutation_p.Q160L	p.Q201L	NM_002086	NP_002077	P62993	GRB2_HUMAN	all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		6	959	-	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		201			SH3 2.		P29354|Q14450|Q63057|Q63059	Missense_Mutation	SNP	ENST00000392562.1	37	c.602A>T	CCDS11721.1	.	.	.	.	.	.	.	.	.	.	T	36	5.692299	0.96793	.	.	ENSG00000177885	ENST00000316804;ENST00000392562;ENST00000392564;ENST00000392563;ENST00000316615	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.45	5.45	0.79879	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.47173	0.1431	L	0.42686	1.345	0.80722	D	1	B;B	0.31485	0.325;0.082	B;B	0.29862	0.108;0.025	T	0.49234	-0.8961	10	0.56958	D	0.05	-27.6202	15.6739	0.77300	0.0:0.0:0.0:1.0	.	160;201	P62993-2;P62993	.;GRB2_HUMAN	L	201;201;201;160;160	ENSP00000339007:Q201L;ENSP00000376345:Q201L;ENSP00000376347:Q201L;ENSP00000376346:Q160L;ENSP00000317360:Q160L	ENSP00000317360:Q160L	Q	-	2	0	GRB2	70828096	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.127000	0.71642	2.289000	0.77006	0.459000	0.35465	CAG		0.493	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1			41	131	0	0	0	0.002852	0	41	131				
SLC16A3	9123	broad.mit.edu	37	17	80194624	80194624	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:80194624C>A	ENST00000581287.1	+	2	2565	c.243C>A	c.(241-243)tgC>tgA	p.C81*	SLC16A3_ENST00000392339.1_Nonsense_Mutation_p.C81*|SLC16A3_ENST00000584781.1_3'UTR|SLC16A3_ENST00000582743.1_Nonsense_Mutation_p.C81*|SLC16A3_ENST00000392341.1_Nonsense_Mutation_p.C81*	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	81					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.C81*(1)		endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	GCAGTGTGTGCGTGAACCGCT	0.667											OREG0024821	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(52;652 1135 19190 37282 52456)	Pancreas(52;652 1135 19190 37282 52456)	uc002kea.2		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)	2						c.(241-243)TGC>TGA		solute carrier family 16, member 3	Pyruvic acid(DB00119)						88.0	86.0	86.0					17																	80194624		2203	4300	6503	SO:0001587	stop_gained	9123				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	actin cytoskeleton|integral to plasma membrane|membrane fraction|nuclear membrane	secondary active monocarboxylate transmembrane transporter activity|symporter activity	g.chr17:80194624C>A	U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.243C>A	17.37:g.80194624C>A	ENSP00000463978:p.Cys81*		OREG0024821	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1196	SLC16A3_uc002kee.2_Nonsense_Mutation_p.C81*|SLC16A3_uc002keb.2_Nonsense_Mutation_p.C81*|SLC16A3_uc002kec.2_Nonsense_Mutation_p.C81*|SLC16A3_uc002ked.2_Nonsense_Mutation_p.C81*	p.C81*	NM_001042422	NP_001035887	O15427	MOT4_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		3	382	+	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		81			Helical; (Potential).		B3KXG8|Q2M1P8	Nonsense_Mutation	SNP	ENST00000581287.1	37	c.243C>A	CCDS11804.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.338862	0.81911	.	.	ENSG00000141526	ENST00000392341;ENST00000392339	.	.	.	5.62	-5.71	0.02413	.	0.102436	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	11.0165	0.47691	0.0:0.5381:0.1095:0.3525	.	.	.	.	X	81	.	ENSP00000376150:C81X	C	+	3	2	SLC16A3	77787913	0.105000	0.21958	0.589000	0.28718	0.401000	0.30781	-0.638000	0.05452	-1.223000	0.02584	-0.982000	0.02568	TGC		0.667	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443498.1	NM_004207		21	46	1	0	7.87624e-14	0.00278	1.22178e-13	21	46				
CSNK1D	1453	broad.mit.edu	37	17	80213371	80213371	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:80213371C>A	ENST00000314028.6	-	3	619	c.270G>T	c.(268-270)gaG>gaT	p.E90D	CSNK1D_ENST00000398519.5_Missense_Mutation_p.E90D|CSNK1D_ENST00000578904.1_5'UTR|AC132872.2_ENST00000598222.1_5'Flank|CSNK1D_ENST00000392334.2_Missense_Mutation_p.E90D	NM_001893.4	NP_001884.2	P48730	KC1D_HUMAN	casein kinase 1, delta	90	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle (GO:0005819)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.E90D(3)		breast(2)|large_intestine(2)|lung(7)	11	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			TGAAGAGGTCCTCCAGGCTTG	0.547																																							uc002kej.2		NA																	3	Substitution - Missense(3)		lung(3)	breast(2)	2						c.(268-270)GAG>GAT		casein kinase 1, delta isoform 1							160.0	133.0	142.0					17																	80213371		2203	4300	6503	SO:0001583	missense	1453				circadian regulation of gene expression|DNA repair|G2/M transition of mitotic cell cycle|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|regulation of circadian rhythm|Wnt receptor signaling pathway	centrosome|cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:80213371C>A		CCDS11805.1, CCDS11806.1	17q25	2013-01-17				ENSG00000141551			2452	protein-coding gene	gene with protein product		600864				7797465	Standard	NM_001893		Approved	HCKID, CKID, CKIdelta	uc002kej.3	P48730		ENST00000314028.6:c.270G>T	17.37:g.80213371C>A	ENSP00000324464:p.Glu90Asp					SLC16A3_uc002kee.2_Intron|CSNK1D_uc002kef.2_Missense_Mutation_p.E90D|CSNK1D_uc002kei.2_Missense_Mutation_p.E90D|CSNK1D_uc010wvj.1_Translation_Start_Site|CSNK1D_uc002keh.2_5'Flank|CSNK1D_uc010dim.1_5'Flank	p.E90D	NM_001893	NP_001884	P48730	KC1D_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)		3	586	-	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		90			Protein kinase.		A2I2P2|Q96KZ6|Q9BTN5	Missense_Mutation	SNP	ENST00000314028.6	37	c.270G>T	CCDS11805.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264262	0.80358	.	.	ENSG00000141551	ENST00000314028;ENST00000392334;ENST00000398519;ENST00000403276	T;T;T;T	0.66460	2.08;2.08;-0.21;2.08	5.42	-4.48	0.03515	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80025	0.4548	M	0.88105	2.93	0.58432	D	0.999996	D;D;D	0.71674	0.973;0.998;0.998	P;D;D	0.70227	0.705;0.947;0.968	T	0.81482	-0.0913	10	0.87932	D	0	.	13.2972	0.60305	0.0:0.2331:0.0:0.7669	.	90;90;33	P48730;P48730-2;B4E0G1	KC1D_HUMAN;.;.	D	90;90;33;90	ENSP00000324464:E90D;ENSP00000376146:E90D;ENSP00000381531:E33D;ENSP00000385769:E90D	ENSP00000324464:E90D	E	-	3	2	CSNK1D	77806660	0.208000	0.23494	0.940000	0.37924	0.986000	0.74619	-0.420000	0.07062	-0.983000	0.03511	-0.156000	0.13503	GAG		0.547	CSNK1D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442632.1	NM_139062		24	50	1	0	6.32553e-13	0.004656	9.53326e-13	24	50				
DLGAP1	9229	broad.mit.edu	37	18	3502601	3502601	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr18:3502601C>A	ENST00000315677.3	-	12	3209	c.2614G>T	c.(2614-2616)Ggg>Tgg	p.G872W	DLGAP1_ENST00000515196.2_Missense_Mutation_p.G872W|DLGAP1_ENST00000400147.2_Missense_Mutation_p.G570W|DLGAP1_ENST00000400149.3_Missense_Mutation_p.G562W|DLGAP1_ENST00000400145.2_Missense_Mutation_p.G570W|DLGAP1_ENST00000400155.1_Missense_Mutation_p.G578W|DLGAP1_ENST00000539435.1_Missense_Mutation_p.G580W|DLGAP1_ENST00000581699.1_Missense_Mutation_p.G578W|DLGAP1_ENST00000534970.1_Missense_Mutation_p.G556W|DLGAP1_ENST00000400150.3_Missense_Mutation_p.G588W|DLGAP1_ENST00000581527.1_Missense_Mutation_p.G872W|DLGAP1_ENST00000584874.1_Missense_Mutation_p.G872W	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	872					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.G872W(1)|p.G580W(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TCCCAAAACCCCGCCAAATCC	0.408																																							uc002kmf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(2614-2616)GGG>TGG		discs large homolog-associated protein 1 isoform							82.0	89.0	86.0					18																	3502601		2203	4300	6503	SO:0001583	missense	9229				synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane		g.chr18:3502601C>A	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.2614G>T	18.37:g.3502601C>A	ENSP00000316377:p.Gly872Trp					DLGAP1_uc010wyz.1_Missense_Mutation_p.G872W|DLGAP1_uc002kme.1_Missense_Mutation_p.G570W|DLGAP1_uc010dkn.2_Missense_Mutation_p.G580W|DLGAP1_uc010wyw.1_Missense_Mutation_p.G578W|DLGAP1_uc010wyx.1_Missense_Mutation_p.G594W|DLGAP1_uc010wyy.1_Missense_Mutation_p.G556W|DLGAP1_uc002kmg.2_Missense_Mutation_p.G570W	p.G872W	NM_004746	NP_004737	O14490	DLGP1_HUMAN			9	2681	-		Colorectal(8;0.0257)	872					A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	c.2614G>T	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319463	0.81469	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.73321	0.3572	M	0.90759	3.145	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.78094	-0.2338	10	0.87932	D	0	-23.8947	20.0966	0.97849	0.0:1.0:0.0:0.0	.	872;556;568;578;580;570;872;570	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;O14490-3;O14490;O14490-2	.;.;.;.;.;.;DLGP1_HUMAN;.	W	872;570;588;562;578;556;580;570;872	ENSP00000316377:G872W;ENSP00000383011:G570W;ENSP00000383014:G588W;ENSP00000383013:G562W;ENSP00000383019:G578W;ENSP00000437817:G556W;ENSP00000446312:G580W;ENSP00000383010:G570W;ENSP00000445973:G872W	ENSP00000316377:G872W	G	-	1	0	DLGAP1	3492601	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.818000	0.86416	2.753000	0.94483	0.557000	0.71058	GGG		0.408	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			22	41	1	0	1.1804e-14	0.003954	1.88626e-14	22	41				
CCDC178	374864	broad.mit.edu	37	18	30950088	30950088	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr18:30950088G>T	ENST00000383096.3	-	6	456	c.274C>A	c.(274-276)Cca>Aca	p.P92T	CCDC178_ENST00000300227.8_Missense_Mutation_p.P92T|CCDC178_ENST00000583930.1_Missense_Mutation_p.P92T|CCDC178_ENST00000403303.1_Missense_Mutation_p.P92T|CCDC178_ENST00000402325.1_Missense_Mutation_p.P92T|CCDC178_ENST00000579916.1_Missense_Mutation_p.P92T|CCDC178_ENST00000579947.1_Missense_Mutation_p.P92T|CCDC178_ENST00000406524.2_Missense_Mutation_p.P92T			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	92								p.P92T(2)									CAAGGTGCTGGAATATTTACT	0.378																																							uc002kxn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(274-276)CCA>ACA		hypothetical protein LOC374864 isoform 1							90.0	81.0	84.0					18																	30950088		2203	4300	6503	SO:0001583	missense	374864							g.chr18:30950088G>T	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.274C>A	18.37:g.30950088G>T	ENSP00000372576:p.Pro92Thr					C18orf34_uc010xbr.1_Missense_Mutation_p.P92T|C18orf34_uc010dmf.1_Missense_Mutation_p.P92T|C18orf34_uc002kxo.2_Missense_Mutation_p.P92T|C18orf34_uc002kxp.2_Missense_Mutation_p.P92T	p.P92T	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN			5	416	-			92					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.274C>A	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644992	0.29246	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.60797	1.52;1.52;1.53;1.54;1.53;0.16	5.5	5.5	0.81552	.	.	.	.	.	T	0.72534	0.3472	L	0.57536	1.79	0.37198	D	0.90424	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.999;0.999;0.999	T	0.78061	-0.2351	9	0.87932	D	0	-17.3306	14.8979	0.70656	0.0:0.0:1.0:0.0	.	92;92;92;92;92	F8W7A7;A1L4G8;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;CR034_HUMAN	T	92	ENSP00000385591:P92T;ENSP00000372576:P92T;ENSP00000300227:P92T;ENSP00000385867:P92T;ENSP00000385234:P92T;ENSP00000382130:P92T	ENSP00000300227:P92T	P	-	1	0	C18orf34	29204086	1.000000	0.71417	0.998000	0.56505	0.674000	0.39518	4.758000	0.62220	2.589000	0.87451	0.555000	0.69702	CCA		0.378	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		19	19	1	0	2.37509e-13	0.010504	3.6399e-13	19	19				
SKA1	220134	broad.mit.edu	37	18	47908532	47908532	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr18:47908532G>T	ENST00000285116.3	+	4	458	c.247G>T	c.(247-249)Gac>Tac	p.D83Y	SKA1_ENST00000398452.2_Missense_Mutation_p.D83Y|SKA1_ENST00000417656.2_Missense_Mutation_p.D83Y|SKA1_ENST00000488454.1_5'UTR	NM_001039535.2|NM_145060.3	NP_001034624.1|NP_659497.1	Q96BD8	SKA1_HUMAN	spindle and kinetochore associated complex subunit 1	83					cell division (GO:0051301)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|spindle microtubule (GO:0005876)	microtubule binding (GO:0008017)	p.D83Y(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(1)|prostate(1)	13						AGATTACAAAGACATAGAACA	0.343																																							uc002let.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(247-249)GAC>TAC		spindle and KT associated 1							76.0	80.0	79.0					18																	47908532		2203	4300	6503	SO:0001583	missense	220134				cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding	g.chr18:47908532G>T	BC015706	CCDS11946.1	18q21.1	2013-01-17	2009-08-19	2009-08-19	ENSG00000154839	ENSG00000154839			28109	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 24"""	C18orf24		17093495	Standard	NM_145060		Approved	MGC10200	uc002leu.3	Q96BD8	OTTHUMG00000132685	ENST00000285116.3:c.247G>T	18.37:g.47908532G>T	ENSP00000285116:p.Asp83Tyr					SKA1_uc002leu.2_Missense_Mutation_p.D83Y|SKA1_uc010xdl.1_Missense_Mutation_p.D83Y	p.D83Y	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN			4	431	+			83			Potential.		B2R9Y6|B4E0P4	Missense_Mutation	SNP	ENST00000285116.3	37	c.247G>T	CCDS11946.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477826	0.63849	.	.	ENSG00000154839	ENST00000285116;ENST00000417656;ENST00000398452	T;T;T	0.50813	0.73;0.73;0.73	5.66	4.79	0.61399	.	0.100689	0.64402	D	0.000003	T	0.61388	0.2343	L	0.53249	1.67	0.80722	D	1	D;D	0.71674	0.983;0.998	P;D	0.66847	0.847;0.947	T	0.64546	-0.6382	10	0.87932	D	0	-1.1282	12.3505	0.55144	0.0815:0.0:0.9185:0.0	.	83;83	Q96BD8-2;Q96BD8	.;SKA1_HUMAN	Y	83	ENSP00000285116:D83Y;ENSP00000397222:D83Y;ENSP00000381470:D83Y	ENSP00000285116:D83Y	D	+	1	0	SKA1	46162530	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	4.927000	0.63440	1.398000	0.46701	0.561000	0.74099	GAC		0.343	SKA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255982.2	NM_145060		5	16	1	0	2.0095e-06	0.001984	2.44367e-06	5	16				
TCF4	6925	broad.mit.edu	37	18	52896228	52896228	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr18:52896228C>A	ENST00000356073.4	-	18	2328	c.1717G>T	c.(1717-1719)Gag>Tag	p.E573*	TCF4_ENST00000567880.1_Nonsense_Mutation_p.E513*|TCF4_ENST00000568673.1_Nonsense_Mutation_p.E553*|TCF4_ENST00000564999.1_Nonsense_Mutation_p.E573*|TCF4_ENST00000565018.2_Nonsense_Mutation_p.E577*|TCF4_ENST00000543082.1_Nonsense_Mutation_p.E531*|TCF4_ENST00000398339.1_Nonsense_Mutation_p.E679*|TCF4_ENST00000561831.3_Nonsense_Mutation_p.E413*|TCF4_ENST00000540999.1_Nonsense_Mutation_p.E549*|TCF4_ENST00000537856.3_Nonsense_Mutation_p.E443*|TCF4_ENST00000564403.2_Nonsense_Mutation_p.E583*|TCF4_ENST00000566279.1_Nonsense_Mutation_p.E517*|TCF4_ENST00000566286.1_Nonsense_Mutation_p.E570*|TCF4_ENST00000568740.1_Nonsense_Mutation_p.E548*|TCF4_ENST00000570177.2_Nonsense_Mutation_p.E443*|TCF4_ENST00000354452.3_Nonsense_Mutation_p.E577*|TCF4_ENST00000544241.2_Nonsense_Mutation_p.E506*|TCF4_ENST00000564228.1_Nonsense_Mutation_p.E502*|TCF4_ENST00000570287.2_Nonsense_Mutation_p.E413*|TCF4_ENST00000457482.3_Nonsense_Mutation_p.E417*|TCF4_ENST00000537578.1_Nonsense_Mutation_p.E553*|TCF4_ENST00000561992.1_Nonsense_Mutation_p.E443*	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	573	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)	p.E679*(1)|p.E573*(1)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CGCAGACGCTCTCGGGCATTG	0.572																																							uc002lfz.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)|lung(1)	2						c.(1717-1719)GAG>TAG		transcription factor 4 isoform b							190.0	164.0	173.0					18																	52896228		2203	4300	6503	SO:0001587	stop_gained	6925				positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding	g.chr18:52896228C>A	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1717G>T	18.37:g.52896228C>A	ENSP00000348374:p.Glu573*					TCF4_uc002lfw.3_Nonsense_Mutation_p.E417*|TCF4_uc010xdu.1_Nonsense_Mutation_p.E443*|TCF4_uc010xdv.1_Nonsense_Mutation_p.E443*|TCF4_uc002lfx.2_Nonsense_Mutation_p.E506*|TCF4_uc010xdw.1_Nonsense_Mutation_p.E443*|TCF4_uc002lfy.2_Nonsense_Mutation_p.E531*|TCF4_uc010xdx.1_Nonsense_Mutation_p.E549*|TCF4_uc010dph.1_Nonsense_Mutation_p.E577*|TCF4_uc010xdy.1_Nonsense_Mutation_p.E553*|TCF4_uc002lga.2_Nonsense_Mutation_p.E679*|TCF4_uc002lgb.1_Nonsense_Mutation_p.E413*|TCF4_uc010dpi.2_Nonsense_Mutation_p.E583*|TCF4_uc002lfv.2_Nonsense_Mutation_p.E356*	p.E573*	NM_003199	NP_003190	P15884	ITF2_HUMAN		Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)	18	2329	-			573			Basic motif.		B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Nonsense_Mutation	SNP	ENST00000356073.4	37	c.1717G>T	CCDS11960.1	.	.	.	.	.	.	.	.	.	.	C	39	7.329868	0.98217	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.5457	19.0276	0.92939	0.0:1.0:0.0:0.0	.	.	.	.	X	577;417;573;531;549;553;506;443;679	.	ENSP00000346440:E577X	E	-	1	0	TCF4	51047226	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	7.818000	0.86416	2.797000	0.96272	0.563000	0.77884	GAG		0.572	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199		38	40	1	0	7.53189e-24	0.007835	1.36865e-23	38	40				
WDR7	23335	broad.mit.edu	37	18	54363593	54363593	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr18:54363593C>T	ENST00000254442.3	+	12	1689	c.1478C>T	c.(1477-1479)tCa>tTa	p.S493L	WDR7_ENST00000357574.3_Missense_Mutation_p.S493L|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	493					hematopoietic progenitor cell differentiation (GO:0002244)			p.S493L(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GTGGATTTTTCAGTCATAATT	0.403																																							uc002lgk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1477-1479)TCA>TTA		rabconnectin-3 beta isoform 1							149.0	136.0	141.0					18																	54363593		2203	4300	6503	SO:0001583	missense	23335							g.chr18:54363593C>T	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.1478C>T	18.37:g.54363593C>T	ENSP00000254442:p.Ser493Leu					WDR7_uc010dpk.1_Intron|WDR7_uc002lgl.1_Missense_Mutation_p.S493L	p.S493L	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN		Lung(128;0.0238)|Colorectal(16;0.0296)	12	1689	+			493			WD 6.		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	c.1478C>T	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	C	35	5.537869	0.96460	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.61392	0.11;0.11	6.03	6.03	0.97812	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70988	0.3287	L	0.41710	1.295	0.80722	D	1	P;D	0.69078	0.842;0.997	P;D	0.80764	0.578;0.994	T	0.70081	-0.4970	10	0.59425	D	0.04	.	20.1519	0.98089	0.0:1.0:0.0:0.0	.	493;493	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	L	493	ENSP00000254442:S493L;ENSP00000350187:S493L	ENSP00000254442:S493L	S	+	2	0	WDR7	52514591	1.000000	0.71417	0.955000	0.39395	0.969000	0.65631	7.670000	0.83925	2.861000	0.98227	0.655000	0.94253	TCA		0.403	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1			4	57	0	0	0	0.000602	0	4	57				
CDH19	28513	broad.mit.edu	37	18	64212068	64212068	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr18:64212068T>C	ENST00000540086.1	-	6	1094	c.848A>G	c.(847-849)aAt>aGt	p.N283S	CDH19_ENST00000262150.2_Missense_Mutation_p.N283S	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	393	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N283S(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TCCTATGTCATTATCATATGC	0.358																																							uc002lkc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(847-849)AAT>AGT		cadherin 19, type 2 preproprotein							113.0	102.0	105.0					18																	64212068		2203	4300	6503	SO:0001583	missense	28513				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:64212068T>C	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.848A>G	18.37:g.64212068T>C	ENSP00000439593:p.Asn283Ser					CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Missense_Mutation_p.N283S|CDH19_uc002lkd.2_Missense_Mutation_p.N283S	p.N283S	NM_021153	NP_066976	Q9H159	CAD19_HUMAN			6	986	-		Esophageal squamous(42;0.0132)	283			Cadherin 3.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000540086.1	37	c.848A>G	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	T	7.649	0.682535	0.14907	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.50001	0.76;0.76	5.28	1.61	0.23674	Cadherin (4);Cadherin-like (1);	0.489229	0.23912	N	0.043329	T	0.20210	0.0486	N	0.04387	-0.21	0.09310	N	1	B;B	0.13145	0.007;0.003	B;B	0.19666	0.012;0.026	T	0.14504	-1.0470	10	0.23302	T	0.38	.	4.7833	0.13213	0.0:0.3547:0.1649:0.4804	.	283;283	F5H1K0;Q9H159	.;CAD19_HUMAN	S	283;283;228	ENSP00000262150:N283S;ENSP00000439593:N283S	ENSP00000262150:N283S	N	-	2	0	CDH19	62363048	0.000000	0.05858	0.948000	0.38648	0.774000	0.43823	-0.604000	0.05667	0.337000	0.23665	0.402000	0.26972	AAT		0.358	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153		9	15	0	0	0	0.004482	0	9	15				
MATK	4145	broad.mit.edu	37	19	3784122	3784122	+	Splice_Site	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:3784122G>A	ENST00000310132.6	-	5	760	c.362C>T	c.(361-363)cCg>cTg	p.P121L	MATK_ENST00000395045.2_Splice_Site_p.P122L|MATK_ENST00000395040.2_Splice_Site_p.P80L|MATK_ENST00000585778.1_Splice_Site_p.P121L	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	121					cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.P122L(1)|p.P121L(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCACTCACGGCATGAGGCT	0.701																																							uc002lyt.2		NA																	2	Substitution - Missense(2)		lung(2)	stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5						c.(361-363)CCG>CTG		megakaryocyte-associated tyrosine kinase isoform							24.0	28.0	26.0					19																	3784122		2200	4297	6497	SO:0001630	splice_region_variant	4145				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr19:3784122G>A	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.362+1C>T	19.37:g.3784122G>A						MATK_uc002lyv.2_Missense_Mutation_p.P122L|MATK_uc002lyu.2_Missense_Mutation_p.P80L|MATK_uc010dtq.2_Missense_Mutation_p.P121L	p.P121L	NM_139355	NP_647612	P42679	MATK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)	5	762	-		Hepatocellular(1079;0.137)	121					B3KNZ9|Q9NST8	Missense_Mutation	SNP	ENST00000310132.6	37	c.362C>T	CCDS12114.1	.	.	.	.	.	.	.	.	.	.	g	19.64	3.865581	0.71949	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	T;T;T	0.29142	1.58;1.58;1.58	4.25	2.02	0.26589	Src homology-3 domain (1);SH2 motif (2);	0.067710	0.64402	D	0.000012	T	0.40815	0.1132	M	0.64170	1.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	P;P;P	0.60012	0.729;0.867;0.729	T	0.15093	-1.0449	9	.	.	.	-30.699	5.182	0.15165	0.0837:0.1429:0.626:0.1474	.	121;122;121	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	L	122;121;80	ENSP00000378485:P122L;ENSP00000308734:P121L;ENSP00000378481:P80L	.	P	-	2	0	MATK	3735122	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	5.953000	0.70290	0.331000	0.23511	0.306000	0.20318	CCG		0.701	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453639.1	NM_139355	Missense_Mutation	8	12	0	0	0	0.008291	0	8	12				
SEMA6B	10501	broad.mit.edu	37	19	4558098	4558098	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:4558098G>A	ENST00000586582.1	-	3	495	c.185C>T	c.(184-186)gCt>gTt	p.A62V	SEMA6B_ENST00000586965.1_Missense_Mutation_p.A62V|SEMA6B_ENST00000301293.3_Missense_Mutation_p.A62V	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	62	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.A62V(1)		breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGTCGTCAGCACCTTCTGC	0.627																																							uc010duc.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(184-186)GCT>GTT		semaphorin 6B precursor							52.0	41.0	45.0					19																	4558098		2203	4300	6503	SO:0001583	missense	10501				cell differentiation|nervous system development	integral to membrane	receptor activity	g.chr19:4558098G>A	AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.185C>T	19.37:g.4558098G>A	ENSP00000467290:p.Ala62Val					SEMA6B_uc010dud.2_Missense_Mutation_p.A62V|SEMA6B_uc010xih.1_Missense_Mutation_p.A62V	p.A62V	NM_032108	NP_115484	Q9H3T3	SEM6B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	2	223	-		Hepatocellular(1079;0.137)	62			Extracellular (Potential).|Sema.		A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	c.185C>T	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	G	8.947	0.967310	0.18659	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.21191	2.02	3.49	2.45	0.29901	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.769868	0.11604	U	0.547520	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	B;B	0.22983	0.078;0.073	B;B	0.23275	0.045;0.044	T	0.25916	-1.0118	10	0.59425	D	0.04	.	5.5738	0.17212	0.1153:0.2041:0.6806:0.0	.	62;62	B4DT36;Q9H3T3	.;SEM6B_HUMAN	V	62	ENSP00000301293:A62V	ENSP00000301292:A62V	A	-	2	0	SEMA6B	4509098	0.515000	0.26210	0.010000	0.14722	0.274000	0.26718	2.684000	0.46951	0.679000	0.31345	0.491000	0.48974	GCT		0.627	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458656.2	NM_032108		4	5	0	0	0	0.000602	0	4	5				
TUBB4A	10382	broad.mit.edu	37	19	6495933	6495933	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:6495933C>G	ENST00000264071.2	-	4	948	c.577G>C	c.(577-579)Gtg>Ctg	p.V193L	CTD-2396E7.10_ENST00000596027.1_RNA|TUBB4A_ENST00000540257.1_Missense_Mutation_p.V193L|CTD-2396E7.9_ENST00000599292.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	193					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.V193L(1)									GTATTCTCCACCAGCTGGTGC	0.592																																							uc002mfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(577-579)GTG>CTG		tubulin, beta 4							264.0	188.0	213.0					19																	6495933		2203	4300	6503	SO:0001583	missense	10382				'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr19:6495933C>G	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.577G>C	19.37:g.6495933C>G	ENSP00000264071:p.Val193Leu					TUBB4_uc002mff.1_Missense_Mutation_p.V121L|MIR220B_hsa-mir-220b|MI0005529_5'Flank	p.V193L	NM_006087	NP_006078	P04350	TBB4_HUMAN		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)	4	684	-		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)	193					B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	c.577G>C	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141612	0.37825	.	.	ENSG00000104833	ENST00000264071;ENST00000540257	T;T	0.69306	-0.39;-0.39	3.98	3.98	0.46160	.	0.000000	0.64402	D	0.000009	T	0.56949	0.2020	L	0.31065	0.9	0.53005	D	0.999968	B	0.19445	0.036	B	0.24394	0.053	T	0.60052	-0.7338	10	0.87932	D	0	.	14.999	0.71455	0.0:1.0:0.0:0.0	.	193	P04350	TBB4A_HUMAN	L	193	ENSP00000264071:V193L;ENSP00000443590:V193L	ENSP00000264071:V193L	V	-	1	0	TUBB4	6446933	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.657000	0.83745	1.795000	0.52594	0.549000	0.68633	GTG		0.592	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087		29	57	0	0	0	0.007291	0	29	57				
FBN3	84467	broad.mit.edu	37	19	8152944	8152944	+	Splice_Site	SNP	C	C	A	rs369302494		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:8152944C>A	ENST00000600128.1	-	52	6910	c.6496G>T	c.(6496-6498)Gac>Tac	p.D2166Y	FBN3_ENST00000601739.1_Splice_Site_p.D2166Y|FBN3_ENST00000270509.2_Splice_Site_p.D2166Y			Q75N90	FBN3_HUMAN	fibrillin 3	2166	EGF-like 35; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.D2166Y(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGAGTTGTACCCTCGCAGGTC	0.642																																							uc002mjf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						c.(6496-6498)GAC>TAC		fibrillin 3 precursor							103.0	87.0	93.0					19																	8152944		2203	4300	6503	SO:0001630	splice_region_variant	84467					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr19:8152944C>A		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6496+1G>T	19.37:g.8152944C>A						FBN3_uc002mje.2_Missense_Mutation_p.D5Y	p.D2166Y	NM_032447	NP_115823	Q75N90	FBN3_HUMAN			51	6517	-			2166			EGF-like 35; calcium-binding.		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	c.6496G>T	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004085	0.54254	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.99080	-5.4	4.03	4.03	0.46877	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.99474	0.9813	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.98137	1.0434	9	.	.	.	.	16.5178	0.84305	0.0:1.0:0.0:0.0	.	2166;272	Q75N90;Q6ZNB8	FBN3_HUMAN;.	Y	2166;272	ENSP00000270509:D2166Y	.	D	-	1	0	FBN3	8058944	1.000000	0.71417	0.965000	0.40720	0.061000	0.15899	4.389000	0.59639	1.951000	0.56629	0.313000	0.20887	GAC		0.642	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	Missense_Mutation	13	23	1	0	2.27111e-07	0.001368	2.84897e-07	13	23				
MUC16	94025	broad.mit.edu	37	19	9047816	9047816	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:9047816T>A	ENST00000397910.4	-	5	34018	c.33815A>T	c.(33814-33816)gAg>gTg	p.E11272V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11274	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.E6905V(1)|p.E11272V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAGCTACTCTCTGCAGGATG	0.488																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(33814-33816)GAG>GTG		mucin 16							62.0	56.0	58.0					19																	9047816		1942	4152	6094	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9047816T>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33815A>T	19.37:g.9047816T>A	ENSP00000381008:p.Glu11272Val						p.E11272V	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			5	34019	-			11274			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.33815A>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	6.524	0.464966	0.12402	.	.	ENSG00000181143	ENST00000397910	T	0.02812	4.15	3.07	2.02	0.26589	.	.	.	.	.	T	0.08088	0.0202	L	0.59436	1.845	.	.	.	D	0.65815	0.995	P	0.61003	0.882	T	0.13150	-1.0520	8	0.87932	D	0	.	5.6527	0.17625	0.2398:0.0:0.0:0.7602	.	11272	B5ME49	.	V	11272	ENSP00000381008:E11272V	ENSP00000381008:E11272V	E	-	2	0	MUC16	8908816	0.003000	0.15002	0.001000	0.08648	0.035000	0.12851	0.411000	0.21115	0.524000	0.28502	0.454000	0.30748	GAG		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		8	8	0	0	0	0.00308	0	8	8				
MUC16	94025	broad.mit.edu	37	19	9064152	9064152	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:9064152G>A	ENST00000397910.4	-	3	23497	c.23294C>T	c.(23293-23295)gCc>gTc	p.A7765V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7767	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A7765V(2)|p.A3398V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGATGCACGGCTTCTGTATG	0.488																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(23293-23295)GCC>GTC		mucin 16							386.0	363.0	371.0					19																	9064152		2083	4205	6288	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9064152G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23294C>T	19.37:g.9064152G>A	ENSP00000381008:p.Ala7765Val						p.A7765V	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	23498	-			7767			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.23294C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.321	0.058860	0.08339	.	.	ENSG00000181143	ENST00000397910	T	0.22134	1.97	1.52	-3.03	0.05429	.	.	.	.	.	T	0.10981	0.0268	N	0.24115	0.695	.	.	.	B	0.09022	0.002	B	0.04013	0.001	T	0.27938	-1.0059	8	0.87932	D	0	.	2.3535	0.04290	0.4876:0.0:0.2766:0.2358	.	7765	B5ME49	.	V	7765	ENSP00000381008:A7765V	ENSP00000381008:A7765V	A	-	2	0	MUC16	8925152	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.837000	0.01689	-1.079000	0.03113	0.195000	0.17529	GCC		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		70	81	0	0	0	0.00361	0	70	81				
ZNF177	7730	broad.mit.edu	37	19	9492374	9492374	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:9492374A>T	ENST00000589262.1	+	6	1433	c.1367A>T	c.(1366-1368)cAg>cTg	p.Q456L	ZNF177_ENST00000434737.2_Missense_Mutation_p.Q456L|ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000602856.1_3'UTR|ZNF177_ENST00000541595.2_Missense_Mutation_p.Q296L|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000343499.4_Missense_Mutation_p.Q296L|ZNF177_ENST00000602738.1_Missense_Mutation_p.Q296L	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	456					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q296L(1)|p.Q456L(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						AAATGTATTCAGTGTGAAAAA	0.428																																							uc002mli.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(886-888)CAG>CTG		zinc finger protein 177							144.0	152.0	149.0					19																	9492374		2203	4300	6503	SO:0001583	missense	7730				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9492374A>T	U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.1367A>T	19.37:g.9492374A>T	ENSP00000468531:p.Gln456Leu					ZNF177_uc002mlj.2_Missense_Mutation_p.Q246L|ZNF177_uc002mlk.2_Missense_Mutation_p.Q296L	p.Q296L	NM_003451	NP_003442	Q13360	ZN177_HUMAN			12	1550	+			296			C2H2-type 7.		B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	ENST00000589262.1	37	c.887A>T	CCDS54214.1	.	.	.	.	.	.	.	.	.	.	A	10.28	1.305511	0.23736	.	.	ENSG00000188629	ENST00000541595;ENST00000343499;ENST00000434737	T;T;T	0.05786	3.39;3.39;3.39	2.49	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04998	0.0134	L	0.31526	0.94	0.25356	N	0.988829	B;B	0.20261	0.043;0.011	B;B	0.14578	0.011;0.011	T	0.16247	-1.0409	8	0.59425	D	0.04	.	6.0377	0.19716	0.7701:0.0:0.0:0.2299	.	456;296	B4DY57;Q13360	.;ZN177_HUMAN	L	296;296;456	ENSP00000445323:Q296L;ENSP00000341497:Q296L;ENSP00000415070:Q456L	ENSP00000341497:Q296L	Q	+	2	0	ZNF177	9353374	0.000000	0.05858	0.138000	0.22173	0.994000	0.84299	0.552000	0.23376	0.349000	0.23975	0.460000	0.39030	CAG		0.428	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449028.1	NM_003451		45	57	0	0	0	0.002852	0	45	57				
ZNF257	113835	broad.mit.edu	37	19	22270783	22270783	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:22270783G>T	ENST00000594947.1	+	4	375	c.231G>T	c.(229-231)atG>atT	p.M77I	ZNF257_ENST00000600162.1_3'UTR	NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	77					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.M77I(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTTAGTTATGTGTTCTCATA	0.294																																							uc010ecx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(229-231)ATG>ATT		zinc finger protein 257							41.0	41.0	41.0					19																	22270783		1894	4140	6034	SO:0001583	missense	113835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22270783G>T	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.231G>T	19.37:g.22270783G>T	ENSP00000470209:p.Met77Ile					ZNF257_uc010ecy.2_Missense_Mutation_p.M45I	p.M77I	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN			4	400	+		all_lung(12;0.0961)|Lung NSC(12;0.103)	77					B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	37	c.231G>T	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	G	0.026	-1.371502	0.01225	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.1	-0.514	0.11958	.	.	.	.	.	T	0.13457	0.0326	N	0.04746	-0.17	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.32214	-0.9915	8	0.10377	T	0.69	.	4.7543	0.13075	0.2492:0.0:0.7508:0.0	.	77	Q9Y2Q1	ZN257_HUMAN	I	77	.	ENSP00000380312:M77I	M	+	3	0	ZNF257	22062623	0.002000	0.14202	0.022000	0.16811	0.058000	0.15608	-0.389000	0.07342	-0.317000	0.08677	0.305000	0.20034	ATG		0.294	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1			9	24	1	0	5.68852e-11	0.004482	8.20386e-11	9	24				
ZNF536	9745	broad.mit.edu	37	19	31038886	31038886	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:31038886C>A	ENST00000355537.3	+	4	2507	c.2360C>A	c.(2359-2361)gCc>gAc	p.A787D		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	787					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.A787D(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TGTGACTATGCCGGCACGCAG	0.512																																							uc002nsu.1		NA																	1	Substitution - Missense(1)	p.A787A(1)	lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(2359-2361)GCC>GAC		zinc finger protein 536							65.0	68.0	67.0					19																	31038886		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31038886C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2360C>A	19.37:g.31038886C>A	ENSP00000347730:p.Ala787Asp					ZNF536_uc010edd.1_Missense_Mutation_p.A787D	p.A787D	NM_014717	NP_055532	O15090	ZN536_HUMAN			4	2498	+	Esophageal squamous(110;0.0834)		787			C2H2-type 9.		A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2360C>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089712	0.76756	.	.	ENSG00000198597	ENST00000355537	T	0.14266	2.52	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.30324	0.0761	L	0.31752	0.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00989	-1.1489	10	0.87932	D	0	-31.1218	20.6721	0.99693	0.0:1.0:0.0:0.0	.	787;787	A7E228;O15090	.;ZN536_HUMAN	D	787	ENSP00000347730:A787D	ENSP00000347730:A787D	A	+	2	0	ZNF536	35730726	1.000000	0.71417	0.989000	0.46669	0.987000	0.75469	7.481000	0.81124	2.894000	0.99253	0.591000	0.81541	GCC		0.512	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		36	233	1	0	4.0492e-12	0.006999	6.03113e-12	36	233				
TSHZ3	57616	broad.mit.edu	37	19	31770398	31770398	+	Nonsense_Mutation	SNP	C	C	A	rs375404314		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:31770398C>A	ENST00000240587.4	-	2	628	c.301G>T	c.(301-303)Gag>Tag	p.E101*		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	101					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E101*(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ACCGTGACCTCCTTGGTCTCC	0.532																																							uc002nsy.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(301-303)GAG>TAG		zinc finger protein 537							116.0	115.0	115.0					19																	31770398		2122	4234	6356	SO:0001587	stop_gained	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31770398C>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.301G>T	19.37:g.31770398C>A	ENSP00000240587:p.Glu101*						p.E101*	NM_020856	NP_065907	Q63HK5	TSH3_HUMAN			2	366	-	Esophageal squamous(110;0.226)		101					Q9H0G6|Q9P254	Nonsense_Mutation	SNP	ENST00000240587.4	37	c.301G>T	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	36	5.911078	0.97093	.	.	ENSG00000121297	ENST00000240587	.	.	.	5.77	5.77	0.91146	.	0.429836	0.20677	U	0.087722	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-27.4581	19.9924	0.97371	0.0:1.0:0.0:0.0	.	.	.	.	X	101	.	ENSP00000240587:E101X	E	-	1	0	TSHZ3	36462238	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	4.162000	0.58177	2.701000	0.92244	0.650000	0.86243	GAG		0.532	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		144	40	1	0	2.909e-70	0.00361	5.5393e-70	144	40				
HAUS5	23354	broad.mit.edu	37	19	36109807	36109807	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:36109807G>T	ENST00000203166.5	+	13	1060	c.1035G>T	c.(1033-1035)ggG>ggT	p.G345G	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	345					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.G345G(1)		NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						TGATACTGGGGCTTCGGCGCT	0.617																																							uc002oam.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1033-1035)GGG>GGT		HAUS augmin-like complex, subunit 5							47.0	46.0	46.0					19																	36109807		2072	4210	6282	SO:0001819	synonymous_variant	23354				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle		g.chr19:36109807G>T	AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.1035G>T	19.37:g.36109807G>T							p.G345G	NM_015302	NP_056117	O94927	HAUS5_HUMAN			13	1086	+			345					B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Silent	SNP	ENST00000203166.5	37	c.1035G>T	CCDS42550.1																																																																																				0.617	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459055.2			31	42	1	0	2.80507e-11	0.002445	4.10121e-11	31	42				
RBM42	79171	broad.mit.edu	37	19	36120454	36120454	+	Missense_Mutation	SNP	C	C	G	rs199759784		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:36120454C>G	ENST00000262633.4	+	2	266	c.161C>G	c.(160-162)cCt>cGt	p.P54R	RBM42_ENST00000588161.1_Missense_Mutation_p.P54R|RBM42_ENST00000592202.1_Missense_Mutation_p.P54R|RBM42_ENST00000589871.1_Missense_Mutation_p.P54R|RBM42_ENST00000360475.4_Missense_Mutation_p.P54R|RBM42_ENST00000589559.1_Missense_Mutation_p.P54R|RBM42_ENST00000586618.1_Missense_Mutation_p.P54R	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	54						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P54R(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCTCCAGTACCTGGAATCCCA	0.577																																							uc002oan.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(160-162)CCT>CGT		RNA binding motif protein 42							86.0	82.0	84.0					19																	36120454		2203	4300	6503	SO:0001583	missense	79171					cytoplasm|nucleus	nucleotide binding|RNA binding	g.chr19:36120454C>G	BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.161C>G	19.37:g.36120454C>G	ENSP00000262633:p.Pro54Arg					RBM42_uc010xsx.1_Missense_Mutation_p.P54R|RBM42_uc010eef.2_Missense_Mutation_p.P54R|RBM42_uc002oao.2_Missense_Mutation_p.P54R|RBM42_uc002oap.2_Missense_Mutation_p.P54R|RBM42_uc002oaq.2_Missense_Mutation_p.P54R|RBM42_uc010eeg.2_Missense_Mutation_p.P54R	p.P54R	NM_024321	NP_077297	Q9BTD8	RBM42_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		2	237	+	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		54					O00320|Q8N5R7|Q9BU66	Missense_Mutation	SNP	ENST00000262633.4	37	c.161C>G	CCDS12468.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838479	0.51057	.	.	ENSG00000126254	ENST00000262633;ENST00000360475	T;T	0.06371	3.36;3.31	4.72	4.72	0.59763	.	0.360004	0.25247	N	0.032046	T	0.06735	0.0172	N	0.19112	0.55	0.09310	N	1	P;B;P;B;P	0.49185	0.589;0.062;0.828;0.062;0.92	B;B;B;B;B	0.44224	0.211;0.035;0.422;0.035;0.444	T	0.20974	-1.0259	10	0.72032	D	0.01	-2.6603	15.2415	0.73474	0.0:1.0:0.0:0.0	.	54;54;54;54;54	B4DWT0;Q9BTD8-4;Q9BTD8-3;Q9BTD8-2;Q9BTD8	.;.;.;.;RBM42_HUMAN	R	54	ENSP00000262633:P54R;ENSP00000353663:P54R	ENSP00000262633:P54R	P	+	2	0	RBM42	40812294	0.987000	0.35691	0.091000	0.20842	0.638000	0.38207	3.782000	0.55401	2.437000	0.82529	0.655000	0.94253	CCT		0.577	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459057.2	NM_024321		36	65	0	0	0	0.004289	0	36	65				
ZFP14	57677	broad.mit.edu	37	19	36831324	36831324	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:36831324G>A	ENST00000270001.7	-	5	1519	c.1404C>T	c.(1402-1404)acC>acT	p.T468T		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T468T(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TCTGATGTTGGGTAAGTTGTG	0.373																																							uc002odx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1402-1404)ACC>ACT		zinc finger protein 14-like							103.0	97.0	99.0					19																	36831324		2203	4300	6503	SO:0001819	synonymous_variant	57677				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:36831324G>A	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1404C>T	19.37:g.36831324G>A						ZFP14_uc010xtd.1_Silent_p.T469T|ZFP14_uc010eex.1_Silent_p.T468T	p.T468T	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN			4	1497	-	Esophageal squamous(110;0.162)		468			C2H2-type 11.		A7MD23	Silent	SNP	ENST00000270001.7	37	c.1404C>T	CCDS33002.1																																																																																				0.373	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917		50	63	0	0	0	0.00361	0	50	63				
ZNF345	25850	broad.mit.edu	37	19	37367788	37367788	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:37367788A>G	ENST00000529555.1	+	2	844	c.56A>G	c.(55-57)gAa>gGa	p.E19G	ZNF345_ENST00000420450.1_Missense_Mutation_p.E19G|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000589046.1_Missense_Mutation_p.E19G			Q14585	ZN345_HUMAN	zinc finger protein 345	19					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E19G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGTGATTGGGAATGTAAAAAC	0.368																																							uc002oex.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(55-57)GAA>GGA		zinc finger protein 345							86.0	84.0	85.0					19																	37367788		2203	4300	6503	SO:0001583	missense	25850				negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleus	DNA binding|zinc ion binding	g.chr19:37367788A>G	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.56A>G	19.37:g.37367788A>G	ENSP00000431202:p.Glu19Gly					ZNF345_uc002oey.3_Missense_Mutation_p.E19G|ZNF345_uc002oez.2_Intron	p.E19G	NM_003419	NP_003410	Q14585	ZN345_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		3	434	+	Esophageal squamous(110;0.183)		19						Missense_Mutation	SNP	ENST00000529555.1	37	c.56A>G	CCDS12497.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825348	0.32237	.	.	ENSG00000251247	ENST00000532141;ENST00000420450;ENST00000529555;ENST00000331800	T;T;T;T	0.09163	5.37;3.1;3.1;3.01	4.4	4.4	0.53042	.	.	.	.	.	T	0.13243	0.0321	L	0.58101	1.795	0.23700	N	0.99708	B	0.20052	0.041	B	0.14578	0.011	T	0.07309	-1.0779	9	0.66056	D	0.02	.	10.3184	0.43751	1.0:0.0:0.0:0.0	.	19	Q14585	ZN345_HUMAN	G	19	ENSP00000431289:E19G;ENSP00000431216:E19G;ENSP00000431202:E19G;ENSP00000331120:E19G	ENSP00000331120:E19G	E	+	2	0	ZNF345	42059628	0.001000	0.12720	1.000000	0.80357	0.973000	0.67179	0.299000	0.19138	2.186000	0.69663	0.533000	0.62120	GAA		0.368	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1			34	82	0	0	0	0.002836	0	34	82				
ZNF829	374899	broad.mit.edu	37	19	37383322	37383322	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:37383322A>T	ENST00000391711.3	-	6	735	c.371T>A	c.(370-372)tTc>tAc	p.F124Y	ZNF829_ENST00000520965.1_Missense_Mutation_p.F205Y|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F124Y(1)		endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACTTGACTGAAATGTCTCTT	0.338																																							uc002ofa.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)TTC>TAC		zinc finger protein 829							56.0	51.0	52.0					19																	37383322		1816	4088	5904	SO:0001583	missense	374899				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37383322A>T	BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.371T>A	19.37:g.37383322A>T	ENSP00000429266:p.Phe124Tyr					ZNF345_uc002oez.2_Intron	p.F124Y	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	733	-	Esophageal squamous(110;0.183)		124					Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	ENST00000391711.3	37	c.371T>A	CCDS42557.1	.	.	.	.	.	.	.	.	.	.	A	8.336	0.827560	0.16749	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.05717	3.4	3.45	2.39	0.29439	.	.	.	.	.	T	0.04092	0.0114	L	0.28649	0.875	0.21950	N	0.999451	B	0.02656	0.0	B	0.04013	0.001	T	0.45644	-0.9247	9	0.02654	T	1	.	7.9071	0.29767	0.779:0.221:0.0:0.0	.	124	Q3KNS6	ZN829_HUMAN	Y	124	ENSP00000429266:F124Y	ENSP00000429266:F124Y	F	-	2	0	ZNF829	42075162	0.529000	0.26322	0.992000	0.48379	0.961000	0.63080	1.786000	0.38694	0.673000	0.31224	0.528000	0.53228	TTC		0.338	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109575.3	NM_001037232		6	71	0	0	0	0.001168	0	6	71				
ZNF568	374900	broad.mit.edu	37	19	37440956	37440956	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:37440956A>C	ENST00000333987.7	+	7	1407	c.901A>C	c.(901-903)Act>Cct	p.T301P	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.T237P|ZNF568_ENST00000427117.1_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	301					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T301P(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGAATTCATACTGGGGAGAA	0.378																																							uc002ofc.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(901-903)ACT>CCT		zinc finger protein 568							36.0	40.0	39.0					19																	37440956		2167	4275	6442	SO:0001583	missense	374900				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37440956A>C	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.901A>C	19.37:g.37440956A>C	ENSP00000334685:p.Thr301Pro					ZNF568_uc010efg.2_Intron|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Missense_Mutation_p.T225P|ZNF568_uc010efe.2_Missense_Mutation_p.T225P|ZNF568_uc010eff.1_Intron	p.T301P	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		7	1416	+	Esophageal squamous(110;0.183)		301					B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	37	c.901A>C	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.740700	0.49045	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.25749	1.78;1.78	3.95	2.9	0.33743	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38058	N	0.001828	T	0.40743	0.1129	L	0.49256	1.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.16512	-1.0400	10	0.87932	D	0	.	8.6781	0.34191	0.8066:0.1933:0.0:0.0	.	301	Q3ZCX4	ZN568_HUMAN	P	301;237	ENSP00000334685:T301P;ENSP00000394514:T237P	ENSP00000334685:T301P	T	+	1	0	ZNF568	42132796	0.517000	0.26226	0.040000	0.18447	0.984000	0.73092	2.500000	0.45381	0.637000	0.30526	0.533000	0.62120	ACT		0.378	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539		31	42	0	0	0	0.002096	0	31	42				
ZNF569	148266	broad.mit.edu	37	19	37904566	37904566	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:37904566C>A	ENST00000316950.6	-	6	1551	c.994G>T	c.(994-996)Ggt>Tgt	p.G332C	ZNF569_ENST00000392149.2_Missense_Mutation_p.G332C|ZNF569_ENST00000392150.2_Missense_Mutation_p.G173C	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	332					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G332C(1)		breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGGCTTTACCACATTCATTA	0.398																																							uc002ogi.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|skin(1)	3						c.(994-996)GGT>TGT		zinc finger protein 569							136.0	132.0	133.0					19																	37904566		2203	4300	6503	SO:0001583	missense	148266				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37904566C>A	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.994G>T	19.37:g.37904566C>A	ENSP00000325018:p.Gly332Cys					ZNF569_uc002ogh.2_Missense_Mutation_p.G173C|ZNF569_uc002ogj.2_Missense_Mutation_p.G356C	p.G332C	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1552	-			332			C2H2-type 6.		A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	c.994G>T	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208365	0.58343	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	T;T	0.58797	0.31;0.31	3.97	2.93	0.34026	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38492	N	0.001667	T	0.79009	0.4374	M	0.92880	3.355	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.82293	-0.0529	10	0.87932	D	0	.	10.6846	0.45835	0.0:0.9015:0.0:0.0985	.	173;332	Q17RR6;Q5MCW4	.;ZN569_HUMAN	C	332;173	ENSP00000325018:G332C;ENSP00000375993:G173C	ENSP00000325018:G332C	G	-	1	0	ZNF569	42596406	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	1.817000	0.39002	1.000000	0.39049	0.655000	0.94253	GGT		0.398	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484		86	152	1	0	2.18481e-45	0.00361	4.13553e-45	86	152				
RYR1	6261	broad.mit.edu	37	19	38959634	38959634	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:38959634C>A	ENST00000359596.3	+	26	3410	c.3410C>A	c.(3409-3411)cCa>cAa	p.P1137Q	RYR1_ENST00000360985.3_Missense_Mutation_p.P1137Q|RYR1_ENST00000355481.4_Missense_Mutation_p.P1137Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1137	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.P1137Q(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGCAGTGAACCATTTGGGCGC	0.567																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(3409-3411)CCA>CAA		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						63.0	60.0	61.0					19																	38959634		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38959634C>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3410C>A	19.37:g.38959634C>A	ENSP00000352608:p.Pro1137Gln					RYR1_uc002oiu.2_Missense_Mutation_p.P1137Q	p.P1137Q	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		26	3540	+	all_cancers(60;7.91e-06)		1137			6 X approximate repeats.|Cytoplasmic.|B30.2/SPRY 2.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.3410C>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	c	9.324	1.058824	0.19987	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.72725	-0.68;-0.68;-0.68	4.33	3.29	0.37713	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000014	T	0.73094	0.3543	M	0.69823	2.125	0.33506	D	0.590555	P;P	0.51933	0.949;0.907	P;P	0.51170	0.575;0.661	T	0.77938	-0.2400	10	0.30078	T	0.28	.	9.9434	0.41593	0.0:0.8273:0.0:0.1727	.	1137;1137	P21817-2;P21817	.;RYR1_HUMAN	Q	1137	ENSP00000352608:P1137Q;ENSP00000347667:P1137Q;ENSP00000354254:P1137Q	ENSP00000347667:P1137Q	P	+	2	0	RYR1	43651474	0.000000	0.05858	0.887000	0.34795	0.848000	0.48234	-0.308000	0.08156	1.050000	0.40346	0.483000	0.47432	CCA		0.567	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			20	34	1	0	1.00905e-13	0.008871	1.55766e-13	20	34				
RYR1	6261	broad.mit.edu	37	19	38980787	38980787	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:38980787G>T	ENST00000359596.3	+	36	5886	c.5886G>T	c.(5884-5886)gcG>gcT	p.A1962A	RYR1_ENST00000360985.3_Silent_p.A1962A|RYR1_ENST00000355481.4_Silent_p.A1962A			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1962	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A1962A(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CAGCCTTTGCGGAGCGCTATG	0.592																																							uc002oit.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(5884-5886)GCG>GCT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						65.0	57.0	59.0					19																	38980787		2203	4300	6503	SO:0001819	synonymous_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38980787G>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5886G>T	19.37:g.38980787G>T						RYR1_uc002oiu.2_Silent_p.A1962A	p.A1962A	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		36	6016	+	all_cancers(60;7.91e-06)		1962			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	c.5886G>T	CCDS33011.1																																																																																				0.592	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			25	39	1	0	7.88262e-20	0.00333	1.36232e-19	25	39				
RYR1	6261	broad.mit.edu	37	19	39008322	39008322	+	Missense_Mutation	SNP	C	C	T	rs200296387		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:39008322C>T	ENST00000359596.3	+	66	10009	c.10009C>T	c.(10009-10011)Cgg>Tgg	p.R3337W	RYR1_ENST00000360985.3_Missense_Mutation_p.R3337W|RYR1_ENST00000355481.4_Missense_Mutation_p.R3337W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3337					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R3337W(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTGGATGAAGCGGCTGGCTGG	0.622																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(10009-10011)CGG>TGG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	36.0	37.0	36.0		10009,10009	3.4	1.0	19		36	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RYR1	NM_000540.2,NM_001042723.1	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	3337/5039,3337/5034	39008322	1,13005	2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39008322C>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10009C>T	19.37:g.39008322C>T	ENSP00000352608:p.Arg3337Trp					RYR1_uc002oiu.2_Missense_Mutation_p.R3337W|RYR1_uc002oiv.1_Missense_Mutation_p.R257W|RYR1_uc010xuf.1_Missense_Mutation_p.R257W	p.R3337W	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		66	10139	+	all_cancers(60;7.91e-06)		3337					Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.10009C>T	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	5.988	0.366158	0.11352	0.0	1.16E-4	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.98060	-4.69;-4.69;-4.69	3.41	3.41	0.39046	.	0.000000	0.64402	U	0.000019	D	0.98438	0.9480	M	0.86028	2.79	0.47949	D	0.999555	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.99	D	0.98662	1.0684	10	0.87932	D	0	.	9.6803	0.40065	0.3385:0.6615:0.0:0.0	.	3337;3337;3337	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	W	3337;3337;3337;257	ENSP00000352608:R3337W;ENSP00000347667:R3337W;ENSP00000354254:R3337W	ENSP00000347667:R3337W	R	+	1	2	RYR1	43700162	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	1.606000	0.36826	1.753000	0.51906	0.205000	0.17691	CGG		0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			6	40	0	0	0	0.00308	0	6	40				
MAP4K1	11184	broad.mit.edu	37	19	39101766	39101766	+	Silent	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:39101766A>T	ENST00000591517.1	-	11	763	c.735T>A	c.(733-735)gcT>gcA	p.A245A	MAP4K1_ENST00000586296.1_Silent_p.A245A|MAP4K1_ENST00000589002.1_Intron|MAP4K1_ENST00000423454.2_Intron|MAP4K1_ENST00000589130.1_Silent_p.A241A|MAP4K1_ENST00000396857.2_Silent_p.A245A	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	245	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.A245A(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGTGGAAGGCAGCCGACCTTG	0.582																																							uc002oix.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(4)|lung(3)|ovary(1)	8						c.(733-735)GCT>GCA		mitogen-activated protein kinase kinase kinase							98.0	109.0	106.0					19																	39101766		1987	4157	6144	SO:0001819	synonymous_variant	11184				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity	g.chr19:39101766A>T	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.735T>A	19.37:g.39101766A>T						MAP4K1_uc002oiy.1_Silent_p.A245A|MAP4K1_uc010xug.1_Intron	p.A245A	NM_007181	NP_009112	Q92918	M4K1_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)		11	843	-	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		245			Protein kinase.			Silent	SNP	ENST00000591517.1	37	c.735T>A	CCDS59385.1																																																																																				0.582	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600		9	30	0	0	0	0.004482	0	9	30				
TRPM4	54795	broad.mit.edu	37	19	49693476	49693476	+	Silent	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:49693476A>C	ENST00000252826.5	+	15	2157	c.2031A>C	c.(2029-2031)acA>acC	p.T677T	TRPM4_ENST00000355712.5_Silent_p.T323T|TRPM4_ENST00000427978.2_Silent_p.T677T	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	677					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)	p.T677T(1)		breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CTCTGCTGACACAGAAGTGGT	0.587																																							uc002pmw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2029-2031)ACA>ACC		transient receptor potential cation channel,							211.0	199.0	203.0					19																	49693476		2203	4300	6503	SO:0001819	synonymous_variant	54795				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding	g.chr19:49693476A>C	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.2031A>C	19.37:g.49693476A>C						TRPM4_uc010emu.2_Silent_p.T677T|TRPM4_uc010yak.1_Silent_p.T141T|TRPM4_uc002pmx.2_Silent_p.T503T|TRPM4_uc010emv.2_Silent_p.T562T|TRPM4_uc010yal.1_Silent_p.T323T|TRPM4_uc002pmy.2_Silent_p.T19T	p.T677T	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)	15	2103	+		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)	677			Cytoplasmic (Potential).		A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Silent	SNP	ENST00000252826.5	37	c.2031A>C	CCDS33073.1																																																																																				0.587	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636		125	106	0	0	0	0.00361	0	125	106				
ZNF432	9668	broad.mit.edu	37	19	52538395	52538395	+	Silent	SNP	G	G	A	rs188722056	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:52538395G>A	ENST00000594154.1	-	5	749	c.537C>T	c.(535-537)ttC>ttT	p.F179F	ZNF432_ENST00000221315.5_Silent_p.F179F			O94892	ZN432_HUMAN	zinc finger protein 432	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F179F(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		TACTTACAGAGAATTTAGCTG	0.348																																							uc002pyk.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|pancreas(1)	3						c.(535-537)TTC>TTT		zinc finger protein 432							65.0	64.0	64.0					19																	52538395		2203	4300	6503	SO:0001819	synonymous_variant	9668				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52538395G>A	AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.537C>T	19.37:g.52538395G>A							p.F179F	NM_014650	NP_055465	O94892	ZN432_HUMAN		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)	5	855	-		all_neural(266;0.117)	179						Silent	SNP	ENST00000594154.1	37	c.537C>T	CCDS12848.1																																																																																				0.348	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1	NM_014650		3	85	0	0	0	0.004672	0	3	85				
ZNF836	162962	broad.mit.edu	37	19	52659499	52659499	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:52659499G>A	ENST00000322146.8	-	5	1958	c.1437C>T	c.(1435-1437)ttC>ttT	p.F479F	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Silent_p.F479F	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F479F(2)		endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						AAGTCTGACTGAAGACCTTGC	0.428																																							uc010ydi.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1435-1437)TTC>TTT		zinc finger protein 836							114.0	118.0	116.0					19																	52659499		2203	4300	6503	SO:0001819	synonymous_variant	162962				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52659499G>A	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.1437C>T	19.37:g.52659499G>A						ZNF836_uc010ydj.1_Silent_p.F479F	p.F479F	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN			5	1811	-			479			C2H2-type 10.			Silent	SNP	ENST00000322146.8	37	c.1437C>T	CCDS46162.1																																																																																				0.428	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657		54	54	0	0	0	0.00361	0	54	54				
ZNF761	388561	broad.mit.edu	37	19	53958705	53958705	+	RNA	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:53958705G>A	ENST00000454407.1	+	0	1397							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R261K(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		ATACTTGAAAGACATAGGATA	0.383																																							uc010eqp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(943-945)AGA>AAA		zinc finger protein 761							83.0	85.0	84.0					19																	53958705		2203	4300	6503			388561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53958705G>A	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958705G>A						ZNF761_uc010ydy.1_Missense_Mutation_p.R261K|ZNF761_uc002qbt.1_Missense_Mutation_p.R261K	p.R315K	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN		GBM - Glioblastoma multiforme(134;0.00786)	7	1402	+			315			C2H2-type 4.		Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37	c.944G>A																																																																																					0.383	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401		14	112	0	0	0	0.003163	0	14	112				
VSTM1	284415	broad.mit.edu	37	19	54561767	54561767	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:54561767G>T	ENST00000338372.2	-	3	323	c.148C>A	c.(148-150)Cag>Aag	p.Q50K	VSTM1_ENST00000425006.2_Missense_Mutation_p.Q50K|VSTM1_ENST00000366170.2_Intron|VSTM1_ENST00000376626.1_Missense_Mutation_p.Q50K	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	50	Ig-like V-type.				immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.Q50K(1)		breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		GAATGAGCCTGACACTTCAGG	0.532																																							uc002qcw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(148-150)CAG>AAG		V-set and transmembrane domain containing 1							118.0	113.0	115.0					19																	54561767		2203	4300	6503	SO:0001583	missense	284415					integral to membrane		g.chr19:54561767G>T	AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.148C>A	19.37:g.54561767G>T	ENSP00000343366:p.Gln50Lys					VSTM1_uc010erb.2_RNA|VSTM1_uc002qcx.3_Missense_Mutation_p.Q50K	p.Q50K	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN		GBM - Glioblastoma multiforme(134;0.165)	3	324	-	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)		50			Ig-like V-type.		B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Missense_Mutation	SNP	ENST00000338372.2	37	c.148C>A	CCDS12872.1	.	.	.	.	.	.	.	.	.	.	G	2.137	-0.397743	0.04899	.	.	ENSG00000189068	ENST00000338372;ENST00000376626;ENST00000425006	T;T;T	0.13420	2.59;2.59;2.59	3.49	-2.94	0.05581	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.060130	0.02983	N	0.145940	T	0.15478	0.0373	M	0.77486	2.375	0.09310	N	1	B;B	0.26445	0.149;0.149	B;B	0.25405	0.06;0.06	T	0.26883	-1.0090	9	.	.	.	-0.0648	0.542	0.00647	0.3434:0.1737:0.3058:0.1771	.	50;50	D2DJS4;Q6UX27	.;VSTM1_HUMAN	K	50	ENSP00000343366:Q50K;ENSP00000365813:Q50K;ENSP00000413006:Q50K	.	Q	-	1	0	VSTM1	59253579	0.000000	0.05858	0.002000	0.10522	0.038000	0.13279	-2.184000	0.01254	-0.624000	0.05611	0.467000	0.42956	CAG		0.532	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481		12	91	1	0	1.5842e-08	0.001855	2.08603e-08	12	91				
LILRA2	11027	broad.mit.edu	37	19	55086909	55086909	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:55086909C>T	ENST00000251377.3	+	6	975	c.842C>T	c.(841-843)aCc>aTc	p.T281I	LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000391737.1_Missense_Mutation_p.T269I|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000251376.3_Missense_Mutation_p.T281I|LILRA2_ENST00000391738.3_Missense_Mutation_p.T281I|LILRB1_ENST00000418536.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	281	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.T281I(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GCCAACTTCACCCTGGGCCCT	0.632																																							uc002qgg.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(841-843)ACC>ATC		leukocyte immunoglobulin-like receptor,							55.0	57.0	56.0					19																	55086909		2203	4300	6503	SO:0001583	missense	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55086909C>T	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.842C>T	19.37:g.55086909C>T	ENSP00000251377:p.Thr281Ile					LILRA2_uc010ern.2_Missense_Mutation_p.T281I|LILRA2_uc002qgf.2_Missense_Mutation_p.T281I|LILRA2_uc010yfe.1_Missense_Mutation_p.T281I|LILRA2_uc010yff.1_Missense_Mutation_p.T269I|LILRA2_uc010ero.2_Missense_Mutation_p.T269I|LILRA2_uc010yfg.1_Intron	p.T281I	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	5	931	+			281			Ig-like C2-type 3.|Extracellular (Potential).		O75020	Missense_Mutation	SNP	ENST00000251377.3	37	c.842C>T	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.408056	0.42715	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72	2.8	0.414	0.16406	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	3.373290	0.00780	N	0.001278	T	0.26048	0.0635	M	0.73319	2.225	0.09310	N	1	B;P;P;B	0.48911	0.295;0.917;0.917;0.354	B;P;P;B	0.52823	0.248;0.71;0.703;0.287	T	0.07481	-1.0770	10	0.35671	T	0.21	.	3.2698	0.06878	0.2546:0.5952:0.0:0.1503	.	281;269;281;281	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	I	281;281;281;281;269	ENSP00000388131:T281I;ENSP00000251377:T281I;ENSP00000375618:T281I;ENSP00000251376:T281I;ENSP00000375617:T269I	ENSP00000251376:T281I	T	+	2	0	LILRA2	59778721	0.000000	0.05858	0.009000	0.14445	0.335000	0.28730	-0.849000	0.04322	0.048000	0.15891	0.400000	0.26472	ACC		0.632	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			30	39	0	0	0	0.002836	0	30	39				
ISOC2	79763	broad.mit.edu	37	19	55967071	55967071	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:55967071C>A	ENST00000425675.2	-	3	340	c.280G>T	c.(280-282)Gag>Tag	p.E94*	ISOC2_ENST00000438389.2_Intron|ISOC2_ENST00000085068.3_Nonsense_Mutation_p.E94*			Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2	94					protein destabilization (GO:0031648)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.E94*(1)		endometrium(1)|lung(4)|ovary(1)|stomach(1)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		CTGTCCAGCTCCTGCTGCAGG	0.672																																							uc002qlb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(280-282)GAG>TAG		isochorismatase domain containing 2 isoform 1							20.0	22.0	22.0					19																	55967071		2202	4295	6497	SO:0001587	stop_gained	79763				protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding	g.chr19:55967071C>A	AK027122	CCDS12925.1, CCDS46194.1, CCDS46195.1	19q13.42	2011-07-14			ENSG00000063241	ENSG00000063241			26278	protein-coding gene	gene with protein product		612928				17658461	Standard	NM_024710		Approved	FLJ23469	uc002qla.3	Q96AB3		ENST00000425675.2:c.280G>T	19.37:g.55967071C>A	ENSP00000401726:p.Glu94*					ISOC2_uc002qla.2_Nonsense_Mutation_p.E94*|ISOC2_uc002qlc.2_Intron	p.E94*	NM_001136201	NP_001129673	Q96AB3	ISOC2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)	3	454	-	Breast(117;0.155)		94					Q6ZN91|Q9H5G0	Nonsense_Mutation	SNP	ENST00000425675.2	37	c.280G>T	CCDS46195.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759731	0.89932	.	.	ENSG00000063241	ENST00000085068;ENST00000425675	.	.	.	4.39	4.39	0.52855	.	0.293676	0.31507	N	0.007522	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-18.9208	8.6525	0.34044	0.0:0.8934:0.0:0.1066	.	.	.	.	X	94	.	ENSP00000085068:E94X	E	-	1	0	ISOC2	60658883	0.935000	0.31712	0.998000	0.56505	0.572000	0.35998	0.895000	0.28363	2.168000	0.68352	0.491000	0.48974	GAG		0.672	ISOC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453179.1	NM_024710		8	8	1	0	0.000157383	0.00308	0.000180353	8	8				
ZIM3	114026	broad.mit.edu	37	19	57646434	57646434	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:57646434C>A	ENST00000269834.1	-	5	1656	c.1271G>T	c.(1270-1272)tGt>tTt	p.C424F	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C424F(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GGTTTTTCCACATTCACTACA	0.388																																							uc002qnz.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(1270-1272)TGT>TTT		zinc finger, imprinted 3							161.0	163.0	162.0					19																	57646434		2203	4300	6503	SO:0001583	missense	114026				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57646434C>A	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.1271G>T	19.37:g.57646434C>A	ENSP00000269834:p.Cys424Phe						p.C424F	NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	5	1657	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)	424			C2H2-type 10.		Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	c.1271G>T	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411608	0.42817	.	.	ENSG00000141946	ENST00000269834	D	0.85861	-2.04	2.53	2.53	0.30540	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95046	0.8396	H	0.98996	4.395	0.31143	N	0.706402	D	0.89917	1.0	D	0.91635	0.999	D	0.91931	0.5555	9	0.87932	D	0	.	10.7601	0.46259	0.0:1.0:0.0:0.0	.	424	Q96PE6	ZIM3_HUMAN	F	424	ENSP00000269834:C424F	ENSP00000269834:C424F	C	-	2	0	ZIM3	62338246	1.000000	0.71417	0.003000	0.11579	0.102000	0.19082	4.443000	0.59994	1.400000	0.46741	0.313000	0.20887	TGT		0.388	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1			19	180	1	0	2.35188e-11	0.006122	3.4545e-11	19	180				
ZNF211	10520	broad.mit.edu	37	19	58152597	58152597	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:58152597A>T	ENST00000347302.3	+	3	922	c.743A>T	c.(742-744)cAg>cTg	p.Q248L	ZNF211_ENST00000299871.5_Missense_Mutation_p.Q313L|ZNF211_ENST00000541801.1_Missense_Mutation_p.Q239L|ZNF211_ENST00000420680.1_Missense_Mutation_p.Q252L|ZNF211_ENST00000254182.7_Missense_Mutation_p.Q239L|ZNF211_ENST00000391703.3_Missense_Mutation_p.Q187L|ZNF211_ENST00000544273.1_Missense_Mutation_p.Q260L|ZNF211_ENST00000240731.4_Missense_Mutation_p.Q261L	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q261L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTTCAGGACCAGAGAATCCTC	0.443																																							uc002qpq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(742-744)CAG>CTG		zinc finger protein 211 isoform 2							98.0	98.0	98.0					19																	58152597		2203	4300	6503	SO:0001583	missense	10520					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58152597A>T	U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.743A>T	19.37:g.58152597A>T	ENSP00000339562:p.Gln248Leu					ZNF211_uc010yhb.1_Missense_Mutation_p.Q252L|ZNF211_uc002qpp.2_Missense_Mutation_p.Q261L|ZNF211_uc002qpr.2_Missense_Mutation_p.Q312L|ZNF211_uc002qps.2_Missense_Mutation_p.Q313L|ZNF211_uc002qpt.2_Missense_Mutation_p.Q260L|ZNF211_uc010yhc.1_Missense_Mutation_p.Q260L|ZNF211_uc010yhd.1_Missense_Mutation_p.Q187L|ZNF211_uc010yhe.1_Missense_Mutation_p.Q239L	p.Q248L	NM_198855	NP_942152	Q13398	ZN211_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	923	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	248					B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Missense_Mutation	SNP	ENST00000347302.3	37	c.743A>T	CCDS12957.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.489013	0.26686	.	.	ENSG00000121417	ENST00000420680;ENST00000347302;ENST00000254182;ENST00000391703;ENST00000541801;ENST00000299871;ENST00000544273;ENST00000240731	T;T;T;T;T;T;T;T	0.15256	2.44;2.44;2.44;2.44;2.44;2.44;2.44;2.44	3.53	2.51	0.30379	.	.	.	.	.	T	0.12178	0.0296	L	0.46670	1.46	0.09310	N	1	P;P;P;B;P;P	0.41929	0.733;0.733;0.765;0.033;0.614;0.614	B;B;B;B;B;B	0.29598	0.104;0.104;0.102;0.009;0.048;0.048	T	0.18681	-1.0329	9	0.66056	D	0.02	.	8.0941	0.30818	0.8903:0.0:0.1097:0.0	.	252;260;313;239;248;261	Q13398-4;Q13398-3;F8WDV2;Q13398-2;Q13398;B9ZVW1	.;.;.;.;ZN211_HUMAN;.	L	252;248;239;187;239;313;260;261	ENSP00000399193:Q252L;ENSP00000339562:Q248L;ENSP00000254182:Q239L;ENSP00000375584:Q187L;ENSP00000442601:Q239L;ENSP00000299871:Q313L;ENSP00000441386:Q260L;ENSP00000240731:Q261L	ENSP00000240731:Q261L	Q	+	2	0	ZNF211	62844409	.	.	0.513000	0.27749	0.916000	0.54674	.	.	1.613000	0.50231	0.482000	0.46254	CAG		0.443	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1			67	47	0	0	0	0.00361	0	67	47				
ZNF154	7710	broad.mit.edu	37	19	58213094	58213094	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:58213094G>T	ENST00000512439.2	-	3	1419	c.1223C>A	c.(1222-1224)aCt>aAt	p.T408N	ZNF551_ENST00000596085.1_Intron|ZNF154_ENST00000426889.1_Missense_Mutation_p.T408N|AC003006.7_ENST00000594684.1_Intron|AC003006.7_ENST00000599221.1_Intron			Q13106	ZN154_HUMAN	zinc finger protein 154	408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T408N(2)		endometrium(1)|kidney(1)|large_intestine(7)|lung(3)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTTCTCCCCAGTGTGAACCCT	0.443																																							uc010euf.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1222-1224)ACT>AAT		zinc finger protein 154							60.0	63.0	62.0					19																	58213094		2184	4297	6481	SO:0001583	missense	7710					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58213094G>T	U20648	CCDS42639.1	19q13.4	2013-01-08	2006-08-22		ENSG00000179909	ENSG00000179909		"""Zinc fingers, C2H2-type"", ""-"""	12939	protein-coding gene	gene with protein product		604085	"""zinc finger protein 154 (pHZ-92)"""			7557990	Standard	XR_243957		Approved	pHZ-92	uc010euf.3	Q13106	OTTHUMG00000140375	ENST00000512439.2:c.1223C>A	19.37:g.58213094G>T	ENSP00000421258:p.Thr408Asn					ZNF776_uc002qpx.2_Intron|ZNF154_uc002qpy.2_RNA	p.T408N	NM_001085384	NP_001078853	Q13106	ZN154_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	3	1463	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	408					A7MCY3|Q8IVG7|Q8NAR0	Missense_Mutation	SNP	ENST00000512439.2	37	c.1223C>A	CCDS42639.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548333	0.45383	.	.	ENSG00000179909	ENST00000512439;ENST00000426889	T;T	0.26067	1.76;1.76	2.99	2.99	0.34606	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32763	0.0840	L	0.58810	1.83	0.28535	N	0.912393	P	0.48350	0.909	P	0.47299	0.543	T	0.18999	-1.0319	9	0.72032	D	0.01	.	12.1742	0.54176	0.0:0.0:1.0:0.0	.	408	Q13106	ZN154_HUMAN	N	408	ENSP00000421258:T408N;ENSP00000442370:T408N	ENSP00000442370:T408N	T	-	2	0	ZNF154	62904906	0.917000	0.31117	1.000000	0.80357	0.570000	0.35934	2.416000	0.44644	1.990000	0.58119	0.561000	0.74099	ACT		0.443	ZNF154-002	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277102.2			36	31	1	0	4.4194e-11	0.002836	6.41722e-11	36	31				
ZNF417	147687	broad.mit.edu	37	19	58420582	58420582	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:58420582C>A	ENST00000312026.5	-	3	1228	c.1064G>T	c.(1063-1065)gGg>gTg	p.G355V	ZNF417_ENST00000536263.1_Missense_Mutation_p.G156V|CTD-2583A14.9_ENST00000602124.1_Intron|ZNF417_ENST00000595559.1_Missense_Mutation_p.G354V	NM_152475.2	NP_689688.2	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	355					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G355V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|stomach(3)|upper_aerodigestive_tract(1)	18		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		CCCACATTCCCCACAGTGATA	0.428																																							uc002qqq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1063-1065)GGG>GTG		zinc finger protein 417							98.0	90.0	93.0					19																	58420582		2202	4281	6483	SO:0001583	missense	147687				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58420582C>A	BC025783	CCDS12965.1, CCDS74469.1	19q13.43	2013-01-08				ENSG00000173480		"""Zinc fingers, C2H2-type"", ""-"""	20646	protein-coding gene	gene with protein product							Standard	NM_152475		Approved	MGC34079	uc002qqq.3	Q8TAU3		ENST00000312026.5:c.1064G>T	19.37:g.58420582C>A	ENSP00000311319:p.Gly355Val					ZNF417_uc010yhm.1_Missense_Mutation_p.G312V|ZNF417_uc002qqr.2_Missense_Mutation_p.G354V	p.G355V	NM_152475	NP_689688	Q8TAU3	ZN417_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)	3	1263	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	355			C2H2-type 6.		B4DEU1	Missense_Mutation	SNP	ENST00000312026.5	37	c.1064G>T	CCDS12965.1	.	.	.	.	.	.	.	.	.	.	.	13.28	2.190361	0.38707	.	.	ENSG00000173480	ENST00000312026;ENST00000536263	T;T	0.17854	2.25;2.25	2.21	-3.12	0.05282	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19604	0.0471	L	0.33668	1.02	0.09310	N	1	B;D	0.76494	0.069;0.999	B;D	0.70487	0.02;0.969	T	0.17930	-1.0353	9	0.35671	T	0.21	.	1.2647	0.02008	0.1563:0.1991:0.387:0.2577	.	355;355	F5H0M9;Q8TAU3	.;ZN417_HUMAN	V	355;156	ENSP00000311319:G355V;ENSP00000442760:G156V	ENSP00000311319:G355V	G	-	2	0	ZNF417	63112394	0.000000	0.05858	0.001000	0.08648	0.326000	0.28443	-5.203000	0.00142	-0.218000	0.10018	0.306000	0.20318	GGG		0.428	ZNF417-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466860.1	NM_152475		84	89	1	0	8.61122e-29	0.00361	1.59672e-28	84	89				
PXDN	7837	broad.mit.edu	37	2	1642638	1642638	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:1642638T>C	ENST00000252804.4	-	21	4236	c.4186A>G	c.(4186-4188)Atc>Gtc	p.I1396V		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1396					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.I1396V(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AGGTCTGTGATGGTCTTCTGC	0.557																																							uc002qxa.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(6)|ovary(2)	8						c.(4186-4188)ATC>GTC		peroxidasin precursor							136.0	141.0	139.0					2																	1642638		2084	4213	6297	SO:0001583	missense	7837				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity	g.chr2:1642638T>C	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.4186A>G	2.37:g.1642638T>C	ENSP00000252804:p.Ile1396Val						p.I1396V	NM_012293	NP_036425	Q92626	PXDN_HUMAN		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)	21	4250	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	1396					A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	c.4186A>G	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.262450	0.39995	.	.	ENSG00000130508	ENST00000252804	T	0.60040	0.22	5.43	5.43	0.79202	.	0.054582	0.64402	D	0.000001	T	0.51363	0.1670	L	0.50333	1.59	0.40357	D	0.979201	B	0.22800	0.075	B	0.22152	0.038	T	0.48410	-0.9038	10	0.23302	T	0.38	-55.5092	14.0045	0.64453	0.0:0.0:0.0:1.0	.	1396	Q92626	PXDN_HUMAN	V	1396	ENSP00000252804:I1396V	ENSP00000252804:I1396V	I	-	1	0	PXDN	1621645	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.513000	0.60476	2.185000	0.69588	0.460000	0.39030	ATC		0.557	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455		10	34	0	0	0	0.00245	0	10	34				
GRHL1	29841	broad.mit.edu	37	2	10102598	10102598	+	Silent	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:10102598G>C	ENST00000324907.9	+	5	820	c.684G>C	c.(682-684)tcG>tcC	p.S228S	GRHL1_ENST00000324883.5_Intron|GRHL1_ENST00000405379.2_Silent_p.S228S	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	228					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S228S(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		TCTTCCCCTCGGATCTCAGTC	0.383																																							uc002raa.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)|skin(1)	2						c.(682-684)TCG>TCC		grainyhead-like 1							165.0	153.0	156.0					2																	10102598		1879	4110	5989	SO:0001819	synonymous_variant	29841				cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding	g.chr2:10102598G>C	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.684G>C	2.37:g.10102598G>C						GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Silent_p.S77S	p.S228S	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN		Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)	5	855	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		228					A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Silent	SNP	ENST00000324907.9	37	c.684G>C	CCDS33144.2																																																																																				0.383	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552		3	23	0	0	0	0.009096	0	3	23				
APOB	338	broad.mit.edu	37	2	21233969	21233969	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:21233969G>T	ENST00000233242.1	-	26	5898	c.5771C>A	c.(5770-5772)aCt>aAt	p.T1924N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1924					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T1924N(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCTGCCCAGTATGTTCTCC	0.458																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(5770-5772)ACT>AAT		apolipoprotein B precursor	Atorvastatin(DB01076)						203.0	187.0	192.0					2																	21233969		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21233969G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5771C>A	2.37:g.21233969G>T	ENSP00000233242:p.Thr1924Asn						p.T1924N	NM_000384	NP_000375	P04114	APOB_HUMAN			26	5899	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1924					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.5771C>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.009328	0.35415	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00902	5.56	5.67	4.79	0.61399	.	0.100807	0.43260	D	0.000595	T	0.01730	0.0055	M	0.67953	2.075	0.40556	D	0.981165	B	0.34372	0.451	B	0.30179	0.112	T	0.56323	-0.7998	10	0.66056	D	0.02	.	14.9046	0.70709	0.0693:0.0:0.9307:0.0	.	1924	P04114	APOB_HUMAN	N	1924	ENSP00000233242:T1924N	ENSP00000233242:T1924N	T	-	2	0	APOB	21087474	0.017000	0.18338	0.341000	0.25589	0.971000	0.66376	0.738000	0.26158	1.389000	0.46526	0.555000	0.69702	ACT		0.458	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			52	128	1	0	1.39843e-22	0.00361	2.52671e-22	52	128				
APOB	338	broad.mit.edu	37	2	21251356	21251356	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:21251356G>T	ENST00000233242.1	-	13	1799	c.1672C>A	c.(1672-1674)Cga>Aga	p.R558R	APOB_ENST00000399256.4_Silent_p.R558R	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	558	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.R558*(1)|p.R558R(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAGCCAGTCGCTTATCTCCC	0.448																																							uc002red.2		NA																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(1672-1674)CGA>AGA		apolipoprotein B precursor	Atorvastatin(DB01076)						118.0	113.0	115.0					2																	21251356		2203	4300	6503	SO:0001819	synonymous_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21251356G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1672C>A	2.37:g.21251356G>T							p.R558R	NM_000384	NP_000375	P04114	APOB_HUMAN			13	1800	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		558			Vitellogenin.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	c.1672C>A	CCDS1703.1																																																																																				0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			40	77	1	0	2.24893e-16	0.009718	3.72479e-16	40	77				
DNMT3A	1788	broad.mit.edu	37	2	25470539	25470539	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:25470539G>A	ENST00000264709.3	-	8	1272	c.935C>T	c.(934-936)tCt>tTt	p.S312F	DNMT3A_ENST00000402667.1_Missense_Mutation_p.S89F|DNMT3A_ENST00000380746.4_Missense_Mutation_p.S123F|DNMT3A_ENST00000321117.5_Missense_Mutation_p.S312F	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	312	Interaction with DNMT1 and DNMT3B.|PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.S312F(1)|p.S123F(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCCACCAAGACACAATGCG	0.632			"""Mis, F, N, S"""		AML																																		uc002rgc.2		NA		Rec	yes		2	2p23	1788	Mis|F|N|S	DNA (cytosine-5-)-methyltransferase 3 alpha			L			AML		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140						c.(934-936)TCT>TTT		DNA cytosine methyltransferase 3 alpha isoform							90.0	93.0	92.0					2																	25470539		2203	4300	6503	SO:0001583	missense	1788				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding	g.chr2:25470539G>A		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.935C>T	2.37:g.25470539G>A	ENSP00000264709:p.Ser312Phe					DNMT3A_uc002rgd.2_Missense_Mutation_p.S312F|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.S123F	p.S312F	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN			8	1192	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		312			Interaction with DNMT1 and DNMT3B.|PWWP.		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	c.935C>T	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855531	0.91355	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	4.97	4.97	0.65823	PWWP (3);	0.000000	0.85682	D	0.000000	D	0.83571	0.5283	M	0.75615	2.305	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75020	0.985;0.957	D	0.85626	0.1267	10	0.87932	D	0	-5.9433	16.9479	0.86235	0.0:0.0:1.0:0.0	.	312;123	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	F	123;312;312;89	ENSP00000370122:S123F;ENSP00000324375:S312F;ENSP00000264709:S312F;ENSP00000384237:S89F	ENSP00000264709:S312F	S	-	2	0	DNMT3A	25324043	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.495000	0.97964	2.584000	0.87258	0.462000	0.41574	TCT		0.632	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552		19	38	0	0	0	0.001882	0	19	38				
DTNB	1838	broad.mit.edu	37	2	25754371	25754371	+	Silent	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:25754371T>C	ENST00000406818.3	-	9	1221	c.972A>G	c.(970-972)ccA>ccG	p.P324P	DTNB_ENST00000407661.3_Silent_p.P324P|DTNB_ENST00000496972.2_Silent_p.P267P|DTNB_ENST00000405222.1_Silent_p.P324P|DTNB_ENST00000404103.3_Silent_p.P324P|DTNB_ENST00000545439.1_Silent_p.P120P|DTNB_ENST00000407186.1_Silent_p.P324P|DTNB_ENST00000407038.3_Silent_p.P324P|DTNB_ENST00000288642.8_Silent_p.P324P	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	324						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.P324P(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGGTTTCTCTGGTTGCTCAG	0.468																																							uc002rgh.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)	4						c.(970-972)CCA>CCG		dystrobrevin, beta isoform 1							158.0	155.0	156.0					2																	25754371		1880	4100	5980	SO:0001819	synonymous_variant	1838					cytoplasm	calcium ion binding|zinc ion binding	g.chr2:25754371T>C	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.972A>G	2.37:g.25754371T>C						DTNB_uc010yko.1_Silent_p.P267P|DTNB_uc010ykp.1_Silent_p.P120P|DTNB_uc002rgo.2_Silent_p.P145P|DTNB_uc002rgi.2_Silent_p.P324P|DTNB_uc002rgj.2_Silent_p.P324P|DTNB_uc002rgk.2_Silent_p.P324P|DTNB_uc002rgl.2_Silent_p.P324P|DTNB_uc002rgq.2_Silent_p.P324P|DTNB_uc002rgm.2_Silent_p.P324P|DTNB_uc002rgn.2_Silent_p.P120P|DTNB_uc002rgr.1_Silent_p.P313P|DTNB_uc010ykq.1_Silent_p.P177P	p.P324P	NM_021907	NP_068707	O60941	DTNB_HUMAN			9	1222	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		324					B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Silent	SNP	ENST00000406818.3	37	c.972A>G	CCDS46237.1																																																																																				0.468	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147		24	77	0	0	0	0.005443	0	24	77				
PLB1	151056	broad.mit.edu	37	2	28841261	28841261	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:28841261C>A	ENST00000327757.5	+	46	3354	c.3310C>A	c.(3310-3312)Ctg>Atg	p.L1104M	PLB1_ENST00000422425.2_Missense_Mutation_p.L1093M|PLB1_ENST00000541605.1_Missense_Mutation_p.L69M	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	1104	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.L1104M(1)|p.L1093M(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GGGTGACTCTCTGACTGTGAG	0.597																																							uc002rmb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|skin(2)|breast(1)	9						c.(3310-3312)CTG>ATG		phospholipase B1 precursor							89.0	83.0	85.0					2																	28841261		2203	4300	6503	SO:0001583	missense	151056				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity	g.chr2:28841261C>A		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.3310C>A	2.37:g.28841261C>A	ENSP00000330442:p.Leu1104Met					PLB1_uc010ezj.1_Missense_Mutation_p.L1093M|PLB1_uc002rme.1_Missense_Mutation_p.L69M|PLB1_uc002rmf.1_RNA	p.L1104M	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN			46	3310	+	Acute lymphoblastic leukemia(172;0.155)		1104			4 X 308-326 AA approximate repeats.|Extracellular (Potential).|4.		A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	c.3310C>A	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.065682	0.36470	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000541605	T;T;T	0.20069	2.1;2.1;2.1	5.49	2.46	0.29980	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);	0.314541	0.27122	N	0.020822	T	0.48519	0.1504	M	0.91090	3.175	0.38112	D	0.937604	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.50030	-0.8875	10	0.59425	D	0.04	-5.2892	6.4853	0.22085	0.3798:0.5346:0.0:0.0855	.	1093;1104	Q6P1J6-3;Q6P1J6	.;PLB1_HUMAN	M	1104;1093;69	ENSP00000330442:L1104M;ENSP00000416440:L1093M;ENSP00000437426:L69M	ENSP00000330442:L1104M	L	+	1	2	PLB1	28694765	0.000000	0.05858	0.268000	0.24571	0.340000	0.28889	-0.737000	0.04877	0.245000	0.21373	-0.500000	0.04577	CTG		0.597	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			15	38	1	0	2.48551e-13	0.00499	3.77275e-13	15	38				
XDH	7498	broad.mit.edu	37	2	31609340	31609340	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:31609340G>T	ENST00000379416.3	-	9	781	c.733C>A	c.(733-735)Ctg>Atg	p.L245M	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	245	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.L245M(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	AGGTCCAGCAGCTCCTTGAGG	0.607																																					Colon(66;682 1445 30109 40147)	Colon(66;682 1445 30109 40147)	uc002rnv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8						c.(733-735)CTG>ATG		xanthine dehydrogenase	Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)						122.0	101.0	109.0					2																	31609340		2203	4300	6503	SO:0001583	missense	7498				purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity	g.chr2:31609340G>T	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.733C>A	2.37:g.31609340G>T	ENSP00000368727:p.Leu245Met						p.L245M	NM_000379	NP_000370	P47989	XDH_HUMAN			9	812	-	Acute lymphoblastic leukemia(172;0.155)		245			FAD-binding PCMH-type.		Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	c.733C>A	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814846	0.50527	.	.	ENSG00000158125	ENST00000379416	T	0.27256	1.68	5.9	5.02	0.67125	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);Xanthine dehydrogenase, small subunit (1);Molybdopterin dehydrogenase, FAD-binding (1);	0.202153	0.44688	D	0.000430	T	0.62588	0.2440	H	0.95679	3.705	0.54753	D	0.999983	D	0.76494	0.999	D	0.74674	0.984	T	0.75199	-0.3402	10	0.87932	D	0	.	14.081	0.64922	0.0731:0.0:0.9269:0.0	.	245	P47989	XDH_HUMAN	M	245	ENSP00000368727:L245M	ENSP00000368727:L245M	L	-	1	2	XDH	31462844	1.000000	0.71417	0.998000	0.56505	0.051000	0.14879	3.854000	0.55949	1.522000	0.49001	0.638000	0.83543	CTG		0.607	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		19	38	1	0	1.33834e-09	0.007413	1.83841e-09	19	38				
STRN	6801	broad.mit.edu	37	2	37111118	37111118	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:37111118G>T	ENST00000263918.4	-	9	1151	c.1143C>A	c.(1141-1143)agC>agA	p.S381R	STRN_ENST00000379213.2_Missense_Mutation_p.S332R	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	381					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.S381R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				GCCTGGAGCTGCTGGGTCTGG	0.408																																							uc002rpn.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1141-1143)AGC>AGA		striatin, calmodulin binding protein							87.0	80.0	82.0					2																	37111118		2203	4300	6503	SO:0001583	missense	6801				dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding	g.chr2:37111118G>T	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.1143C>A	2.37:g.37111118G>T	ENSP00000263918:p.Ser381Arg					STRN_uc010ezx.2_Missense_Mutation_p.S344R	p.S381R	NM_003162	NP_003153	O43815	STRN_HUMAN			9	1152	-		Ovarian(717;0.0129)|all_hematologic(82;0.21)	381					Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	37	c.1143C>A	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813985	0.50527	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	T;T	0.64991	-0.13;-0.1	5.83	3.94	0.45596	.	0.129062	0.64402	D	0.000001	T	0.35970	0.0950	N	0.08118	0	0.48901	D	0.999725	P;B	0.36392	0.551;0.022	B;B	0.40982	0.345;0.015	T	0.13818	-1.0495	10	0.15066	T	0.55	-3.2965	1.4876	0.02450	0.2144:0.1609:0.459:0.1656	.	332;381	O43815-2;O43815	.;STRN_HUMAN	R	381;356;332	ENSP00000263918:S381R;ENSP00000368513:S332R	ENSP00000263918:S381R	S	-	3	2	STRN	36964622	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.648000	0.46647	0.716000	0.32124	0.650000	0.86243	AGC		0.408	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1			8	26	1	0	5.18039e-06	0.00308	6.22822e-06	8	26				
ABCG8	64241	broad.mit.edu	37	2	44078951	44078951	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:44078951G>T	ENST00000272286.2	+	4	641	c.551G>T	c.(550-552)cGt>cTt	p.R184L		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	184	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> H (in STSL). {ECO:0000269|PubMed:11452359}.		ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.R184H(1)|p.R184L(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CAGGCCCAGCGTGACAAAAGG	0.622																																							uc002rtq.2		NA																	2	Substitution - Missense(2)		lung(1)|breast(1)	skin(3)|ovary(1)	4	GRCh37	CM012312	ABCG8	M		c.(550-552)CGT>CTT		ATP-binding cassette sub-family G member 8							98.0	107.0	104.0					2																	44078951		2203	4300	6503	SO:0001583	missense	64241				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44078951G>T	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.551G>T	2.37:g.44078951G>T	ENSP00000272286:p.Arg184Leu					ABCG8_uc010yoa.1_Missense_Mutation_p.R184L	p.R184L	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN			4	641	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	184		R -> H (in STSL).	ABC transporter.|Cytoplasmic (Potential).		Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	c.551G>T	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281789	0.80692	.	.	ENSG00000143921	ENST00000272286	T	0.41400	1.0	4.98	4.1	0.47936	ABC transporter-like (2);	0.097521	0.64402	D	0.000004	T	0.35278	0.0926	N	0.17800	0.525	0.80722	D	1	P;P	0.39003	0.459;0.654	B;B	0.43623	0.222;0.425	T	0.32052	-0.9921	10	0.87932	D	0	.	13.7348	0.62811	0.0753:0.0:0.9247:0.0	.	184;184	Q9H221-2;Q9H221	.;ABCG8_HUMAN	L	184	ENSP00000272286:R184L	ENSP00000272286:R184L	R	+	2	0	ABCG8	43932455	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	7.201000	0.77847	1.078000	0.41014	0.655000	0.94253	CGT		0.622	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437		24	62	1	0	3.28513e-13	0.003954	4.97462e-13	24	62				
RTN4	57142	broad.mit.edu	37	2	55252705	55252705	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:55252705C>A	ENST00000337526.6	-	3	2773	c.2530G>T	c.(2530-2532)Gac>Tac	p.D844Y	RTN4_ENST00000394611.2_Missense_Mutation_p.D638Y|RTN4_ENST00000354474.6_Missense_Mutation_p.D612Y|RTN4_ENST00000357376.3_Missense_Mutation_p.D638Y|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000404909.1_Missense_Mutation_p.D638Y|RTN4_ENST00000405240.1_Missense_Mutation_p.D638Y	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	844					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.D844Y(1)|p.D638Y(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						ATAAATAAGTCATCATTTGAA	0.348																																							uc002rye.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|large_intestine(1)	3						c.(2530-2532)GAC>TAC		reticulon 4 isoform A							53.0	55.0	54.0					2																	55252705		2203	4299	6502	SO:0001583	missense	57142				apoptosis|axonal fasciculation|cerebral cortex radial glia guided migration|endoplasmic reticulum tubular network organization|negative regulation of anti-apoptosis|negative regulation of axon extension|nerve growth factor receptor signaling pathway|regulation of apoptosis|regulation of branching morphogenesis of a nerve|regulation of cell migration	integral to endoplasmic reticulum membrane|nuclear envelope|plasma membrane	protein binding	g.chr2:55252705C>A	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.2530G>T	2.37:g.55252705C>A	ENSP00000337838:p.Asp844Tyr					RTN4_uc002ryd.2_Missense_Mutation_p.D638Y|RTN4_uc002ryf.2_Intron|RTN4_uc002ryg.2_Intron	p.D844Y	NM_020532	NP_065393	Q9NQC3	RTN4_HUMAN			3	2828	-			844			Cytoplasmic (Potential).		O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	37	c.2530G>T	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.304979	0.40795	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.22539	1.97;1.97;1.95;1.97;1.97;1.99	5.27	4.39	0.52855	.	0.467419	0.20139	N	0.098417	T	0.31765	0.0807	L	0.50333	1.59	0.21822	N	0.999521	D	0.71674	0.998	P	0.60173	0.87	T	0.12066	-1.0562	10	0.72032	D	0.01	0.2911	6.1158	0.20126	0.1515:0.6943:0.0:0.1542	.	844	Q9NQC3	RTN4_HUMAN	Y	638;638;844;638;638;612	ENSP00000384471:D638Y;ENSP00000349944:D638Y;ENSP00000337838:D844Y;ENSP00000378109:D638Y;ENSP00000385650:D638Y;ENSP00000346465:D612Y	ENSP00000337838:D844Y	D	-	1	0	RTN4	55106209	0.113000	0.22115	0.105000	0.21289	0.549000	0.35272	1.465000	0.35299	1.195000	0.43115	0.655000	0.94253	GAC		0.348	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1			9	64	1	0	1.12685e-05	0.004482	1.34461e-05	9	64				
SMEK2	57223	broad.mit.edu	37	2	55808792	55808792	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:55808792C>T	ENST00000345102.5	-	8	1577	c.1276G>A	c.(1276-1278)Gat>Aat	p.D426N	SMEK2_ENST00000407823.3_Missense_Mutation_p.D426N|SMEK2_ENST00000272313.5_Missense_Mutation_p.D426N	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	426					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)		p.D426N(2)		kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGATCAGTATCACAGATCATT	0.363																																							uc002rzc.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1276-1278)GAT>AAT		SMEK homolog 2, suppressor of mek1 isoform 1							112.0	107.0	109.0					2																	55808792		2203	4300	6503	SO:0001583	missense	57223					microtubule organizing center|nucleus	protein binding	g.chr2:55808792C>T	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1276G>A	2.37:g.55808792C>T	ENSP00000339769:p.Asp426Asn					SMEK2_uc002rzb.2_Missense_Mutation_p.D426N|SMEK2_uc002rzd.2_Missense_Mutation_p.D426N|SMEK2_uc002rza.2_Missense_Mutation_p.D302N	p.D426N	NM_001122964	NP_001116436	Q5MIZ7	P4R3B_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)		8	1651	-			426					Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	37	c.1276G>A	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	C	35	5.522903	0.96431	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.56103	0.48;0.48;0.48	5.62	5.62	0.85841	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61527	0.2354	M	0.77820	2.39	0.80722	D	1	B;B;B;B	0.31859	0.154;0.343;0.154;0.343	B;B;B;B	0.36030	0.132;0.167;0.132;0.216	T	0.61608	-0.7028	10	0.46703	T	0.11	-15.8062	20.0172	0.97481	0.0:1.0:0.0:0.0	.	426;426;426;426	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9	.;P4R3B_HUMAN;.;.	N	426	ENSP00000272313:D426N;ENSP00000385912:D426N;ENSP00000339769:D426N	ENSP00000272313:D426N	D	-	1	0	SMEK2	55662296	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.814000	0.96858	0.585000	0.79938	GAT		0.363	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463		4	69	0	0	0	0.009096	0	4	69				
BMP10	27302	broad.mit.edu	37	2	69093072	69093072	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:69093072G>A	ENST00000295379.1	-	2	1124	c.966C>T	c.(964-966)taC>taT	p.Y322Y		NM_014482.1	NP_055297.1	O95393	BMP10_HUMAN	bone morphogenetic protein 10	322					activin receptor signaling pathway (GO:0032924)|adult heart development (GO:0007512)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heart trabecula formation (GO:0060347)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction (GO:0055117)|sarcomere organization (GO:0045214)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Z disc (GO:0030018)	hormone activity (GO:0005179)|receptor serine/threonine kinase binding (GO:0033612)	p.Y322Y(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(15)|ovary(2)	27						TCCTCTTACAGTAGTTTCCTT	0.512																																							uc002sez.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(964-966)TAC>TAT		bone morphogenetic protein 10 preproprotein							74.0	75.0	75.0					2																	69093072		2203	4300	6503	SO:0001819	synonymous_variant	27302				activin receptor signaling pathway|adult heart development|atrial cardiac muscle tissue morphogenesis|BMP signaling pathway|cardiac muscle cell proliferation|heart trabecula formation|negative regulation of cardiac muscle hypertrophy|negative regulation of cell growth|negative regulation of endothelial cell migration|Notch signaling pathway|pathway-restricted SMAD protein phosphorylation|positive regulation of cardiac muscle cell proliferation|positive regulation of cardiac muscle hypertrophy|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent|sarcomere organization|ventricular cardiac muscle cell development|ventricular cardiac muscle tissue morphogenesis	cell surface|extracellular space|Z disc	cytokine activity|growth factor activity|receptor serine/threonine kinase binding	g.chr2:69093072G>A	AF101441	CCDS1890.1	2p13.2	2014-09-17			ENSG00000163217	ENSG00000163217		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	20869	protein-coding gene	gene with protein product		608748				10072785	Standard	NM_014482		Approved		uc002sez.1	O95393	OTTHUMG00000129573	ENST00000295379.1:c.966C>T	2.37:g.69093072G>A							p.Y322Y	NM_014482	NP_055297	O95393	BMP10_HUMAN			2	1125	-			322					Q53R17|Q6NTE0	Silent	SNP	ENST00000295379.1	37	c.966C>T	CCDS1890.1																																																																																				0.512	BMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251768.1	NM_014482		15	30	0	0	0	0.003163	0	15	30				
ZNF638	27332	broad.mit.edu	37	2	71632734	71632734	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:71632734G>T	ENST00000409544.1	+	18	3592	c.2962G>T	c.(2962-2964)Gct>Tct	p.A988S	ZNF638_ENST00000264447.4_Missense_Mutation_p.A988S|ZNF638_ENST00000409407.1_5'Flank|ZNF638_ENST00000355812.3_Missense_Mutation_p.A988S	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	988					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A988S(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTTTTAGGAAGCTATATTTAT	0.259																																							uc002shx.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(2962-2964)GCT>TCT		zinc finger protein 638							55.0	58.0	57.0					2																	71632734		2198	4284	6482	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71632734G>T	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2962G>T	2.37:g.71632734G>T	ENSP00000386433:p.Ala988Ser					ZNF638_uc010yqw.1_Missense_Mutation_p.A567S|ZNF638_uc002shy.2_Missense_Mutation_p.A988S|ZNF638_uc002shz.2_Missense_Mutation_p.A988S|ZNF638_uc002sia.2_Missense_Mutation_p.A988S|ZNF638_uc002sib.1_Missense_Mutation_p.A988S|ZNF638_uc010fed.2_RNA|ZNF638_uc002sic.2_Missense_Mutation_p.A85S	p.A988S	NM_014497	NP_055312	Q14966	ZN638_HUMAN			18	3281	+			988					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.2962G>T	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674021	0.67928	.	.	ENSG00000075292	ENST00000394137;ENST00000355812;ENST00000264447;ENST00000409544	T;T;T	0.56444	0.46;1.45;1.45	5.46	4.59	0.56863	.	0.232595	0.30602	N	0.009262	T	0.59918	0.2229	L	0.51422	1.61	0.80722	D	1	D;D;P;D	0.67145	0.976;0.996;0.592;0.976	P;P;B;P	0.60609	0.629;0.877;0.193;0.629	T	0.55451	-0.8139	10	0.18276	T	0.48	-5.5985	12.6488	0.56749	0.081:0.0:0.919:0.0	.	988;988;988;988	A8K583;Q14966-4;Q14966-3;Q14966	.;.;.;ZN638_HUMAN	S	567;988;988;988	ENSP00000348066:A988S;ENSP00000264447:A988S;ENSP00000386433:A988S	ENSP00000264447:A988S	A	+	1	0	ZNF638	71486242	1.000000	0.71417	0.993000	0.49108	0.972000	0.66771	3.611000	0.54132	1.453000	0.47775	-0.133000	0.14855	GCT		0.259	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		16	36	1	0	2.94398e-08	0.007413	3.82898e-08	16	36				
MOGS	7841	broad.mit.edu	37	2	74689728	74689728	+	Silent	SNP	G	G	A	rs535610745		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:74689728G>A	ENST00000233616.4	-	4	1350	c.1188C>T	c.(1186-1188)agC>agT	p.S396S	MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000452063.2_Silent_p.S290S|MOGS_ENST00000409065.1_3'UTR	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	396					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)	p.S396S(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						CAAGGAGGCCGCTGAGGGCAG	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		20469	0.001		0.0	False		,,,				2504	0.0						uc010ffj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1186-1188)AGC>AGT		mannosyl-oligosaccharide glucosidase isoform 1							111.0	121.0	118.0					2																	74689728		1930	4132	6062	SO:0001819	synonymous_variant	7841				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity	g.chr2:74689728G>A	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.1188C>T	2.37:g.74689728G>A						MOGS_uc010ffh.2_Silent_p.S121S|MOGS_uc010yrt.1_Silent_p.S277S|MOGS_uc010ffi.2_Silent_p.S290S	p.S396S	NM_006302	NP_006293	Q13724	MOGS_HUMAN			4	1351	-			396			Lumenal (Potential).		A8K938|F5H6D0|Q17RN9|Q8TCT5	Silent	SNP	ENST00000233616.4	37	c.1188C>T	CCDS42700.1																																																																																				0.582	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302		9	166	0	0	0	0.008291	0	9	166				
DQX1	165545	broad.mit.edu	37	2	74751135	74751135	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:74751135C>T	ENST00000404568.3	-	4	950	c.731G>A	c.(730-732)cGg>cAg	p.R244Q	DQX1_ENST00000495597.1_5'UTR|DQX1_ENST00000393951.2_Missense_Mutation_p.R244Q	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	244						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.R126Q(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						AGCTTCCACCCGATCAGGTGG	0.532																																							uc010yrw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(730-732)CGG>CAG		DEAQ box polypeptide 1 (RNA-dependent ATPase)							54.0	54.0	54.0					2																	74751135		2203	4300	6503	SO:0001583	missense	165545					nucleus	ATP binding|helicase activity|nucleic acid binding	g.chr2:74751135C>T	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.731G>A	2.37:g.74751135C>T	ENSP00000384621:p.Arg244Gln					DQX1_uc002smc.2_5'Flank	p.R244Q	NM_133637	NP_598376	Q8TE96	DQX1_HUMAN			4	896	-			244					Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	c.731G>A	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	C	8.204	0.798818	0.16397	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.07688	3.17;3.17	5.38	0.462	0.16695	.	0.586122	0.16342	N	0.218628	T	0.05640	0.0148	L	0.36672	1.1	0.09310	N	1	P	0.39250	0.665	B	0.26202	0.067	T	0.27400	-1.0075	10	0.87932	D	0	-12.7191	10.1905	0.43024	0.3725:0.5233:0.1042:0.0	.	244	Q8TE96	DQX1_HUMAN	Q	244	ENSP00000377523:R244Q;ENSP00000384621:R244Q	ENSP00000377523:R244Q	R	-	2	0	DQX1	74604643	0.000000	0.05858	0.013000	0.15412	0.120000	0.20174	0.593000	0.23999	0.155000	0.19261	0.609000	0.83330	CGG		0.532	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637		4	50	0	0	0	0.009096	0	4	50				
REG3G	130120	broad.mit.edu	37	2	79253232	79253232	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:79253232A>G	ENST00000272324.5	+	2	197	c.13A>G	c.(13-15)Atg>Gtg	p.M5V	REG3G_ENST00000393897.2_Missense_Mutation_p.M5V|REG3G_ENST00000409471.1_Missense_Mutation_p.M5V	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	5					acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.M5V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTGCCTCCCATGGCCCTGCC	0.542																																							uc002snw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13-15)ATG>GTG		regenerating islet-derived 3 gamma precursor							190.0	143.0	159.0					2																	79253232		2203	4300	6503	SO:0001583	missense	130120				acute-phase response	extracellular region	sugar binding	g.chr2:79253232A>G	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.13A>G	2.37:g.79253232A>G	ENSP00000272324:p.Met5Val					REG3G_uc002snx.2_Missense_Mutation_p.M5V|REG3G_uc010ffu.2_Missense_Mutation_p.M5V	p.M5V	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN			2	98	+			5					A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	ENST00000272324.5	37	c.13A>G	CCDS1962.1	.	.	.	.	.	.	.	.	.	.	A	8.703	0.910231	0.17833	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.16457	4.4;4.4;2.34	4.3	0.445	0.16597	.	1.407420	0.04505	N	0.381928	T	0.21062	0.0507	M	0.74647	2.275	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.32903	-0.9889	10	0.51188	T	0.08	.	4.0277	0.09695	0.6289:0.179:0.1921:0.0	.	5;5	Q3SYE6;Q6UW15	.;REG3G_HUMAN	V	5	ENSP00000377475:M5V;ENSP00000272324:M5V;ENSP00000387105:M5V	ENSP00000272324:M5V	M	+	1	0	REG3G	79106740	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.023000	0.03607	0.070000	0.16634	-0.274000	0.10170	ATG		0.542	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448		10	22	0	0	0	0.000978	0	10	22				
ZNF2	7549	broad.mit.edu	37	2	95847613	95847613	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:95847613G>T	ENST00000340539.5	+	5	1502	c.1040G>T	c.(1039-1041)tGt>tTt	p.C347F	ZNF2_ENST00000398107.2_Missense_Mutation_p.C305F|ZNF2_ENST00000425369.1_Missense_Mutation_p.C267F|ZNF2_ENST00000453539.2_Missense_Mutation_p.C360F|ZNF2_ENST00000295210.6_Missense_Mutation_p.C309F	NM_021088.2	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C347F(1)		endometrium(4)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	12		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		TGTAACGAGTGTGGCAAAGCT	0.488																																							uc002suf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1036-1038)TGT>TTT		zinc finger protein 2 isoform a							83.0	91.0	88.0					2																	95847613		2117	4267	6384	SO:0001583	missense	7549				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:95847613G>T	X60152	CCDS42712.1, CCDS42713.1, CCDS62957.1	2q11.1	2013-09-24	2005-02-07		ENSG00000163067	ENSG00000275111		"""Zinc fingers, C2H2-type"", ""-"""	12991	protein-coding gene	gene with protein product		194500	"""zinc finger protein 2 (A1-5)"""			8183940, 1945843	Standard	NM_021088		Approved	A1-5, ZNF661, Zfp661	uc002suf.3	Q9BSG1	OTTHUMG00000155150	ENST00000340539.5:c.1040G>T	2.37:g.95847613G>T	ENSP00000345392:p.Cys347Phe					ZNF2_uc002sug.2_Missense_Mutation_p.C304F|ZNF2_uc010yue.1_Missense_Mutation_p.C309F|ZNF2_uc010fhs.2_Missense_Mutation_p.C267F	p.C346F	NM_021088	NP_066574	Q9BSG1	ZNF2_HUMAN		READ - Rectum adenocarcinoma(193;0.0222)	6	1499	+		Ovarian(717;0.00768)	346			C2H2-type 7.		A8MWV7|B4DIR4|Q4ZFY6|Q96G44|Q9UMC5	Missense_Mutation	SNP	ENST00000340539.5	37	c.1037G>T	CCDS42712.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881196	0.51801	.	.	ENSG00000163067	ENST00000398107;ENST00000340539;ENST00000425369;ENST00000295210;ENST00000453539	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.52532	D	0.000077	T	0.76378	0.3979	H	0.97077	3.935	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.84435	0.0579	10	0.87932	D	0	-17.3222	16.2332	0.82358	0.0:0.0:1.0:0.0	.	309;305;346	B4DIR4;A8MWV7;Q9BSG1	.;.;ZNF2_HUMAN	F	305;347;267;309;360	ENSP00000381178:C305F;ENSP00000345392:C347F;ENSP00000406017:C267F;ENSP00000295210:C309F;ENSP00000411051:C360F	ENSP00000295210:C309F	C	+	2	0	ZNF2	95211340	1.000000	0.71417	0.939000	0.37840	0.110000	0.19582	9.578000	0.98200	2.697000	0.92050	0.563000	0.77884	TGT		0.488	ZNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338595.2	NM_021088		31	48	1	0	9.65021e-13	0.002096	1.45095e-12	31	48				
ASTL	431705	broad.mit.edu	37	2	96789930	96789930	+	Nonsense_Mutation	SNP	C	C	A	rs147267731		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:96789930C>A	ENST00000342380.2	-	9	954	c.955G>T	c.(955-957)Gaa>Taa	p.E319*		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)									p.E319*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						CTCCTGGATTCCGCCGACAGT	0.662																																							uc010yui.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(955-957)GAA>TAA		astacin-like metalloendopeptidase precursor							17.0	21.0	20.0					2																	96789930		2196	4287	6483	SO:0001587	stop_gained	431705				proteolysis		metalloendopeptidase activity|zinc ion binding	g.chr2:96789930C>A	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.955G>T	2.37:g.96789930C>A	ENSP00000343674:p.Glu319*						p.E319*	NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN			9	955	-			319						Nonsense_Mutation	SNP	ENST00000342380.2	37	c.955G>T	CCDS33249.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083662	0.36758	.	.	ENSG00000188886	ENST00000342380	.	.	.	4.74	3.85	0.44370	.	0.934245	0.08854	N	0.884055	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-3.8896	11.3244	0.49440	0.0:0.8158:0.1842:0.0	.	.	.	.	X	319	.	ENSP00000343674:E319X	E	-	1	0	ASTL	96153657	0.010000	0.17322	0.002000	0.10522	0.010000	0.07245	2.235000	0.43044	1.115000	0.41800	0.456000	0.33151	GAA		0.662	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1			12	29	1	0	7.93312e-07	0.00245	9.79702e-07	12	29				
UXS1	80146	broad.mit.edu	37	2	106761802	106761803	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:106761802_106761803CC>AA	ENST00000409501.3	-	6	357_358	c.300_301GG>TT	c.(298-303)gtGGgc>gtTTgc	p.G101C	UXS1_ENST00000283148.7_Missense_Mutation_p.G106C|UXS1_ENST00000479621.1_5'UTR|UXS1_ENST00000428048.2_Intron|UXS1_ENST00000540130.1_Missense_Mutation_p.G44C			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	101					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)	p.G101C(1)|p.G106C(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						AGATGGGAGCCCACGAACCCTG	0.559																																							uc002tdm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(298-303)GTGGGC>GTTTGC		UDP-glucuronate decarboxylase 1																																				SO:0001583	missense	80146				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity	g.chr2:106761802_106761803CC>AA	AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.300_301delinsAA	2.37:g.106761802_106761803delinsAA	ENSP00000387019:p.Gly101Cys					UXS1_uc002tdn.2_Missense_Mutation_p.G106C|UXS1_uc002tdo.2_Missense_Mutation_p.G44C|UXS1_uc010ywh.1_Intron	p.G101C	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN			6	398_399	-			101			Lumenal (Potential).		Q8NBX3|Q9H5C2	Missense_Mutation	DNP	ENST00000409501.3	37	c.300_301GG>TT	CCDS46378.1																																																																																				0.559	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1	NM_025076.3		10	20	0	0	0	0.004672	0	10	20				
DPP10	57628	broad.mit.edu	37	2	116485391	116485391	+	Splice_Site	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:116485391G>C	ENST00000410059.1	+	8	1056		c.e8-1		DPP10_ENST00000393147.2_Splice_Site|DPP10_ENST00000409163.1_Splice_Site|DPP10_ENST00000310323.8_Splice_Site|DPP10_ENST00000488208.1_Splice_Site	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)							integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.?(4)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TCCTGATCCAGATTTATATTT	0.299																																							uc002tla.1		NA																	4	Unknown(4)		lung(2)|skin(2)	ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.e8-1		dipeptidyl peptidase 10 isoform long							35.0	39.0	38.0					2																	116485391		2165	4269	6434	SO:0001630	splice_region_variant	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116485391G>C	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.577-1G>C	2.37:g.116485391G>C						DPP10_uc002tlb.1_Splice_Site_p.I143_splice|DPP10_uc002tlc.1_Splice_Site_p.I189_splice|DPP10_uc002tle.2_Splice_Site_p.I197_splice|DPP10_uc002tlf.1_Splice_Site_p.I186_splice	p.I193_splice	NM_020868	NP_065919	Q8N608	DPP10_HUMAN			8	1034	+								A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Splice_Site	SNP	ENST00000410059.1	37	c.577_splice	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903141	0.72754	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000476155	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2953	0.90143	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPP10	116201861	1.000000	0.71417	0.997000	0.53966	0.718000	0.41266	9.631000	0.98424	2.570000	0.86706	0.591000	0.81541	.		0.299	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	Intron	12	24	0	0	0	0.00245	0	12	24				
MARCO	8685	broad.mit.edu	37	2	119727764	119727765	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:119727764_119727765CC>AA	ENST00000327097.4	+	3	409_410	c.274_275CC>AA	c.(274-276)CCg>AAg	p.P92K	MARCO_ENST00000541757.1_Missense_Mutation_p.P14K	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	92					apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.P92K(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						TGAGGACAGCCCGTCCTTCTCC	0.614																																					GBM(8;18 374 7467 11269 32796)	GBM(8;18 374 7467 11269 32796)	uc002tln.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(274-276)CCG>AAG		macrophage receptor with collagenous structure																																				SO:0001583	missense	8685				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity	g.chr2:119727764_119727765CC>AA	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	Exception_encountered	2.37:g.119727764_119727765delinsAA	ENSP00000318916:p.Pro92Lys					MARCO_uc010yyf.1_Missense_Mutation_p.P14K	p.P92K	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN			3	406_407	+			92			Extracellular (Potential).		B4DW79|Q9Y5S3	Missense_Mutation	DNP	ENST00000327097.4	37	c.274_275CC>AA	CCDS2124.1																																																																																				0.614	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770		12	40	0	0	0	0.004672	0	12	40				
NIFK	84365	broad.mit.edu	37	2	122486106	122486106	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:122486106G>A	ENST00000285814.4	-	5	643	c.571C>T	c.(571-573)Cag>Tag	p.Q191*	AC018737.1_ENST00000419902.1_RNA	NM_032390.4	NP_115766.3	Q9BYG3	MK67I_HUMAN		191					negative regulation of phosphatase activity (GO:0010923)|protein complex assembly (GO:0006461)|rRNA metabolic process (GO:0016072)|rRNA transcription (GO:0009303)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Q191*(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12						TCCGTTTTCTGTAAAATCTTT	0.279																																							uc002tnk.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(571-573)CAG>TAG		MKI67 interacting nucleolar phosphoprotein							38.0	40.0	39.0					2																	122486106		2197	4284	6481	SO:0001587	stop_gained	84365				protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr2:122486106G>A																												ENST00000285814.4:c.571C>T	2.37:g.122486106G>A	ENSP00000285814:p.Gln191*					uc002tnj.1_RNA	p.Q191*	NM_032390	NP_115766	Q9BYG3	MK67I_HUMAN			5	648	-			191					A8K788|Q8TB66|Q96ED4	Nonsense_Mutation	SNP	ENST00000285814.4	37	c.571C>T	CCDS2135.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790703	0.50102	.	.	ENSG00000155438	ENST00000285814;ENST00000447132;ENST00000451734	.	.	.	4.1	2.24	0.28232	.	1.453290	0.04154	N	0.321813	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.544	5.7564	0.18176	0.1087:0.1974:0.6939:0.0	.	.	.	.	X	191;86;159	.	ENSP00000285814:Q191X	Q	-	1	0	MKI67IP	122202576	0.997000	0.39634	0.029000	0.17559	0.121000	0.20230	2.090000	0.41682	0.460000	0.27045	0.655000	0.94253	CAG		0.279	MKI67IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254239.2			12	28	0	0	0	0.001855	0	12	28				
LCT	3938	broad.mit.edu	37	2	136561527	136561527	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:136561527C>A	ENST00000264162.2	-	11	4646	c.4636G>T	c.(4636-4638)Ggc>Tgc	p.G1546C		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1546	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.G1546S(1)|p.G1546C(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TAGCCATAGCCCTGGTAAGCA	0.498																																							uc002tuu.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(4636-4638)GGC>TGC		lactase-phlorizin hydrolase preproprotein							109.0	83.0	92.0					2																	136561527		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136561527C>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4636G>T	2.37:g.136561527C>A	ENSP00000264162:p.Gly1546Cys						p.G1546C	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	11	4647	-			1546			Extracellular (Potential).|4.|4 X approximate repeats.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.4636G>T	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.779329	0.70107	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.60672	0.17	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84710	0.5532	H	0.96015	3.755	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	D	0.88870	0.3332	10	0.87932	D	0	-31.7491	20.0124	0.97464	0.0:1.0:0.0:0.0	.	1546	P09848	LPH_HUMAN	C	1546;978	ENSP00000264162:G1546C	ENSP00000264162:G1546C	G	-	1	0	LCT	136277997	1.000000	0.71417	0.979000	0.43373	0.242000	0.25591	7.818000	0.86416	2.749000	0.94314	0.655000	0.94253	GGC		0.498	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		8	21	1	0	1.12685e-05	0.004482	1.34461e-05	8	21				
LRP1B	53353	broad.mit.edu	37	2	141680663	141680663	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:141680663C>T	ENST00000389484.3	-	21	4161	c.3190G>A	c.(3190-3192)Ggt>Agt	p.G1064S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1064	LDL-receptor class A 8. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G1064S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACGCAATTACCATCAGGGTGG	0.443										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(3190-3192)GGT>AGT		low density lipoprotein-related protein 1B							151.0	132.0	138.0					2																	141680663		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141680663C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3190G>A	2.37:g.141680663C>T	ENSP00000374135:p.Gly1064Ser	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Missense_Mutation_p.G246S	p.G1064S	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	21	4162	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1064			Extracellular (Potential).|LDL-receptor class A 8.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.3190G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952262	0.92660	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.95137	-3.62;-3.62	5.01	5.01	0.66863	.	0.000000	0.64402	U	0.000001	D	0.96482	0.8852	M	0.62016	1.91	0.80722	D	1	P;D	0.69078	0.727;0.997	P;D	0.70016	0.734;0.967	D	0.95920	0.8930	10	0.39692	T	0.17	.	18.3106	0.90199	0.0:1.0:0.0:0.0	.	247;1064	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	S	1064;1002;209	ENSP00000374135:G1064S;ENSP00000413239:G209S	ENSP00000374135:G1064S	G	-	1	0	LRP1B	141397133	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.399000	0.79935	2.316000	0.78162	0.557000	0.71058	GGT		0.443	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		15	48	0	0	0	0.00245	0	15	48				
LRP1B	53353	broad.mit.edu	37	2	141986816	141986816	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:141986816G>C	ENST00000389484.3	-	6	1757	c.786C>G	c.(784-786)atC>atG	p.I262M		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	262					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.I262M(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTGTTATCTGGATACATTTGA	0.303										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(784-786)ATC>ATG		low density lipoprotein-related protein 1B							113.0	111.0	112.0					2																	141986816		2202	4300	6502	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141986816G>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.786C>G	2.37:g.141986816G>C	ENSP00000374135:p.Ile262Met	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Intron	p.I262M	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	6	1758	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	262			Extracellular (Potential).|LDL-receptor class B 1.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.786C>G	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	9.972	1.225836	0.22542	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91740	-2.9	5.2	-1.26	0.09376	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.326134	0.27941	U	0.017234	T	0.78168	0.4241	N	0.08118	0	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.64601	-0.6369	10	0.30854	T	0.27	.	6.1777	0.20453	0.4371:0.2229:0.34:0.0	.	262	Q9NZR2	LRP1B_HUMAN	M	262;200	ENSP00000374135:I262M	ENSP00000374135:I262M	I	-	3	3	LRP1B	141703286	0.845000	0.29573	0.952000	0.39060	0.994000	0.84299	-0.213000	0.09305	-0.631000	0.05560	-0.225000	0.12378	ATC		0.303	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		24	52	0	0	0	0.002299	0	24	52				
GALNT3	2591	broad.mit.edu	37	2	166605329	166605329	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:166605329C>G	ENST00000392701.3	-	11	2639	c.1864G>C	c.(1864-1866)Gat>Cat	p.D622H	GALNT3_ENST00000409882.1_Missense_Mutation_p.D360H	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	622	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.D622H(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TGGAGTGGATCTGATGGGTTG	0.333																																							uc010fph.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(1864-1866)GAT>CAT		polypeptide N-acetylgalactosaminyltransferase 3							87.0	84.0	85.0					2																	166605329		2203	4299	6502	SO:0001583	missense	2591				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:166605329C>G		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1864G>C	2.37:g.166605329C>G	ENSP00000376465:p.Asp622His						p.D622H	NM_004482	NP_004473	Q14435	GALT3_HUMAN			11	2251	-			622			Ricin B-type lectin.|Lumenal (Potential).		Q53TG9|Q7Z476	Missense_Mutation	SNP	ENST00000392701.3	37	c.1864G>C	CCDS2226.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966600	0.74131	.	.	ENSG00000115339	ENST00000392701;ENST00000409882	T;T	0.79033	-1.23;-1.23	5.86	5.86	0.93980	Ricin B-related lectin (1);Ricin B lectin (3);	6.722010	0.00166	N	0.000001	D	0.91646	0.7360	M	0.82823	2.61	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.78545	-0.2163	10	0.54805	T	0.06	.	20.1931	0.98233	0.0:1.0:0.0:0.0	.	622	Q14435	GALT3_HUMAN	H	622;360	ENSP00000376465:D622H;ENSP00000386955:D360H	ENSP00000376465:D622H	D	-	1	0	GALNT3	166313575	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	4.644000	0.61397	2.771000	0.95319	0.563000	0.77884	GAT		0.333	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482		3	23	0	0	0	0.004672	0	3	23				
LRP2	4036	broad.mit.edu	37	2	170002265	170002265	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:170002265T>C	ENST00000263816.3	-	70	13265	c.12980A>G	c.(12979-12981)aAt>aGt	p.N4327S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4327					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.N4327S(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACCTGACTTATTGTATCTGAG	0.363																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(12979-12981)AAT>AGT		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						101.0	92.0	95.0					2																	170002265		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170002265T>C		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12980A>G	2.37:g.170002265T>C	ENSP00000263816:p.Asn4327Ser						p.N4327S	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	70	13193	-			4327			Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.12980A>G	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.303105	0.60195	.	.	ENSG00000081479	ENST00000263816	D	0.89875	-2.58	5.38	5.38	0.77491	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.097317	0.64402	D	0.000001	D	0.86272	0.5893	L	0.54323	1.7	0.80722	D	1	D	0.53745	0.962	B	0.41374	0.355	D	0.87186	0.2231	10	0.49607	T	0.09	.	14.2709	0.66152	0.0:0.0:0.0:1.0	.	4327	P98164	LRP2_HUMAN	S	4327	ENSP00000263816:N4327S	ENSP00000263816:N4327S	N	-	2	0	LRP2	169710511	1.000000	0.71417	0.086000	0.20670	0.594000	0.36715	7.763000	0.85283	2.173000	0.68751	0.533000	0.62120	AAT		0.363	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		19	43	0	0	0	0.008871	0	19	43				
TTN	7273	broad.mit.edu	37	2	179449567	179449567	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:179449567C>T	ENST00000591111.1	-	260	60102	c.59878G>A	c.(59878-59880)Gat>Aat	p.D19960N	TTN_ENST00000460472.2_Missense_Mutation_p.D12536N|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D19033N|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D12728N|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D12661N|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D21601N|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19960	Fibronectin type-III 44. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D19033N(1)|p.D12661N(1)|p.D19031N(1)|p.D12536N(1)|p.D12728N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGCTTACATCACACTTCTCC	0.507																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(57097-57099)GAT>AAT		titin isoform N2-A							135.0	135.0	135.0					2																	179449567		1973	4152	6125	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179449567C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59878G>A	2.37:g.179449567C>T	ENSP00000465570:p.Asp19960Asn					uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D12728N|TTN_uc010zfi.1_Missense_Mutation_p.D12661N|TTN_uc010zfj.1_Missense_Mutation_p.D12536N	p.D19033N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		259	57321	-			19960					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.57097G>A		.	.	.	.	.	.	.	.	.	.	C	28.5	4.927657	0.92389	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	6.17	6.17	0.99709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75280	0.3828	M	0.76433	2.335	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.75184	-0.3407	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	12536;12661;12728;19960	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	19033;12536;12728;12661;12534	ENSP00000343764:D19033N;ENSP00000434586:D12536N;ENSP00000340554:D12728N;ENSP00000352154:D12661N	ENSP00000340554:D12728N	D	-	1	0	TTN	179157813	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GAT		0.507	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		16	151	0	0	0	0.00499	0	16	151				
MARS2	92935	broad.mit.edu	37	2	198571111	198571111	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:198571111G>T	ENST00000282276.6	+	1	1025	c.982G>T	c.(982-984)Ggc>Tgc	p.G328C	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	328					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.G328C(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	GTTAGGGGCCGGCATGAGCCC	0.537																																							uc002uuq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(982-984)GGC>TGC		methionine-tRNA synthetase 2 precursor	L-Methionine(DB00134)						125.0	125.0	125.0					2																	198571111		2203	4300	6503	SO:0001583	missense	92935				methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity	g.chr2:198571111G>T	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.982G>T	2.37:g.198571111G>T	ENSP00000282276:p.Gly328Cys					uc002uup.2_Intron	p.G328C	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN			1	1025	+			328					A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	c.982G>T	CCDS33358.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108036	0.77096	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.58358	0.34	5.45	5.45	0.79879	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.109437	0.64402	D	0.000007	D	0.83092	0.5179	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89325	0.3643	10	0.87932	D	0	-14.7498	16.7845	0.85571	0.0:0.0:1.0:0.0	.	328	Q96GW9	SYMM_HUMAN	C	328;255	ENSP00000282276:G328C	ENSP00000282276:G328C	G	+	1	0	MARS2	198279356	1.000000	0.71417	0.916000	0.36221	0.980000	0.70556	9.746000	0.98859	2.575000	0.86900	0.655000	0.94253	GGC		0.537	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		47	124	1	0	1.61863e-15	0.00361	2.64639e-15	47	124				
MARS2	92935	broad.mit.edu	37	2	198571470	198571470	+	Nonsense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:198571470T>A	ENST00000282276.6	+	1	1384	c.1341T>A	c.(1339-1341)taT>taA	p.Y447*	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	447					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.Y447*(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	CAGAGGATTATGCTCTGGTGA	0.542																																							uc002uuq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1339-1341)TAT>TAA		methionine-tRNA synthetase 2 precursor	L-Methionine(DB00134)						89.0	92.0	91.0					2																	198571470		2203	4300	6503	SO:0001587	stop_gained	92935				methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity	g.chr2:198571470T>A	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1341T>A	2.37:g.198571470T>A	ENSP00000282276:p.Tyr447*					uc002uup.2_Intron	p.Y447*	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN			1	1384	+			447					A0AVC3|Q76E79|Q8IW62|Q8N7N4	Nonsense_Mutation	SNP	ENST00000282276.6	37	c.1341T>A	CCDS33358.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.554435	0.86231	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	.	.	.	5.17	-3.52	0.04682	.	0.330466	0.33217	N	0.005152	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-11.5642	11.2783	0.49180	0.0:0.4415:0.0:0.5585	.	.	.	.	X	447;374	.	ENSP00000282276:Y447X	Y	+	3	2	MARS2	198279715	0.049000	0.20398	0.955000	0.39395	0.987000	0.75469	-0.588000	0.05774	-0.804000	0.04410	-0.254000	0.11334	TAT		0.542	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		29	75	0	0	0	0.00632	0	29	75				
MAP2	4133	broad.mit.edu	37	2	210561338	210561338	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:210561338G>T	ENST00000360351.4	+	8	4759	c.4253G>T	c.(4252-4254)cGg>cTg	p.R1418L	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.R1414L|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000475600.1_3'UTR	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1418					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R1418L(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAGGAAGCTCGGAGATCATCT	0.393																																					Pancreas(27;423 979 28787 29963)	Pancreas(27;423 979 28787 29963)	uc002vde.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(4252-4254)CGG>CTG		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)						68.0	73.0	71.0					2																	210561338		2203	4299	6502	SO:0001583	missense	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210561338G>T		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4253G>T	2.37:g.210561338G>T	ENSP00000353508:p.Arg1418Leu					MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.R1414L	p.R1418L	NM_002374	NP_002365	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	8	4501	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	1418					Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	c.4253G>T	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947429	0.53186	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.26373	1.74;1.74	5.66	5.66	0.87406	MAP2/Tau projection (1);	0.000000	0.53938	D	0.000047	T	0.46132	0.1377	L	0.56769	1.78	0.37529	D	0.917843	D;D	0.76494	0.999;0.998	D;D	0.72075	0.976;0.974	T	0.50398	-0.8833	10	0.72032	D	0.01	-8.551	13.0038	0.58692	0.0732:0.0:0.9268:0.0	.	1414;1418	P11137-3;P11137	.;MAP2_HUMAN	L	1418;1414	ENSP00000353508:R1418L;ENSP00000392164:R1414L	ENSP00000353508:R1418L	R	+	2	0	MAP2	210269583	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.213000	0.42844	2.673000	0.90976	0.650000	0.86243	CGG		0.393	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		15	49	1	0	1.05317e-09	0.00245	1.45612e-09	15	49				
ERBB4	2066	broad.mit.edu	37	2	212522507	212522507	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:212522507C>A	ENST00000342788.4	-	16	2228	c.1918G>T	c.(1918-1920)Ggc>Tgc	p.G640C	ERBB4_ENST00000402597.1_Intron|ERBB4_ENST00000436443.1_Missense_Mutation_p.G640C	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	640					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G640C(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GTGGAATGGCCCGTCCATGGG	0.428										TSP Lung(8;0.080)																													uc002veg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(1918-1920)GGC>TGC		v-erb-a erythroblastic leukemia viral oncogene							268.0	210.0	230.0					2																	212522507		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212522507C>A	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1918G>T	2.37:g.212522507C>A	ENSP00000342235:p.Gly640Cys	TSP Lung(8;0.080)				ERBB4_uc002veh.1_Missense_Mutation_p.G640C|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Missense_Mutation_p.G640C	p.G640C	NM_005235	NP_005226	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	16	2016	-		Renal(323;0.06)|Lung NSC(271;0.197)	640			Extracellular (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.1918G>T	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660459	0.47572	.	.	ENSG00000178568	ENST00000342788;ENST00000436443	T;T	0.77098	-1.07;-1.07	5.14	5.14	0.70334	.	0.202625	0.42964	D	0.000640	T	0.62245	0.2412	N	0.14661	0.345	0.80722	D	1	B;P;P	0.42296	0.356;0.775;0.666	B;B;B	0.36244	0.108;0.22;0.11	T	0.69978	-0.4998	10	0.62326	D	0.03	.	14.9366	0.70960	0.0:0.8154:0.1846:0.0	.	499;640;640	Q53QS8;Q15303-3;Q15303	.;.;ERBB4_HUMAN	C	640	ENSP00000342235:G640C;ENSP00000403204:G640C	ENSP00000342235:G640C	G	-	1	0	ERBB4	212230752	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.191000	0.58372	2.557000	0.86248	0.650000	0.86243	GGC		0.428	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		15	40	1	0	2.61681e-11	0.00245	3.83478e-11	15	40				
PTPRN	5798	broad.mit.edu	37	2	220162048	220162048	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:220162048G>T	ENST00000295718.2	-	14	2235	c.1995C>A	c.(1993-1995)gcC>gcA	p.A665A	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000497977.1_5'Flank|PTPRN_ENST00000409251.3_Silent_p.A636A|PTPRN_ENST00000423636.2_Silent_p.A575A	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	665					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A665A(1)		breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GGCTGGCCTGGGCTGCGTCGC	0.652																																							uc002vkz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)|skin(1)	4						c.(1993-1995)GCC>GCA		protein tyrosine phosphatase, receptor type, N							65.0	66.0	65.0					2																	220162048		2203	4300	6503	SO:0001819	synonymous_variant	5798				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr2:220162048G>T		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1995C>A	2.37:g.220162048G>T						PTPRN_uc010zlc.1_Silent_p.A575A|PTPRN_uc002vla.2_Silent_p.A636A	p.A665A	NM_002846	NP_002837	Q16849	PTPRN_HUMAN		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)	14	2084	-		Renal(207;0.0474)	665			Cytoplasmic (Potential).		B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	37	c.1995C>A	CCDS2440.1																																																																																				0.652	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2			23	50	1	0	9.57634e-11	0.00333	1.37175e-10	23	50				
SPEG	10290	broad.mit.edu	37	2	220344800	220344800	+	Silent	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:220344800A>T	ENST00000312358.7	+	25	5412	c.5280A>T	c.(5278-5280)acA>acT	p.T1760T	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1760	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T1760T(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGTATGGCACACCTGAGTTTG	0.607																																							uc010fwg.2		NA																	1	Substitution - coding silent(1)		lung(1)	stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(5278-5280)ACA>ACT		SPEG complex locus							84.0	90.0	88.0					2																	220344800		2134	4247	6381	SO:0001819	synonymous_variant	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220344800A>T	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.5280A>T	2.37:g.220344800A>T							p.T1760T	NM_005876	NP_005867	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	25	5280	+		Renal(207;0.0183)	1760			Protein kinase 1.		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	c.5280A>T	CCDS42824.1																																																																																				0.607	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		15	45	0	0	0	0.003163	0	15	45				
SPEG	10290	broad.mit.edu	37	2	220354290	220354290	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:220354290G>A	ENST00000312358.7	+	36	8682	c.8550G>A	c.(8548-8550)agG>agA	p.R2850R	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2850	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R2850R(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GAAGACACAGGGGCCTGCAGG	0.657																																							uc010fwg.2		NA																	1	Substitution - coding silent(1)		lung(1)	stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(8548-8550)AGG>AGA		SPEG complex locus							61.0	69.0	67.0					2																	220354290		1962	4131	6093	SO:0001819	synonymous_variant	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220354290G>A	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8550G>A	2.37:g.220354290G>A							p.R2850R	NM_005876	NP_005867	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	36	8550	+		Renal(207;0.0183)	2850			Pro-rich.		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	c.8550G>A	CCDS42824.1																																																																																				0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		35	76	0	0	0	0.003755	0	35	76				
SLC4A3	6508	broad.mit.edu	37	2	220494042	220494042	+	Missense_Mutation	SNP	G	G	T	rs200923264		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:220494042G>T	ENST00000358055.3	+	4	906	c.394G>T	c.(394-396)Gct>Tct	p.A132S	SLC4A3_ENST00000373760.2_Missense_Mutation_p.A132S|SLC4A3_ENST00000273063.6_Missense_Mutation_p.A132S|SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000373762.3_Missense_Mutation_p.A132S|SLC4A3_ENST00000317151.3_Missense_Mutation_p.A132S|AC009955.8_ENST00000455896.1_RNA			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	132					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.A132S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAGGGGGGAGCTGGAGTgga	0.622																																							uc002vmp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5						c.(394-396)GCT>TCT		solute carrier family 4, anion exchanger, member							19.0	24.0	23.0					2																	220494042		2202	4298	6500	SO:0001583	missense	6508				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity	g.chr2:220494042G>T		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.394G>T	2.37:g.220494042G>T	ENSP00000350756:p.Ala132Ser					SLC4A3_uc002vmn.2_Missense_Mutation_p.A132S|SLC4A3_uc002vmo.3_Missense_Mutation_p.A132S|SLC4A3_uc010fwm.2_5'UTR|SLC4A3_uc010fwn.1_5'Flank	p.A132S	NM_005070	NP_005061	P48751	B3A3_HUMAN		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	4	663	+		Renal(207;0.0183)	132			Cytoplasmic.		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	37	c.394G>T	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239885	0.22711	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.01	5.01	0.66863	.	1.164010	0.06279	N	0.697068	T	0.23249	0.0562	N	0.22421	0.69	0.29322	N	0.867264	B;B	0.25809	0.043;0.135	B;B	0.19391	0.011;0.025	T	0.05599	-1.0875	10	0.06099	T	0.92	.	16.2844	0.82712	0.0:0.0:1.0:0.0	.	132;132	P48751;P48751-3	B3A3_HUMAN;.	S	132	ENSP00000350756:A132S;ENSP00000362865:A132S;ENSP00000273063:A132S;ENSP00000362867:A132S;ENSP00000314006:A132S	ENSP00000273063:A132S	A	+	1	0	SLC4A3	220202286	0.997000	0.39634	1.000000	0.80357	0.920000	0.55202	1.934000	0.40163	2.598000	0.87819	0.462000	0.41574	GCT		0.622	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070		9	21	1	0	0.000274275	0.004482	0.000309838	9	21				
SLC19A3	80704	broad.mit.edu	37	2	228566913	228566913	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:228566913C>A	ENST00000258403.3	-	2	193	c.122G>T	c.(121-123)gGa>gTa	p.G41V	SLC19A3_ENST00000409287.1_Missense_Mutation_p.G41V|SLC19A3_ENST00000541617.1_5'UTR	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	41					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.G41V(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	TTTATCTGGTCCAGATAAATA	0.388																																							uc002vpi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(121-123)GGA>GTA		solute carrier family 19, member 3	L-Cysteine(DB00151)						106.0	111.0	109.0					2																	228566913		2203	4300	6503	SO:0001583	missense	80704				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity	g.chr2:228566913C>A	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.122G>T	2.37:g.228566913C>A	ENSP00000258403:p.Gly41Val					SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_5'UTR	p.G41V	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	2	211	-		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)	41			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000258403.3	37	c.122G>T	CCDS2468.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865227	0.71949	.	.	ENSG00000135917	ENST00000409287;ENST00000258403;ENST00000456524;ENST00000419059;ENST00000409456	D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28	5.67	3.87	0.44632	Major facilitator superfamily domain, general substrate transporter (1);	0.054589	0.85682	D	0.000000	D	0.94627	0.8268	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94949	0.8098	10	0.87932	D	0	-11.5939	12.4292	0.55565	0.0:0.862:0.0:0.138	.	41	Q9BZV2	S19A3_HUMAN	V	41	ENSP00000386298:G41V;ENSP00000258403:G41V;ENSP00000399001:G41V;ENSP00000398349:G41V;ENSP00000387193:G41V	ENSP00000258403:G41V	G	-	2	0	SLC19A3	228275157	1.000000	0.71417	0.973000	0.42090	0.975000	0.68041	1.572000	0.36461	0.855000	0.35359	-0.123000	0.14984	GGA		0.388	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1			33	75	1	0	1.57351e-24	0.003755	2.88402e-24	33	75				
CHRND	1144	broad.mit.edu	37	2	233391331	233391331	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:233391331G>T	ENST00000258385.3	+	2	177	c.145G>T	c.(145-147)Gag>Tag	p.E49*	CHRND_ENST00000536614.1_Nonsense_Mutation_p.E49*|CHRND_ENST00000543200.1_Nonsense_Mutation_p.E49*|CHRND_ENST00000457943.2_5'UTR	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	49					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)	p.E49*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GGCACACAAAGAGGAGAGTGT	0.642																																							uc002vsw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(145-147)GAG>TAG		nicotinic acetylcholine receptor delta							75.0	79.0	78.0					2																	233391331		2203	4300	6503	SO:0001587	stop_gained	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233391331G>T	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.145G>T	2.37:g.233391331G>T	ENSP00000258385:p.Glu49*					CHRND_uc010zmg.1_Nonsense_Mutation_p.E49*|CHRND_uc010fyc.2_5'UTR|CHRND_uc010zmh.1_5'UTR	p.E49*	NM_000751	NP_000742	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	2	149	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	49			Extracellular (Potential).		A8K661|B4DT92|Q52LH4	Nonsense_Mutation	SNP	ENST00000258385.3	37	c.145G>T	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468775	0.63625	.	.	ENSG00000135902	ENST00000449596;ENST00000543200;ENST00000258385;ENST00000536614	.	.	.	4.58	4.58	0.56647	.	0.609990	0.16741	N	0.201434	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.5635	0.87913	0.0:0.0:1.0:0.0	.	.	.	.	X	49	.	ENSP00000258385:E49X	E	+	1	0	CHRND	233099575	0.998000	0.40836	0.031000	0.17742	0.216000	0.24613	5.408000	0.66368	2.389000	0.81357	0.561000	0.74099	GAG		0.642	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2			18	69	1	0	1.00905e-13	0.008871	1.55766e-13	18	69				
UGT1A3	54659	broad.mit.edu	37	2	234637908	234637908	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:234637908G>C	ENST00000482026.1	+	1	155	c.136G>C	c.(136-138)Gag>Cag	p.E46Q	UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000609767.1_Missense_Mutation_p.E46Q|UGT1A6_ENST00000406651.1_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	46					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)	p.E46Q(1)		breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	CAGCATGCGGGAGGTCTTGCG	0.582																																							uc002vuy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(136-138)GAG>CAG		UDP glycosyltransferase 1 family, polypeptide A3							67.0	67.0	67.0					2																	234637908		2203	4300	6503	SO:0001583	missense	54659				flavonoid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding	g.chr2:234637908G>C	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.136G>C	2.37:g.234637908G>C	ENSP00000418532:p.Glu46Gln					UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Missense_Mutation_p.E46Q	p.E46Q	NM_019093	NP_061966	P35503	UD13_HUMAN		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	1	136	+		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)	46					B8K287	Missense_Mutation	SNP	ENST00000482026.1	37	c.136G>C	CCDS2509.1	.	.	.	.	.	.	.	.	.	.	g	5.676	0.309369	0.10733	.	.	ENSG00000243135	ENST00000482026	T	0.61859	0.07	4.35	-3.37	0.04898	.	.	.	.	.	T	0.52500	0.1738	L	0.39397	1.21	0.09310	N	1	B;B	0.30686	0.29;0.29	P;P	0.45232	0.474;0.474	T	0.56050	-0.8043	9	0.21540	T	0.41	.	9.1472	0.36939	0.6064:0.1039:0.2898:0.0	.	46;46	Q5DT01;P35503	.;UD13_HUMAN	Q	46	ENSP00000418532:E46Q	ENSP00000418532:E46Q	E	+	1	0	UGT1A3	234302647	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-3.533000	0.00439	-0.665000	0.05317	0.585000	0.79938	GAG		0.582	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093		14	36	0	0	0	0.004007	0	14	36				
SPP2	6694	broad.mit.edu	37	2	234967486	234967486	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:234967486G>T	ENST00000168148.3	+	3	305	c.217G>T	c.(217-219)Gtc>Ttc	p.V73F	SPP2_ENST00000373368.1_Missense_Mutation_p.V73F	NM_006944.2	NP_008875.1	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa	73					bone remodeling (GO:0046849)|negative regulation of endopeptidase activity (GO:0010951)|protein complex assembly (GO:0006461)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	endopeptidase inhibitor activity (GO:0004866)	p.V73F(1)		breast(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		GAAGGTTGAGGTCCTAGATGA	0.393																																							uc002vvk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(217-219)GTC>TTC		secreted phosphoprotein 2, 24kDa precursor							125.0	114.0	118.0					2																	234967486		2203	4300	6503	SO:0001583	missense	6694				bone remodeling|skeletal system development	extracellular region	endopeptidase inhibitor activity	g.chr2:234967486G>T		CCDS2511.1	2q37.1	2012-08-14	2002-08-29		ENSG00000072080	ENSG00000072080			11256	protein-coding gene	gene with protein product		602637	"""secreted phosphoprotein 2, 24kD"""			9533032	Standard	XM_005246102		Approved	SPP24	uc002vvk.1	Q13103	OTTHUMG00000059208	ENST00000168148.3:c.217G>T	2.37:g.234967486G>T	ENSP00000168148:p.Val73Phe					SPP2_uc010fyl.1_5'UTR	p.V73F	NM_006944	NP_008875	Q13103	SPP24_HUMAN		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)	3	302	+		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)	73					A4QMV3|Q3B892|Q546M5	Missense_Mutation	SNP	ENST00000168148.3	37	c.217G>T	CCDS2511.1	.	.	.	.	.	.	.	.	.	.	G	8.068	0.769553	0.15983	.	.	ENSG00000072080	ENST00000373368;ENST00000168148	T;T	0.48201	0.82;0.82	5.06	-1.14	0.09741	.	1.275500	0.05278	N	0.518771	T	0.34803	0.0910	L	0.43152	1.355	0.09310	N	1	B	0.18013	0.025	B	0.20955	0.032	T	0.23190	-1.0195	10	0.36615	T	0.2	-4.4834	0.7929	0.01061	0.2035:0.2797:0.3064:0.2104	.	73	Q13103	SPP24_HUMAN	F	73	ENSP00000362466:V73F;ENSP00000168148:V73F	ENSP00000168148:V73F	V	+	1	0	SPP2	234632225	0.000000	0.05858	0.000000	0.03702	0.692000	0.40212	-0.220000	0.09215	-0.099000	0.12263	0.591000	0.81541	GTC		0.393	SPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131313.3	NM_006944		24	52	1	0	6.36457e-07	0.003954	7.89058e-07	24	52				
RTP5	285093	broad.mit.edu	37	2	242814381	242814382	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:242814381_242814382CT>AA	ENST00000343216.3	+	2	702_703	c.674_675CT>AA	c.(673-675)cCT>cAA	p.P225Q		NM_173821.2	NP_776182.2												p.P225Q(1)									CCTGCCCCCCCTGCGGGGGCCT	0.663																																							uc010fzu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(673-675)CCT>CAA		hypothetical protein LOC285093																																				SO:0001583	missense	285093					integral to membrane		g.chr2:242814381_242814382CT>AA																												Exception_encountered	2.37:g.242814381_242814382delinsAA	ENSP00000345374:p.Pro225Gln						p.P225Q	NM_173821	NP_776182	Q14D33	CB085_HUMAN			2	697_698	+			225						Missense_Mutation	DNP	ENST00000343216.3	37	c.674_675CT>AA	CCDS42843.1																																																																																				0.663	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1			14	25	0	0	0	0.004672	0	14	25				
ATRN	8455	broad.mit.edu	37	20	3584857	3584857	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:3584857A>G	ENST00000262919.5	+	24	3817	c.3749A>G	c.(3748-3750)aAt>aGt	p.N1250S	ATRN_ENST00000446916.2_Missense_Mutation_p.N1250S	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	1250					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.N1250S(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						AACCACCCAAATATCACTTTC	0.393																																							uc002wim.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(3748-3750)AAT>AGT		attractin isoform 1							106.0	104.0	105.0					20																	3584857		2203	4300	6503	SO:0001583	missense	8455				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr20:3584857A>G	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.3749A>G	20.37:g.3584857A>G	ENSP00000262919:p.Asn1250Ser					ATRN_uc002wil.2_Missense_Mutation_p.N1250S	p.N1250S	NM_139321	NP_647537	O75882	ATRN_HUMAN			24	3839	+			1250			Extracellular (Potential).		A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	ENST00000262919.5	37	c.3749A>G	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.498882	0.85069	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.55234	0.53;0.53	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.73148	0.3550	M	0.77313	2.365	0.80722	D	1	D;D	0.71674	0.995;0.998	P;D	0.80764	0.893;0.994	T	0.75918	-0.3148	10	0.56958	D	0.05	-18.9257	15.7357	0.77842	1.0:0.0:0.0:0.0	.	1250;1250	O75882;O75882-2	ATRN_HUMAN;.	S	1250;1250;1176	ENSP00000262919:N1250S;ENSP00000416587:N1250S	ENSP00000262919:N1250S	N	+	2	0	ATRN	3532857	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.204000	0.70986	0.482000	0.46254	AAT		0.393	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321		14	54	0	0	0	0.00245	0	14	54				
ADAM33	80332	broad.mit.edu	37	20	3655206	3655206	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:3655206C>A	ENST00000356518.2	-	6	786	c.545G>T	c.(544-546)aGg>aTg	p.R182M	ADAM33_ENST00000379861.4_Missense_Mutation_p.R182M|ADAM33_ENST00000350009.2_Missense_Mutation_p.R182M|ADAM33_ENST00000466620.1_5'Flank	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	182					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R182M(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						CCCAGGATCCCTGTGGCCACA	0.597																																							uc002wit.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|skin(1)	4						c.(544-546)AGG>ATG		ADAM metallopeptidase domain 33 isoform alpha							75.0	79.0	78.0					20																	3655206		2203	4300	6503	SO:0001583	missense	80332				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr20:3655206C>A	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.545G>T	20.37:g.3655206C>A	ENSP00000348912:p.Arg182Met					ADAM33_uc002wir.1_Missense_Mutation_p.R182M|ADAM33_uc002wis.2_5'Flank|ADAM33_uc002wiu.2_Missense_Mutation_p.R182M|ADAM33_uc002wiw.1_Intron|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Intron|ADAM33_uc002wix.1_Intron|ADAM33_uc010zqg.1_Missense_Mutation_p.R194M|ADAM33_uc010zqh.1_Missense_Mutation_p.R182M	p.R182M	NM_025220	NP_079496	Q9BZ11	ADA33_HUMAN			6	632	-			182			Extracellular (Potential).		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	c.545G>T	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640008	0.29157	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	T;T;T	0.01613	4.73;4.73;4.76	4.77	0.625	0.17665	.	.	.	.	.	T	0.03053	0.0090	L	0.29908	0.895	0.25123	N	0.990621	D;D;D;D;D	0.64830	0.994;0.988;0.989;0.98;0.98	P;P;P;P;P	0.55749	0.783;0.525;0.717;0.525;0.525	T	0.49579	-0.8925	9	0.48119	T	0.1	.	7.6348	0.28259	0.0:0.5451:0.0:0.4549	.	182;194;182;182;182	B4DTZ3;B4E1Y6;Q9BZ11-2;Q9BZ11;A2A2L3	.;.;.;ADA33_HUMAN;.	M	182	ENSP00000348912:R182M;ENSP00000369190:R182M;ENSP00000322550:R182M	ENSP00000322550:R182M	R	-	2	0	ADAM33	3603206	0.000000	0.05858	0.025000	0.17156	0.030000	0.12068	-0.246000	0.08878	0.051000	0.15978	0.655000	0.94253	AGG		0.597	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220		37	62	1	0	2.20474e-14	0.003755	3.47082e-14	37	62				
ESF1	51575	broad.mit.edu	37	20	13755882	13755882	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:13755882C>A	ENST00000202816.1	-	4	1177	c.1070G>T	c.(1069-1071)tGg>tTg	p.W357L		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.W357L(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TAATCTATCCCAGTCCATGTT	0.323																																							uc002woj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1069-1071)TGG>TTG		ABT1-associated protein							121.0	125.0	124.0					20																	13755882		2203	4299	6502	SO:0001583	missense	51575				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm		g.chr20:13755882C>A		CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1070G>T	20.37:g.13755882C>A	ENSP00000202816:p.Trp357Leu					ESF1_uc002wok.1_Missense_Mutation_p.W357L	p.W357L	NM_016649	NP_057733	Q9H501	ESF1_HUMAN			4	1178	-			357					Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	c.1070G>T	CCDS13117.1	.	.	.	.	.	.	.	.	.	.	c	31	5.058485	0.93846	.	.	ENSG00000089048	ENST00000202816	T	0.76578	-1.03	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.91576	0.7339	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93154	0.6552	10	0.87932	D	0	-1.4161	19.3744	0.94502	0.0:1.0:0.0:0.0	.	357	Q9H501	ESF1_HUMAN	L	357	ENSP00000202816:W357L	ENSP00000202816:W357L	W	-	2	0	ESF1	13703882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.815000	0.86186	2.759000	0.94783	0.645000	0.84053	TGG		0.323	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649		19	66	1	0	2.54575e-18	0.010504	4.30611e-18	19	66				
ADA	100	broad.mit.edu	37	20	43248977	43248977	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:43248977G>T	ENST00000372874.4	-	11	1175	c.1041C>A	c.(1039-1041)ctC>ctA	p.L347L	ADA_ENST00000537820.1_Silent_p.L323L|PKIG_ENST00000372887.1_Intron|Z97053.1_ENST00000597250.1_5'Flank|PKIG_ENST00000372882.3_Intron|ADA_ENST00000464097.1_5'UTR	NM_000022.2	NP_000013.2	P00813	ADA_HUMAN	adenosine deaminase	347					adenosine catabolic process (GO:0006154)|aging (GO:0007568)|cell adhesion (GO:0007155)|dATP catabolic process (GO:0046061)|deoxyadenosine catabolic process (GO:0006157)|embryonic digestive tract development (GO:0048566)|germinal center B cell differentiation (GO:0002314)|histamine secretion (GO:0001821)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|negative regulation of adenosine receptor signaling pathway (GO:0060169)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of mucus secretion (GO:0070256)|negative regulation of penile erection (GO:0060407)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleobase-containing small molecule metabolic process (GO:0055086)|Peyer's patch development (GO:0048541)|placenta development (GO:0001890)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of germinal center formation (GO:0002636)|positive regulation of heart rate (GO:0010460)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide salvage (GO:0032261)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|purine-containing compound salvage (GO:0043101)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to morphine (GO:0043278)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|trophectodermal cell differentiation (GO:0001829)|xanthine biosynthetic process (GO:0046111)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|lysosome (GO:0005764)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenosine deaminase activity (GO:0004000)|purine nucleoside binding (GO:0001883)|zinc ion binding (GO:0008270)	p.L347L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(2)|prostate(3)|skin(2)|urinary_tract(1)	18		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	AGGCTTTATAGAGCAGGTCGA	0.537									Adenosine Deaminase Deficiency																														uc002xmj.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(1039-1041)CTC>CTA		adenosine deaminase	Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)						133.0	129.0	130.0					20																	43248977		2203	4300	6503	SO:0001819	synonymous_variant	100	Adenosine_Deaminase_Deficiency	Familial Cancer Database	Severe Combined Immunodeficiency (SCID) due to ADA-deficiency	adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding	g.chr20:43248977G>T	X02994	CCDS13335.1	20q13.12	2014-09-17			ENSG00000196839	ENSG00000196839	3.5.4.4		186	protein-coding gene	gene with protein product		608958				6198240, 6090454	Standard	NM_000022		Approved		uc002xmj.3	P00813	OTTHUMG00000033081	ENST00000372874.4:c.1041C>A	20.37:g.43248977G>T						ADA_uc010ggt.2_RNA	p.L347L	NM_000022	NP_000013	P00813	ADA_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		11	1169	-		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	347					Q53F92|Q6LA59	Silent	SNP	ENST00000372874.4	37	c.1041C>A	CCDS13335.1																																																																																				0.537	ADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080509.2	NM_000022		21	48	1	0	1.10513e-12	0.002299	1.6577e-12	21	48				
SLC2A10	81031	broad.mit.edu	37	20	45358045	45358045	+	Missense_Mutation	SNP	G	G	T	rs201268555		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:45358045G>T	ENST00000359271.2	+	4	1715	c.1465G>T	c.(1465-1467)Ggc>Tgc	p.G489C		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	489					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.G489C(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				CGCTGTCCTCGGCCTGGGCTT	0.562																																							uc002xsl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1465-1467)GGC>TGC		solute carrier family 2 member 10							69.0	66.0	67.0					20																	45358045		2203	4300	6503	SO:0001583	missense	81031					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr20:45358045G>T	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1465G>T	20.37:g.45358045G>T	ENSP00000352216:p.Gly489Cys						p.G489C	NM_030777	NP_110404	O95528	GTR10_HUMAN			4	1562	+		Myeloproliferative disorder(115;0.0122)	489			Helical; Name=12; (Potential).		A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	c.1465G>T	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954182	0.73902	.	.	ENSG00000197496	ENST00000359271	D	0.82167	-1.58	5.72	3.78	0.43462	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.451973	0.23658	N	0.045854	D	0.86502	0.5948	L	0.43554	1.36	0.48901	D	0.999723	D	0.76494	0.999	D	0.70935	0.971	D	0.85985	0.1485	10	0.59425	D	0.04	-7.0362	12.4025	0.55420	0.1366:0.0:0.8634:0.0	.	489	O95528	GTR10_HUMAN	C	489	ENSP00000352216:G489C	ENSP00000352216:G489C	G	+	1	0	SLC2A10	44791452	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	6.185000	0.72013	0.771000	0.33359	0.591000	0.81541	GGC		0.562	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2			16	32	1	0	1.3612e-06	0.003163	1.66806e-06	16	32				
SLC2A10	81031	broad.mit.edu	37	20	45362406	45362406	+	Missense_Mutation	SNP	G	G	T	rs573480396		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:45362406G>T	ENST00000359271.2	+	5	1809	c.1559G>T	c.(1558-1560)aGc>aTc	p.S520I		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	520					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.S520I(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				TTCACCCTGAGCTTTGGCCAC	0.617																																							uc002xsl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1558-1560)AGC>ATC		solute carrier family 2 member 10							112.0	94.0	100.0					20																	45362406		2203	4300	6503	SO:0001583	missense	81031					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr20:45362406G>T	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1559G>T	20.37:g.45362406G>T	ENSP00000352216:p.Ser520Ile						p.S520I	NM_030777	NP_110404	O95528	GTR10_HUMAN			5	1656	+		Myeloproliferative disorder(115;0.0122)	520			Cytoplasmic (Potential).		A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	c.1559G>T	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.284691	0.23392	.	.	ENSG00000197496	ENST00000359271	D	0.81996	-1.56	3.87	1.83	0.25207	.	0.714594	0.13269	N	0.400624	T	0.66829	0.2829	N	0.12961	0.28	0.09310	N	1	B	0.28128	0.201	B	0.26770	0.073	T	0.56721	-0.7932	10	0.48119	T	0.1	-3.5362	6.5191	0.22264	0.2321:0.0:0.7679:0.0	.	520	O95528	GTR10_HUMAN	I	520	ENSP00000352216:S520I	ENSP00000352216:S520I	S	+	2	0	SLC2A10	44795813	0.127000	0.22367	0.131000	0.22000	0.167000	0.22549	0.670000	0.25157	0.397000	0.25310	0.462000	0.41574	AGC		0.617	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2			12	52	1	0	7.03913e-09	0.001368	9.4449e-09	12	52				
ZMYND8	23613	broad.mit.edu	37	20	45850047	45850047	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:45850047C>A	ENST00000311275.7	-	20	3528	c.3275G>T	c.(3274-3276)aGc>aTc	p.S1092I	ZMYND8_ENST00000396281.4_Missense_Mutation_p.S1092I|ZMYND8_ENST00000536340.1_Missense_Mutation_p.S1119I|ZMYND8_ENST00000458360.2_Missense_Mutation_p.S960I|ZMYND8_ENST00000372023.3_Missense_Mutation_p.S1014I|ZMYND8_ENST00000461685.1_Missense_Mutation_p.S1066I|ZMYND8_ENST00000262975.4_Missense_Mutation_p.S1046I|ZMYND8_ENST00000360911.3_Missense_Mutation_p.S1041I|ZMYND8_ENST00000540497.1_Missense_Mutation_p.S1040I|ZMYND8_ENST00000471951.2_Missense_Mutation_p.S1112I|ZMYND8_ENST00000355972.4_Missense_Mutation_p.S1092I|ZMYND8_ENST00000446994.2_Missense_Mutation_p.S983I|ZMYND8_ENST00000352431.2_Missense_Mutation_p.S1066I	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	1092	Poly-Ser.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)	p.S1066N(1)|p.S1066I(1)		NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			TGATTGTGTGCTCGAGGAGCT	0.557																																							uc002xta.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5						c.(3274-3276)AGC>ATC		zinc finger, MYND-type containing 8 isoform b							128.0	105.0	113.0					20																	45850047		2203	4300	6503	SO:0001583	missense	23613						protein binding|zinc ion binding	g.chr20:45850047C>A	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.3275G>T	20.37:g.45850047C>A	ENSP00000312237:p.Ser1092Ile					ZMYND8_uc010ghq.1_Missense_Mutation_p.S723I|ZMYND8_uc010ghr.1_Missense_Mutation_p.S994I|ZMYND8_uc002xst.1_Missense_Mutation_p.S974I|ZMYND8_uc002xsu.1_Missense_Mutation_p.S965I|ZMYND8_uc002xsv.1_Missense_Mutation_p.S1020I|ZMYND8_uc002xsw.1_Missense_Mutation_p.S798I|ZMYND8_uc002xsx.1_Missense_Mutation_p.S798I|ZMYND8_uc002xsy.1_Missense_Mutation_p.S1021I|ZMYND8_uc002xsz.1_Missense_Mutation_p.S983I|ZMYND8_uc010zxy.1_Missense_Mutation_p.S1119I|ZMYND8_uc002xtb.1_Missense_Mutation_p.S1066I|ZMYND8_uc002xss.2_Missense_Mutation_p.S1092I|ZMYND8_uc010zxz.1_Missense_Mutation_p.S960I|ZMYND8_uc002xtc.1_Missense_Mutation_p.S1066I|ZMYND8_uc002xtd.1_Missense_Mutation_p.S1041I|ZMYND8_uc002xte.1_Missense_Mutation_p.S1046I|ZMYND8_uc010zya.1_Missense_Mutation_p.S1092I|ZMYND8_uc002xtf.1_Missense_Mutation_p.S1112I|ZMYND8_uc002xsr.1_Missense_Mutation_p.S191I	p.S1092I	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)		20	3529	-			1092			Poly-Ser.		B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37	c.3275G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.37|12.37	1.916337|1.916337	0.33815|0.33815	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000467200|ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497	.|T;T;T;T;T;T;T;T;T;T;T	.|0.55760	.|0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5	5.53|5.53	3.58|3.58	0.41010|0.41010	.|.	.|0.404608	.|0.31404	.|N	.|0.007718	T|T	0.59783|0.59783	0.2219|0.2219	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	.|B;P;P;P;P;P;B;P;P;P;P;B;B;D;B;P	.|0.60575	.|0.214;0.883;0.668;0.641;0.81;0.771;0.115;0.547;0.771;0.472;0.472;0.203;0.167;0.988;0.07;0.472	.|B;P;B;B;B;B;B;B;B;B;B;B;B;P;B;B	.|0.61477	.|0.058;0.533;0.161;0.188;0.405;0.311;0.124;0.173;0.311;0.176;0.244;0.072;0.04;0.889;0.058;0.176	T|T	0.53322|0.53322	-0.8455|-0.8455	5|10	.|0.59425	.|D	.|0.04	-0.651|-0.651	11.6269|11.6269	0.51151|0.51151	0.0:0.8656:0.0:0.1344|0.0:0.8656:0.0:0.1344	.|.	.|960;1119;1014;1021;1112;1046;1041;1066;1066;1092;983;1041;1040;985;994;1092	.|B7ZM62;F5H0X3;Q2HXV3;Q5TH11;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8	.|.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.	D|I	973|1041;1092;960;1047;1113;1066;1092;1119;1092;983;1066;1014;1040	.|ENSP00000354166:S1041I;ENSP00000312237:S1092I;ENSP00000392964:S960I;ENSP00000335537:S1066I;ENSP00000379577:S1092I;ENSP00000439800:S1119I;ENSP00000348246:S1092I;ENSP00000396725:S983I;ENSP00000418210:S1066I;ENSP00000361093:S1014I;ENSP00000443086:S1040I	.|ENSP00000262975:S1047I	E|S	-|-	3|2	2|0	ZMYND8|ZMYND8	45283454|45283454	0.915000|0.915000	0.31059|0.31059	0.016000|0.016000	0.15963|0.15963	0.028000|0.028000	0.11728|0.11728	1.795000|1.795000	0.38784|0.38784	0.672000|0.672000	0.31204|0.31204	0.555000|0.555000	0.69702|0.69702	GAG|AGC		0.557	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047		18	41	1	0	2.48551e-13	0.00499	3.77275e-13	18	41				
BMP7	655	broad.mit.edu	37	20	55803293	55803293	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:55803293G>A	ENST00000395863.3	-	2	1108	c.603C>T	c.(601-603)caC>caT	p.H201H	BMP7_ENST00000395864.3_Silent_p.H201H|BMP7_ENST00000450594.2_Silent_p.H201H	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	201					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)	p.H201H(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			ACCTGCCCAAGTGCTCCTGGA	0.572																																							uc010gip.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(601-603)CAC>CAT		bone morphogenetic protein 7 precursor							114.0	115.0	115.0					20																	55803293		2203	4300	6503	SO:0001819	synonymous_variant	655				BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity	g.chr20:55803293G>A		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.603C>T	20.37:g.55803293G>A						BMP7_uc010giq.1_Silent_p.H201H|BMP7_uc002xyc.2_Silent_p.H201H	p.H201H	NM_001719	NP_001710	P18075	BMP7_HUMAN	BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)		2	1132	-	all_lung(29;0.0133)|Melanoma(10;0.242)		201					Q9H512|Q9NTQ7	Silent	SNP	ENST00000395863.3	37	c.603C>T	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	G	9.200	1.028291	0.19512	.	.	ENSG00000101144	ENST00000433911	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	T	0.70448	0.3225	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68530	-0.5384	4	.	.	.	.	13.9054	0.63831	0.0725:0.0:0.9275:0.0	.	.	.	.	F	87	.	.	L	-	1	0	BMP7	55236700	0.957000	0.32711	0.973000	0.42090	0.960000	0.62799	1.567000	0.36407	2.644000	0.89710	0.655000	0.94253	CTT		0.572	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2			35	83	0	0	0	0.003755	0	35	83				
C20orf85	128602	broad.mit.edu	37	20	56728599	56728599	+	Splice_Site	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:56728599G>T	ENST00000371168.3	+	2	129		c.e2-1			NM_178456.2	NP_848551.1	Q9H1P6	CT085_HUMAN	chromosome 20 open reading frame 85									p.?(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	13	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			TTCTTTTTCAGGAAATACCGT	0.478																																							uc002xyv.2		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e2-1		hypothetical protein LOC128602							99.0	102.0	101.0					20																	56728599		2203	4300	6503	SO:0001630	splice_region_variant	128602							g.chr20:56728599G>T	AL354776	CCDS13465.1	20q13.32	2012-10-29			ENSG00000124237	ENSG00000124237			16216	protein-coding gene	gene with protein product	"""Low in Lung Cancer 1"""						Standard	NM_178456		Approved	bA196N14.1, LLC1	uc002xyv.3	Q9H1P6	OTTHUMG00000032836	ENST00000371168.3:c.69-1G>T	20.37:g.56728599G>T							p.W23_splice	NM_178456	NP_848551	Q9H1P6	CT085_HUMAN	BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)		2	107	+	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)								Splice_Site	SNP	ENST00000371168.3	37	c.69_splice	CCDS13465.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391225	0.62066	.	.	ENSG00000124237	ENST00000371168	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8731	0.88816	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C20orf85	56162005	1.000000	0.71417	0.994000	0.49952	0.723000	0.41478	5.456000	0.66665	2.760000	0.94817	0.655000	0.94253	.		0.478	C20orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079866.2	NM_178456	Intron	47	84	1	0	2.81731e-22	0.00361	5.07594e-22	47	84				
GNAS	2778	broad.mit.edu	37	20	57429321	57429321	+	Missense_Mutation	SNP	G	G	T	rs535138966		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:57429321G>T	ENST00000371100.4	+	1	1553	c.1001G>T	c.(1000-1002)gGc>gTc	p.G334V	GNAS_ENST00000306120.3_Missense_Mutation_p.A271S|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000371099.2_Missense_Mutation_p.G334V|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Missense_Mutation_p.G334V|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000464624.2_3'UTR	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.G334V(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCGCTTGACGGCCCGCCCATC	0.642			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	Colon(117;935 1597 6045 8307 46442)	uc002xzw.2		NA		Dom	yes		20	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	McCune-Albright syndrome; pseudohypoparathyroidism|type IA	E			pituitary adenoma		1	Substitution - Missense(1)		lung(1)	pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292						c.(1000-1002)GGC>GTC		GNAS complex locus XLas							16.0	23.0	21.0					20																	57429321		1925	4107	6032	SO:0001583	missense	2778	3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome			activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	g.chr20:57429321G>T	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.1001G>T	20.37:g.57429321G>T	ENSP00000360141:p.Gly334Val	TSP Lung(22;0.16)				GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	p.G334V	NM_080425	NP_536350	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		1	1286	+	all_lung(29;0.0104)		Error:Variant_position_missing_in_P63092_after_alignment					A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371100.4	37	c.1001G>T	CCDS46622.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.295|9.295	1.051538|1.051538	0.19827|0.19827	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000306120|ENST00000371099;ENST00000371100;ENST00000371102	.|D;D	.|0.89552	.|-2.53;-2.52	3.76|3.76	-2.4|-2.4	0.06583|0.06583	.|.	.|7.445510	.|0.00987	.|N	.|0.003473	T|T	0.81307|0.81307	0.4795|0.4795	L|L	0.29908|0.29908	0.895|0.895	0.39280|0.39280	D|D	0.964547|0.964547	.|B	.|0.21905	.|0.062	.|B	.|0.14023	.|0.01	T|T	0.63404|0.63404	-0.6645|-0.6645	6|10	0.21014|0.45353	T|T	0.42|0.12	.|.	4.4799|4.4799	0.11762|0.11762	0.4689:0.1698:0.3613:0.0|0.4689:0.1698:0.3613:0.0	.|.	.|334	.|Q5JWF2	.|GNAS1_HUMAN	S|V	271|334	.|ENSP00000360141:G334V;ENSP00000360143:G334V	ENSP00000302237:A271S|ENSP00000360140:G334V	A|G	+|+	1|2	0|0	GNAS|GNAS	56862716|56862716	0.107000|0.107000	0.21998|0.21998	0.174000|0.174000	0.22961|0.22961	0.577000|0.577000	0.36160|0.36160	0.173000|0.173000	0.16724|0.16724	-0.428000|-0.428000	0.07339|0.07339	0.462000|0.462000	0.41574|0.41574	GCC|GGC		0.642	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080417.3	NM_000516		3	6	1	0	0.00024832	0.009096	0.000282021	3	6				
GNAS	2778	broad.mit.edu	37	20	57430039	57430039	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr20:57430039C>T	ENST00000306120.3	+	1	1529	c.1529C>T	c.(1528-1530)aCg>aTg	p.T510M	GNAS_ENST00000371098.2_Intron|GNAS_ENST00000371099.2_Silent_p.D573D|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Silent_p.D573D|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Silent_p.D573D			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.D573D(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CCAGCAGCGACGATGACTCCA	0.687			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	Colon(117;935 1597 6045 8307 46442)	uc002xzw.2		NA		Dom	yes		20	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	McCune-Albright syndrome; pseudohypoparathyroidism|type IA	E			pituitary adenoma		1	Substitution - coding silent(1)		lung(1)	pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292						c.(1717-1719)GAC>GAT		GNAS complex locus XLas							12.0	16.0	15.0					20																	57430039		2136	4236	6372	SO:0001583	missense	2778	3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome			activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	g.chr20:57430039C>T	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000306120.3:c.1529C>T	20.37:g.57430039C>T	ENSP00000302237:p.Thr510Met	TSP Lung(22;0.16)				GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	p.D573D	NM_080425	NP_536350	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		1	2004	+	all_lung(29;0.0104)		Error:Variant_position_missing_in_P63092_after_alignment					A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Silent	SNP	ENST00000306120.3	37	c.1719C>T		.	.	.	.	.	.	.	.	.	.	C	12.45	1.942480	0.34283	.	.	ENSG00000087460	ENST00000306120	.	.	.	3.34	-0.338	0.12651	.	.	.	.	.	T	0.35770	0.0943	.	.	.	0.24306	N	0.995107	.	.	.	.	.	.	T	0.35943	-0.9768	5	0.54805	T	0.06	.	4.8771	0.13662	0.0:0.4313:0.434:0.1346	.	.	.	.	M	510	.	ENSP00000302237:T510M	T	+	2	0	GNAS	56863434	0.098000	0.21812	0.362000	0.25862	0.847000	0.48162	-0.003000	0.12901	0.190000	0.20209	0.462000	0.41574	ACG		0.687	GNAS-050	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000267987.1	NM_000516		6	13	0	0	0	0.001984	0	6	13				
NCAM2	4685	broad.mit.edu	37	21	22804541	22804541	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:22804541G>T	ENST00000400546.1	+	12	1843	c.1594G>T	c.(1594-1596)Gtg>Ttg	p.V532L	NCAM2_ENST00000284894.7_Missense_Mutation_p.V390L	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	532	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V532L(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TCACTATCAGGTGGATGTCAA	0.443																																							uc002yld.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1594-1596)GTG>TTG		neural cell adhesion molecule 2 precursor							86.0	83.0	84.0					21																	22804541		1888	4108	5996	SO:0001583	missense	4685				neuron cell-cell adhesion	integral to membrane|plasma membrane		g.chr21:22804541G>T		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1594G>T	21.37:g.22804541G>T	ENSP00000383392:p.Val532Leu					NCAM2_uc011acb.1_Missense_Mutation_p.V390L	p.V532L	NM_004540	NP_004531	O15394	NCAM2_HUMAN		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)	12	1843	+		Lung NSC(9;0.195)	532			Fibronectin type-III 1.|Extracellular (Potential).		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	c.1594G>T	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.403718	0.42613	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.63913	-0.07;-0.07	5.58	3.67	0.42095	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.112626	0.64402	D	0.000012	T	0.48822	0.1521	L	0.39633	1.23	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.51482	-0.8700	10	0.54805	T	0.06	-14.2887	6.9324	0.24449	0.1484:0.0:0.7014:0.1502	.	390;532	B7Z5K2;O15394	.;NCAM2_HUMAN	L	532;390	ENSP00000383392:V532L;ENSP00000284894:V390L	ENSP00000284894:V390L	V	+	1	0	NCAM2	21726412	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.006000	0.57083	2.611000	0.88343	0.655000	0.94253	GTG		0.443	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540		16	33	1	0	1.99824e-07	0.00499	2.53668e-07	16	33				
APP	351	broad.mit.edu	37	21	27254054	27254054	+	Missense_Mutation	SNP	C	C	G	rs200396597		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:27254054C>G	ENST00000346798.3	-	18	2273	c.2240G>C	c.(2239-2241)cGc>cCc	p.R747P	APP_ENST00000348990.5_Missense_Mutation_p.R672P|APP_ENST00000358918.3_Missense_Mutation_p.R729P|APP_ENST00000439274.2_Missense_Mutation_p.R691P|APP_ENST00000354192.3_Missense_Mutation_p.R616P|APP_ENST00000448388.2_Missense_Mutation_p.R637P|APP_ENST00000359726.3_Missense_Mutation_p.R691P|APP_ENST00000357903.3_Missense_Mutation_p.R728P|APP_ENST00000440126.3_Missense_Mutation_p.R723P	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	747	Interaction with G(o)-alpha.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.R747P(1)		endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				GGACAGGTGGCGCTCCTCTGG	0.478											OREG0026148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002ylz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2239-2241)CGC>CCC		amyloid beta A4 protein isoform a precursor							113.0	102.0	106.0					21																	27254054		2203	4300	6503	SO:0001583	missense	351				adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity	g.chr21:27254054C>G	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.2240G>C	21.37:g.27254054C>G	ENSP00000284981:p.Arg747Pro		OREG0026148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	792	APP_uc011acg.1_Missense_Mutation_p.R255P|APP_uc010glk.2_Missense_Mutation_p.R723P|APP_uc002yma.2_Missense_Mutation_p.R728P|APP_uc011ach.1_Missense_Mutation_p.R691P|APP_uc002ymb.2_Missense_Mutation_p.R672P|APP_uc010glj.2_Missense_Mutation_p.R616P|APP_uc011aci.1_Missense_Mutation_p.R637P	p.R747P	NM_000484	NP_000475	P05067	A4_HUMAN			18	2440	-		Breast(209;0.00295)	747			Cytoplasmic (Potential).|Interaction with G(o)-alpha.		B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	ENST00000346798.3	37	c.2240G>C	CCDS13576.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474935	0.84640	.	.	ENSG00000142192	ENST00000346798;ENST00000354192;ENST00000348990;ENST00000357903;ENST00000358918;ENST00000359726;ENST00000448388;ENST00000440126;ENST00000439274	D;D;D;D;D;D;D;D;D	0.96856	-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15	6.06	6.06	0.98353	Beta-amyloid precursor protein C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97374	0.9141	L	0.43152	1.355	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.998;0.998;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.995;0.999;0.991;0.991;1.0	D	0.97762	1.0221	10	0.87932	D	0	-17.9043	20.2159	0.98296	0.0:1.0:0.0:0.0	.	637;691;723;616;672;728;747	E9PEV0;E9PG40;B4DII8;P05067-10;P05067-4;P05067-8;P05067	.;.;.;.;.;.;A4_HUMAN	P	747;616;672;728;729;691;637;723;691	ENSP00000284981:R747P;ENSP00000346129:R616P;ENSP00000345463:R672P;ENSP00000350578:R728P;ENSP00000351796:R729P;ENSP00000352760:R691P;ENSP00000388538:R637P;ENSP00000387483:R723P;ENSP00000398879:R691P	ENSP00000284981:R747P	R	-	2	0	APP	26175925	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.882000	0.98803	0.655000	0.94253	CGC		0.478	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484		20	62	0	0	0	0.010504	0	20	62				
CLDN8	9073	broad.mit.edu	37	21	31588044	31588044	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:31588044T>C	ENST00000399899.1	-	1	347	c.200A>G	c.(199-201)tAt>tGt	p.Y67C	CLDN8_ENST00000286809.1_Missense_Mutation_p.Y67C	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	67					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.Y67C(1)		NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						CAGGGAATCATAGATTTTGCA	0.488																																							uc002ynu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(199-201)TAT>TGT		claudin 8							100.0	92.0	95.0					21																	31588044		2203	4300	6503	SO:0001583	missense	9073				calcium-independent cell-cell adhesion	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr21:31588044T>C	AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.200A>G	21.37:g.31588044T>C	ENSP00000382783:p.Tyr67Cys						p.Y67C	NM_199328	NP_955360	P56748	CLD8_HUMAN			1	275	-			67			Extracellular (Potential).		D3DSE3|Q53EX7	Missense_Mutation	SNP	ENST00000399899.1	37	c.200A>G	CCDS13587.1	.	.	.	.	.	.	.	.	.	.	T	20.0	3.930925	0.73327	.	.	ENSG00000156284	ENST00000399899;ENST00000286809;ENST00000536721	D;D	0.89485	-2.52;-2.52	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.96213	0.8765	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97461	1.0034	10	0.87932	D	0	.	14.934	0.70938	0.0:0.0:0.0:1.0	.	67	P56748	CLD8_HUMAN	C	67	ENSP00000382783:Y67C;ENSP00000286809:Y67C	ENSP00000286809:Y67C	Y	-	2	0	CLDN8	30509915	1.000000	0.71417	0.933000	0.37362	0.977000	0.68977	7.783000	0.85696	2.252000	0.74401	0.528000	0.53228	TAT		0.488	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182260.1	NM_199328		21	67	0	0	0	0.010504	0	21	67				
KRTAP13-1	140258	broad.mit.edu	37	21	31768427	31768427	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:31768427G>A	ENST00000355459.2	+	1	36	c.23G>A	c.(22-24)gGa>gAa	p.G8E		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	8						intermediate filament (GO:0005882)		p.G8E(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGCTGCTCTGGAAACTTCTCC	0.532																																							uc002yoa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(22-24)GGA>GAA		keratin associated protein 13-1							217.0	189.0	198.0					21																	31768427		2203	4300	6503	SO:0001583	missense	140258					intermediate filament		g.chr21:31768427G>A	AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.23G>A	21.37:g.31768427G>A	ENSP00000347635:p.Gly8Glu						p.G8E	NM_181599	NP_853630	Q8IUC0	KR131_HUMAN			1	36	+			8					Q14D20|Q3LI79	Missense_Mutation	SNP	ENST00000355459.2	37	c.23G>A	CCDS13590.2	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148602	0.57151	.	.	ENSG00000198390	ENST00000355459	T	0.04194	3.68	4.3	4.3	0.51218	.	0.162879	0.28583	N	0.014829	T	0.20700	0.0498	M	0.86953	2.85	0.23150	N	0.998218	D	0.89917	1.0	D	0.72075	0.976	T	0.04005	-1.0985	10	0.59425	D	0.04	.	8.3295	0.32178	0.1035:0.0:0.8965:0.0	.	8	Q8IUC0	KR131_HUMAN	E	8	ENSP00000347635:G8E	ENSP00000347635:G8E	G	+	2	0	KRTAP13-1	30690298	0.993000	0.37304	0.999000	0.59377	0.676000	0.39594	0.787000	0.26858	2.672000	0.90937	0.650000	0.86243	GGA		0.532	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128252.3			16	93	0	0	0	0.00499	0	16	93				
KRTAP19-6	337973	broad.mit.edu	37	21	31914037	31914037	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:31914037T>C	ENST00000334046.5	-	1	146	c.116A>G	c.(115-117)tAt>tGt	p.Y39C		NM_181612.2	NP_853643.1	Q3LI70	KR196_HUMAN	keratin associated protein 19-6	39						intermediate filament (GO:0005882)		p.Y39C(1)		breast(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	9						GCCATATCTATAGCCTCCATA	0.498																																							uc002yok.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(115-117)TAT>TGT		keratin associated protein 19-6							122.0	131.0	128.0					21																	31914037		2203	4300	6503	SO:0001583	missense	337973					intermediate filament		g.chr21:31914037T>C	AP001708	CCDS13598.1	21q22.1	2010-09-30			ENSG00000186925	ENSG00000186925		"""Keratin associated proteins"""	18941	protein-coding gene	gene with protein product						12359730	Standard	NM_181612		Approved	KAP19.6	uc002yok.1	Q3LI70	OTTHUMG00000057779	ENST00000334046.5:c.116A>G	21.37:g.31914037T>C	ENSP00000375107:p.Tyr39Cys						p.Y39C	NM_181612	NP_853643	Q3LI70	KR196_HUMAN			1	145	-			39					Q3LI71	Missense_Mutation	SNP	ENST00000334046.5	37	c.116A>G	CCDS13598.1	.	.	.	.	.	.	.	.	.	.	t	6.048	0.377282	0.11466	.	.	ENSG00000186925	ENST00000334046;ENST00000437381	T	0.11277	2.79	4.58	-3.75	0.04372	.	.	.	.	.	T	0.06142	0.0159	.	.	.	0.09310	N	1	B	0.21905	0.062	B	0.22386	0.039	T	0.41698	-0.9494	8	0.87932	D	0	0.8802	0.1358	0.00078	0.2921:0.2119:0.1501:0.3459	.	39	Q3LI70	KR196_HUMAN	C	39	ENSP00000375107:Y39C	ENSP00000375107:Y39C	Y	-	2	0	KRTAP19-6	30835908	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.269000	0.08596	-0.941000	0.03700	-0.322000	0.08575	TAT		0.498	KRTAP19-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128231.4			52	101	0	0	0	0.00361	0	52	101				
GART	2618	broad.mit.edu	37	21	34889378	34889378	+	Silent	SNP	G	G	A	rs377635181		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:34889378G>A	ENST00000381831.3	-	16	2288	c.2025C>T	c.(2023-2025)gtC>gtT	p.V675V	GART_ENST00000381815.4_Silent_p.V675V|GART_ENST00000543717.1_Silent_p.V227V|GART_ENST00000381839.3_Silent_p.V675V	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	675	AIRS.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)	p.V675V(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CAAAGGCTTTGACATGTCCTG	0.448																																							uc002yrx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2023-2025)GTC>GTT		phosphoribosylglycinamide formyltransferase,	Pemetrexed(DB00642)						127.0	119.0	122.0					21																	34889378		2203	4300	6503	SO:0001819	synonymous_variant	2618				'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding	g.chr21:34889378G>A	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2025C>T	21.37:g.34889378G>A						GART_uc002yrz.2_Silent_p.V675V|GART_uc010gmd.2_Silent_p.V337V|GART_uc002yry.2_Silent_p.V675V	p.V675V	NM_000819	NP_000810	P22102	PUR2_HUMAN			16	2160	-			675			AIRS.		A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Silent	SNP	ENST00000381831.3	37	c.2025C>T	CCDS13627.1																																																																																				0.448	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819		29	79	0	0	0	0.009535	0	29	79				
DOPEY2	9980	broad.mit.edu	37	21	37665644	37665644	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:37665644C>T	ENST00000399151.3	+	37	6757	c.6672C>T	c.(6670-6672)acC>acT	p.T2224T		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2224					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.T2224T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						ATGAGATCACCATGAAGAGTG	0.448																																							uc002yvg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(6670-6672)ACC>ACT		pad-1-like							80.0	77.0	78.0					21																	37665644		2203	4300	6503	SO:0001819	synonymous_variant	9980				endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane		g.chr21:37665644C>T	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6672C>T	21.37:g.37665644C>T						DOPEY2_uc011aeb.1_Silent_p.T2173T	p.T2224T	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN			37	6751	+			2224					D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	37	c.6672C>T	CCDS13643.1																																																																																				0.448	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128		3	63	0	0	0	0.004672	0	3	63				
TTC3	7267	broad.mit.edu	37	21	38507791	38507791	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:38507791G>T	ENST00000399017.2	+	18	4302	c.1555G>T	c.(1555-1557)Ggt>Tgt	p.G519C	TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000540756.1_Missense_Mutation_p.G209C|TTC3_ENST00000355666.1_Missense_Mutation_p.G519C|TTC3_ENST00000354749.2_Missense_Mutation_p.G519C	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	519					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G519C(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GTTGCTGAACGGTTTAGATCC	0.403																																					Ovarian(38;194 1649 35661)	Ovarian(38;194 1649 35661)	uc002yvz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|lung(2)|breast(2)	9						c.(1555-1557)GGT>TGT		tetratricopeptide repeat domain 3							55.0	54.0	55.0					21																	38507791		2203	4300	6503	SO:0001583	missense	7267				protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr21:38507791G>T	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.1555G>T	21.37:g.38507791G>T	ENSP00000381981:p.Gly519Cys					TTC3_uc011aee.1_Missense_Mutation_p.G209C|TTC3_uc002ywa.2_Missense_Mutation_p.G519C|TTC3_uc002ywb.2_Missense_Mutation_p.G519C|TTC3_uc010gnf.2_Missense_Mutation_p.G284C|TTC3_uc002ywc.2_Missense_Mutation_p.G209C|TTC3_uc011aed.1_Missense_Mutation_p.G209C|TTC3_uc010gne.1_Missense_Mutation_p.G519C	p.G519C	NM_001001894	NP_001001894	P53804	TTC3_HUMAN			18	1660	+		Myeloproliferative disorder(46;0.0412)	519					A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	c.1555G>T	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.168217	0.57476	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000540756;ENST00000399017;ENST00000354749	T;T;T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01	5.49	3.65	0.41850	Tetratricopeptide-like helical (1);	0.422122	0.22144	N	0.064002	T	0.75133	0.3808	N	0.19112	0.55	0.09310	N	1	D;D	0.89917	0.993;1.0	P;D	0.76575	0.764;0.988	T	0.62397	-0.6863	9	.	.	.	-17.4457	6.1093	0.20092	0.299:0.0:0.701:0.0	.	209;519	B4DSZ9;P53804	.;TTC3_HUMAN	C	519;519;501;519;209;519;519	ENSP00000403943:G519C;ENSP00000408456:G519C;ENSP00000391891:G501C;ENSP00000347889:G519C;ENSP00000442875:G209C;ENSP00000381981:G519C;ENSP00000346791:G519C	.	G	+	1	0	TTC3	37429661	0.488000	0.25996	0.645000	0.29479	0.780000	0.44128	2.477000	0.45180	1.447000	0.47661	0.655000	0.94253	GGT		0.403	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1			14	23	1	0	2.31682e-05	0.003163	2.7287e-05	14	23				
TMPRSS2	7113	broad.mit.edu	37	21	42866466	42866466	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:42866466C>A	ENST00000332149.5	-	3	189	c.55G>T	c.(55-57)Gga>Tga	p.G19*	TMPRSS2_ENST00000398585.3_Nonsense_Mutation_p.G56*|TMPRSS2_ENST00000458356.1_Nonsense_Mutation_p.G19*|TMPRSS2_ENST00000497881.1_Intron	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	19					positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G19*(2)|p.G56*(1)	TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				GGTTGGTATCCATGGTTTTCA	0.483			T	"""ERG, ETV1, ETV4, ETV5"""	prostate																																		uc002yzj.2		NA		Dom	yes		21	21q22.3	7113	T	"""transmembrane protease, serine 2"""			E	ERG|ETV1|ETV4|ETV5		prostate 	TMPRSS2/ERG(2499)|TMPRSS2/ETV1(24)	3	Substitution - Nonsense(3)		lung(3)	prostate(2523)|central_nervous_system(1)	2524						c.(55-57)GGA>TGA		transmembrane protease, serine 2 isoform 2							135.0	119.0	125.0					21																	42866466		2203	4300	6503	SO:0001587	stop_gained	7113				proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:42866466C>A	U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.55G>T	21.37:g.42866466C>A	ENSP00000330330:p.Gly19*					TMPRSS2_uc010gor.2_Nonsense_Mutation_p.G56*|TMPRSS2_uc010gos.1_Nonsense_Mutation_p.G19*	p.G19*	NM_005656	NP_005647	O15393	TMPS2_HUMAN			3	189	-		Prostate(19;4.48e-07)|all_epithelial(19;0.031)	19			Cytoplasmic (Potential).		A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Nonsense_Mutation	SNP	ENST00000332149.5	37	c.55G>T	CCDS33564.1	.	.	.	.	.	.	.	.	.	.	C	38	7.041762	0.98021	.	.	ENSG00000184012	ENST00000332149;ENST00000398585;ENST00000458356;ENST00000454499;ENST00000424093;ENST00000455813	.	.	.	4.92	4.92	0.64577	.	0.000000	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.988	0.64348	0.0:1.0:0.0:0.0	.	.	.	.	X	19;56;19;19;19;19	.	ENSP00000330330:G19X	G	-	1	0	TMPRSS2	41788336	0.973000	0.33851	0.996000	0.52242	0.752000	0.42762	3.413000	0.52686	2.428000	0.82296	0.650000	0.86243	GGA		0.483	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195189.1			9	29	1	0	0.000274275	0.004482	0.000309838	9	29				
UMODL1	89766	broad.mit.edu	37	21	43531679	43531679	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:43531679C>T	ENST00000408910.2	+	12	1963	c.1963C>T	c.(1963-1965)Cac>Tac	p.H655Y	UMODL1_ENST00000400427.1_Missense_Mutation_p.H711Y|UMODL1_ENST00000408989.2_Missense_Mutation_p.H783Y|UMODL1_ENST00000400424.2_Missense_Mutation_p.H583Y	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	655					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.H783Y(1)|p.H583Y(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CCCCACCGGCCACTTCCTGTG	0.627																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	uc002zaf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1963-1965)CAC>TAC		uromodulin-like 1 isoform 1 precursor							47.0	55.0	52.0					21																	43531679		1984	4151	6135	SO:0001583	missense	89766					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity	g.chr21:43531679C>T		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1963C>T	21.37:g.43531679C>T	ENSP00000386147:p.His655Tyr					UMODL1_uc002zad.1_Missense_Mutation_p.H583Y|UMODL1_uc002zae.1_Missense_Mutation_p.H711Y|UMODL1_uc002zag.1_Missense_Mutation_p.H783Y	p.H655Y	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN			12	1963	+			655			Extracellular (Potential).		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	c.1963C>T	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404906	0.42613	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.72835	-0.62;-0.69;-0.62;-0.68	4.39	3.49	0.39957	.	0.409228	0.20611	N	0.088976	T	0.47893	0.1470	N	0.16656	0.425	0.24318	N	0.99506	B;B	0.27882	0.192;0.007	B;B	0.24541	0.054;0.005	T	0.26883	-1.0090	10	0.07813	T	0.8	-27.1086	9.9494	0.41630	0.0:0.8937:0.0:0.1063	.	783;655	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	Y	711;583;783;655	ENSP00000383279:H711Y;ENSP00000383276:H583Y;ENSP00000386126:H783Y;ENSP00000386147:H655Y	ENSP00000383276:H583Y	H	+	1	0	UMODL1	42404748	0.013000	0.17824	0.013000	0.15412	0.009000	0.06853	1.561000	0.36342	1.116000	0.41820	0.655000	0.94253	CAC		0.627	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2			17	22	0	0	0	0.004007	0	17	22				
POTEH	23784	broad.mit.edu	37	22	16287736	16287736	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr22:16287736G>T	ENST00000343518.6	-	1	201	c.150C>A	c.(148-150)gaC>gaA	p.D50E		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	50								p.D50E(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TAGCAGAATCGTCGTGGTCTC	0.602																																							uc010gqp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(148-150)GAC>GAA		ANKRD26-like family C, member 3							98.0	114.0	109.0					22																	16287736		1672	3200	4872	SO:0001583	missense	23784							g.chr22:16287736G>T	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.150C>A	22.37:g.16287736G>T	ENSP00000340610:p.Asp50Glu					POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_5'UTR	p.D50E	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN			1	202	-			50					A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	c.150C>A	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	10.91	1.484705	0.26598	.	.	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.46819	0.86	.	.	.	.	.	.	.	.	T	0.39200	0.1069	N	0.24115	0.695	0.09310	N	1	D	0.58970	0.984	P	0.53224	0.721	T	0.25433	-1.0132	7	0.30854	T	0.27	.	.	.	.	.	50	Q6S545	POTEH_HUMAN	E	50	ENSP00000340610:D50E	ENSP00000340610:D50E	D	-	3	2	POTEH	14667736	0.012000	0.17670	0.006000	0.13384	0.006000	0.05464	0.224000	0.17738	0.073000	0.16731	0.074000	0.15403	GAC		0.602	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		5	163	1	0	1.5842e-08	0.001855	2.08603e-08	5	163				
ZNF74	7625	broad.mit.edu	37	22	20761064	20761064	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr22:20761064G>T	ENST00000400451.2	+	5	2255	c.1741G>T	c.(1741-1743)Ggg>Tgg	p.G581W	ZNF74_ENST00000405993.1_Missense_Mutation_p.G549W|ZNF74_ENST00000356671.5_Missense_Mutation_p.G581W|ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000403682.3_3'UTR	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	581					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G581W(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCACAGCGAGGGGAAGCCCTT	0.572																																							uc010gsm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1741-1743)GGG>TGG		zinc finger protein 74							49.0	55.0	53.0					22																	20761064		2149	4269	6418	SO:0001583	missense	7625				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding	g.chr22:20761064G>T	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.1741G>T	22.37:g.20761064G>T	ENSP00000383301:p.Gly581Trp					ZNF74_uc002zsg.2_Missense_Mutation_p.G510W|ZNF74_uc002zsh.2_Missense_Mutation_p.G581W|ZNF74_uc002zsi.2_Missense_Mutation_p.G510W|ZNF74_uc010gsn.2_Missense_Mutation_p.G510W	p.G581W	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)		6	1953	+	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	581					B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	c.1741G>T	CCDS42982.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542456	0.45280	.	.	ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993	T;T;T	0.06294	3.4;3.4;3.32	4.27	3.25	0.37280	Zinc finger, C2H2 (1);	0.179966	0.26971	N	0.021568	T	0.09291	0.0229	L	0.29908	0.895	0.30725	N	0.747786	D	0.54047	0.964	P	0.53006	0.715	T	0.02070	-1.1219	10	0.87932	D	0	-30.1549	10.2574	0.43405	0.0983:0.0:0.9017:0.0	.	581	Q16587	ZNF74_HUMAN	W	581;581;549	ENSP00000383301:G581W;ENSP00000349098:G581W;ENSP00000385855:G549W	ENSP00000349098:G581W	G	+	1	0	ZNF74	19091064	0.002000	0.14202	0.807000	0.32361	0.002000	0.02628	0.449000	0.21744	1.380000	0.46344	0.655000	0.94253	GGG		0.572	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426		16	18	1	0	3.32936e-07	0.006122	4.15191e-07	16	18				
GNAZ	2781	broad.mit.edu	37	22	23437951	23437951	+	Silent	SNP	G	G	T	rs372925670		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr22:23437951G>T	ENST00000248996.4	+	2	735	c.69G>T	c.(67-69)ctG>ctT	p.L23L	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	23					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)	p.L23L(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		ACCGCCACCTGCGCTCAGAGA	0.602																																							uc002zwu.1		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(1)|skin(1)	2						c.(67-69)CTG>CTT		guanine nucleotide binding protein, alpha z		G	,	0,4406		0,0,2203	43.0	46.0	45.0		69,	5.1	1.0	22		45	1,8599		0,1,4299	no	coding-synonymous,intron	GNAZ,RTDR1	NM_002073.2,NM_014433.2	,	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	,	23/356,	23437951	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2781					endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity	g.chr22:23437951G>T		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.69G>T	22.37:g.23437951G>T						RTDR1_uc002zwt.2_Intron	p.L23L	NM_002073	NP_002064	P19086	GNAZ_HUMAN		READ - Rectum adenocarcinoma(21;0.166)	2	606	+	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		23					B2R6C1|Q4QRJ6	Silent	SNP	ENST00000248996.4	37	c.69G>T	CCDS13804.1																																																																																				0.602	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073		27	20	1	0	1.5548e-18	0.005443	2.63694e-18	27	20				
OSM	5008	broad.mit.edu	37	22	30660402	30660402	+	Missense_Mutation	SNP	G	G	T	rs199694620		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr22:30660402G>T	ENST00000215781.2	-	3	269	c.229C>A	c.(229-231)Cgc>Agc	p.R77S	OSM_ENST00000403463.1_3'UTR|OSM_ENST00000403389.1_Missense_Mutation_p.R56S	NM_020530.4	NP_065391.1	P13725	ONCM_HUMAN	oncostatin M	77					behavioral response to pain (GO:0048266)|cell proliferation (GO:0008283)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|peripheral nervous system development (GO:0007422)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|response to heat (GO:0009408)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	extracellular space (GO:0005615)|oncostatin-M receptor complex (GO:0005900)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|oncostatin-M receptor binding (GO:0005147)	p.R77S(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(3)|skin(3)	11			Epithelial(10;0.206)			GCCCCGGGGCGCTCCCTGCAG	0.632																																							uc003ahb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(229-231)CGC>AGC		oncostatin M precursor							34.0	35.0	35.0					22																	30660402		2172	4185	6357	SO:0001583	missense	5008				cell proliferation|immune response|negative regulation of cell proliferation|negative regulation of hormone secretion|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of MAPKKK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of growth	extracellular space|oncostatin-M receptor complex	cytokine activity|growth factor activity|oncostatin-M receptor binding	g.chr22:30660402G>T	AF129855	CCDS13873.1	22q12.2	2011-07-21			ENSG00000099985	ENSG00000099985			8506	protein-coding gene	gene with protein product		165095				1717982	Standard	NM_020530		Approved	MGC20461	uc003ahb.3	P13725	OTTHUMG00000150913	ENST00000215781.2:c.229C>A	22.37:g.30660402G>T	ENSP00000215781:p.Arg77Ser						p.R77S	NM_020530	NP_065391	P13725	ONCM_HUMAN	Epithelial(10;0.206)		3	281	-			77					Q6FHP8|Q9UCP6	Missense_Mutation	SNP	ENST00000215781.2	37	c.229C>A	CCDS13873.1	.	.	.	.	.	.	.	.	.	.	G	1.980	-0.434267	0.04669	.	.	ENSG00000099985	ENST00000215781;ENST00000403389	T	0.46451	0.87	3.73	-2.81	0.05805	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.702808	0.11852	N	0.523265	T	0.24431	0.0592	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.14924	-1.0455	10	0.42905	T	0.14	-8.8	4.8335	0.13453	0.1776:0.0:0.4243:0.398	.	77	P13725	ONCM_HUMAN	S	77;56	ENSP00000215781:R77S	ENSP00000215781:R77S	R	-	1	0	OSM	28990402	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.311000	0.08124	-0.505000	0.06568	-1.367000	0.01198	CGC		0.632	OSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320512.1	NM_020530		7	17	1	0	8.12818e-05	0.001984	9.43344e-05	7	17				
CSF2RB	1439	broad.mit.edu	37	22	37333941	37333941	+	Missense_Mutation	SNP	G	G	A	rs138676111		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr22:37333941G>A	ENST00000403662.3	+	14	2313	c.2091G>A	c.(2089-2091)atG>atA	p.M697I	CSF2RB_ENST00000536485.1_Missense_Mutation_p.M644I|CSF2RB_ENST00000262825.5_Missense_Mutation_p.M703I|CSF2RB_ENST00000406230.1_Missense_Mutation_p.M703I			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	697					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.M697I(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CTATACCCATGAGCTCTGGGG	0.627																																							uc003aqa.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|pancreas(1)	3						c.(2089-2091)ATG>ATA		colony stimulating factor 2 receptor, beta	Sargramostim(DB00020)	G	ILE/MET	0,4406		0,0,2203	54.0	60.0	58.0		2091	-3.3	0.0	22	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	no	missense	CSF2RB	NM_000395.2	10	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	697/898	37333941	1,13005	2203	4300	6503	SO:0001583	missense	1439				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity	g.chr22:37333941G>A	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2091G>A	22.37:g.37333941G>A	ENSP00000384053:p.Met697Ile					CSF2RB_uc003aqc.3_Missense_Mutation_p.M703I	p.M697I	NM_000395	NP_000386	P32927	IL3RB_HUMAN			14	2308	+			697			Cytoplasmic (Potential).		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	c.2091G>A	CCDS13936.1	.	.	.	.	.	.	.	.	.	.	G	0.382	-0.928096	0.02377	0.0	1.16E-4	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.90385	-2.15;-2.66;-2.66;-2.66	4.92	-3.34	0.04943	.	642.877000	0.00166	N	0.000000	T	0.73783	0.3631	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.64681	-0.6350	10	0.42905	T	0.14	3.6818	0.8263	0.01121	0.2781:0.1876:0.109:0.4253	.	703;697	P32927-2;P32927	.;IL3RB_HUMAN	I	697;697;703;703;644	ENSP00000384053:M697I;ENSP00000262825:M703I;ENSP00000385271:M703I;ENSP00000440003:M644I	ENSP00000262825:M703I	M	+	3	0	CSF2RB	35663887	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.258000	0.08733	-0.346000	0.08312	-0.513000	0.04457	ATG		0.627	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		12	27	0	0	0	0.000978	0	12	27				
NFAM1	150372	broad.mit.edu	37	22	42805469	42805469	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr22:42805469A>T	ENST00000329021.5	-	3	573	c.536T>A	c.(535-537)gTg>gAg	p.V179E		NM_145912.5	NP_666017.1	Q8NET5	NFAM1_HUMAN	NFAT activating protein with ITAM motif 1	179					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cytokine production (GO:0001819)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of B cell differentiation (GO:0045577)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.V179E(1)		large_intestine(1)|lung(3)	4						GGCCGTGCCCACTACACTCAG	0.657																																							uc003bcn.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)GTG>GAG		NFAT activation molecule 1 precursor							100.0	99.0	99.0					22																	42805469		2203	4300	6503	SO:0001583	missense	150372				B cell differentiation|inflammatory response|intracellular signal transduction|positive regulation of B cell receptor signaling pathway|positive regulation of cytokine production|positive regulation of sequence-specific DNA binding transcription factor activity	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity	g.chr22:42805469A>T	BC038241	CCDS14034.1	22q13.2	2005-02-01			ENSG00000235568	ENSG00000235568			29872	protein-coding gene	gene with protein product		608740				12615919	Standard	NM_145912		Approved	CNAIP	uc003bcn.4	Q8NET5	OTTHUMG00000150923	ENST00000329021.5:c.536T>A	22.37:g.42805469A>T	ENSP00000333680:p.Val179Glu						p.V179E	NM_145912	NP_666017	Q8NET5	NFAM1_HUMAN			3	574	-			179			Helical; (Potential).		B0QYD0|Q20WL2|Q5JZ96|Q8IUY8|Q8TEM8	Missense_Mutation	SNP	ENST00000329021.5	37	c.536T>A	CCDS14034.1	.	.	.	.	.	.	.	.	.	.	A	12.44	1.939377	0.34189	.	.	ENSG00000235568	ENST00000329021	T	0.44083	0.93	4.95	4.95	0.65309	.	1.537140	0.05323	U	0.526921	T	0.43322	0.1242	L	0.40543	1.245	0.27459	N	0.953215	D	0.54207	0.965	P	0.44811	0.461	T	0.36939	-0.9727	10	0.66056	D	0.02	-3.4667	10.9921	0.47555	1.0:0.0:0.0:0.0	.	179	Q8NET5	NFAM1_HUMAN	E	179	ENSP00000333680:V179E	ENSP00000333680:V179E	V	-	2	0	NFAM1	41135413	0.907000	0.30839	0.837000	0.33122	0.013000	0.08279	2.855000	0.48333	1.867000	0.54127	0.402000	0.26972	GTG		0.657	NFAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320541.1	NM_145912		6	65	0	0	0	0.001984	0	6	65				
GTSE1	51512	broad.mit.edu	37	22	46704833	46704833	+	Missense_Mutation	SNP	C	C	A	rs147669373	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr22:46704833C>A	ENST00000454366.1	+	4	967	c.755C>A	c.(754-756)gCg>gAg	p.A252E		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	233					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)		p.A252E(1)|p.A233E(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CCTGGGGCTGCGGAGAAGGTA	0.622																																					GBM(153;542 1915 12487 29016 50495)	GBM(153;542 1915 12487 29016 50495)	uc011aqy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(754-756)GCG>GAG		G-2 and S-phase expressed 1							34.0	38.0	37.0					22																	46704833		2195	4287	6482	SO:0001583	missense	51512				DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule		g.chr22:46704833C>A	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.755C>A	22.37:g.46704833C>A	ENSP00000415430:p.Ala252Glu					GTSE1_uc011aqz.1_Missense_Mutation_p.A99E	p.A252E	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)	4	967	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	233					B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	ENST00000454366.1	37	c.755C>A	CCDS14074.2	.	.	.	.	.	.	.	.	.	.	C	6.216	0.408028	0.11754	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.06608	3.28	4.72	-9.44	0.00603	.	2.817550	0.00935	N	0.002766	T	0.03263	0.0095	N	0.03608	-0.345	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.36648	-0.9739	10	0.59425	D	0.04	9.353	12.0246	0.53362	0.1131:0.6674:0.0:0.2195	.	233	Q9NYZ3	GTSE1_HUMAN	E	252;212	ENSP00000415430:A252E	ENSP00000354634:A212E	A	+	2	0	GTSE1	45083497	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.879000	0.01629	-2.144000	0.00802	-0.290000	0.09829	GCG		0.622	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426		3	32	1	0	0.00024832	0.009096	0.000282021	3	32				
CHL1	10752	broad.mit.edu	37	3	440756	440756	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:440756T>A	ENST00000256509.2	+	26	3952	c.3310T>A	c.(3310-3312)Tgt>Agt	p.C1104S	CHL1_ENST00000397491.2_Missense_Mutation_p.C1088S	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.C1104S(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TGGACTGATGTGTGCGATTGC	0.368																																							uc003bou.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(3262-3264)TGT>AGT		cell adhesion molecule with homology to L1CAM							240.0	225.0	230.0					3																	440756		2203	4300	6503	SO:0001583	missense	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:440756T>A	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3310T>A	3.37:g.440756T>A	ENSP00000256509:p.Cys1104Ser					CHL1_uc003bot.2_Missense_Mutation_p.C1104S|CHL1_uc003bow.1_Missense_Mutation_p.C1088S|CHL1_uc011asi.1_Missense_Mutation_p.C1051S	p.C1088S	NM_006614	NP_006605	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	25	3533	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	1088			Helical; (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	c.3262T>A	CCDS2556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.8|20.8	4.048954|4.048954	0.75846|0.75846	.|.	.|.	ENSG00000134121|ENSG00000134121	ENST00000256509;ENST00000397491|ENST00000445697	T;T|.	0.61274|.	0.12;0.14|.	5.45|5.45	4.27|4.27	0.50696|0.50696	.|.	0.106561|0.106561	0.64402|0.64402	D|D	0.000003|0.000003	T|.	0.54967|.	0.1891|.	L|L	0.46947|0.46947	1.48|1.48	0.50171|0.50171	D|D	0.999851|0.999851	P;P;D|.	0.69078|.	0.637;0.881;0.997|.	P;P;D|.	0.70016|.	0.802;0.694;0.967|.	T|.	0.49899|.	-0.8890|.	10|.	0.52906|.	T|.	0.07|.	.|.	7.4165|7.4165	0.27047|0.27047	0.1346:0.0:0.2802:0.5853|0.1346:0.0:0.2802:0.5853	.|.	1088;1088;1104|.	B3KX75;O00533;O00533-2|.	.;CHL1_HUMAN;.|.	S|X	1104;1088|237	ENSP00000256509:C1104S;ENSP00000380628:C1088S|.	ENSP00000256509:C1104S|.	C|C	+|+	1|3	0|2	CHL1|CHL1	415756|415756	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	3.654000|3.654000	0.54453|0.54453	0.874000|0.874000	0.35823|0.35823	0.533000|0.533000	0.62120|0.62120	TGT|TGT		0.368	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		32	93	0	0	0	0.002836	0	32	93				
PPARG	5468	broad.mit.edu	37	3	12475578	12475578	+	Silent	SNP	C	C	A	rs149367249	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:12475578C>A	ENST00000287820.6	+	7	1573	c.1452C>A	c.(1450-1452)atC>atA	p.I484I	PPARG_ENST00000397010.2_Silent_p.I456I|PPARG_ENST00000539812.1_3'UTR|PPARG_ENST00000397000.1_3'UTR|PPARG_ENST00000397026.2_Silent_p.I462I|PPARG_ENST00000397012.2_Silent_p.I456I|PPARG_ENST00000309576.6_Silent_p.I456I|PPARG_ENST00000397015.2_Silent_p.I456I	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	484	Ligand-binding.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.I484I(1)	PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	TGCAGGTGATCAAGAAGACGG	0.517			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																uc003bwx.2		NA		Dom	yes		3	3p25	5468	T	"""peroxisome proliferative activated receptor, gamma"""	yes	Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension	E	PAX8		follicular thyroid		1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)	2						c.(1450-1452)ATC>ATA		peroxisome proliferative activated receptor	Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)						70.0	63.0	65.0					3																	12475578		2203	4300	6503	SO:0001819	synonymous_variant	5468				activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr3:12475578C>A	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.1452C>A	3.37:g.12475578C>A						PPARG_uc003bwr.2_Silent_p.I456I|PPARG_uc003bws.2_Silent_p.I456I|PPARG_uc003bwu.2_Silent_p.I456I|PPARG_uc003bwv.2_3'UTR	p.I484I	NM_015869	NP_056953	P37231	PPARG_HUMAN			7	1543	+			484			Ligand-binding.		A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Silent	SNP	ENST00000287820.6	37	c.1452C>A	CCDS2609.1																																																																																				0.517	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037		10	32	1	0	0.00621372	0.006214	0.00661964	10	32				
C3orf20	84077	broad.mit.edu	37	3	14763190	14763190	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:14763190G>T	ENST00000253697.3	+	10	1917	c.1465G>T	c.(1465-1467)Gga>Tga	p.G489*	C3orf20_ENST00000412910.1_Nonsense_Mutation_p.G367*|C3orf20_ENST00000435614.1_Nonsense_Mutation_p.G367*|C3orf20_ENST00000495387.1_3'UTR	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	489						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.G489*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						AAAGGTACTGGGACAGGACTC	0.502																																							uc003byy.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1465-1467)GGA>TGA		hypothetical protein LOC84077							198.0	166.0	177.0					3																	14763190		2203	4300	6503	SO:0001587	stop_gained	84077					cytoplasm|integral to membrane		g.chr3:14763190G>T	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1465G>T	3.37:g.14763190G>T	ENSP00000253697:p.Gly489*					C3orf20_uc003byz.2_Nonsense_Mutation_p.G367*|C3orf20_uc003bza.2_Nonsense_Mutation_p.G367*|C3orf20_uc003bzb.1_5'UTR	p.G489*	NM_032137	NP_115513	Q8ND61	CC020_HUMAN			10	1869	+			489					Q7L0U6|Q8NCP2|Q9H0I7	Nonsense_Mutation	SNP	ENST00000253697.3	37	c.1465G>T	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	G	37	6.479371	0.97598	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	.	.	.	5.63	3.82	0.43975	.	0.290655	0.24649	N	0.036723	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-15.5757	8.131	0.31027	0.1795:0.0:0.8205:0.0	.	.	.	.	X	489;367;367	.	ENSP00000253697:G489X	G	+	1	0	C3orf20	14738194	0.184000	0.23200	0.329000	0.25429	0.532000	0.34746	1.008000	0.29872	1.517000	0.48917	0.591000	0.81541	GGA		0.502	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		38	69	1	0	2.09667e-21	0.003755	3.71443e-21	38	69				
COLQ	8292	broad.mit.edu	37	3	15531040	15531040	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:15531040G>T	ENST00000383788.5	-	2	336	c.211C>A	c.(211-213)Cga>Aga	p.R71R	COLQ_ENST00000435459.2_Silent_p.R61R|COLQ_ENST00000383787.2_Silent_p.R71R|COLQ_ENST00000603808.1_Silent_p.R71R|COLQ_ENST00000383781.4_Silent_p.R61R|COLQ_ENST00000383785.2_Silent_p.R71R|COLQ_ENST00000383786.5_Silent_p.R71R	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	71					acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.R71R(1)|p.R61R(1)		endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						ACCGGACTTCGGCCACCTCTG	0.582																																							uc003bzx.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(211-213)CGA>AGA		acetylcholinesterase collagen-like tail subunit							69.0	63.0	65.0					3																	15531040		2203	4300	6503	SO:0001819	synonymous_variant	8292				acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft		g.chr3:15531040G>T	AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.211C>A	3.37:g.15531040G>T						HACL1_uc011avr.1_RNA|COLQ_uc003bzv.2_Silent_p.R61R|COLQ_uc003bzz.2_Silent_p.R71R|COLQ_uc010heo.2_Silent_p.R71R|COLQ_uc003cac.1_RNA|COLQ_uc003cae.1_5'UTR|COLQ_uc003cad.1_RNA	p.R71R	NM_005677	NP_005668	Q9Y215	COLQ_HUMAN			2	337	-			71					B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Silent	SNP	ENST00000383788.5	37	c.211C>A	CCDS33709.1																																																																																				0.582	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343575.1	NM_005677		14	27	1	0	1.05317e-09	0.00245	1.45612e-09	14	27				
ARPP21	10777	broad.mit.edu	37	3	35781039	35781039	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:35781039G>C	ENST00000187397.4	+	17	2331	c.1875G>C	c.(1873-1875)caG>caC	p.Q625H	ARPP21_ENST00000458225.1_Missense_Mutation_p.Q626H|ARPP21_ENST00000417925.1_Missense_Mutation_p.Q626H|ARPP21_ENST00000337271.5_Missense_Mutation_p.Q606H|ARPP21_ENST00000444190.1_Missense_Mutation_p.Q606H	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	625	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.Q625H(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CCTCACCACAGGGATTTGTGC	0.547																																							uc003cgb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1873-1875)CAG>CAC		cyclic AMP-regulated phosphoprotein, 21 kD							68.0	66.0	67.0					3																	35781039		2203	4300	6503	SO:0001583	missense	10777					cytoplasm	nucleic acid binding	g.chr3:35781039G>C	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1875G>C	3.37:g.35781039G>C	ENSP00000187397:p.Gln625His					ARPP21_uc003cga.2_Missense_Mutation_p.Q606H|ARPP21_uc011axy.1_Missense_Mutation_p.Q626H|ARPP21_uc003cgf.2_Missense_Mutation_p.Q461H|ARPP21_uc003cgg.2_Missense_Mutation_p.Q148H	p.Q625H	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN			17	2139	+			625			Gln-rich.		B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	c.1875G>C	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418468	0.62622	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.87	1.06	0.20224	.	0.144282	0.46145	D	0.000313	T	0.62036	0.2395	M	0.64170	1.965	0.34289	D	0.682989	D;D;D;D	0.71674	0.995;0.998;0.991;0.995	P;D;P;P	0.66351	0.904;0.943;0.73;0.904	T	0.67193	-0.5732	10	0.37606	T	0.19	-10.3435	9.2893	0.37778	0.4203:0.0:0.5797:0.0	.	626;148;625;606	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	H	626;606;606;625;626	ENSP00000414351:Q626H;ENSP00000337792:Q606H;ENSP00000405276:Q606H;ENSP00000187397:Q625H;ENSP00000412326:Q626H	ENSP00000187397:Q625H	Q	+	3	2	ARPP21	35756043	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	0.705000	0.25675	0.130000	0.18549	0.655000	0.94253	CAG		0.547	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		5	33	0	0	0	0.001168	0	5	33				
TRAK1	22906	broad.mit.edu	37	3	42226214	42226214	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:42226214A>T	ENST00000327628.5	+	4	801	c.401A>T	c.(400-402)cAg>cTg	p.Q134L	TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000341421.3_Missense_Mutation_p.Q76L|TRAK1_ENST00000449246.1_Missense_Mutation_p.Q60L|TRAK1_ENST00000396175.1_Missense_Mutation_p.Q76L	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	134	HAP1 N-terminal.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.Q76L(2)|p.Q134L(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CGCATCGGCCAGTCGTTGTTG	0.512																																					GBM(44;195 884 22595 31865 41850)	GBM(44;195 884 22595 31865 41850)	uc003cky.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(400-402)CAG>CTG		OGT(O-Glc-NAc transferase)-interacting protein							111.0	114.0	113.0					3																	42226214		2203	4300	6503	SO:0001583	missense	22906				endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus		g.chr3:42226214A>T		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.401A>T	3.37:g.42226214A>T	ENSP00000328998:p.Gln134Leu					TRAK1_uc011azh.1_Missense_Mutation_p.Q134L|TRAK1_uc011azi.1_Missense_Mutation_p.Q134L|TRAK1_uc003ckz.3_Missense_Mutation_p.Q60L|TRAK1_uc011azj.1_Missense_Mutation_p.Q60L|TRAK1_uc003cla.2_Missense_Mutation_p.Q76L	p.Q134L	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN			4	617	+			134			Potential.|HAP1 N-terminal.		E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	ENST00000327628.5	37	c.401A>T	CCDS43072.1	.	.	.	.	.	.	.	.	.	.	A	32	5.169108	0.94768	.	.	ENSG00000182606	ENST00000327628;ENST00000543338;ENST00000449246;ENST00000396175;ENST00000341421	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	4.96	4.96	0.65561	.	0.207475	0.42548	N	0.000695	T	0.45935	0.1367	M	0.64080	1.96	0.80722	D	1	P;P;P;P;D;P	0.62365	0.454;0.811;0.94;0.655;0.991;0.955	B;B;P;B;D;P	0.63957	0.266;0.167;0.55;0.269;0.92;0.645	T	0.47182	-0.9137	10	0.87932	D	0	.	14.1686	0.65493	1.0:0.0:0.0:0.0	.	60;76;134;76;60;134	B7Z218;C9JC32;B7Z347;Q9UPV9-2;E9PDS2;Q9UPV9	.;.;.;.;.;TRAK1_HUMAN	L	134;134;60;76;76	ENSP00000328998:Q134L;ENSP00000410717:Q60L;ENSP00000379478:Q76L;ENSP00000340702:Q76L	ENSP00000328998:Q134L	Q	+	2	0	TRAK1	42201218	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.075000	0.94004	1.990000	0.58119	0.514000	0.50259	CAG		0.512	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965		39	78	0	0	0	0.005524	0	39	78				
CCR3	1232	broad.mit.edu	37	3	46307361	46307361	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:46307361A>G	ENST00000357422.2	+	4	1255	c.712A>G	c.(712-714)Atc>Gtc	p.I238V	CCR3_ENST00000541018.1_Missense_Mutation_p.I238V|CCR3_ENST00000545097.1_Missense_Mutation_p.I259V|CCR3_ENST00000395942.2_Missense_Mutation_p.I238V|CCR3_ENST00000395940.2_Missense_Mutation_p.I238V			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	238					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.I238V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		GTACAAGGCCATCCGGCTCAT	0.448																																							uc003cpg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|breast(1)|kidney(1)	8						c.(712-714)ATC>GTC		CC chemokine receptor 3 isoform 1							76.0	75.0	75.0					3																	46307361		2203	4300	6503	SO:0001583	missense	1232				cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane		g.chr3:46307361A>G	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.712A>G	3.37:g.46307361A>G	ENSP00000350003:p.Ile238Val					CCR3_uc003cpi.1_Missense_Mutation_p.I238V|CCR3_uc003cpj.1_Missense_Mutation_p.I238V|CCR3_uc003cpk.1_Missense_Mutation_p.I259V|CCR3_uc010hjb.1_Missense_Mutation_p.I256V|CCR3_uc003cpl.1_Missense_Mutation_p.I271V	p.I238V	NM_178329	NP_847899	P51677	CCR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)	4	1255	+			238			Cytoplasmic (Potential).		B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	c.712A>G	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	A	2.430	-0.331001	0.05314	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	5.96	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.202192	0.32640	N	0.005839	T	0.46132	0.1377	N	0.11818	0.18	0.33315	D	0.566618	B;B	0.19935	0.032;0.04	B;B	0.23574	0.028;0.047	T	0.48990	-0.8985	10	0.02654	T	1	.	8.884	0.35392	0.8534:0.0:0.1466:0.0	.	259;238	F5GWL6;P51677	.;CCR3_HUMAN	V	238;259;238;238;238	ENSP00000350003:I238V;ENSP00000441600:I259V;ENSP00000440097:I238V;ENSP00000379271:I238V;ENSP00000379273:I238V	ENSP00000350003:I238V	I	+	1	0	CCR3	46282365	0.874000	0.30092	1.000000	0.80357	0.968000	0.65278	1.543000	0.36147	2.270000	0.75569	0.533000	0.62120	ATC		0.448	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2			19	36	0	0	0	0.008871	0	19	36				
LTF	4057	broad.mit.edu	37	3	46492017	46492017	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:46492017C>G	ENST00000231751.4	-	7	1145	c.850G>C	c.(850-852)Gat>Cat	p.D284H	LTF_ENST00000417439.1_Missense_Mutation_p.D284H|LTF_ENST00000426532.2_Missense_Mutation_p.D240H	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	284	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)	p.D284H(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		CAGATGGCATCCTCCTTGCCA	0.567																																							uc003cpq.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|lung(1)	4						c.(850-852)GAT>CAT		lactotransferrin precursor	Pefloxacin(DB00487)						95.0	85.0	88.0					3																	46492017		2203	4296	6499	SO:0001583	missense	4057				cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity	g.chr3:46492017C>G		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.850G>C	3.37:g.46492017C>G	ENSP00000231751:p.Asp284His					LTF_uc003fzr.2_Missense_Mutation_p.D240H|LTF_uc010hjh.2_Missense_Mutation_p.D284H|LTF_uc003cpr.2_Missense_Mutation_p.D271H	p.D284H	NM_002343	NP_002334	P02788	TRFL_HUMAN		all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	7	888	-			284			Transferrin-like 1.		A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	37	c.850G>C	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.503495	0.26949	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	4.61	0.612	0.17591	.	0.495173	0.24645	N	0.036765	T	0.52917	0.1764	M	0.73962	2.25	0.09310	N	1	D;D;D	0.67145	0.996;0.964;0.996	D;P;D	0.70716	0.97;0.89;0.97	T	0.43376	-0.9395	10	0.87932	D	0	-8.9406	8.299	0.32004	0.0:0.5602:0.0:0.4398	.	284;271;284	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	H	284;240;284;271	ENSP00000231751:D284H;ENSP00000405719:D240H;ENSP00000405546:D284H;ENSP00000397427:D271H	ENSP00000231751:D284H	D	-	1	0	LTF	46467021	0.001000	0.12720	0.001000	0.08648	0.168000	0.22595	0.008000	0.13197	-0.019000	0.14055	0.655000	0.94253	GAT		0.567	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343		10	14	0	0	0	0.006214	0	10	14				
COL7A1	1294	broad.mit.edu	37	3	48612109	48612109	+	Splice_Site	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:48612109C>G	ENST00000328333.8	-	77	6501		c.e77+1		COL7A1_ENST00000454817.1_Splice_Site	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1						cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.?(2)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGAGGCCTCACCCTGTCTCCT	0.632																																							uc003ctz.2		NA																	2	Unknown(2)		lung(2)	ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.e77+1		alpha 1 type VII collagen precursor							75.0	79.0	78.0					3																	48612109		2203	4300	6503	SO:0001630	splice_region_variant	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48612109C>G	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.6393+1G>C	3.37:g.48612109C>G							p.R2131_splice	NM_000094	NP_000085	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	77	6394	-								Q14054|Q16507	Splice_Site	SNP	ENST00000328333.8	37	c.6393_splice	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393369	0.62066	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9122	0.88937	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL7A1	48587113	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	4.555000	0.60767	2.456000	0.83038	0.462000	0.41574	.		0.632	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	Intron	17	43	0	0	0	0.00499	0	17	43				
CELSR3	1951	broad.mit.edu	37	3	48697761	48697761	+	Silent	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:48697761T>A	ENST00000164024.4	-	1	2587	c.2307A>T	c.(2305-2307)gcA>gcT	p.A769A	CELSR3_ENST00000544264.1_Silent_p.A769A	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	769	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A769A(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGCCCACAGCTGCATCCTCAT	0.557																																							uc003cul.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(2305-2307)GCA>GCT		cadherin EGF LAG seven-pass G-type receptor 3							99.0	85.0	90.0					3																	48697761		2203	4300	6503	SO:0001819	synonymous_variant	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48697761T>A	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2307A>T	3.37:g.48697761T>A						CELSR3_uc003cuf.1_Silent_p.A839A	p.A769A	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	1	2588	-			769			Extracellular (Potential).|Cadherin 5.		O75092	Silent	SNP	ENST00000164024.4	37	c.2307A>T	CCDS2775.1																																																																																				0.557	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		14	34	0	0	0	0.00245	0	14	34				
RNF123	63891	broad.mit.edu	37	3	49749945	49749945	+	Missense_Mutation	SNP	G	G	A	rs199836723		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:49749945G>A	ENST00000327697.6	+	27	2674	c.2530G>A	c.(2530-2532)Gtc>Atc	p.V844I	RNF123_ENST00000432042.1_Missense_Mutation_p.V698I|RNF123_ENST00000433785.1_5'Flank	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	844					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.V844I(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCTGCTGCGCGTCTGCCTGCG	0.612																																							uc003cxh.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7						c.(2530-2532)GTC>ATC		ring finger protein 123							107.0	82.0	91.0					3																	49749945		2203	4300	6503	SO:0001583	missense	63891					cytoplasm	ligase activity|protein binding|zinc ion binding	g.chr3:49749945G>A	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2530G>A	3.37:g.49749945G>A	ENSP00000328287:p.Val844Ile					RNF123_uc010hky.1_Missense_Mutation_p.V506I|RNF123_uc003cxi.2_RNA	p.V844I	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)	27	2616	+			844					A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	c.2530G>A	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.722705	0.48728	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.78003	-0.75;-1.14	5.91	4.13	0.48395	.	0.166280	0.52532	N	0.000064	T	0.68329	0.2989	L	0.39245	1.2	0.80722	D	1	B;B	0.15930	0.015;0.004	B;B	0.08055	0.003;0.003	T	0.61554	-0.7039	10	0.35671	T	0.21	-34.4243	11.6706	0.51399	0.1417:0.0:0.8583:0.0	.	698;844	C9J266;Q5XPI4	.;RN123_HUMAN	I	844;844;698	ENSP00000328287:V844I;ENSP00000392443:V698I	ENSP00000328287:V844I	V	+	1	0	RNF123	49724949	1.000000	0.71417	0.839000	0.33178	0.718000	0.41266	4.471000	0.60182	0.853000	0.35312	-0.145000	0.13849	GTC		0.612	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064		13	28	0	0	0	0.001855	0	13	28				
ITIH1	3697	broad.mit.edu	37	3	52825805	52825805	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:52825805C>T	ENST00000273283.2	+	22	2638	c.2614C>T	c.(2614-2616)Caa>Taa	p.Q872*	ITIH1_ENST00000405128.3_Nonsense_Mutation_p.Q238*|ITIH1_ENST00000537050.1_Nonsense_Mutation_p.Q584*|ITIH1_ENST00000542827.1_3'UTR|ITIH1_ENST00000540715.1_Nonsense_Mutation_p.Q730*	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	872	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q872*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CAGGGGTTTGCAAAAAGACTA	0.577																																							uc003dfs.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(2614-2616)CAA>TAA		inter-alpha (globulin) inhibitor H1							78.0	74.0	75.0					3																	52825805		2203	4300	6503	SO:0001587	stop_gained	3697				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity	g.chr3:52825805C>T		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2614C>T	3.37:g.52825805C>T	ENSP00000273283:p.Gln872*					ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Missense_Mutation_p.A463V|ITIH1_uc010hmo.1_Nonsense_Mutation_p.Q426*|ITIH1_uc003dfu.2_Nonsense_Mutation_p.Q238*|ITIH3_uc003dfv.2_5'Flank|ITIH3_uc011bek.1_5'Flank	p.Q872*	NM_002215	NP_002206	P19827	ITIH1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)	22	2638	+			872			Hyaluronan-binding.		A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Nonsense_Mutation	SNP	ENST00000273283.2	37	c.2614C>T	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	C	40	8.225353	0.98714	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	.	.	.	5.61	5.61	0.85477	.	0.062535	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-14.2043	17.416	0.87500	0.0:1.0:0.0:0.0	.	.	.	.	X	872;730;584;425;238	.	ENSP00000273283:Q872X	Q	+	1	0	ITIH1	52800845	1.000000	0.71417	0.918000	0.36340	0.484000	0.33280	4.406000	0.59748	2.640000	0.89533	0.591000	0.81541	CAA		0.577	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215		4	31	0	0	0	0.009096	0	4	31				
FHIT	2272	broad.mit.edu	37	3	59908137	59908137	+	Missense_Mutation	SNP	C	C	G	rs202183587		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:59908137C>G	ENST00000468189.1	-	8	653	c.283G>C	c.(283-285)Gtt>Ctt	p.V95L	FHIT_ENST00000476844.1_Missense_Mutation_p.V95L|FHIT_ENST00000341848.4_Missense_Mutation_p.V95L|FHIT_ENST00000492590.1_Missense_Mutation_p.V95L|FHIT_ENST00000466788.1_5'UTR			P49789	FHIT_HUMAN	fragile histidine triad	95	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				DNA replication (GO:0006260)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide metabolic process (GO:0009117)|purine nucleotide metabolic process (GO:0006163)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|catalytic activity (GO:0003824)|hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|ubiquitin protein ligase binding (GO:0031625)	p.V95L(2)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)	12		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		TGGACGTGAACGTGCTGAAAA	0.418			T	HMGA2	pleomorphic salivary gland adenoma				Renal Cell Cancer associated with constitutional translocation of chromosome 3																														uc003dkx.3		NA		Dom	yes		3	3p14.2	2272	T	fragile histidine triad gene			E	HMGA2		pleomorphic salivary gland adenoma		2	Substitution - Missense(2)		lung(2)		0						c.(283-285)GTT>CTT		fragile histidine triad gene							126.0	111.0	116.0					3																	59908137		2203	4300	6503	SO:0001583	missense	2272	Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3	Familial Cancer Database		nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding	g.chr3:59908137C>G	BC032336	CCDS2894.1	3p14.2	2012-02-27	2012-02-27		ENSG00000189283	ENSG00000189283			3701	protein-coding gene	gene with protein product		601153	"""fragile histidine triad gene"""			8598045, 9671749	Standard	NM_002012		Approved	FRA3B, AP3Aase	uc003dky.3	P49789	OTTHUMG00000158591	ENST00000468189.1:c.283G>C	3.37:g.59908137C>G	ENSP00000417480:p.Val95Leu					FHIT_uc003dky.2_Missense_Mutation_p.V95L|FHIT_uc010hnn.1_Missense_Mutation_p.V95L	p.V95L	NM_002012	NP_002003	P49789	FHIT_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)	8	654	-		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)	95			Histidine triad motif.|HIT.|Binding to substrate; phosphate linker.		A2IAS9|A2IAT0|A2IAT6|A8K1A9|Q45QG9|Q6IU12	Missense_Mutation	SNP	ENST00000468189.1	37	c.283G>C	CCDS2894.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597462	0.46318	.	.	ENSG00000189283	ENST00000492590;ENST00000476844;ENST00000468189;ENST00000341848	D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21	5.6	4.73	0.59995	Histidine triad, conserved site (1);Histidine triad motif (1);Histidine triad-like motif (1);	0.290817	0.32244	N	0.006371	D	0.85106	0.5621	L	0.47016	1.485	0.43271	D	0.995228	B	0.23442	0.085	B	0.36922	0.236	T	0.79860	-0.1625	9	.	.	.	-12.9057	12.503	0.55966	0.0:0.9221:0.0:0.0779	.	95	P49789	FHIT_HUMAN	L	95	ENSP00000418582:V95L;ENSP00000417557:V95L;ENSP00000417480:V95L;ENSP00000342087:V95L	.	V	-	1	0	FHIT	59883177	1.000000	0.71417	0.989000	0.46669	0.767000	0.43475	4.256000	0.58810	1.381000	0.46364	-0.140000	0.14226	GTT		0.418	FHIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351648.1	NM_002012		9	30	0	0	0	0.004482	0	9	30				
CADPS	8618	broad.mit.edu	37	3	62751616	62751616	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:62751616G>T	ENST00000383710.4	-	2	834	c.485C>A	c.(484-486)gCt>gAt	p.A162D	CADPS_ENST00000357948.3_Missense_Mutation_p.A162D|CADPS_ENST00000490353.2_Missense_Mutation_p.A162D|CADPS_ENST00000283269.9_Missense_Mutation_p.A162D	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	162					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.A162D(2)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ATTGAGGAAAGCCTGAAACCG	0.468																																							uc003dll.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(484-486)GCT>GAT		Ca2+-dependent secretion activator isoform 1							143.0	127.0	133.0					3																	62751616		2203	4300	6503	SO:0001583	missense	8618				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding	g.chr3:62751616G>T	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.485C>A	3.37:g.62751616G>T	ENSP00000373215:p.Ala162Asp					CADPS_uc003dlm.2_Missense_Mutation_p.A162D|CADPS_uc003dln.2_Missense_Mutation_p.A162D	p.A162D	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)	2	845	-		Lung SC(41;0.0452)	162					A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	c.485C>A	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933637	0.92458	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;T	0.82255	-1.59;-1.59;-1.59;-1.43	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.87176	0.6112	L	0.55990	1.75	0.80722	D	1	D;P;P	0.59767	0.986;0.932;0.877	P;P;B	0.55871	0.786;0.726;0.255	D	0.88464	0.3057	10	0.87932	D	0	.	17.9568	0.89072	0.0:0.0:1.0:0.0	.	162;162;162	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	D	162	ENSP00000373215:A162D;ENSP00000350632:A162D;ENSP00000283269:A162D;ENSP00000418736:A162D	ENSP00000283269:A162D	A	-	2	0	CADPS	62726656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.398000	0.97281	2.602000	0.87976	0.655000	0.94253	GCT		0.468	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394		25	71	1	0	5.61819e-17	0.005443	9.35384e-17	25	71				
ADAMTS9	56999	broad.mit.edu	37	3	64527523	64527523	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:64527523C>A	ENST00000498707.1	-	33	5530	c.5188G>T	c.(5188-5190)Gtc>Ttc	p.V1730F	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.V1702F	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1730	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1730F(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CAGTTATAGACATTACGGCAG	0.403																																							uc003dmg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|urinary_tract(1)|skin(1)	4						c.(5188-5190)GTC>TTC		ADAM metallopeptidase with thrombospondin type 1							148.0	144.0	145.0					3																	64527523		2203	4300	6503	SO:0001583	missense	56999				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr3:64527523C>A	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5188G>T	3.37:g.64527523C>A	ENSP00000418735:p.Val1730Phe					ADAMTS9_uc011bfo.1_Missense_Mutation_p.V1702F|ADAMTS9_uc011bfp.1_Missense_Mutation_p.V641F	p.V1730F	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)	33	5220	-		Lung NSC(201;0.00682)	1730			TSP type-1 15.		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	c.5188G>T	CCDS2903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.074|8.074	0.770843|0.770843	0.15983|0.15983	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000481060|ENST00000295903;ENST00000498707	.|T;T	.|0.59224	.|0.28;0.3	5.7|5.7	-0.234|-0.234	0.13074|0.13074	.|.	.|0.890859	.|0.09999	.|N	.|0.728661	T|T	0.48892|0.48892	0.1525|0.1525	L|L	0.53617|0.53617	1.68|1.68	0.09310|0.09310	N|N	1|1	.|B;B	.|0.27192	.|0.171;0.087	.|B;B	.|0.25987	.|0.065;0.053	T|T	0.43228|0.43228	-0.9404|-0.9404	5|10	.|0.56958	.|D	.|0.05	.|.	6.643|6.643	0.22919|0.22919	0.0:0.3921:0.1268:0.4812|0.0:0.3921:0.1268:0.4812	.|.	.|1702;1730	.|B7ZVX9;Q9P2N4	.|.;ATS9_HUMAN	I|F	785|1702;1730	.|ENSP00000295903:V1702F;ENSP00000418735:V1730F	.|ENSP00000295903:V1702F	M|V	-|-	3|1	0|0	ADAMTS9|ADAMTS9	64502563|64502563	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.353000|0.353000	0.29299|0.29299	-0.078000|-0.078000	0.11375|0.11375	-0.271000|-0.271000	0.09272|0.09272	-0.383000|-0.383000	0.06682|0.06682	ATG|GTC		0.403	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			26	73	1	0	8.16721e-17	0.002096	1.35623e-16	26	73				
PDZRN3	23024	broad.mit.edu	37	3	73432672	73432672	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:73432672C>A	ENST00000263666.4	-	10	3159	c.3045G>T	c.(3043-3045)atG>atT	p.M1015I	PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Missense_Mutation_p.M737I|PDZRN3_ENST00000462146.2_Missense_Mutation_p.M672I|PDZRN3_ENST00000466780.1_Missense_Mutation_p.M672I|PDZRN3_ENST00000479530.1_Missense_Mutation_p.M732I	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	1015					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M1015I(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CGAGAATGTTCATCTCCTTCC	0.498																																							uc003dpl.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7						c.(3043-3045)ATG>ATT		PDZ domain containing ring finger 3							241.0	242.0	242.0					3																	73432672		2203	4300	6503	SO:0001583	missense	23024						ubiquitin-protein ligase activity|zinc ion binding	g.chr3:73432672C>A	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.3045G>T	3.37:g.73432672C>A	ENSP00000263666:p.Met1015Ile					PDZRN3_uc011bgh.1_Missense_Mutation_p.M672I|PDZRN3_uc010hoe.1_Missense_Mutation_p.M713I|PDZRN3_uc011bgf.1_Missense_Mutation_p.M732I|PDZRN3_uc011bgg.1_Missense_Mutation_p.M735I	p.M1015I	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)	10	3141	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	1015			Potential.		A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	c.3045G>T	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.020|0.020	-1.440151|-1.440151	0.01098|0.01098	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530|ENST00000494559	T;T;T;T;T|.	0.39229|.	1.09;1.09;1.09;1.09;1.09|.	5.34|5.34	3.5|3.5	0.40072|0.40072	.|.	0.639083|.	0.18159|.	N|.	0.149858|.	T|.	0.30355|.	0.0762|.	N|N	0.02539|0.02539	-0.55|-0.55	0.38502|0.38502	D|D	0.948255|0.948255	B;B;B;B|.	0.20988|.	0.0;0.028;0.0;0.05|.	B;B;B;B|.	0.15484|.	0.001;0.009;0.002;0.013|.	T|.	0.12993|.	-1.0526|.	10|.	0.12103|.	T|.	0.63|.	.|.	15.0946|15.0946	0.72223|0.72223	0.0:0.5597:0.4403:0.0|0.0:0.5597:0.4403:0.0	.|.	737;732;732;1015|.	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7|.	.;.;.;PZRN3_HUMAN|.	I|L	1015;737;672;672;732|331	ENSP00000263666:M1015I;ENSP00000442026:M737I;ENSP00000418168:M672I;ENSP00000418484:M672I;ENSP00000418624:M732I|.	ENSP00000263666:M1015I|.	M|X	-|-	3|2	0|2	PDZRN3|PDZRN3	73515362|73515362	1.000000|1.000000	0.71417|0.71417	0.621000|0.621000	0.29145|0.29145	0.006000|0.006000	0.05464|0.05464	1.113000|1.113000	0.31184|0.31184	0.580000|0.580000	0.29522|0.29522	-0.211000|-0.211000	0.12701|0.12701	ATG|TGA		0.498	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		25	218	1	0	3.65163e-15	0.00632	5.87958e-15	25	218				
EPHA6	285220	broad.mit.edu	37	3	97251300	97251300	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:97251300C>A	ENST00000514100.1	+	8	717	c.475C>A	c.(475-477)Caa>Aaa	p.Q159K	EPHA6_ENST00000442602.2_Missense_Mutation_p.Q133K|EPHA6_ENST00000502694.1_Missense_Mutation_p.Q159K|EPHA6_ENST00000389672.5_Missense_Mutation_p.Q767K	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	673	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.Q673K(1)|p.Q767K(1)|p.Q159K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CATGGATCGGCAAAGAAGAGA	0.443																																							uc010how.1		NA																	3	Substitution - Missense(3)		lung(3)	stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(2299-2301)CAA>AAA		EPH receptor A6 isoform a							92.0	90.0	90.0					3																	97251300		1862	4120	5982	SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:97251300C>A	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.475C>A	3.37:g.97251300C>A	ENSP00000421711:p.Gln159Lys					EPHA6_uc011bgo.1_RNA|EPHA6_uc011bgp.1_Missense_Mutation_p.Q133K|EPHA6_uc003drs.3_Missense_Mutation_p.Q159K|EPHA6_uc003drr.3_Missense_Mutation_p.Q159K|EPHA6_uc003drt.2_Missense_Mutation_p.Q159K|EPHA6_uc010hox.1_RNA	p.Q767K	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN			11	2342	+			672			Protein kinase.|Cytoplasmic (Potential).		D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37	c.2299C>A		.	.	.	.	.	.	.	.	.	.	C	34	5.367204	0.95900	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.87313	0.6146	L	0.31664	0.95	0.80722	D	1	D;B;D;D	0.58268	0.98;0.354;0.982;0.964	P;B;D;P	0.70227	0.799;0.213;0.968;0.785	D	0.88126	0.2835	9	0.87932	D	0	.	20.1542	0.98100	0.0:1.0:0.0:0.0	.	133;672;159;159	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	K	767;159;159;133	ENSP00000374323:Q767K;ENSP00000421711:Q159K;ENSP00000423950:Q159K;ENSP00000403100:Q133K	ENSP00000374323:Q767K	Q	+	1	0	EPHA6	98733990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.767000	0.95098	0.563000	0.77884	CAA		0.443	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448		20	40	1	0	8.34094e-07	0.008871	1.02807e-06	20	40				
IMPG2	50939	broad.mit.edu	37	3	100962638	100962638	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:100962638C>A	ENST00000193391.7	-	13	2724	c.2537G>T	c.(2536-2538)gGc>gTc	p.G846V		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	846					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.G846V(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	GTAATCTGTGCCTATCCGGTC	0.443																																							uc003duq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(2536-2538)GGC>GTC		interphotoreceptor matrix proteoglycan 2							190.0	178.0	182.0					3																	100962638		2203	4300	6503	SO:0001583	missense	50939				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity	g.chr3:100962638C>A	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2537G>T	3.37:g.100962638C>A	ENSP00000193391:p.Gly846Val					IMPG2_uc011bhe.1_Missense_Mutation_p.G709V	p.G846V	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN			13	2740	-			846			Extracellular (Potential).		A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	c.2537G>T	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763427	0.49574	.	.	ENSG00000081148	ENST00000193391	T	0.20463	2.07	5.43	3.64	0.41730	.	0.150946	0.46442	D	0.000285	T	0.27798	0.0684	L	0.34521	1.04	0.58432	D	0.999994	D;D	0.58268	0.982;0.982	P;P	0.58172	0.834;0.834	T	0.01557	-1.1325	10	0.72032	D	0.01	-8.8944	10.0234	0.42057	0.0:0.7814:0.0:0.2186	.	846;846	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	V	846	ENSP00000193391:G846V	ENSP00000193391:G846V	G	-	2	0	IMPG2	102445328	0.990000	0.36364	1.000000	0.80357	0.891000	0.51852	1.158000	0.31737	0.663000	0.31027	-0.391000	0.06502	GGC		0.443	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3			37	75	1	0	4.07013e-28	0.00874	7.52501e-28	37	75				
BBX	56987	broad.mit.edu	37	3	107524268	107524268	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:107524268G>T	ENST00000325805.8	+	18	3077	c.2790G>T	c.(2788-2790)ccG>ccT	p.P930P	BBX_ENST00000402543.1_Silent_p.P880P|BBX_ENST00000406780.1_Silent_p.P900P|BBX_ENST00000415149.2_Silent_p.P900P|BBX_ENST00000416476.2_Missense_Mutation_p.R594L			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	930					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P900P(1)		breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			AAGAAATGCCGCAGGCTCCTG	0.443																																							uc010hpr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(2788-2790)CCG>CCT		HMG-BOX transcription factor BBX isoform 1							129.0	132.0	131.0					3																	107524268		2203	4300	6503	SO:0001819	synonymous_variant	56987				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr3:107524268G>T	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.2790G>T	3.37:g.107524268G>T						BBX_uc003dwk.3_Silent_p.P900P|BBX_uc003dwl.3_Missense_Mutation_p.R594L|BBX_uc003dwm.3_Silent_p.P900P|BBX_uc003dwo.3_Missense_Mutation_p.R247L	p.P930P	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.112)		18	3117	+			930					A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Silent	SNP	ENST00000325805.8	37	c.2790G>T	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954429	0.34471	.	.	ENSG00000114439	ENST00000416476	D	0.99051	-5.37	6.16	-2.18	0.07037	.	.	.	.	.	D	0.96144	0.8743	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.87648	0.2526	8	0.87932	D	0	-9.5346	2.4092	0.04420	0.2473:0.2797:0.3439:0.1291	.	594	A2RRM7	.	L	594	ENSP00000403860:R594L	ENSP00000403860:R594L	R	+	2	0	BBX	109006958	0.986000	0.35501	0.980000	0.43619	0.996000	0.88848	0.150000	0.16263	-0.543000	0.06240	-0.269000	0.10298	CGC		0.443	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235		33	82	1	0	6.53348e-20	0.003755	1.13223e-19	33	82				
DZIP3	9666	broad.mit.edu	37	3	108363427	108363427	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:108363427G>T	ENST00000361582.3	+	14	1788	c.1558G>T	c.(1558-1560)Ggt>Tgt	p.G520C	DZIP3_ENST00000463306.1_Missense_Mutation_p.G520C	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	520					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G520C(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TTTGATGAATGGTCTCACTGA	0.403																																							uc003dxd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1558-1560)GGT>TGT		DAZ interacting protein 3, zinc finger							125.0	126.0	126.0					3																	108363427		2203	4300	6503	SO:0001583	missense	9666				protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:108363427G>T	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1558G>T	3.37:g.108363427G>T	ENSP00000355028:p.Gly520Cys					DZIP3_uc003dxf.1_Missense_Mutation_p.G520C|DZIP3_uc011bhm.1_Intron|DZIP3_uc003dxe.1_Missense_Mutation_p.G520C|DZIP3_uc003dxg.1_Missense_Mutation_p.G243C	p.G520C	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN			14	1980	+			520					B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	c.1558G>T	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949316	0.53186	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T	0.18810	2.19;2.19	4.12	4.12	0.48240	.	0.000000	0.47093	D	0.000247	T	0.27765	0.0683	N	0.14661	0.345	0.39453	D	0.967433	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.12889	-1.0530	10	0.87932	D	0	-10.3531	12.1881	0.54252	0.0:0.0:1.0:0.0	.	520;520	C9J9M8;Q86Y13	.;DZIP3_HUMAN	C	520	ENSP00000355028:G520C;ENSP00000419981:G520C	ENSP00000355028:G520C	G	+	1	0	DZIP3	109846117	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.817000	0.55668	2.586000	0.87340	0.650000	0.86243	GGT		0.403	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648		32	83	1	0	4.02929e-09	0.002096	5.4757e-09	32	83				
GUCA1C	9626	broad.mit.edu	37	3	108626994	108626994	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:108626994C>A	ENST00000261047.3	-	4	637	c.505G>T	c.(505-507)Gtt>Ttt	p.V169F	GUCA1C_ENST00000393963.3_Missense_Mutation_p.C182F	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	169					phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)	p.V169F(1)		endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						CTCTTGTAAACAATCTCCAGG	0.418																																					NSCLC(157;1360 1999 30631 40189 44208)	NSCLC(157;1360 1999 30631 40189 44208)	uc003dxj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(505-507)GTT>TTT		guanylate cyclase activator 1C							100.0	96.0	98.0					3																	108626994		2203	4300	6503	SO:0001583	missense	9626				signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity	g.chr3:108626994C>A	AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.505G>T	3.37:g.108626994C>A	ENSP00000261047:p.Val169Phe					GUCA1C_uc003dxk.2_Missense_Mutation_p.C182F	p.V169F	NM_005459	NP_005450	O95843	GUC1C_HUMAN			4	573	-			169					O95844|Q9UNM0	Missense_Mutation	SNP	ENST00000261047.3	37	c.505G>T	CCDS2954.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.91|17.91	3.503618|3.503618	0.64298|0.64298	.|.	.|.	ENSG00000138472|ENSG00000138472	ENST00000393963|ENST00000261047	T|T	0.69806|0.71934	-0.43|-0.61	5.67|5.67	3.58|3.58	0.41010|0.41010	.|.	.|0.428657	.|0.25208	.|N	.|0.032333	T|T	0.58779|0.58779	0.2146|0.2146	L|L	0.34521|0.34521	1.04|1.04	0.58432|0.58432	D|D	0.999999|0.999999	P|D	0.34780|0.60575	0.468|0.988	B|P	0.34180|0.47118	0.177|0.538	T|T	0.61705|0.61705	-0.7008|-0.7008	8|10	.|0.87932	.|D	.|0	.|.	2.8543|2.8543	0.05568|0.05568	0.2517:0.5438:0.0:0.2045|0.2517:0.5438:0.0:0.2045	.|.	182|169	C9JNI2|O95843	.|GUC1C_HUMAN	F|F	182|169	ENSP00000377535:C182F|ENSP00000261047:V169F	.|ENSP00000261047:V169F	C|V	-|-	2|1	0|0	GUCA1C|GUCA1C	110109684|110109684	0.325000|0.325000	0.24660|0.24660	0.194000|0.194000	0.23346|0.23346	0.977000|0.977000	0.68977|0.68977	0.519000|0.519000	0.22862|0.22862	1.359000|1.359000	0.45940|0.45940	0.563000|0.563000	0.77884|0.77884	TGT|GTT		0.418	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353819.1	NM_005459		11	37	1	0	1.36491e-13	0.001855	2.1019e-13	11	37				
IGSF11	152404	broad.mit.edu	37	3	118624546	118624546	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:118624546G>T	ENST00000393775.2	-	5	905	c.600C>A	c.(598-600)gtC>gtA	p.V200V	IGSF11_ENST00000425327.2_Silent_p.V199V|IGSF11_ENST00000354673.2_Silent_p.V199V|IGSF11_ENST00000491903.1_Silent_p.V200V|IGSF11_ENST00000441144.2_Silent_p.V199V|IGSF11_ENST00000489689.1_Silent_p.V200V	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	200	Ig-like C2-type.				cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V199V(1)|p.V200V(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TCCGGATGGTGACTGTTCCCT	0.463																																							uc003ebw.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(598-600)GTC>GTA		immunoglobulin superfamily, member 11 isoform b							105.0	101.0	103.0					3																	118624546		2203	4300	6503	SO:0001819	synonymous_variant	152404				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity	g.chr3:118624546G>T	AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.600C>A	3.37:g.118624546G>T						IGSF11_uc011biv.1_Silent_p.V200V|IGSF11_uc003ebx.2_Silent_p.V200V|IGSF11_uc003eby.2_Silent_p.V199V|IGSF11_uc003ebz.2_Silent_p.V199V|IGSF11_uc010hqs.2_Silent_p.V199V	p.V200V	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN			5	847	-			200			Ig-like C2-type.|Extracellular (Potential).		C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Silent	SNP	ENST00000393775.2	37	c.600C>A	CCDS46891.1																																																																																				0.463	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2			14	40	1	0	7.93312e-07	0.00245	9.79702e-07	14	40				
MYLK	4638	broad.mit.edu	37	3	123452795	123452795	+	Missense_Mutation	SNP	C	C	T	rs532659627		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:123452795C>T	ENST00000475616.1	-	7	1047	c.1048G>A	c.(1048-1050)Gca>Aca	p.A350T	MYLK_ENST00000346322.5_Missense_Mutation_p.A350T|MYLK_ENST00000360304.3_Missense_Mutation_p.A350T|MYLK_ENST00000359169.1_Missense_Mutation_p.A350T|MYLK_ENST00000360772.3_Missense_Mutation_p.A350T			Q15746	MYLK_HUMAN	myosin light chain kinase	350					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.A350T(1)|p.A350P(1)|p.A350S(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TGAACTCTTGCGGCCTGCAGG	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16789	0.0		0.0	False		,,,				2504	0.0						uc003ego.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(6)|skin(2)|stomach(1)	9						c.(1048-1050)GCA>ACA		myosin light chain kinase isoform 1							72.0	79.0	76.0					3																	123452795		2203	4300	6503	SO:0001583	missense	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123452795C>T	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1048G>A	3.37:g.123452795C>T	ENSP00000418335:p.Ala350Thr					MYLK_uc011bjw.1_Missense_Mutation_p.A350T|MYLK_uc003egp.2_Missense_Mutation_p.A350T|MYLK_uc003egq.2_Missense_Mutation_p.A350T|MYLK_uc003egr.2_Missense_Mutation_p.A350T|MYLK_uc003egs.2_Missense_Mutation_p.A174T	p.A350T	NM_053025	NP_444253	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	10	1330	-		Lung NSC(201;0.0496)	350					B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	c.1048G>A	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	9.192	1.026194	0.19512	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.66099	-0.19;-0.14;-0.19;-0.09;-0.14	5.43	-7.78	0.01223	.	.	.	.	.	T	0.36276	0.0961	L	0.27053	0.805	0.09310	N	0.999999	B;B;B;B;B	0.17038	0.02;0.001;0.02;0.0;0.005	B;B;B;B;B	0.13407	0.006;0.001;0.009;0.001;0.001	T	0.20472	-1.0274	9	0.14656	T	0.56	.	4.3246	0.11034	0.1071:0.2038:0.1012:0.5879	.	350;350;350;350;350	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	T	350	ENSP00000354004:A350T;ENSP00000353452:A350T;ENSP00000352088:A350T;ENSP00000320622:A350T;ENSP00000418335:A350T	ENSP00000320622:A350T	A	-	1	0	MYLK	124935485	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.939000	0.03933	-1.950000	0.01030	-0.844000	0.03045	GCA		0.632	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		4	107	0	0	0	0.001168	0	4	107				
IL20RB	53833	broad.mit.edu	37	3	136714381	136714381	+	Missense_Mutation	SNP	G	G	A	rs370491517		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:136714381G>A	ENST00000329582.4	+	6	1057	c.808G>A	c.(808-810)Gtc>Atc	p.V270I	IL20RB_ENST00000309741.5_3'UTR	NM_144717.3	NP_653318.2	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta	270					homeostasis of number of cells within a tissue (GO:0048873)|immune response-inhibiting signal transduction (GO:0002765)|inflammatory response to antigenic stimulus (GO:0002437)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of type IV hypersensitivity (GO:0001808)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-4 production (GO:0032753)	integral component of membrane (GO:0016021)		p.V270I(2)		kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14						CCCCGTGGTGGTCCTCCCAGA	0.512																																							uc003eri.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(808-810)GTC>ATC		interleukin 20 receptor beta precursor		G	ILE/VAL	0,4406		0,0,2203	251.0	252.0	251.0		808	4.8	1.0	3		251	1,8599	1.2+/-3.3	0,1,4299	no	missense	IL20RB	NM_144717.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	270/312	136714381	1,13005	2203	4300	6503	SO:0001583	missense	53833					integral to membrane	receptor activity	g.chr3:136714381G>A	BC033292	CCDS3093.1	3q22.3	2013-02-11			ENSG00000174564	ENSG00000174564		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	6004	protein-coding gene	gene with protein product		605621	"""fibronectin type III domain containing 6"""	FNDC6		11163236, 16703417	Standard	NM_144717		Approved	DIRS1, IL-20R2, MGC34923	uc003eri.2	Q6UXL0	OTTHUMG00000159779	ENST00000329582.4:c.808G>A	3.37:g.136714381G>A	ENSP00000328133:p.Val270Ile					IL20RB_uc003erj.1_RNA|IL20RB_uc010hud.1_Missense_Mutation_p.V128I	p.V270I	NM_144717	NP_653318	Q6UXL0	I20RB_HUMAN			6	1057	+			270			Cytoplasmic (Potential).		B4DL40|Q6P438|Q8IYY5|Q8TAJ7	Missense_Mutation	SNP	ENST00000329582.4	37	c.808G>A	CCDS3093.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.612585	0.46631	0.0	1.16E-4	ENSG00000174564	ENST00000329582	T	0.52983	0.64	5.73	4.84	0.62591	.	0.251123	0.20491	U	0.091296	T	0.33059	0.0850	L	0.32530	0.975	0.80722	D	1	B	0.32573	0.376	B	0.23716	0.048	T	0.12218	-1.0556	10	0.38643	T	0.18	-2.4456	9.972	0.41761	0.0961:0.0:0.9039:0.0	.	270	Q6UXL0	I20RB_HUMAN	I	270	ENSP00000328133:V270I	ENSP00000328133:V270I	V	+	1	0	IL20RB	138197071	1.000000	0.71417	0.980000	0.43619	0.769000	0.43574	1.522000	0.35921	1.390000	0.46547	0.643000	0.83706	GTC		0.512	IL20RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357277.2	NM_144717		62	198	0	0	0	0.00361	0	62	198				
ARMC8	25852	broad.mit.edu	37	3	137960639	137960639	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:137960639G>T	ENST00000469044.1	+	11	1123	c.852G>T	c.(850-852)ttG>ttT	p.L284F	ARMC8_ENST00000489213.1_Missense_Mutation_p.L242F|ARMC8_ENST00000470821.1_Missense_Mutation_p.L284F|ARMC8_ENST00000481646.1_Missense_Mutation_p.L270F|ARMC8_ENST00000393058.3_Missense_Mutation_p.L274F|ARMC8_ENST00000485396.1_Missense_Mutation_p.L211F|ARMC8_ENST00000538260.1_Missense_Mutation_p.L253F|ARMC8_ENST00000471453.1_Missense_Mutation_p.L270F|ARMC8_ENST00000358441.2_Missense_Mutation_p.L270F|ARMC8_ENST00000461822.1_Intron|ARMC8_ENST00000491704.1_Missense_Mutation_p.L242F	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	284								p.L270F(2)		endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						TACCTTGTTTGGTTCGAATGT	0.378																																							uc003esa.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(808-810)TTG>TTT		armadillo repeat containing 8 isoform 2							117.0	106.0	110.0					3																	137960639		2203	4300	6503	SO:0001583	missense	25852						binding	g.chr3:137960639G>T		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.852G>T	3.37:g.137960639G>T	ENSP00000419413:p.Leu284Phe					ARMC8_uc003erw.2_Missense_Mutation_p.L270F|ARMC8_uc003erx.2_Missense_Mutation_p.L270F|ARMC8_uc003ery.2_Missense_Mutation_p.L242F|ARMC8_uc003erz.2_Missense_Mutation_p.L242F|ARMC8_uc011bmf.1_Missense_Mutation_p.L253F|ARMC8_uc011bmg.1_Intron|ARMC8_uc011bmh.1_Missense_Mutation_p.L211F|ARMC8_uc003esb.1_Missense_Mutation_p.L242F|ARMC8_uc003esc.1_Missense_Mutation_p.L42F	p.L270F	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN			12	1177	+			284			ARM 6.		A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	ENST00000469044.1	37	c.810G>T		.	.	.	.	.	.	.	.	.	.	G	22.5	4.301870	0.81136	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000358441;ENST00000489213;ENST00000485396;ENST00000471453;ENST00000470821;ENST00000538260;ENST00000393058;ENST00000463485;ENST00000539459	T;T;T;T;T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.01;-0.01;-0.51;-0.01;-0.01;-0.53;-0.8;0.48	5.8	5.8	0.92144	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85906	0.5806	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.995;0.992;0.999;0.999	D;D;D;P;D;D	0.87578	0.988;0.995;0.969;0.9;0.994;0.998	D	0.86694	0.1925	10	0.87932	D	0	.	17.546	0.87861	0.0:0.0:1.0:0.0	.	211;253;284;270;284;270	B7Z637;F5GWK4;Q8IUR7;Q8IUR7-2;G5E9V6;Q8IUR7-6	.;.;ARMC8_HUMAN;.;.;.	F	270;284;242;270;242;211;270;284;253;274;178;141	ENSP00000420333:L270F;ENSP00000419413:L284F;ENSP00000417304:L242F;ENSP00000351221:L270F;ENSP00000418412:L242F;ENSP00000417049:L211F;ENSP00000420440:L270F;ENSP00000418405:L284F;ENSP00000441592:L253F;ENSP00000376778:L274F;ENSP00000417403:L178F	ENSP00000351221:L270F	L	+	3	2	ARMC8	139443329	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.963000	0.49184	2.737000	0.93849	0.563000	0.77884	TTG		0.378	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396		21	37	1	0	8.10497e-08	0.010504	1.03509e-07	21	37				
P2RY1	5028	broad.mit.edu	37	3	152554645	152554645	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:152554645C>T	ENST00000305097.3	+	1	1910	c.1074C>T	c.(1072-1074)acC>acT	p.T358T	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	358					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)	p.T358T(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AAGACATGACCCTCAATATTT	0.438																																							uc003ezq.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(1072-1074)ACC>ACT		purinergic receptor P2Y1							42.0	44.0	43.0					3																	152554645		2201	4298	6499	SO:0001819	synonymous_variant	5028				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:152554645C>T	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.1074C>T	3.37:g.152554645C>T							p.T358T	NM_002563	NP_002554	P47900	P2RY1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)		1	1910	+			358			Cytoplasmic (Potential).			Silent	SNP	ENST00000305097.3	37	c.1074C>T	CCDS3169.1																																																																																				0.438	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563		20	33	0	0	0	0.007413	0	20	33				
GPR149	344758	broad.mit.edu	37	3	154147360	154147360	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:154147360C>A	ENST00000389740.2	-	1	144	c.45G>T	c.(43-45)ctG>ctT	p.L15L		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	15					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L15L(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCTCTTTCCACAGGCTAGAGT	0.353																																							uc003faa.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)	6						c.(43-45)CTG>CTT		G protein-coupled receptor 149							78.0	77.0	77.0					3																	154147360		1827	4091	5918	SO:0001819	synonymous_variant	344758					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:154147360C>A	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.45G>T	3.37:g.154147360C>A							p.L15L	NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		1	145	-			15			Extracellular (Potential).			Silent	SNP	ENST00000389740.2	37	c.45G>T	CCDS43162.1																																																																																				0.353	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580		23	56	1	0	6.12954e-19	0.004656	1.05078e-18	23	56				
IQCJ	654502	broad.mit.edu	37	3	158983125	158983125	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:158983125C>T	ENST00000451172.1	+	5	518	c.413C>T	c.(412-414)cCc>cTc	p.P138L	IQCJ_ENST00000482126.1_Missense_Mutation_p.P111L|IQCJ-SCHIP1_ENST00000467442.1_Intron|IQCJ-SCHIP1_ENST00000485419.1_Intron|IQCJ-SCHIP1_ENST00000476809.1_Intron	NM_001042705.2	NP_001036170.1	Q1A5X6	IQCJ_HUMAN	IQ motif containing J	138								p.P138L(1)		cervix(1)|endometrium(2)|large_intestine(2)|lung(10)	15			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CTTGCCAGACCCACTGGGTTC	0.483																																							uc003fcp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(412-414)CCC>CTC		IQ motif containing J isoform CaMBPv1							125.0	121.0	123.0					3																	158983125		1899	4127	6026	SO:0001583	missense	654502							g.chr3:158983125C>T	DQ309553, DQ309554	CCDS46946.1, CCDS46947.1, CCDS56290.1	3q25.32	2011-03-24			ENSG00000214216	ENSG00000214216			32406	protein-coding gene	gene with protein product		611622				17045569	Standard	NM_001042705		Approved			Q1A5X6	OTTHUMG00000166440	ENST00000451172.1:c.413C>T	3.37:g.158983125C>T	ENSP00000402153:p.Pro138Leu					SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|IQCJ_uc010hvy.1_Missense_Mutation_p.P111L	p.P138L	NM_001042705	NP_001036170	Q1A5X6	IQCJ_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)		5	518	+			138					B7ZMM2|B9EH97|Q1A5X5	Missense_Mutation	SNP	ENST00000451172.1	37	c.413C>T	CCDS46946.1	.	.	.	.	.	.	.	.	.	.	C	3.780	-0.045852	0.07452	.	.	ENSG00000214216	ENST00000451172;ENST00000482126	.	.	.	3.25	-0.907	0.10521	.	.	.	.	.	T	0.12518	0.0304	N	0.12182	0.205	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.09377	0.004;0.004	T	0.28839	-1.0031	8	0.02654	T	1	.	0.4372	0.00480	0.2115:0.3482:0.19:0.2502	.	111;138	B7ZMM2;Q1A5X6	.;IQCJ_HUMAN	L	138;111	.	ENSP00000402153:P138L	P	+	2	0	IQCJ	160465819	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.546000	0.06062	-0.214000	0.10078	0.491000	0.48974	CCC		0.483	IQCJ-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352395.1	NM_001042705.1		18	58	0	0	0	0.00499	0	18	58				
SLITRK3	22865	broad.mit.edu	37	3	164908507	164908507	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:164908507C>G	ENST00000475390.1	-	2	555	c.112G>C	c.(112-114)Gag>Cag	p.E38Q	SLITRK3_ENST00000241274.3_Missense_Mutation_p.E38Q			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	38					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.E38Q(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TCTATTTCCTCTGAGTCCTCT	0.398										HNSCC(40;0.11)																													uc003fej.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)	10						c.(112-114)GAG>CAG		slit and trk like 3 protein precursor							112.0	111.0	111.0					3																	164908507		2203	4300	6503	SO:0001583	missense	22865					integral to membrane		g.chr3:164908507C>G	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.112G>C	3.37:g.164908507C>G	ENSP00000420091:p.Glu38Gln	HNSCC(40;0.11)				SLITRK3_uc003fek.2_Missense_Mutation_p.E38Q	p.E38Q	NM_014926	NP_055741	O94933	SLIK3_HUMAN			2	556	-			38			Extracellular (Potential).		Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.112G>C	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285296	0.59867	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.69685	0.57;0.57;-0.42	6.01	6.01	0.97437	.	0.000000	0.38217	N	0.001766	T	0.60881	0.2303	L	0.33485	1.01	0.45066	D	0.998083	B	0.21452	0.056	B	0.19148	0.024	T	0.54529	-0.8280	10	0.51188	T	0.08	-17.8271	20.5182	0.99214	0.0:1.0:0.0:0.0	.	38	O94933	SLIK3_HUMAN	Q	38	ENSP00000420091:E38Q;ENSP00000241274:E38Q;ENSP00000419611:E38Q	ENSP00000241274:E38Q	E	-	1	0	SLITRK3	166391201	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.041000	0.70988	2.860000	0.98153	0.655000	0.94253	GAG		0.398	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		18	59	0	0	0	0.010504	0	18	59				
MSANTD1	345222	broad.mit.edu	37	4	3255175	3255175	+	Missense_Mutation	SNP	G	G	T	rs138360402		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:3255175G>T	ENST00000438480.2	+	2	2309	c.562G>T	c.(562-564)Gac>Tac	p.D188Y	MSANTD1_ENST00000510580.1_Missense_Mutation_p.D188Y|MSANTD1_ENST00000507492.1_Missense_Mutation_p.D175Y	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	188								p.D188Y(2)		endometrium(1)|lung(2)	3						TGATCGCTCCGACAGCTCCTC	0.587																																							uc003ggs.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(562-564)GAC>TAC		hypothetical protein LOC345222 isoform a							151.0	140.0	144.0					4																	3255175		2203	4300	6503	SO:0001583	missense	345222							g.chr4:3255175G>T		CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.562G>T	4.37:g.3255175G>T	ENSP00000411584:p.Asp188Tyr					C4orf44_uc003ggt.2_Missense_Mutation_p.D188Y	p.D188Y	NM_001042690	NP_001036155	Q6ZTZ1	CD044_HUMAN			2	745	+			188					C9J6V0	Missense_Mutation	SNP	ENST00000438480.2	37	c.562G>T	CCDS47003.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736752	0.69304	.	.	ENSG00000188981	ENST00000507492;ENST00000438480;ENST00000510580	.	.	.	5.31	4.45	0.53987	.	1.026730	0.07729	N	0.944930	T	0.66963	0.2843	L	0.40543	1.245	0.38891	D	0.957124	D;D	0.60575	0.988;0.985	P;P	0.57324	0.752;0.818	T	0.60419	-0.7267	9	0.72032	D	0.01	.	14.3507	0.66699	0.0:0.0:0.8507:0.1493	.	188;188	D6RD98;Q6ZTZ1	.;CD044_HUMAN	Y	175;188;188	.	ENSP00000411584:D188Y	D	+	1	0	C4orf44	3224973	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.160000	0.50739	1.225000	0.43566	0.558000	0.71614	GAC		0.587	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982		50	96	1	0	4.0181e-32	0.00361	7.47226e-32	50	96				
ADRA2C	152	broad.mit.edu	37	4	3769638	3769638	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:3769638C>A	ENST00000330055.5	+	1	1514	c.1305C>A	c.(1303-1305)gtC>gtA	p.V435V	ADRA2C_ENST00000509482.1_Intron	NM_000683.3	NP_000674.2	P18825	ADA2C_HUMAN	adrenoceptor alpha 2C	435					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|platelet activation (GO:0030168)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of vasoconstriction (GO:0045907)|regulation of insulin secretion (GO:0050796)|regulation of sensory perception of pain (GO:0051930)|small molecule metabolic process (GO:0044281)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V435V(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Fenoldopam(DB00800)|Iloperidone(DB04946)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCAACCCGGTCATCTACACGG	0.602																																					Esophageal Squamous(12;454 628 4517 14479)	Esophageal Squamous(12;454 628 4517 14479)	uc003ghm.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1303-1305)GTC>GTA		alpha-2C-adrenergic receptor	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)						28.0	33.0	31.0					4																	3769638		2187	4293	6480	SO:0001819	synonymous_variant	152				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity	g.chr4:3769638C>A	AY455666	CCDS47004.1	4p16.3	2013-10-22	2012-05-09		ENSG00000184160	ENSG00000184160		"""GPCR / Class A : Adrenoceptors : alpha"""	283	protein-coding gene	gene with protein product		104250	"""adrenergic, alpha-2C-, receptor"""	ADRA2L2, ADRA2RL2		1849485	Standard	NM_000683		Approved	ADRARL2	uc003ghm.3	P18825	OTTHUMG00000159830	ENST00000330055.5:c.1305C>A	4.37:g.3769638C>A						ADRA2C_uc010icx.2_Intron	p.V435V	NM_000683	NP_000674	P18825	ADA2C_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	1	1343	+			435			Helical; Name=7; (By similarity).		P35369|Q9HB49	Silent	SNP	ENST00000330055.5	37	c.1305C>A	CCDS47004.1																																																																																				0.602	ADRA2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357607.1	NM_000683		3	22	1	0	0.00909568	0.009096	0.00960939	3	22				
EVC2	132884	broad.mit.edu	37	4	5570329	5570330	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:5570329_5570330CA>AT	ENST00000344408.5	-	20	3451_3452	c.3398_3399TG>AT	c.(3397-3399)aTG>aAT	p.M1133N	EVC2_ENST00000344938.1_Missense_Mutation_p.M1133N|EVC2_ENST00000310917.2_Missense_Mutation_p.M1053N	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	1133					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.M1133N(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CCCCGGGCACCATGGCCATCCT	0.604																																							uc003gij.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(2)	5						c.(3397-3399)ATG>AAT		limbin																																				SO:0001583	missense	132884					integral to membrane		g.chr4:5570329_5570330CA>AT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.3398_3399delinsAT	4.37:g.5570329_5570330delinsAT	ENSP00000342144:p.Met1133Asn					EVC2_uc011bwb.1_Missense_Mutation_p.M573N|EVC2_uc003gik.2_Missense_Mutation_p.M1053N	p.M1133N	NM_147127	NP_667338	Q86UK5	LBN_HUMAN			20	3452_3453	-			1133					Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	DNP	ENST00000344408.5	37	c.3398_3399TG>AT	CCDS3382.2																																																																																				0.604	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		7	8	0	0	0	0.004672	0	7	8				
ABLIM2	84448	broad.mit.edu	37	4	8082493	8082493	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:8082493T>A	ENST00000341937.5	-	5	555	c.491A>T	c.(490-492)cAg>cTg	p.Q164L	ABLIM2_ENST00000296372.8_Missense_Mutation_p.Q164L|ABLIM2_ENST00000447017.2_Missense_Mutation_p.Q164L|ABLIM2_ENST00000545242.1_Missense_Mutation_p.Q164L|ABLIM2_ENST00000428004.2_Missense_Mutation_p.Q164L|ABLIM2_ENST00000505872.1_Missense_Mutation_p.Q164L|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000407564.3_Missense_Mutation_p.Q164L|ABLIM2_ENST00000361737.5_Missense_Mutation_p.Q164L|ABLIM2_ENST00000546334.1_Missense_Mutation_p.Q164L|ABLIM2_ENST00000361581.5_Missense_Mutation_p.Q164L	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	164	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)	p.Q164L(1)		NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						TACCAGGGCCTGGCCATTCTT	0.552																																							uc003gko.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(3)	3						c.(490-492)CAG>CTG		actin binding LIM protein family, member 2							71.0	76.0	75.0					4																	8082493		1959	4147	6106	SO:0001583	missense	84448				axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding	g.chr4:8082493T>A	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.491A>T	4.37:g.8082493T>A	ENSP00000342813:p.Gln164Leu					ABLIM2_uc003gkj.3_Missense_Mutation_p.Q164L|ABLIM2_uc003gkm.3_Missense_Mutation_p.Q164L|ABLIM2_uc003gkp.2_Missense_Mutation_p.Q164L|ABLIM2_uc003gkq.2_Missense_Mutation_p.Q164L|ABLIM2_uc003gkr.2_Missense_Mutation_p.Q164L|ABLIM2_uc003gks.3_Missense_Mutation_p.Q164L|ABLIM2_uc011bwl.1_Missense_Mutation_p.Q169L	p.Q164L	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN			5	634	-			164			LIM zinc-binding 3.		E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Missense_Mutation	SNP	ENST00000341937.5	37	c.491A>T	CCDS47013.1	.	.	.	.	.	.	.	.	.	.	T	19.45	3.830055	0.71258	.	.	ENSG00000163995	ENST00000361737;ENST00000400045;ENST00000296372;ENST00000545242;ENST00000546334;ENST00000447017;ENST00000341937;ENST00000361581;ENST00000407564;ENST00000505872;ENST00000428004	D;D;D;D;D;D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	3.84	3.84	0.44239	Zinc finger, LIM-type (5);	0.123452	0.56097	D	0.000028	D	0.93245	0.7848	M	0.86028	2.79	0.80722	D	1	D;D;D;P;D;D;D;D	0.76494	0.973;0.97;0.999;0.931;0.995;0.997;0.983;0.972	P;D;D;P;D;D;P;D	0.77557	0.725;0.939;0.988;0.773;0.99;0.967;0.82;0.909	D	0.94109	0.7369	10	0.87932	D	0	.	12.7988	0.57573	0.0:0.0:0.0:1.0	.	169;164;164;164;164;164;164;164	B7Z6W4;Q6H8Q1-6;Q08E71;Q6H8Q1-2;Q6H8Q1-3;Q6H8Q1;Q19VH0;E9PF39	.;.;.;.;.;ABLM2_HUMAN;.;.	L	164	ENSP00000354887:Q164L;ENSP00000296372:Q164L;ENSP00000441255:Q164L;ENSP00000444365:Q164L;ENSP00000393511:Q164L;ENSP00000342813:Q164L;ENSP00000355003:Q164L;ENSP00000384658:Q164L;ENSP00000421283:Q164L;ENSP00000389410:Q164L	ENSP00000296372:Q164L	Q	-	2	0	ABLIM2	8133393	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	4.407000	0.59754	1.613000	0.50231	0.374000	0.22700	CAG		0.552	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083		12	15	0	0	0	0.001368	0	12	15				
BST1	683	broad.mit.edu	37	4	15724522	15724522	+	Silent	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:15724522G>C	ENST00000265016.4	+	8	1011	c.816G>C	c.(814-816)gtG>gtC	p.V272V	BST1_ENST00000382346.3_Silent_p.V287V	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	272					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)	p.V272V(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						TACAGTGCGTGGACCACAGCA	0.373																																							uc003goh.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(814-816)GTG>GTC		bone marrow stromal cell antigen 1 precursor							132.0	128.0	129.0					4																	15724522		2203	4300	6503	SO:0001819	synonymous_variant	683				humoral immune response|multicellular organismal development	anchored to membrane|extrinsic to membrane|plasma membrane	binding|NAD+ nucleosidase activity	g.chr4:15724522G>C	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.816G>C	4.37:g.15724522G>C						BST1_uc003goi.2_Silent_p.V83V	p.V272V	NM_004334	NP_004325	Q10588	BST1_HUMAN			8	1011	+			272					B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Silent	SNP	ENST00000265016.4	37	c.816G>C	CCDS3416.1	.	.	.	.	.	.	.	.	.	.	G	9.298	1.052439	0.19907	.	.	ENSG00000109743	ENST00000505785;ENST00000514989	.	.	.	5.24	3.51	0.40186	.	.	.	.	.	T	0.57784	0.2077	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51458	-0.8703	4	.	.	.	-27.0808	8.0836	0.30758	0.1875:0.0:0.8125:0.0	.	.	.	.	S	168;80	.	.	W	+	2	0	BST1	15333620	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	2.737000	0.47393	0.594000	0.29761	0.555000	0.69702	TGG		0.373	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214968.2	NM_004334		17	61	0	0	0	0.007413	0	17	61				
LCORL	254251	broad.mit.edu	37	4	17910869	17910869	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:17910869C>A	ENST00000382226.5	-	5	638	c.530G>T	c.(529-531)gGt>gTt	p.G177V	LCORL_ENST00000326877.4_Missense_Mutation_p.G177V|LCORL_ENST00000539056.1_Missense_Mutation_p.G90V|LCORL_ENST00000382224.1_Missense_Mutation_p.G93V	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	177					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G177V(2)		kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						TTGAGTTTTACCACTTTTTGA	0.363																																							uc003gpq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(529-531)GGT>GTT		ligand dependent nuclear receptor							135.0	125.0	128.0					4																	17910869		2203	4300	6503	SO:0001583	missense	254251				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr4:17910869C>A		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.530G>T	4.37:g.17910869C>A	ENSP00000371661:p.Gly177Val					LCORL_uc011bxk.1_Missense_Mutation_p.G90V	p.G177V	NM_153686	NP_710153	Q8N3X6	LCORL_HUMAN			5	541	-			177					Q96NK1	Missense_Mutation	SNP	ENST00000382226.5	37	c.530G>T	CCDS54749.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315802	0.60524	.	.	ENSG00000178177	ENST00000326877;ENST00000539056;ENST00000382224;ENST00000382226	.	.	.	5.43	4.58	0.56647	.	0.495582	0.23201	N	0.050793	T	0.51210	0.1661	N	0.14661	0.345	0.50632	D	0.999884	D;P	0.56746	0.977;0.498	P;B	0.55923	0.787;0.347	T	0.56944	-0.7895	9	0.51188	T	0.08	.	16.0897	0.81084	0.0:0.8656:0.1344:0.0	.	90;177	B4DSW0;Q8N3X6-3	.;.	V	177;90;93;177	.	ENSP00000317566:G177V	G	-	2	0	LCORL	17519967	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	4.391000	0.59652	1.272000	0.44329	-0.282000	0.10007	GGT		0.363	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_153686		19	55	1	0	2.39187e-15	0.008871	3.88668e-15	19	55				
GBA3	57733	broad.mit.edu	37	4	22737808	22737808	+	RNA	SNP	C	C	A	rs529839966		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:22737808C>A	ENST00000503442.1	+	0	354				GBA3_ENST00000511446.2_RNA|GBA3_ENST00000508166.1_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)	p.T88K(1)		breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCTGATGGGACGACAGGTTTC	0.413																																							uc003gqp.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(262-264)ACG>AAG		cytosolic beta-glucosidase isoform a							132.0	131.0	131.0					4																	22737808		1880	4112	5992			57733				glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity	g.chr4:22737808C>A	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22737808C>A						GBA3_uc010iep.2_Missense_Mutation_p.T88K|GBA3_uc011bxo.1_Missense_Mutation_p.T89K	p.T88K	NM_020973	NP_066024	Q9H227	GBA3_HUMAN			2	354	+			88					Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Missense_Mutation	SNP	ENST00000503442.1	37	c.263C>A																																																																																					0.413	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2			28	90	1	0	1.39806e-14	0.008361	2.22848e-14	28	90				
GBA3	57733	broad.mit.edu	37	4	22820507	22820507	+	RNA	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:22820507C>A	ENST00000503442.1	+	0	541				GBA3_ENST00000511446.2_RNA|GBA3_ENST00000508264.1_RNA|GBA3_ENST00000508166.1_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AGGAATAAGCCAAGATCATCC	0.498																																							uc003gqp.3		NA																	0					0						c.(1369-1371)GCC>GCA		cytosolic beta-glucosidase isoform a							96.0	84.0	88.0					4																	22820507		1931	4131	6062			57733				glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity	g.chr4:22820507C>A	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22820507C>A						GBA3_uc010iep.2_Silent_p.A150A|GBA3_uc011bxo.1_3'UTR	p.A457A	NM_020973	NP_066024	Q9H227	GBA3_HUMAN			6	1462	+			457					Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Silent	SNP	ENST00000503442.1	37	c.1371C>A																																																																																					0.498	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2			6	19	1	0	3.59834e-05	0.001168	4.21463e-05	6	19				
GRXCR1	389207	broad.mit.edu	37	4	43032469	43032470	+	Missense_Mutation	DNP	GA	GA	TT	rs146696590	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:43032469_43032470GA>TT	ENST00000399770.2	+	4	785_786	c.785_786GA>TT	c.(784-786)cGA>cTT	p.R262L		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	262					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)	p.R262L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						TCCATGTTTCGAAACTGCTTCA	0.47																																							uc003gwt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(784-786)CGA>CTT		glutaredoxin, cysteine rich 1																																				SO:0001583	missense	389207				cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity	g.chr4:43032469_43032470GA>TT		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	Exception_encountered	4.37:g.43032469_43032470delinsTT	ENSP00000382670:p.Arg262Leu						p.R262L	NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN			4	785_786	+			262						Missense_Mutation	DNP	ENST00000399770.2	37	c.785_786GA>TT	CCDS43225.1																																																																																				0.470	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476		50	99	0	0	0	0.004672	0	50	99				
KDR	3791	broad.mit.edu	37	4	55946163	55946163	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:55946163G>T	ENST00000263923.4	-	30	4311	c.4016C>A	c.(4015-4017)aCa>aAa	p.T1339K	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1339					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.T1339K(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATCTGGGCTGTGCTACCGGT	0.522			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																													uc003has.2		NA		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		1	Substitution - Missense(1)		lung(1)	lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(4015-4017)ACA>AAA		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						215.0	200.0	205.0					4																	55946163		2203	4300	6503	SO:0001583	missense	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55946163G>T	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.4016C>A	4.37:g.55946163G>T	ENSP00000263923:p.Thr1339Lys	TSP Lung(20;0.16)				KDR_uc003hat.1_Missense_Mutation_p.T1339K	p.T1339K	NM_002253	NP_002244	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		30	4318	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		1339			Cytoplasmic (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	c.4016C>A	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.663738	0.00772	.	.	ENSG00000128052	ENST00000263923	T	0.74947	-0.89	5.09	3.24	0.37175	.	1.368110	0.04471	N	0.376018	T	0.56426	0.1984	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.41466	-0.9507	10	0.05959	T	0.93	.	9.0592	0.36425	0.2528:0.0:0.7472:0.0	.	1339	P35968	VGFR2_HUMAN	K	1339	ENSP00000263923:T1339K	ENSP00000263923:T1339K	T	-	2	0	KDR	55640920	0.003000	0.15002	0.002000	0.10522	0.000000	0.00434	1.264000	0.33015	1.065000	0.40693	-0.355000	0.07637	ACA		0.522	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			34	100	1	0	6.84511e-11	0.003271	9.84953e-11	34	100				
KDR	3791	broad.mit.edu	37	4	55976691	55976691	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:55976691T>A	ENST00000263923.4	-	9	1429	c.1134A>T	c.(1132-1134)aaA>aaT	p.K378N		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	378	Ig-like C2-type 4.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.K378N(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CATGCCCCGCTTTAATTGTGT	0.388			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																													uc003has.2		NA		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		1	Substitution - Missense(1)		lung(1)	lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(1132-1134)AAA>AAT		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						104.0	96.0	98.0					4																	55976691		2203	4300	6503	SO:0001583	missense	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55976691T>A	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1134A>T	4.37:g.55976691T>A	ENSP00000263923:p.Lys378Asn	TSP Lung(20;0.16)				KDR_uc003hat.1_Missense_Mutation_p.K378N|KDR_uc011bzx.1_Missense_Mutation_p.K378N	p.K378N	NM_002253	NP_002244	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		9	1436	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		378			Ig-like C2-type 4.|Extracellular (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	c.1134A>T	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	T	10.74	1.435089	0.25813	.	.	ENSG00000128052	ENST00000263923	T	0.68624	-0.34	5.65	-1.66	0.08265	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.328521	0.32488	N	0.006038	T	0.49795	0.1578	L	0.52573	1.65	0.32887	D	0.511385	P;P	0.41848	0.763;0.601	B;B	0.41894	0.369;0.312	T	0.51841	-0.8654	10	0.19147	T	0.46	.	1.9791	0.03422	0.1207:0.2841:0.1246:0.4706	.	378;378	P35968-2;P35968	.;VGFR2_HUMAN	N	378	ENSP00000263923:K378N	ENSP00000263923:K378N	K	-	3	2	KDR	55671448	0.949000	0.32298	0.622000	0.29159	0.018000	0.09664	0.329000	0.19698	-0.153000	0.11137	0.460000	0.39030	AAA		0.388	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			25	40	0	0	0	0.005443	0	25	40				
LPHN3	23284	broad.mit.edu	37	4	62599218	62599218	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:62599218A>C	ENST00000514591.1	+	7	1470	c.1141A>C	c.(1141-1143)Aac>Cac	p.N381H	LPHN3_ENST00000508946.1_Missense_Mutation_p.N381H|LPHN3_ENST00000506746.1_Missense_Mutation_p.N449H|LPHN3_ENST00000504896.1_Missense_Mutation_p.N381H|LPHN3_ENST00000507164.1_Missense_Mutation_p.N449H|LPHN3_ENST00000509896.1_Missense_Mutation_p.N449H|LPHN3_ENST00000514157.1_Missense_Mutation_p.N381H|LPHN3_ENST00000506720.1_Missense_Mutation_p.N449H|LPHN3_ENST00000508693.1_Missense_Mutation_p.N449H|LPHN3_ENST00000545650.1_Missense_Mutation_p.N381H|LPHN3_ENST00000506700.1_Missense_Mutation_p.N381H|LPHN3_ENST00000514996.1_Missense_Mutation_p.N381H|LPHN3_ENST00000507625.1_Missense_Mutation_p.N449H|LPHN3_ENST00000511324.1_Missense_Mutation_p.N449H|LPHN3_ENST00000512091.2_Missense_Mutation_p.N381H			Q9HAR2	LPHN3_HUMAN	latrophilin 3	381	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.N381H(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TGTATGGAATAACTATCACGT	0.393																																							uc010ihh.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(1141-1143)AAC>CAC		latrophilin 3 precursor							66.0	59.0	62.0					4																	62599218		1852	4104	5956	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62599218A>C	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1141A>C	4.37:g.62599218A>C	ENSP00000422533:p.Asn381His					LPHN3_uc003hcq.3_Missense_Mutation_p.N381H|LPHN3_uc010ihg.1_Missense_Mutation_p.N449H|LPHN3_uc003hcs.1_Missense_Mutation_p.N210H	p.N381H	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			5	1314	+			381			Extracellular (Potential).|Olfactomedin-like.		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.1141A>C	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.410477	0.62399	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.96275	0.8785	M	0.92077	3.27	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.91635	0.999;0.999;0.994	D	0.97195	0.9860	10	0.87932	D	0	.	14.4261	0.67218	1.0:0.0:0.0:0.0	.	381;449;381	E9PE04;E7EN28;Q9HAR2-2	.;.;.	H	381;381;449;449;381;381;381;381;381;449;449;449;381;381;381;449;449;381	ENSP00000423388:N381H;ENSP00000422533:N381H;ENSP00000423787:N449H;ENSP00000425033:N449H;ENSP00000424120:N381H;ENSP00000439831:N381H;ENSP00000421476:N449H;ENSP00000424030:N449H;ENSP00000421372:N449H;ENSP00000425201:N381H;ENSP00000423434:N381H;ENSP00000421627:N381H;ENSP00000420931:N449H;ENSP00000425884:N449H;ENSP00000424258:N381H	ENSP00000280009:N381H	N	+	1	0	LPHN3	62281813	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.962000	0.93254	1.999000	0.58509	0.455000	0.32223	AAC		0.393	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			5	22	0	0	0	0.001168	0	5	22				
TMPRSS11E	28983	broad.mit.edu	37	4	69342097	69342097	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:69342097C>T	ENST00000305363.4	+	7	712	c.648C>T	c.(646-648)cgC>cgT	p.R216R		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	216	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R216R(1)		endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						GGAGTCATCGCTGTGGAGCAA	0.488																																							uc003hdz.3		NA																	1	Substitution - coding silent(1)		lung(1)		NA						c.(646-648)CGC>CGT		transmembrane protease, serine 11E							218.0	207.0	211.0					4																	69342097		2203	4300	6503	SO:0001819	synonymous_variant	0							g.chr4:69342097C>T	AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.648C>T	4.37:g.69342097C>T							p.R216R	NM_014058	NP_054777					7	712	+								A6NL71|Q14DC8|Q6UW31	Silent	SNP	ENST00000305363.4	37	c.648C>T	CCDS33993.1																																																																																				0.488	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360584.1	NM_014058		19	35	0	0	0	0.008871	0	19	35				
PKD2	5311	broad.mit.edu	37	4	88973291	88973291	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:88973291T>A	ENST00000237596.2	+	7	1763	c.1697T>A	c.(1696-1698)gTa>gAa	p.V566E	PKD2_ENST00000511337.1_3'UTR|PKD2_ENST00000508588.1_5'UTR	NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.V566E(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GCTGTCACAGTATTTTTTGTC	0.308																																							uc003hre.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1696-1698)GTA>GAA		polycystin 2							86.0	84.0	84.0					4																	88973291		2203	4300	6503	SO:0001583	missense	5311					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity	g.chr4:88973291T>A	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.1697T>A	4.37:g.88973291T>A	ENSP00000237596:p.Val566Glu					PKD2_uc011cdf.1_5'UTR|PKD2_uc011cdg.1_5'UTR|PKD2_uc011cdh.1_5'UTR	p.V566E	NM_000297	NP_000288	Q13563	PKD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)	7	1763	+		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)	566			Helical; (Potential).		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000237596.2	37	c.1697T>A	CCDS3627.1	.	.	.	.	.	.	.	.	.	.	T	18.02	3.530958	0.64972	.	.	ENSG00000118762	ENST00000237596	T	0.74632	-0.86	5.23	5.23	0.72850	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	D	0.87330	0.6150	M	0.87381	2.88	0.80722	D	1	D	0.59767	0.986	D	0.69142	0.962	D	0.89754	0.3942	10	0.87932	D	0	-17.0758	15.4425	0.75195	0.0:0.0:0.0:1.0	.	566	Q13563	PKD2_HUMAN	E	566	ENSP00000237596:V566E	ENSP00000237596:V566E	V	+	2	0	PKD2	89192315	1.000000	0.71417	0.856000	0.33681	0.529000	0.34654	7.740000	0.84986	2.100000	0.63781	0.533000	0.62120	GTA		0.308	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253042.4	NM_000297		4	54	0	0	0	0.000602	0	4	54				
ANK2	287	broad.mit.edu	37	4	114277762	114277762	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:114277762C>A	ENST00000357077.4	+	38	8041	c.7988C>A	c.(7987-7989)tCc>tAc	p.S2663Y	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.S2630Y|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2663					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.S2663Y(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTGTCTTCCTCCTCAGAAAGT	0.478																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(7987-7989)TCC>TAC		ankyrin 2 isoform 1							116.0	117.0	117.0					4																	114277762		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114277762C>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.7988C>A	4.37:g.114277762C>A	ENSP00000349588:p.Ser2663Tyr					ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc011cgb.1_Missense_Mutation_p.S2678Y	p.S2663Y	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	8088	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	2630					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.7988C>A	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589938	0.86851	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.72835	-0.68;-0.69	5.86	5.86	0.93980	.	0.000000	0.56097	D	0.000035	D	0.84275	0.5436	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.82594	-0.0380	9	.	.	.	.	20.1916	0.98230	0.0:1.0:0.0:0.0	.	2630;2663	Q01484;Q01484-4	ANK2_HUMAN;.	Y	2663;2630	ENSP00000349588:S2663Y;ENSP00000264366:S2630Y	.	S	+	2	0	ANK2	114497211	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.759000	0.68785	2.770000	0.95276	0.655000	0.94253	TCC		0.478	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		20	20	1	0	5.35267e-07	0.007413	6.64902e-07	20	20				
SCLT1	132320	broad.mit.edu	37	4	129880846	129880846	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:129880846C>A	ENST00000281142.5	-	12	1459	c.956G>T	c.(955-957)tGc>tTc	p.C319F	SCLT1_ENST00000434680.1_Intron|SCLT1_ENST00000503215.1_Intron|SCLT1_ENST00000439369.2_Intron|SCLT1_ENST00000502495.1_5'UTR	NM_144643.2	NP_653244.2	Q96NL6	SCLT1_HUMAN	sodium channel and clathrin linker 1	319					cilium assembly (GO:0042384)|clustering of voltage-gated sodium channels (GO:0045162)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|clathrin complex (GO:0071439)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)	sodium channel regulator activity (GO:0017080)	p.C319F(2)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	29						TAATTCATTGCACTTTGCTTG	0.358																																							uc003igp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)|central_nervous_system(1)	5						c.(955-957)TGC>TTC		sodium channel associated protein 1							169.0	158.0	162.0					4																	129880846		2203	4300	6503	SO:0001583	missense	132320					centrosome		g.chr4:129880846C>A	AK055217	CCDS3740.1	4q28.2	2008-05-02			ENSG00000151466	ENSG00000151466			26406	protein-coding gene	gene with protein product		611399				15797711	Standard	XM_005262732		Approved	hCAP-1A, FLJ30655	uc003igp.2	Q96NL6	OTTHUMG00000133346	ENST00000281142.5:c.956G>T	4.37:g.129880846C>A	ENSP00000281142:p.Cys319Phe					SCLT1_uc003ign.2_5'UTR|SCLT1_uc003igo.2_5'UTR|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	p.C319F	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN			12	1462	-			319			Potential.		A4QN04|Q0VAH2|Q6P2M4	Missense_Mutation	SNP	ENST00000281142.5	37	c.956G>T	CCDS3740.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.725515	0.30593	.	.	ENSG00000151466	ENST00000281142	T	0.09630	2.96	5.05	1.36	0.22044	.	0.047852	0.85682	D	0.000000	T	0.13415	0.0325	M	0.68952	2.095	0.25143	N	0.990482	P	0.49358	0.923	B	0.43728	0.429	T	0.10086	-1.0645	9	.	.	.	2.0032	9.408	0.38473	0.0:0.702:0.0:0.298	.	319	Q96NL6	SCLT1_HUMAN	F	319	ENSP00000281142:C319F	.	C	-	2	0	SCLT1	130100296	0.024000	0.19004	0.540000	0.28089	0.478000	0.33099	0.159000	0.16442	0.180000	0.19960	0.467000	0.42956	TGC		0.358	SCLT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257176.2	NM_144643		44	46	1	0	9.84934e-19	0.002522	1.67491e-18	44	46				
TKTL2	84076	broad.mit.edu	37	4	164394569	164394569	+	Silent	SNP	G	G	A	rs376513845		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:164394569G>A	ENST00000280605.3	-	1	478	c.318C>T	c.(316-318)agC>agT	p.S106S		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	106						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.S106S(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TCTCCAAGTCGCTGTGAAGTT	0.537																																							uc003iqp.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|pancreas(1)	5						c.(316-318)AGC>AGT		transketolase-like 2		G		0,4406		0,0,2203	131.0	98.0	109.0		318	-0.1	0.0	4		109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TKTL2	NM_032136.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		106/627	164394569	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84076					cytoplasm	metal ion binding|transketolase activity	g.chr4:164394569G>A	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.318C>T	4.37:g.164394569G>A							p.S106S	NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN			1	479	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	106					A4FVB4|Q8NCT0|Q96M82	Silent	SNP	ENST00000280605.3	37	c.318C>T	CCDS3805.1																																																																																				0.537	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136		8	15	0	0	0	0.00308	0	8	15				
TLR3	7098	broad.mit.edu	37	4	187004712	187004712	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:187004712C>T	ENST00000296795.3	+	4	1976	c.1872C>T	c.(1870-1872)tcC>tcT	p.S624S	TLR3_ENST00000504367.1_Silent_p.S347S	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	624					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S624S(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TCATAACATCCGTTGAGAAGA	0.393																																							uc003iyq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|prostate(1)|lung(1)|breast(1)	5						c.(1870-1872)TCC>TCT		toll-like receptor 3 precursor							75.0	78.0	77.0					4																	187004712		2203	4300	6503	SO:0001819	synonymous_variant	7098				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity	g.chr4:187004712C>T	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1872C>T	4.37:g.187004712C>T						TLR3_uc011ckz.1_Silent_p.S347S|TLR3_uc003iyr.2_Silent_p.S347S	p.S624S	NM_003265	NP_003256	O15455	TLR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)	4	1973	+		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)	624			LRR 22.|Lumenal (Potential).		B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Silent	SNP	ENST00000296795.3	37	c.1872C>T	CCDS3846.1																																																																																				0.393	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4			5	56	0	0	0	0.000602	0	5	56				
C5orf55	116349	broad.mit.edu	37	5	442858	442858	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:442858A>C	ENST00000408966.2	-	1	400	c.80T>G	c.(79-81)gTg>gGg	p.V27G	EXOC3_ENST00000512944.1_5'Flank	NM_138464.2	NP_612473.1	Q8N2X6	CE055_HUMAN	chromosome 5 open reading frame 55	27						extracellular region (GO:0005576)				large_intestine(1)|lung(2)	3						CCCGGCGCCCACCTCAGTCCG	0.587																																							uc010ita.2		NA																	0					0						c.(79-81)GTG>GGG		hypothetical protein LOC116349 precursor							66.0	79.0	74.0					5																	442858		1962	4144	6106	SO:0001583	missense	116349					extracellular region		g.chr5:442858A>C	BC014011	CCDS43298.1	5p15.33	2012-02-24			ENSG00000221990	ENSG00000221990			25175	protein-coding gene	gene with protein product						12477932	Standard	NM_138464		Approved		uc010ita.3	Q8N2X6	OTTHUMG00000162235	ENST00000408966.2:c.80T>G	5.37:g.442858A>C	ENSP00000386139:p.Val27Gly					EXOC3_uc003jba.2_5'Flank	p.V27G	NM_138464	NP_612473	Q8N2X6	CE055_HUMAN			1	401	-			27					Q96CR9	Missense_Mutation	SNP	ENST00000408966.2	37	c.80T>G	CCDS43298.1	.	.	.	.	.	.	.	.	.	.	A	3.388	-0.125022	0.06795	.	.	ENSG00000221990	ENST00000408966	T	0.39592	1.07	0.677	-1.35	0.09114	.	.	.	.	.	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	P	0.41041	0.736	B	0.31614	0.133	T	0.11542	-1.0583	8	0.87932	D	0	.	.	.	.	.	27	Q8N2X6	CE055_HUMAN	G	27	ENSP00000386139:V27G	ENSP00000386139:V27G	V	-	2	0	C5orf55	495858	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.160000	0.10041	-1.157000	0.02815	0.172000	0.16884	GTG		0.587	C5orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368033.1	NM_138464		13	123	0	0	0	0.002299	0	13	123				
TAS2R1	50834	broad.mit.edu	37	5	9629469	9629469	+	Missense_Mutation	SNP	C	C	A	rs145804099		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:9629469C>A	ENST00000382492.2	-	1	994	c.676G>T	c.(676-678)Gcg>Tcg	p.A226S	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	226					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.A226S(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						GACAGCAACGCGCTGATGGGT	0.498																																							uc003jem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(676-678)GCG>TCG		taste receptor T2R1							63.0	71.0	68.0					5																	9629469		2203	4300	6503	SO:0001583	missense	50834				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity	g.chr5:9629469C>A	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.676G>T	5.37:g.9629469C>A	ENSP00000371932:p.Ala226Ser						p.A226S	NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN			1	995	-			226			Helical; Name=6; (Potential).		Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	c.676G>T	CCDS3876.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399229	0.62177	.	.	ENSG00000169777	ENST00000382492	T	0.01430	4.9	5.55	-0.544	0.11847	.	0.147373	0.43919	D	0.000501	T	0.04634	0.0126	M	0.83774	2.66	0.09310	N	1	D	0.69078	0.997	P	0.60286	0.872	T	0.25328	-1.0135	9	.	.	.	.	3.1173	0.06379	0.1096:0.5237:0.1658:0.2009	.	226	Q9NYW7	TA2R1_HUMAN	S	226	ENSP00000371932:A226S	.	A	-	1	0	TAS2R1	9682469	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	0.279000	0.18771	-0.293000	0.08986	0.655000	0.94253	GCG		0.498	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			36	38	1	0	9.80977e-26	0.004289	1.80841e-25	36	38				
CTNND2	1501	broad.mit.edu	37	5	11346577	11346577	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:11346577A>T	ENST00000304623.8	-	9	1724	c.1535T>A	c.(1534-1536)gTt>gAt	p.V512D	CTNND2_ENST00000359640.2_Missense_Mutation_p.V512D|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000503622.1_Missense_Mutation_p.V175D|CTNND2_ENST00000511377.1_Missense_Mutation_p.V421D|CTNND2_ENST00000458100.2_Missense_Mutation_p.V79D	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	512					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V512D(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGGAGACTCAACAGAGGGACA	0.612																																							uc003jfa.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(1534-1536)GTT>GAT		catenin (cadherin-associated protein), delta 2							107.0	112.0	110.0					5																	11346577		2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11346577A>T	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1535T>A	5.37:g.11346577A>T	ENSP00000307134:p.Val512Asp					CTNND2_uc010itt.2_Missense_Mutation_p.V421D|CTNND2_uc011cmy.1_Missense_Mutation_p.V175D|CTNND2_uc011cmz.1_Missense_Mutation_p.V79D|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.V79D	p.V512D	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN			9	1680	-			512					B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.1535T>A	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429197	0.43122	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.78481	-1.06;-1.14;-1.05;-1.18;-1.16	5.8	3.36	0.38483	.	0.589252	0.17179	N	0.183941	T	0.64405	0.2595	L	0.36672	1.1	0.49483	D	0.999794	B;B;P	0.35077	0.22;0.041;0.483	B;B;B	0.33392	0.036;0.025;0.163	T	0.52689	-0.8542	10	0.11794	T	0.64	-0.6119	10.4569	0.44557	0.8667:0.0:0.1333:0.0	.	175;79;512	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	D	512;512;421;79;175	ENSP00000307134:V512D;ENSP00000352661:V512D;ENSP00000426510:V421D;ENSP00000391155:V79D;ENSP00000426887:V175D	ENSP00000307134:V512D	V	-	2	0	CTNND2	11399577	0.999000	0.42202	0.032000	0.17829	0.995000	0.86356	3.922000	0.56462	0.446000	0.26666	0.477000	0.44152	GTT		0.612	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		29	145	0	0	0	0.00632	0	29	145				
TRIO	7204	broad.mit.edu	37	5	14474198	14474198	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:14474198G>C	ENST00000344204.4	+	40	6099	c.6075G>C	c.(6073-6075)tgG>tgC	p.W2025C	TRIO_ENST00000537187.1_Missense_Mutation_p.W2025C	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2025	DH 2. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.W2025C(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TTTACGACTGGCACAGAGAGT	0.453																																							uc003jff.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(6073-6075)TGG>TGC		triple functional domain (PTPRF interacting)							160.0	124.0	136.0					5																	14474198		2203	4300	6503	SO:0001583	missense	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14474198G>C	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.6075G>C	5.37:g.14474198G>C	ENSP00000339299:p.Trp2025Cys					TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Missense_Mutation_p.W1674C	p.W2025C	NM_007118	NP_009049	O75962	TRIO_HUMAN			40	6081	+	Lung NSC(4;0.000742)		2025			DH 2.		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	c.6075G>C	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323314	0.81580	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000541447	T;T	0.62639	0.01;0.01	5.22	5.22	0.72569	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.78181	0.4243	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80344	-0.1422	10	0.87932	D	0	.	18.7955	0.91993	0.0:0.0:1.0:0.0	.	2025;2025	O75962-5;O75962	.;TRIO_HUMAN	C	2025;2025;1712;105	ENSP00000339299:W2025C;ENSP00000446348:W2025C	ENSP00000339299:W2025C	W	+	3	0	TRIO	14527198	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.835000	0.99442	2.440000	0.82611	0.563000	0.77884	TGG		0.453	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		7	61	0	0	0	0.004482	0	7	61				
FBXL7	23194	broad.mit.edu	37	5	15928579	15928579	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:15928579C>A	ENST00000504595.1	+	3	1189	c.708C>A	c.(706-708)ctC>ctA	p.L236L	FBXL7_ENST00000510662.1_Silent_p.L189L|FBXL7_ENST00000329673.7_Silent_p.L224L	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	236					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L236L(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TGGTGTCCCTCTGCCCTAATC	0.562																																							uc003jfn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)	3						c.(706-708)CTC>CTA		F-box and leucine-rich repeat protein 7							123.0	115.0	117.0					5																	15928579		2026	4183	6209	SO:0001819	synonymous_variant	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15928579C>A	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.708C>A	5.37:g.15928579C>A							p.L236L	NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN			3	1189	+			236			LRR 3.		B9EGF1|D6RDY7|O94926	Silent	SNP	ENST00000504595.1	37	c.708C>A	CCDS54833.1																																																																																				0.562	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		22	90	1	0	1.37878e-21	0.00333	2.46321e-21	22	90				
CDH10	1008	broad.mit.edu	37	5	24487843	24487843	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:24487843G>T	ENST00000264463.4	-	12	2803	c.2296C>A	c.(2296-2298)Cga>Aga	p.R766R	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	766					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R766*(1)|p.R766R(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CCCCATTCTCGGAGGTAATCG	0.413										HNSCC(23;0.051)																													uc003jgr.1		NA																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)		lung(2)	ovary(6)|pancreas(4)|breast(2)	12						c.(2296-2298)CGA>AGA		cadherin 10, type 2 preproprotein							162.0	162.0	162.0					5																	24487843		2203	4300	6503	SO:0001819	synonymous_variant	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24487843G>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2296C>A	5.37:g.24487843G>T		HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.R766R	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	12	2628	-			766			Cytoplasmic (Potential).		Q9ULB3	Silent	SNP	ENST00000264463.4	37	c.2296C>A	CCDS3892.1																																																																																				0.413	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		146	93	1	0	6.69687e-66	0.00361	1.27141e-65	146	93				
CDH10	1008	broad.mit.edu	37	5	24509706	24509706	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:24509706T>C	ENST00000264463.4	-	7	1732	c.1225A>G	c.(1225-1227)Agg>Ggg	p.R409G		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	409	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R409G(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TCTGGGTCCCTTGCCATTACA	0.453										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(1225-1227)AGG>GGG		cadherin 10, type 2 preproprotein							97.0	97.0	97.0					5																	24509706		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24509706T>C	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1225A>G	5.37:g.24509706T>C	ENSP00000264463:p.Arg409Gly	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.R409G	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	7	1557	-			409			Cadherin 4.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1225A>G	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	T	15.00	2.702111	0.48307	.	.	ENSG00000040731	ENST00000264463	T	0.01725	4.67	5.26	4.07	0.47477	Cadherin (4);Cadherin-like (1);	0.100486	0.64402	D	0.000007	T	0.04003	0.0112	M	0.76574	2.34	0.42200	D	0.991762	P	0.39003	0.654	B	0.41374	0.355	T	0.44892	-0.9298	10	0.39692	T	0.17	.	11.3076	0.49345	0.0:0.0:0.3089:0.6911	.	409	Q9Y6N8	CAD10_HUMAN	G	409	ENSP00000264463:R409G	ENSP00000264463:R409G	R	-	1	2	CDH10	24545463	0.020000	0.18652	0.989000	0.46669	0.997000	0.91878	1.530000	0.36007	0.912000	0.36772	0.528000	0.53228	AGG		0.453	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		20	83	0	0	0	0.010504	0	20	83				
C5orf42	65250	broad.mit.edu	37	5	37187517	37187517	+	Splice_Site	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:37187517T>A	ENST00000508244.1	-	22	4172	c.4079A>T	c.(4078-4080)aAg>aTg	p.K1360M	C5orf42_ENST00000274258.7_Splice_Site_p.K241M|C5orf42_ENST00000425232.2_Splice_Site_p.K1360M			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1360						integral component of membrane (GO:0016021)		p.K1360M(1)|p.K241M(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GCACATTACCTTTCTGATTGG	0.328																																							uc011cpa.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(2)|skin(1)	7						c.(4078-4080)AAG>ATG		hypothetical protein LOC65250							78.0	80.0	80.0					5																	37187517		2203	4300	6503	SO:0001630	splice_region_variant	65250							g.chr5:37187517T>A		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.4080+1A>T	5.37:g.37187517T>A						C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.K435M|C5orf42_uc011cpb.1_Missense_Mutation_p.K241M	p.K1360M	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)		23	4310	-	all_lung(31;0.000616)		1360					A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	c.4079A>T	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760579	0.89932	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.27557	1.69;1.69;1.66;1.67	5.53	5.53	0.82687	.	0.141022	0.32785	N	0.005654	T	0.42268	0.1195	N	0.24115	0.695	0.42541	D	0.993072	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.971	T	0.44513	-0.9323	10	0.87932	D	0	.	15.9525	0.79850	0.0:0.0:0.0:1.0	.	1360;241	E9PH94;Q9H799	.;CE042_HUMAN	M	1360;1360;241;408;241	ENSP00000421690:K1360M;ENSP00000389014:K1360M;ENSP00000274258:K241M;ENSP00000424223:K408M	ENSP00000274258:K241M	K	-	2	0	C5orf42	37223274	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.545000	0.60698	2.223000	0.72356	0.402000	0.26972	AAG		0.328	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	Missense_Mutation	17	110	0	0	0	0.00499	0	17	110				
FYB	2533	broad.mit.edu	37	5	39202797	39202797	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:39202797C>A	ENST00000351578.6	-	2	456	c.266G>T	c.(265-267)gGc>gTc	p.G89V	FYB_ENST00000505428.1_Missense_Mutation_p.G89V|FYB_ENST00000515010.1_Missense_Mutation_p.G89V|FYB_ENST00000512982.1_Missense_Mutation_p.G89V|FYB_ENST00000540520.1_Missense_Mutation_p.G99V	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	89					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.G89V(3)|p.G99V(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			GAATCTTTGGCCTGCTCCAGT	0.547																																							uc003jls.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(265-267)GGC>GTC		FYN binding protein (FYB-120/130) isoform 2							51.0	49.0	50.0					5																	39202797		1869	4112	5981	SO:0001583	missense	2533				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding	g.chr5:39202797C>A	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.266G>T	5.37:g.39202797C>A	ENSP00000316460:p.Gly89Val					FYB_uc003jlt.2_Missense_Mutation_p.G89V|FYB_uc003jlu.2_Missense_Mutation_p.G89V|FYB_uc011cpl.1_Missense_Mutation_p.G99V	p.G89V	NM_199335	NP_955367	O15117	FYB_HUMAN	Epithelial(62;0.235)		1	333	-	all_lung(31;0.000343)		89					A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	37	c.266G>T	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	C	7.688	0.690385	0.15039	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542;ENST00000510188;ENST00000512138	T;T;T;T;T;T;T	0.52754	1.71;1.71;1.72;1.72;1.72;0.65;0.74	6.17	3.31	0.37934	.	0.791890	0.11798	N	0.528465	T	0.40423	0.1116	L	0.54323	1.7	0.20307	N	0.999913	P;P	0.46706	0.883;0.79	B;B	0.41135	0.348;0.274	T	0.15435	-1.0437	10	0.28530	T	0.3	-1.8718	6.4788	0.22051	0.0:0.4417:0.3377:0.2206	.	99;89	B4DLN2;O15117	.;FYB_HUMAN	V	89;89;89;89;99;89;89;89	ENSP00000316460:G89V;ENSP00000426346:G89V;ENSP00000425845:G89V;ENSP00000427114:G89V;ENSP00000442840:G99V;ENSP00000426597:G89V;ENSP00000424919:G89V	ENSP00000316460:G89V	G	-	2	0	FYB	39238554	0.001000	0.12720	0.299000	0.25016	0.355000	0.29361	-0.311000	0.08124	0.403000	0.25479	0.655000	0.94253	GGC		0.547	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465		25	18	1	0	5.61819e-17	0.005443	9.35384e-17	25	18				
NNT	23530	broad.mit.edu	37	5	43656852	43656852	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:43656852G>T	ENST00000264663.5	+	16	2612	c.2391G>T	c.(2389-2391)gtG>gtT	p.V797V	NNT_ENST00000512996.2_Silent_p.V666V|NNT_ENST00000344920.4_Silent_p.V797V	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	797					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.V797V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CATTCATGGTGGACCCAAGCT	0.493																																							uc003joe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2389-2391)GTG>GTT		nicotinamide nucleotide transhydrogenase	NADH(DB00157)						214.0	184.0	194.0					5																	43656852		2203	4300	6503	SO:0001819	synonymous_variant	23530				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding	g.chr5:43656852G>T	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2391G>T	5.37:g.43656852G>T						NNT_uc003jof.2_Silent_p.V797V	p.V797V	NM_012343	NP_036475	Q13423	NNTM_HUMAN			16	2646	+	Lung NSC(6;2.58e-06)		797			Helical; (Potential).		Q16796|Q2TB60|Q8N3V4	Silent	SNP	ENST00000264663.5	37	c.2391G>T	CCDS3949.1																																																																																				0.493	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977		25	137	1	0	6.12954e-19	0.004656	1.05078e-18	25	137				
ITGA1	3672	broad.mit.edu	37	5	52214578	52214578	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:52214578G>T	ENST00000282588.6	+	16	2463	c.2005G>T	c.(2005-2007)Gta>Tta	p.V669L		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	669					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)	p.V669L(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				AGATGTGGCCGTAGTTAAAGT	0.373																																							uc003jou.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(2005-2007)GTA>TTA		integrin, alpha 1 precursor							119.0	105.0	110.0					5																	52214578		2203	4299	6502	SO:0001583	missense	3672				axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity	g.chr5:52214578G>T	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2005G>T	5.37:g.52214578G>T	ENSP00000282588:p.Val669Leu					ITGA1_uc003jov.2_RNA|ITGA1_uc003jow.2_Missense_Mutation_p.V200L	p.V669L	NM_181501	NP_852478	P56199	ITA1_HUMAN			16	2057	+		Lung NSC(810;5.05e-05)|Breast(144;0.0851)	669			Extracellular (Potential).|FG-GAP 7.		B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	37	c.2005G>T	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923244	0.52653	.	.	ENSG00000213949	ENST00000282588	T	0.55588	0.51	5.51	5.51	0.81932	Integrin alpha-2 (1);	0.242977	0.38111	N	0.001809	T	0.48589	0.1508	L	0.38175	1.15	0.29959	N	0.819542	B	0.24483	0.104	B	0.30179	0.112	T	0.41016	-0.9532	10	0.27785	T	0.31	.	19.7837	0.96428	0.0:0.0:1.0:0.0	.	669	P56199	ITA1_HUMAN	L	669	ENSP00000282588:V669L	ENSP00000282588:V669L	V	+	1	0	ITGA1	52250335	0.959000	0.32827	1.000000	0.80357	0.996000	0.88848	2.492000	0.45311	2.738000	0.93877	0.655000	0.94253	GTA		0.373	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501		17	15	1	0	1.33834e-09	0.007413	1.83841e-09	17	15				
IQGAP2	10788	broad.mit.edu	37	5	75902092	75902092	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:75902092G>T	ENST00000274364.6	+	12	1618	c.1321G>T	c.(1321-1323)Gat>Tat	p.D441Y	IQGAP2_ENST00000379730.3_5'UTR|IQGAP2_ENST00000502745.1_5'Flank|CTD-2236F14.1_ENST00000511327.1_RNA|IQGAP2_ENST00000396234.3_5'Flank	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	441					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.D441Y(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GAATTGTATTGATATGGTTAA	0.358																																							uc003kek.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(1)	7						c.(1321-1323)GAT>TAT		IQ motif containing GTPase activating protein 2							97.0	95.0	96.0					5																	75902092		2203	4300	6503	SO:0001583	missense	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75902092G>T	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1321G>T	5.37:g.75902092G>T	ENSP00000274364:p.Asp441Tyr					IQGAP2_uc010izv.2_5'Flank|IQGAP2_uc011csv.1_5'Flank|IQGAP2_uc003kel.2_5'Flank	p.D441Y	NM_006633	NP_006624	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	12	1543	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)	441					A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	c.1321G>T	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978409	0.53720	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.09817	2.94;2.94;2.94	5.58	4.67	0.58626	.	0.051493	0.85682	D	0.000000	T	0.16557	0.0398	M	0.67953	2.075	0.80722	D	1	B	0.32731	0.382	B	0.33690	0.168	T	0.02411	-1.1163	10	0.87932	D	0	-30.299	16.1288	0.81412	0.0:0.1335:0.8665:0.0	.	441	Q13576	IQGA2_HUMAN	Y	441;414;391	ENSP00000274364:D441Y;ENSP00000423672:D414Y;ENSP00000421097:D391Y	ENSP00000274364:D441Y	D	+	1	0	IQGAP2	75937848	1.000000	0.71417	0.999000	0.59377	0.818000	0.46254	6.453000	0.73488	2.609000	0.88269	0.650000	0.86243	GAT		0.358	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		10	25	1	0	2.80697e-09	0.000978	3.82277e-09	10	25				
F2RL2	2151	broad.mit.edu	37	5	75913420	75913420	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:75913420T>A	ENST00000296641.4	-	2	1315	c.1112A>T	c.(1111-1113)tAc>tTc	p.Y371F	F2RL2_ENST00000504899.1_Missense_Mutation_p.Y349F|IQGAP2_ENST00000274364.6_Intron|IQGAP2_ENST00000379730.3_Intron|IQGAP2_ENST00000502745.1_Intron|IQGAP2_ENST00000396234.3_Intron	NM_004101.3	NP_004092.1	O00254	PAR3_HUMAN	coagulation factor II (thrombin) receptor-like 2	371					blood coagulation (GO:0007596)|metabolic process (GO:0008152)|platelet activation (GO:0030168)|response to wounding (GO:0009611)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|thrombin receptor activity (GO:0015057)	p.Y371F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(3)	32		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)		TTTTGTAAGGTAAGCAGTGGA	0.368																																							uc003kem.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1111-1113)TAC>TTC		coagulation factor II (thrombin) receptor-like 2							89.0	88.0	88.0					5																	75913420		2203	4299	6502	SO:0001583	missense	2151				platelet activation	extracellular region|integral to plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|thrombin receptor activity	g.chr5:75913420T>A	U92971	CCDS4031.1, CCDS58959.1	5q13	2012-08-08			ENSG00000164220	ENSG00000164220		"""GPCR / Class A : Protease activated receptors"""	3539	protein-coding gene	gene with protein product	"""proteinase-activated receptor-3"""	601919				9087410, 9722561	Standard	NM_004101		Approved	PAR3	uc003kem.4	O00254	OTTHUMG00000102119	ENST00000296641.4:c.1112A>T	5.37:g.75913420T>A	ENSP00000296641:p.Tyr371Phe					IQGAP2_uc003kek.2_Intron|IQGAP2_uc010izv.2_Intron|IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron|F2RL2_uc011csw.1_Missense_Mutation_p.Y349F	p.Y371F	NM_004101	NP_004092	O00254	PAR3_HUMAN		all cancers(79;4.43e-43)	2	1297	-		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)	371			Cytoplasmic (Potential).		B2R754|B4DQ13|Q52M68|Q7Z3W3	Missense_Mutation	SNP	ENST00000296641.4	37	c.1112A>T	CCDS4031.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.652402	0.29336	.	.	ENSG00000164220	ENST00000296641;ENST00000504899	T;T	0.64260	-0.09;-0.08	4.58	4.58	0.56647	.	2.181110	0.02224	N	0.064257	T	0.55641	0.1933	L	0.29908	0.895	0.09310	N	0.999991	P	0.48089	0.905	P	0.45232	0.474	T	0.46428	-0.9192	10	0.10636	T	0.68	-2.372	9.6683	0.39998	0.0:0.0824:0.0:0.9176	.	371	O00254	PAR3_HUMAN	F	371;349	ENSP00000296641:Y371F;ENSP00000426703:Y349F	ENSP00000296641:Y371F	Y	-	2	0	F2RL2	75949176	1.000000	0.71417	0.094000	0.20943	0.148000	0.21650	3.148000	0.50647	1.831000	0.53308	0.460000	0.39030	TAC		0.368	F2RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219958.3			7	29	0	0	0	0.00308	0	7	29				
LIX1	167410	broad.mit.edu	37	5	96460280	96460280	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:96460280C>T	ENST00000274382.4	-	2	431	c.136G>A	c.(136-138)Gct>Act	p.A46T	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	46								p.A46T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		GGGAATGCAGCCTTCTGCTGC	0.483																																							uc003kmy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(136-138)GCT>ACT		limb expression 1							108.0	91.0	97.0					5																	96460280		2203	4300	6503	SO:0001583	missense	167410							g.chr5:96460280C>T		CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.136G>A	5.37:g.96460280C>T	ENSP00000274382:p.Ala46Thr						p.A46T	NM_153234	NP_694966	Q8N485	LIX1_HUMAN		COAD - Colon adenocarcinoma(37;0.0733)	2	376	-		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)	46					A8K4R9|Q8N7I2	Missense_Mutation	SNP	ENST00000274382.4	37	c.136G>A	CCDS4088.1	.	.	.	.	.	.	.	.	.	.	C	8.586	0.883544	0.17467	.	.	ENSG00000145721	ENST00000274382;ENST00000512378	T	0.49720	0.77	5.24	1.4	0.22301	.	0.293561	0.37261	N	0.002176	T	0.32224	0.0822	L	0.38953	1.18	0.40521	D	0.98083	B	0.06786	0.001	B	0.06405	0.002	T	0.09058	-1.0692	10	0.45353	T	0.12	-1.7924	6.052	0.19790	0.1336:0.6483:0.0:0.2181	.	46	Q8N485	LIX1_HUMAN	T	46;22	ENSP00000274382:A46T	ENSP00000274382:A46T	A	-	1	0	LIX1	96486036	0.156000	0.22821	0.151000	0.22473	0.050000	0.14768	0.603000	0.24149	0.298000	0.22638	-0.339000	0.08088	GCT		0.483	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250625.1	NM_153234		10	17	0	0	0	0.008291	0	10	17				
PAM	5066	broad.mit.edu	37	5	102285239	102285239	+	Splice_Site	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:102285239A>G	ENST00000438793.3	+	9	1113		c.e9-1		PAM_ENST00000304400.7_Splice_Site|PAM_ENST00000348126.2_Splice_Site|PAM_ENST00000346918.2_Splice_Site|PAM_ENST00000455264.2_Splice_Site|PAM_ENST00000274392.9_Splice_Site|PAM_ENST00000379787.4_Splice_Site	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)	p.?(2)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	CATTTCCCACAGTGGTGAATT	0.338																																							uc003knw.2		NA																	2	Unknown(2)		lung(2)		0						c.e9-2		peptidylglycine alpha-amidating monooxygenase	Vitamin C(DB00126)						93.0	95.0	94.0					5																	102285239		2203	4296	6499	SO:0001630	splice_region_variant	5066				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding	g.chr5:102285239A>G	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.644-1A>G	5.37:g.102285239A>G						PAM_uc003kns.2_Splice_Site_p.V215_splice|PAM_uc003knt.2_Splice_Site_p.V215_splice|PAM_uc003knu.2_Splice_Site_p.V215_splice|PAM_uc003knv.2_Splice_Site_p.V215_splice|PAM_uc011cuz.1_Splice_Site_p.V118_splice	p.V215_splice	NM_000919	NP_000910	P19021	AMD_HUMAN		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	9	1017	+		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)						A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Splice_Site	SNP	ENST00000438793.3	37	c.644_splice	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	A	17.00	3.276498	0.59649	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000274392;ENST00000455264	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.542	0.84395	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAM	102313138	1.000000	0.71417	0.998000	0.56505	0.800000	0.45204	7.499000	0.81566	2.304000	0.77564	0.528000	0.53228	.		0.338	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	Intron	18	31	0	0	0	0.008871	0	18	31				
FBN2	2201	broad.mit.edu	37	5	127641291	127641291	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:127641291C>A	ENST00000508053.1	-	50	6560	c.5586G>T	c.(5584-5586)caG>caT	p.Q1862H	FBN2_ENST00000262464.4_Missense_Mutation_p.Q1862H			P35556	FBN2_HUMAN	fibrillin 2	1862	EGF-like 30; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.Q1862H(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTGCATTCCGCTGGCAGAGAT	0.428																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(5584-5586)CAG>CAT		fibrillin 2 precursor							100.0	99.0	99.0					5																	127641291		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127641291C>A	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5586G>T	5.37:g.127641291C>A	ENSP00000424571:p.Gln1862His						p.Q1862H	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	44	6025	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1862			EGF-like 30; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.5586G>T	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.464209	0.43736	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92048	-2.96;-2.96	5.34	2.39	0.29439	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.103000	0.43579	D	0.000544	T	0.79118	0.4392	N	0.04063	-0.285	0.34499	D	0.705862	B	0.24651	0.108	B	0.25291	0.059	T	0.75714	-0.3221	10	0.38643	T	0.18	.	6.4212	0.21744	0.1312:0.6466:0.0:0.2222	.	1862	P35556	FBN2_HUMAN	H	1862	ENSP00000262464:Q1862H;ENSP00000424571:Q1862H	ENSP00000262464:Q1862H	Q	-	3	2	FBN2	127669190	0.859000	0.29813	1.000000	0.80357	0.790000	0.44656	0.326000	0.19646	0.911000	0.36747	0.650000	0.86243	CAG		0.428	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		27	44	1	0	1.68575e-08	0.007291	2.20605e-08	27	44				
TGFBI	7045	broad.mit.edu	37	5	135390481	135390481	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:135390481G>A	ENST00000442011.2	+	10	1502	c.1341G>A	c.(1339-1341)aaG>aaA	p.K447K	TGFBI_ENST00000305126.8_Silent_p.K447K	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	447	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)	p.K447K(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGCCTCTAAGTATCTGTACC	0.448																																							uc003lbf.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(1)	4						c.(1339-1341)AAG>AAA		transforming growth factor, beta-induced, 68kDa							211.0	208.0	209.0					5																	135390481		1847	4094	5941	SO:0001819	synonymous_variant	7045				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding	g.chr5:135390481G>A	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.1341G>A	5.37:g.135390481G>A						TGFBI_uc003lbg.3_Silent_p.K180K|TGFBI_uc003lbh.3_Silent_p.K273K|TGFBI_uc011cyb.1_Silent_p.K273K|TGFBI_uc010jed.2_Silent_p.K180K	p.K447K	NM_000358	NP_000349	Q15582	BGH3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		10	1502	+			447			FAS1 3.		D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Silent	SNP	ENST00000442011.2	37	c.1341G>A	CCDS47266.1	.	.	.	.	.	.	.	.	.	.	G	8.717	0.913389	0.17907	.	.	ENSG00000120708	ENST00000508767;ENST00000514554	.	.	.	5.83	2.07	0.26955	.	.	.	.	.	T	0.59059	0.2166	.	.	.	0.50171	D	0.999855	.	.	.	.	.	.	T	0.52983	-0.8502	4	.	.	.	-14.6321	10.1372	0.42715	0.3455:0.0:0.6545:0.0	.	.	.	.	I	186;165	.	.	V	+	1	0	TGFBI	135418380	0.993000	0.37304	0.987000	0.45799	0.948000	0.59901	1.175000	0.31944	0.376000	0.24707	0.655000	0.94253	GTA		0.448	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1			7	160	0	0	0	0.00308	0	7	160				
WNT8A	7478	broad.mit.edu	37	5	137426515	137426515	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:137426515C>T	ENST00000398754.1	+	6	814	c.809C>T	c.(808-810)aCa>aTa	p.T270I	WNT8A_ENST00000506684.1_Missense_Mutation_p.T288I	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	270					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.T270I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATCTATGGCACAGAGGGTCGT	0.572																																							uc003lcd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)|skin(1)	4						c.(808-810)ACA>ATA		wingless-type MMTV integration site family,							71.0	76.0	74.0					5																	137426515		2041	4206	6247	SO:0001583	missense	7478				brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity	g.chr5:137426515C>T	AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.809C>T	5.37:g.137426515C>T	ENSP00000381739:p.Thr270Ile					BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Missense_Mutation_p.T288I|WNT8A_uc011cyk.1_Missense_Mutation_p.T288I	p.T270I	NM_058244	NP_490645	Q9H1J5	WNT8A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		6	814	+			270					Q96S51	Missense_Mutation	SNP	ENST00000398754.1	37	c.809C>T	CCDS43368.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532584	0.85812	.	.	ENSG00000061492	ENST00000506684;ENST00000504809;ENST00000398754	D;D;D	0.83250	-1.7;-1.7;-1.7	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.93949	0.8063	H	0.95745	3.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95642	0.8699	10	0.87932	D	0	.	18.1622	0.89712	0.0:1.0:0.0:0.0	.	288;288;270	D6RF47;D6RF94;Q9H1J5	.;.;WNT8A_HUMAN	I	288;288;270	ENSP00000426653:T288I;ENSP00000424809:T288I;ENSP00000381739:T270I	ENSP00000354726:T270I	T	+	2	0	WNT8A	137454414	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	7.607000	0.82883	2.527000	0.85204	0.557000	0.71058	ACA		0.572	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280395.1	NM_058244		12	44	0	0	0	0.000978	0	12	44				
PCDHA5	56143	broad.mit.edu	37	5	140202495	140202495	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140202495G>A	ENST00000529859.1	+	1	1135	c.1135G>A	c.(1135-1137)Ggt>Agt	p.G379S	PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.G379S|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.G379S	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	379	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G379S(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGTGACTCAGGTGCCAACGG	0.567																																							uc003lhl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|skin(1)	3						c.(1135-1137)GGT>AGT		protocadherin alpha 5 isoform 1 precursor							118.0	105.0	110.0					5																	140202495		2203	4300	6503	SO:0001583	missense	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140202495G>A	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1135G>A	5.37:g.140202495G>A	ENSP00000436557:p.Gly379Ser					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.G379S|PCDHA5_uc003lhj.1_Missense_Mutation_p.G379S	p.G379S	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1135	+			379			Extracellular (Potential).|Cadherin 4.		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	c.1135G>A	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541129	0.65085	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.63744	-0.06;-0.06;-0.06	3.84	3.84	0.44239	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.82393	0.5027	M	0.92077	3.27	0.41557	D	0.988603	P;D;D	0.63046	0.945;0.992;0.992	D;P;P	0.64506	0.926;0.84;0.74	D	0.88356	0.2984	9	0.87932	D	0	.	16.1154	0.81302	0.0:0.0:1.0:0.0	.	379;379;379	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	S	379	ENSP00000433416:G379S;ENSP00000436557:G379S;ENSP00000367366:G379S	ENSP00000367366:G379S	G	+	1	0	PCDHA5	140182679	1.000000	0.71417	0.068000	0.19968	0.380000	0.30137	8.016000	0.88706	1.829000	0.53265	0.563000	0.77884	GGT		0.567	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		35	70	0	0	0	0.002836	0	35	70				
PCDHB4	56131	broad.mit.edu	37	5	140503638	140503638	+	Silent	SNP	C	C	T	rs112059899	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140503638C>T	ENST00000194152.1	+	1	2058	c.2058C>T	c.(2056-2058)acC>acT	p.T686T		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	686					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T686T(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCTCTCACCGTCTACCTGG	0.697																																							uc003lip.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(2056-2058)ACC>ACT		protocadherin beta 4 precursor							65.0	75.0	72.0					5																	140503638		2162	4231	6393	SO:0001819	synonymous_variant	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503638C>T	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.2058C>T	5.37:g.140503638C>T							p.T686T	NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2058	+			686			Extracellular (Potential).		Q4V761	Silent	SNP	ENST00000194152.1	37	c.2058C>T	CCDS4246.1																																																																																				0.697	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		4	194	0	0	0	0.006214	0	4	194				
PCDHB4	56131	broad.mit.edu	37	5	140503767	140503767	+	Silent	SNP	C	C	T	rs199774224		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140503767C>T	ENST00000194152.1	+	1	2187	c.2187C>T	c.(2185-2187)ggC>ggT	p.G729G		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	729					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G729G(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCCCGAGGGCCCCTTTCCAG	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		14516	0.001		0.0	False		,,,				2504	0.0						uc003lip.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(2185-2187)GGC>GGT		protocadherin beta 4 precursor							74.0	87.0	83.0					5																	140503767		2203	4300	6503	SO:0001819	synonymous_variant	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503767C>T	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.2187C>T	5.37:g.140503767C>T							p.G729G	NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2187	+			729			Cytoplasmic (Potential).		Q4V761	Silent	SNP	ENST00000194152.1	37	c.2187C>T	CCDS4246.1																																																																																				0.657	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		4	202	0	0	0	0.009096	0	4	202				
PCDHB12	56124	broad.mit.edu	37	5	140590432	140590432	+	Silent	SNP	G	G	T	rs540092611	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140590432G>T	ENST00000239450.2	+	1	2142	c.1953G>T	c.(1951-1953)ccG>ccT	p.P651P	PCDHB12_ENST00000541609.1_Silent_p.P314P	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	651	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P651P(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGAGCCTCCGCGCTCGGCCA	0.731													G|||	3	0.000599042	0.0015	0.0014	5008	,	,		14662	0.0		0.0	False		,,,				2504	0.0						uc003liz.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(1951-1953)CCG>CCT		protocadherin beta 12 precursor							13.0	16.0	15.0					5																	140590432		1998	3897	5895	SO:0001819	synonymous_variant	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140590432G>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1953G>T	5.37:g.140590432G>T						PCDHB12_uc011dak.1_Silent_p.P314P	p.P651P	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2142	+			651			Extracellular (Potential).|Cadherin 6.		B4DDU1	Silent	SNP	ENST00000239450.2	37	c.1953G>T	CCDS4254.1																																																																																				0.731	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		5	73	1	0	0.00307968	0.00308	0.00331979	5	73				
PCDHB13	56123	broad.mit.edu	37	5	140595689	140595689	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140595689G>T	ENST00000341948.4	+	1	2181	c.1994G>T	c.(1993-1995)gGc>gTc	p.G665V		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	665	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G665V(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGGTGGACGGCTTCTCCCAG	0.706																																							uc003lja.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1993-1995)GGC>GTC		protocadherin beta 13 precursor							33.0	38.0	36.0					5																	140595689		2059	4063	6122	SO:0001583	missense	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140595689G>T	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1994G>T	5.37:g.140595689G>T	ENSP00000345491:p.Gly665Val						p.G665V	NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2181	+			665			Cadherin 6.|Extracellular (Potential).		A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	c.1994G>T	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	-	15.99	2.997002	0.54147	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.51325	0.71	3.3	3.3	0.37823	Cadherin (2);	.	.	.	.	T	0.48409	0.1498	N	0.20986	0.625	0.58432	D	0.999994	D	0.89917	1.0	D	0.66979	0.948	T	0.50180	-0.8858	9	0.87932	D	0	.	7.1238	0.25461	0.2195:0.0:0.7805:0.0	.	665	Q9Y5F0	PCDBD_HUMAN	V	665;665;611	ENSP00000345491:G665V	ENSP00000345491:G665V	G	+	2	0	PCDHB13	140575873	0.235000	0.23794	1.000000	0.80357	0.887000	0.51463	0.971000	0.29396	1.576000	0.49790	0.298000	0.19748	GGC		0.706	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		26	61	1	0	1.66031e-10	0.003954	2.34136e-10	26	61				
PCDHGA3	56112	broad.mit.edu	37	5	140723759	140723759	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140723759G>A	ENST00000253812.6	+	1	159	c.159G>A	c.(157-159)ggG>ggA	p.G53G	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	53	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G53G(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGACCTGGGGCTAGAGCCCC	0.607											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003ljm.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(157-159)GGG>GGA		protocadherin gamma subfamily A, 3 isoform 1							86.0	103.0	97.0					5																	140723759		2149	4277	6426	SO:0001819	synonymous_variant	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140723759G>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.159G>A	5.37:g.140723759G>A			OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1658	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Silent_p.G53G	p.G53G	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	159	+			53			Cadherin 1.|Extracellular (Potential).		Q9Y5D4	Silent	SNP	ENST00000253812.6	37	c.159G>A	CCDS47290.1																																																																																				0.607	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		39	116	0	0	0	0.009718	0	39	116				
PCDHGA12	26025	broad.mit.edu	37	5	140811375	140811375	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140811375C>T	ENST00000252085.3	+	1	1191	c.1049C>T	c.(1048-1050)aCc>aTc	p.T350I	PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	350	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T350I(2)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTCCTCACCTCTCTCGCC	0.488																																							uc003lkt.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(1048-1050)ACC>ATC		protocadherin gamma subfamily A, 12 isoform 1							95.0	90.0	91.0					5																	140811375		2203	4300	6503	SO:0001583	missense	26025				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140811375C>T	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1049C>T	5.37:g.140811375C>T	ENSP00000252085:p.Thr350Ile					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.T350I	p.T350I	NM_003735	NP_003726	O60330	PCDGC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1218	+			350			Cadherin 4.|Extracellular (Potential).		O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	c.1049C>T	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	c	13.07	2.128055	0.37533	.	.	ENSG00000253159	ENST00000252085	T	0.01821	4.62	4.54	3.67	0.42095	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.08935	0.0221	M	0.79123	2.44	0.23227	N	0.998085	D;D	0.71674	0.995;0.998	D;D	0.71184	0.972;0.951	T	0.06534	-1.0821	9	0.62326	D	0.03	.	9.8542	0.41075	0.0:0.8278:0.0:0.1721	.	350;350	O60330-2;O60330	.;PCDGC_HUMAN	I	350	ENSP00000252085:T350I	ENSP00000252085:T350I	T	+	2	0	PCDHGA12	140791559	0.000000	0.05858	1.000000	0.80357	0.618000	0.37518	0.278000	0.18753	1.122000	0.41944	0.655000	0.94253	ACC		0.488	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735		17	40	0	0	0	0.007413	0	17	40				
PCDHGA12	26025	broad.mit.edu	37	5	140890662	140890662	+	Silent	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:140890662A>G	ENST00000252085.3	+	4	2863	c.2721A>G	c.(2719-2721)gcA>gcG	p.A907A	PCDHGA4_ENST00000571252.1_Silent_p.A906A|PCDHGA5_ENST00000518069.1_Silent_p.A906A|PCDHGC4_ENST00000306593.1_Silent_p.A913A|PCDHGA11_ENST00000398587.2_Silent_p.A910A|PCDHGA6_ENST00000517434.1_Silent_p.A907A|PCDHGB4_ENST00000519479.1_Silent_p.A898A|PCDHGC3_ENST00000308177.3_Silent_p.A909A|PCDHGC5_ENST00000252087.1_Silent_p.A919A|PCDHGA11_ENST00000518882.1_Silent_p.A725A|PCDHGB7_ENST00000398594.2_Silent_p.A904A|PCDHGA10_ENST00000398610.2_Silent_p.A911A|PCDHGA9_ENST00000573521.1_Silent_p.A907A|PCDHGA3_ENST00000253812.6_Silent_p.A907A|PCDHGA8_ENST00000398604.2_Silent_p.A907A|PCDHGB6_ENST00000520790.1_Silent_p.A905A|PCDHGA7_ENST00000518325.1_Silent_p.A907A|PCDHGB3_ENST00000576222.1_Silent_p.A904A|PCDHGA2_ENST00000394576.2_Silent_p.A907A|PCDHGB1_ENST00000523390.1_Silent_p.A902A|PCDHGA1_ENST00000517417.1_Silent_p.A906A|PCDHGB2_ENST00000522605.1_Silent_p.A906A	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	907					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A907A(9)|p.A906A(7)|p.A904A(3)|p.A919A(2)|p.A909A(2)|p.A902A(2)|p.A905A(1)|p.A910A(1)|p.A911A(1)|p.A898A(1)|p.A913A(1)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACCAACGCAGCTGGCAAGC	0.602																																							uc003lla.1		NA																	30	Substitution - coding silent(30)		lung(30)	ovary(3)	3						c.(2755-2757)GCA>GCG		protocadherin gamma subfamily C, 5 isoform 1							87.0	84.0	85.0					5																	140890662		2203	4300	6503	SO:0001819	synonymous_variant	56097				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140890662A>G	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2721A>G	5.37:g.140890662A>G						PCDHGA1_uc003lji.1_Silent_p.A906A|PCDHGA2_uc003ljk.1_Silent_p.A907A|PCDHGA3_uc003ljm.1_Silent_p.A907A|PCDHGA3_uc010jfx.1_Silent_p.A667A|PCDHGB1_uc003ljo.1_Silent_p.A902A|PCDHGA4_uc003ljq.1_Silent_p.A906A|PCDHGB2_uc003ljs.1_Silent_p.A906A|PCDHGA5_uc003lju.1_Silent_p.A906A|PCDHGB3_uc003ljw.1_Silent_p.A904A|PCDHGA6_uc003ljy.1_Silent_p.A907A|PCDHGA7_uc003lka.1_Silent_p.A907A|PCDHGB4_uc003lkc.1_Silent_p.A898A|PCDHGA8_uc003lkd.1_Silent_p.A907A|PCDHGB5_uc003lkf.1_Silent_p.A898A|PCDHGA9_uc003lkh.1_Silent_p.A907A|PCDHGB6_uc003lkj.1_Silent_p.A905A|PCDHGA10_uc003lkl.1_Silent_p.A911A|PCDHGB7_uc003lkn.1_Silent_p.A904A|PCDHGA11_uc003lkp.1_Silent_p.A725A|PCDHGA11_uc003lkq.1_Silent_p.A910A|PCDHGA12_uc003lkt.1_Silent_p.A907A|PCDHGC3_uc003lkv.1_Silent_p.A909A|PCDHGC3_uc003lkw.1_Silent_p.A109A|PCDHGC4_uc003lky.1_Silent_p.A913A	p.A919A	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		4	2757	+			919			Cytoplasmic (Potential).		O15100|Q6UW70|Q9Y5D7	Silent	SNP	ENST00000252085.3	37	c.2757A>G	CCDS4260.1																																																																																				0.602	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735		15	65	0	0	0	0.00499	0	15	65				
SLC36A1	206358	broad.mit.edu	37	5	150846759	150846759	+	Splice_Site	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:150846759G>C	ENST00000243389.3	+	6	642		c.e6-1		SLC36A1_ENST00000429484.2_Splice_Site|SLC36A1_ENST00000520701.1_Splice_Site|SLC36A1_ENST00000521925.1_Splice_Site	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1						amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)	p.?(1)		endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	CCCACCTCCAGACGTGTTGTG	0.423																																					Melanoma(151;1534 1860 12947 32979 37872)	Melanoma(151;1534 1860 12947 32979 37872)	uc003luc.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e6-1		solute carrier family 36 member 1	Glycine(DB00145)|L-Alanine(DB00160)						187.0	173.0	178.0					5																	150846759		2203	4300	6503	SO:0001630	splice_region_variant	206358				cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity	g.chr5:150846759G>C	AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.420-1G>C	5.37:g.150846759G>C						GM2A_uc011dcs.1_Intron|SLC36A1_uc003lub.1_Splice_Site_p.R140_splice|SLC36A1_uc010jhw.1_Splice_Site_p.R140_splice	p.R140_splice	NM_078483	NP_510968	Q7Z2H8	S36A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		6	637	+		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)						C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Splice_Site	SNP	ENST00000243389.3	37	c.420_splice	CCDS4316.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505001	0.44558	.	.	ENSG00000123643	ENST00000520701;ENST00000429484;ENST00000243389;ENST00000456739;ENST00000521925	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5913	0.91214	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC36A1	150826952	1.000000	0.71417	0.990000	0.47175	0.224000	0.24922	9.113000	0.94321	2.614000	0.88457	0.563000	0.77884	.		0.423	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252433.1	NM_078483	Intron	31	80	0	0	0	0.003271	0	31	80				
FAT2	2196	broad.mit.edu	37	5	150887062	150887062	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:150887062G>A	ENST00000261800.5	-	22	12182	c.12170C>T	c.(12169-12171)gCg>gTg	p.A4057V	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	4057					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A4057V(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATAATGAACGCCACGGCCAC	0.582																																							uc003lue.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(12169-12171)GCG>GTG		FAT tumor suppressor 2 precursor							62.0	62.0	62.0					5																	150887062		2203	4300	6503	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150887062G>A	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.12170C>T	5.37:g.150887062G>A	ENSP00000261800:p.Ala4057Val					GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.A664V	p.A4057V	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		22	12183	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	4057			Helical; (Potential).		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.12170C>T	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	1.387	-0.581963	0.03827	.	.	ENSG00000086570	ENST00000261800	T	0.71222	-0.55	5.46	-1.87	0.07737	Concanavalin A-like lectin/glucanase, subgroup (1);	2.497930	0.01567	N	0.020415	T	0.55162	0.1903	L	0.27053	0.805	0.09310	N	1	B;B	0.18461	0.028;0.002	B;B	0.12156	0.007;0.0	T	0.49570	-0.8926	10	0.02654	T	1	.	11.9139	0.52755	0.5066:0.0:0.4934:0.0	.	4057;1162	Q9NYQ8;E9PDJ8	FAT2_HUMAN;.	V	4057	ENSP00000261800:A4057V	ENSP00000261800:A4057V	A	-	2	0	FAT2	150867255	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	1.609000	0.36858	-0.227000	0.09884	-1.021000	0.02439	GCG		0.582	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		7	53	0	0	0	0.00308	0	7	53				
EBF1	1879	broad.mit.edu	37	5	158139237	158139237	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:158139237C>A	ENST00000313708.6	-	14	1756	c.1474G>T	c.(1474-1476)Ggc>Tgc	p.G492C	EBF1_ENST00000380654.4_Missense_Mutation_p.G461C|EBF1_ENST00000517373.1_Intron|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	492	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G492C(1)	HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCGGCAGAGCCGTATCCGTTC	0.582			T	HMGA2	lipoma																																		uc010jip.2		NA		Dom	yes		5	5q34	1879	T	early B-cell factor 1			M	HMGA2		lipoma	HMGA2/EBF1(2)	1	Substitution - Missense(1)		lung(1)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(1474-1476)GGC>TGC		early B-cell factor							105.0	75.0	85.0					5																	158139237		2203	4300	6503	SO:0001583	missense	1879				multicellular organismal development	nucleus	DNA binding|metal ion binding	g.chr5:158139237C>A	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1474G>T	5.37:g.158139237C>A	ENSP00000322898:p.Gly492Cys					EBF1_uc011ddw.1_Missense_Mutation_p.G360C|EBF1_uc011ddx.1_Missense_Mutation_p.G493C|EBF1_uc003lxl.3_Missense_Mutation_p.G461C	p.G492C	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		14	1776	-	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	492			Pro/Ser/Thr-rich.		Q8IW11	Missense_Mutation	SNP	ENST00000313708.6	37	c.1474G>T	CCDS4343.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595981	0.86953	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654	T;T	0.48522	0.81;0.81	4.92	4.92	0.64577	.	0.114561	0.64402	D	0.000018	T	0.67411	0.2890	M	0.72894	2.215	0.80722	D	1	P;D;D;D	0.64830	0.949;0.994;0.989;0.989	P;P;P;D	0.64237	0.653;0.848;0.908;0.923	T	0.71951	-0.4437	10	0.87932	D	0	-6.8825	18.4976	0.90870	0.0:1.0:0.0:0.0	.	492;479;492;461	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	C	492;492;461	ENSP00000322898:G492C;ENSP00000370029:G461C	ENSP00000322898:G492C	G	-	1	0	EBF1	158071815	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.769000	0.85360	2.428000	0.82296	0.650000	0.86243	GGC		0.582	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007		6	12	1	0	2.0095e-06	0.001984	2.44367e-06	6	12				
GABRP	2568	broad.mit.edu	37	5	170224482	170224482	+	Silent	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:170224482T>A	ENST00000518525.1	+	7	935	c.471T>A	c.(469-471)acT>acA	p.T157T	GABRP_ENST00000519385.1_Silent_p.T157T|GABRP_ENST00000265294.4_Silent_p.T157T|GABRP_ENST00000519598.1_Silent_p.T157T			O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	157					signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T157T(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(4)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	29	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCACGACAACTGTTGCATGTA	0.418																																							uc003mau.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(469-471)ACT>ACA		gamma-aminobutyric acid (GABA) A receptor, pi							150.0	136.0	141.0					5																	170224482		2203	4300	6503	SO:0001819	synonymous_variant	2568					cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr5:170224482T>A	U95367	CCDS4375.1, CCDS75368.1	5q35.1	2012-06-22			ENSG00000094755	ENSG00000094755		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4089	protein-coding gene	gene with protein product	"""GABA(A) receptor, pi"""	602729				9182563	Standard	NM_014211		Approved		uc003mau.3	O00591	OTTHUMG00000130443	ENST00000518525.1:c.471T>A	5.37:g.170224482T>A						GABRP_uc011dev.1_Silent_p.T157T	p.T157T	NM_014211	NP_055026	O00591	GBRP_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		6	669	+	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	157			Extracellular (Potential).		A8KA36|D3DQL2|Q32MJ1	Silent	SNP	ENST00000518525.1	37	c.471T>A	CCDS4375.1																																																																																				0.418	GABRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252834.3	NM_014211		15	45	0	0	0	0.00499	0	15	45				
CDHR2	54825	broad.mit.edu	37	5	176002154	176002154	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:176002154G>C	ENST00000510636.1	+	8	839	c.565G>C	c.(565-567)Ggc>Cgc	p.G189R	CDHR2_ENST00000261944.5_Missense_Mutation_p.G189R|CDHR2_ENST00000506348.1_Missense_Mutation_p.G189R	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	189	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G189R(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						AGTCCTCAATGGCAGCCTCAG	0.627																																							uc003mem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(565-567)GGC>CGC		protocadherin LKC precursor							85.0	82.0	83.0					5																	176002154		2203	4300	6503	SO:0001583	missense	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176002154G>C	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.565G>C	5.37:g.176002154G>C	ENSP00000424565:p.Gly189Arg					CDHR2_uc003men.1_Missense_Mutation_p.G189R	p.G189R	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN			8	631	+			189			Extracellular (Potential).|Cadherin 2.		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	c.565G>C	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530666	0.45073	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.58940	0.3;0.3;0.3	4.01	4.01	0.46588	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.44052	0.1275	L	0.39898	1.24	0.09310	N	0.999997	B	0.31581	0.329	B	0.30251	0.113	T	0.22765	-1.0207	9	0.09338	T	0.73	-18.6856	11.0163	0.47691	0.0946:0.0:0.9054:0.0	.	189	Q9BYE9	CDHR2_HUMAN	R	189	ENSP00000424565:G189R;ENSP00000261944:G189R;ENSP00000421078:G189R	ENSP00000261944:G189R	G	+	1	0	CDHR2	175934760	0.484000	0.25964	0.975000	0.42487	0.867000	0.49689	3.885000	0.56182	2.067000	0.61834	0.478000	0.44815	GGC		0.627	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		26	61	0	0	0	0.00632	0	26	61				
TUBB2B	347733	broad.mit.edu	37	6	3225005	3225005	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:3225005C>T	ENST00000259818.7	-	4	1509	c.1318G>A	c.(1318-1320)Gag>Aag	p.E440K	TUBB2B_ENST00000473006.1_5'UTR	NM_178012.4	NP_821080.1	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B class IIb	440					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|neuron migration (GO:0001764)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.E440K(1)		kidney(2)|large_intestine(5)|lung(1)|prostate(1)|skin(1)	10	Ovarian(93;0.0386)	all_hematologic(90;0.108)				TCCTCGCCCTCCTCCTCCTCG	0.652																																							uc003mvg.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1318-1320)GAG>AAG		tubulin, beta 2B							82.0	60.0	67.0					6																	3225005		2203	4300	6503	SO:0001583	missense	347733				'de novo' posttranslational protein folding|microtubule-based movement|neuron migration|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr6:3225005C>T	BC001352	CCDS4485.1	6p25.2	2011-10-10	2011-10-10		ENSG00000137285	ENSG00000137285		"""Tubulins"""	30829	protein-coding gene	gene with protein product	"""class IIb beta-tubulin"""	612850	"""tubulin, beta 2B"""			8619474, 9110174	Standard	NM_178012		Approved	MGC8685, DKFZp566F223, bA506K6.1	uc003mvg.3	Q9BVA1	OTTHUMG00000014143	ENST00000259818.7:c.1318G>A	6.37:g.3225005C>T	ENSP00000259818:p.Glu440Lys					TUBB2B_uc010jnj.2_Missense_Mutation_p.E403K|TUBB2B_uc010jnk.2_Missense_Mutation_p.E368K|TUBB2B_uc003mvh.2_Missense_Mutation_p.E413K|uc011dhu.1_RNA	p.E440K	NM_178012	NP_821080	Q9BVA1	TBB2B_HUMAN			4	1509	-	Ovarian(93;0.0386)	all_hematologic(90;0.108)	440					A8K068	Missense_Mutation	SNP	ENST00000259818.7	37	c.1318G>A	CCDS4485.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067139	0.55539	.	.	ENSG00000137285	ENST00000259818	T	0.71579	-0.58	5.23	5.23	0.72850	.	0.222213	0.30630	N	0.009207	T	0.62011	0.2393	L	0.47716	1.5	0.58432	D	0.999995	P	0.34587	0.458	B	0.39152	0.292	T	0.69049	-0.5248	10	0.87932	D	0	.	18.8058	0.92037	0.0:1.0:0.0:0.0	.	440	Q9BVA1	TBB2B_HUMAN	K	440	ENSP00000259818:E440K	ENSP00000259818:E440K	E	-	1	0	TUBB2B	3170004	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.551000	0.82182	2.455000	0.83008	0.609000	0.83330	GAG		0.652	TUBB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039680.2	NM_178012		18	38	0	0	0	0.002299	0	18	38				
RANBP9	10048	broad.mit.edu	37	6	13644892	13644892	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:13644892G>C	ENST00000011619.3	-	6	1055	c.997C>G	c.(997-999)Cct>Gct	p.P333A	RANBP9_ENST00000539980.1_Missense_Mutation_p.P104A	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	333	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)	p.P333A(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			AACACGAAAGGATGTTGCCCA	0.423																																							uc003nbb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|skin(1)	2						c.(997-999)CCT>GCT		RAN binding protein 9							122.0	114.0	117.0					6																	13644892		2203	4300	6503	SO:0001583	missense	10048				axon guidance|microtubule nucleation|protein complex assembly	cytosol|microtubule associated complex|nucleus	Ran GTPase binding	g.chr6:13644892G>C	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.997C>G	6.37:g.13644892G>C	ENSP00000011619:p.Pro333Ala					RANBP9_uc003nba.2_Translation_Start_Site	p.P333A	NM_005493	NP_005484	Q96S59	RANB9_HUMAN	Epithelial(50;0.223)		6	1056	-	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	333			B30.2/SPRY.		A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	37	c.997C>G	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708988	0.89018	.	.	ENSG00000010017	ENST00000011619;ENST00000539980	T;T	0.61274	0.12;0.12	5.17	5.17	0.71159	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	T	0.75598	0.3871	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78836	-0.2047	10	0.66056	D	0.02	-11.669	19.037	0.92983	0.0:0.0:1.0:0.0	.	333	Q96S59	RANB9_HUMAN	A	333;104	ENSP00000011619:P333A;ENSP00000438162:P104A	ENSP00000011619:P333A	P	-	1	0	RANBP9	13752871	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.813000	0.99286	2.557000	0.86248	0.557000	0.71058	CCT		0.423	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1			22	82	0	0	0	0.002299	0	22	82				
HIST1H2AC	8334	broad.mit.edu	37	6	26124812	26124812	+	Missense_Mutation	SNP	C	C	G	rs199572605		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:26124812C>G	ENST00000602637.1	+	1	382	c.352C>G	c.(352-354)Cct>Gct	p.P118A	HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2AC_ENST00000377791.2_Missense_Mutation_p.P118A|HIST1H2BC_ENST00000314332.5_5'Flank			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	118						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P118A(1)|p.P118T(1)		NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						CGTGCTTCTGCCTAAGAAGAC	0.567																																							uc003ngm.2		NA																	2	Substitution - Missense(2)		haematopoietic_and_lymphoid_tissue(1)|lung(1)		0						c.(352-354)CCT>GCT		histone cluster 1, H2ac							78.0	79.0	79.0					6																	26124812		2203	4300	6503	SO:0001583	missense	8334				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:26124812C>G	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.352C>G	6.37:g.26124812C>G	ENSP00000473534:p.Pro118Ala					HIST1H2BC_uc003ngk.3_5'Flank|HIST1H2BC_uc003ngl.2_5'Flank|HIST1H2AC_uc003ngn.2_RNA|HIST1H2AC_uc003ngo.2_RNA|HIST1H2AC_uc003ngp.2_Missense_Mutation_p.P118A	p.P118A	NM_003512	NP_003503	Q93077	H2A1C_HUMAN			1	440	+			118					B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Missense_Mutation	SNP	ENST00000602637.1	37	c.352C>G	CCDS4585.1	.	.	.	.	.	.	.	.	.	.	.	12.99	2.102721	0.37145	.	.	ENSG00000180573	ENST00000377791;ENST00000314088	T;T	0.52295	0.67;0.67	5.5	5.5	0.81552	Histone-fold (2);Histone H2A (2);	0.000000	0.44285	D	0.000475	T	0.39489	0.1080	M	0.70595	2.14	0.52099	D	0.999942	B	0.28324	0.207	B	0.22880	0.042	T	0.42882	-0.9425	10	0.72032	D	0.01	.	18.7477	0.91800	0.0:1.0:0.0:0.0	.	118	Q93077	H2A1C_HUMAN	A	118	ENSP00000367022:P118A;ENSP00000321389:P118A	ENSP00000321389:P118A	P	+	1	0	HIST1H2AC	26232791	1.000000	0.71417	1.000000	0.80357	0.364000	0.29643	7.726000	0.84824	2.750000	0.94351	0.467000	0.42956	CCT		0.567	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	NM_003512		25	51	0	0	0	0.00632	0	25	51				
HIST1H3H	8357	broad.mit.edu	37	6	27778257	27778257	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:27778257G>T	ENST00000369163.2	+	1	416	c.406G>T	c.(406-408)Gct>Tct	p.A136S	HIST1H2BL_ENST00000377401.2_5'Flank	NM_003536.2	NP_003527.1	P68431	H31_HUMAN	histone cluster 1, H3h	136					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.A136S(1)		haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)|upper_aerodigestive_tract(3)	10						CGGCGAGAGGGCTTGAGTCTC	0.552																																							uc003njm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(406-408)GCT>TCT		histone cluster 1, H3h							56.0	48.0	51.0					6																	27778257		2203	4300	6503	SO:0001583	missense	8357				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:27778257G>T	Z83735	CCDS4627.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000203813	ENSG00000278828		"""Histones / Replication-dependent"""	4775	protein-coding gene	gene with protein product		602818	"""H3 histone family, member K"", ""histone 1, H3h"""	H3FK		9439656, 12408966	Standard	NM_003536		Approved	H3/k, H3F1K	uc003njm.3	P68431	OTTHUMG00000014483	ENST00000369163.2:c.406G>T	6.37:g.27778257G>T	ENSP00000358160:p.Ala136Ser					HIST1H2BL_uc003njl.2_5'Flank	p.A136S	NM_003536	NP_003527	P68431	H31_HUMAN			1	416	+			136					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000369163.2	37	c.406G>T	CCDS4627.1	.	.	.	.	.	.	.	.	.	.	.	11.07	1.529423	0.27387	.	.	ENSG00000203813	ENST00000369163	T	0.50548	0.74	4.59	4.59	0.56863	.	.	.	.	.	T	0.56630	0.1998	.	.	.	0.43050	D	0.994653	.	.	.	.	.	.	T	0.59484	-0.7446	6	0.52906	T	0.07	.	17.2639	0.87079	0.0:0.0:1.0:0.0	.	.	.	.	S	136	ENSP00000358160:A136S	ENSP00000358160:A136S	A	+	1	0	HIST1H3H	27886236	1.000000	0.71417	0.151000	0.22473	0.058000	0.15608	7.587000	0.82613	2.479000	0.83701	0.655000	0.94253	GCT		0.552	HIST1H3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040151.1	NM_003536		12	23	1	0	1.61879e-10	0.001368	2.29811e-10	12	23				
SKIV2L	6499	broad.mit.edu	37	6	31927176	31927176	+	Splice_Site	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:31927176G>A	ENST00000375394.2	+	2	238	c.125G>A	c.(124-126)aGc>aAc	p.S42N	SKIV2L_ENST00000544581.1_5'UTR|NELFE_ENST00000375429.3_5'Flank|NELFE_ENST00000444811.2_5'Flank|NELFE_ENST00000375425.5_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|MIR1236_ENST00000408340.1_RNA	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	42					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.S42N(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCAGAGAGTAGCGTGAGTGAC	0.572																																							uc003nyn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						c.(124-126)AGC>AAC		superkiller viralicidic activity 2-like homolog							139.0	158.0	152.0					6																	31927176		1511	2709	4220	SO:0001630	splice_region_variant	6499					nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding	g.chr6:31927176G>A		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.126+1G>A	6.37:g.31927176G>A						RDBP_uc003nyk.2_5'Flank|RDBP_uc011dot.1_5'Flank|RDBP_uc003nyl.1_5'Flank|RDBP_uc003nym.1_5'Flank|MIR1236_hsa-mir-1236|MI0006326_5'Flank|SKIV2L_uc011dou.1_5'UTR|SKIV2L_uc011dov.1_5'UTR	p.S42N	NM_006929	NP_008860	Q15477	SKIV2_HUMAN			2	514	+			42					O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	c.125G>A	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817857	0.32145	.	.	ENSG00000204351	ENST00000375394	T	0.43688	0.94	4.96	4.09	0.47781	.	0.167024	0.52532	D	0.000076	T	0.16514	0.0397	L	0.27053	0.805	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.07139	-1.0788	10	0.62326	D	0.03	-6.9573	11.2608	0.49083	0.0:0.8115:0.1885:0.0	.	42	Q15477	SKIV2_HUMAN	N	42	ENSP00000364543:S42N	ENSP00000364543:S42N	S	+	2	0	SKIV2L	32035155	0.951000	0.32395	0.994000	0.49952	0.389000	0.30415	1.940000	0.40223	1.317000	0.45149	-0.147000	0.13772	AGC		0.572	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		Missense_Mutation	45	112	0	0	0	0.002522	0	45	112				
RNF5	6048	broad.mit.edu	37	6	32146358	32146358	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:32146358A>G	ENST00000375094.3	+	1	228	c.70A>G	c.(70-72)Acc>Gcc	p.T24A	RNF5_ENST00000427134.2_Missense_Mutation_p.T24A|AGPAT1_ENST00000375104.2_5'Flank|RNF5_ENST00000487940.1_3'UTR|AGPAT1_ENST00000336984.6_5'Flank|AGPAT1_ENST00000395499.1_5'Flank|AGPAT1_ENST00000490711.1_5'Flank|AGPAT1_ENST00000395497.1_5'Flank|AGPAT1_ENST00000412465.2_5'Flank|AGPAT1_ENST00000375107.3_5'Flank	NM_006913.3	NP_008844.1	Q99942	RNF5_HUMAN	ring finger protein 5, E3 ubiquitin protein ligase	24					cellular protein catabolic process (GO:0044257)|ER-associated misfolded protein catabolic process (GO:0071712)|negative regulation of autophagy (GO:0010507)|protein destabilization (GO:0031648)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of autophagic vacuole assembly (GO:2000785)|response to bacterium (GO:0009617)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T24A(1)		endometrium(1)|lung(7)|urinary_tract(2)	10						GGCGGGCGCGACCTTCGAATG	0.642																																							uc003oaj.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(70-72)ACC>GCC		ring finger protein 5							34.0	42.0	39.0					6																	32146358		1505	2699	4204	SO:0001583	missense	6048				ER-associated misfolded protein catabolic process|protein K48-linked ubiquitination|protein K63-linked ubiquitination	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr6:32146358A>G	U89336	CCDS4745.1	6p21.31	2013-01-09	2012-02-23			ENSG00000204308		"""RING-type (C3HC4) zinc fingers"""	10068	protein-coding gene	gene with protein product		602677	"""ring finger protein 5"""			9533025	Standard	NM_006913		Approved	NG2, G16, RING5, RMA1	uc031snv.1	Q99942	OTTHUMG00000031093	ENST00000375094.3:c.70A>G	6.37:g.32146358A>G	ENSP00000364235:p.Thr24Ala					AGPAT1_uc003oae.2_5'Flank|AGPAT1_uc011dpk.1_5'Flank|AGPAT1_uc003oaf.2_5'Flank|AGPAT1_uc003oag.2_5'Flank|AGPAT1_uc003oah.2_5'Flank|AGPAT1_uc003oai.1_5'Flank|AGPAT1_uc011dpl.1_5'Flank	p.T24A	NM_006913	NP_008844	Q99942	RNF5_HUMAN			1	197	+			24					A2BFI6|B2R4K3|Q0VDB7|Q9UMQ2	Missense_Mutation	SNP	ENST00000375094.3	37	c.70A>G	CCDS4745.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825175	0.32237	.	.	ENSG00000204308	ENST00000375094;ENST00000427134	T;T	0.16457	2.34;2.34	4.42	3.28	0.37604	Zinc finger, RING/FYVE/PHD-type (1);	0.138056	0.48286	D	0.000191	T	0.01976	0.0062	N	0.11845	0.185	0.36342	D	0.859523	B	0.13145	0.007	B	0.12156	0.007	T	0.41980	-0.9478	10	0.02654	T	1	0.4467	5.0494	0.14501	0.7945:0.0:0.2055:0.0	.	24	Q99942	RNF5_HUMAN	A	24	ENSP00000364235:T24A;ENSP00000407656:T24A	ENSP00000364235:T24A	T	+	1	0	RNF5	32254336	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.321000	0.51999	1.970000	0.57323	0.460000	0.39030	ACC		0.642	RNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076133.2	NM_006913		14	37	0	0	0	0.006122	0	14	37				
BRD2	6046	broad.mit.edu	37	6	32943245	32943245	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:32943245G>A	ENST00000374825.4	+	4	2119	c.418G>A	c.(418-420)Gag>Aag	p.E140K	BRD2_ENST00000395287.1_Missense_Mutation_p.E140K|BRD2_ENST00000449085.2_Missense_Mutation_p.E93K|BRD2_ENST00000395289.2_Missense_Mutation_p.E140K|XXbac-BPG181M17.6_ENST00000580587.1_RNA|BRD2_ENST00000443797.2_Missense_Mutation_p.E20K|BRD2_ENST00000374831.4_Missense_Mutation_p.E140K	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	140	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)	p.E140K(1)		central_nervous_system(3)|stomach(2)	5						GGCTGCTTCAGAGTGTATGCA	0.333																																							uc003ocn.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|stomach(2)	5						c.(418-420)GAG>AAG		bromodomain containing 2							90.0	87.0	88.0					6																	32943245		1510	2709	4219	SO:0001583	missense	6046				spermatogenesis	nucleus	protein serine/threonine kinase activity	g.chr6:32943245G>A	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.418G>A	6.37:g.32943245G>A	ENSP00000363958:p.Glu140Lys					BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Missense_Mutation_p.E140K|BRD2_uc003ocp.3_Missense_Mutation_p.E20K|BRD2_uc010juh.2_Missense_Mutation_p.E140K	p.E140K	NM_005104	NP_005095	P25440	BRD2_HUMAN			4	2119	+			140			Bromo 1.		A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	ENST00000374825.4	37	c.418G>A	CCDS4762.1	.	.	.	.	.	.	.	.	.	.	G	34	5.398999	0.96030	.	.	ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38	5.63	5.63	0.86233	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.51477	D	0.000097	T	0.63200	0.2491	M	0.90369	3.11	0.80722	D	1	D;D	0.76494	0.999;0.991	D;D	0.78314	0.991;0.967	T	0.69176	-0.5214	10	0.87932	D	0	-27.1897	17.2219	0.86960	0.0:0.0:1.0:0.0	.	140;140	A2AAU0;P25440	.;BRD2_HUMAN	K	140;140;140;20;140;93	ENSP00000363958:E140K;ENSP00000363964:E140K;ENSP00000378704:E140K;ENSP00000413495:E20K;ENSP00000378702:E140K;ENSP00000409145:E93K	ENSP00000363958:E140K	E	+	1	0	BRD2	33051223	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.592000	0.98245	2.932000	0.99384	0.643000	0.83706	GAG		0.333	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2			11	46	0	0	0	0.000978	0	11	46				
TCP11	6954	broad.mit.edu	37	6	35088692	35088692	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:35088692G>T	ENST00000512012.1	-	5	865	c.709C>A	c.(709-711)Cag>Aag	p.Q237K	TCP11_ENST00000418521.2_Missense_Mutation_p.Q174K|TCP11_ENST00000373979.2_Missense_Mutation_p.Q175K|TCP11_ENST00000244645.3_Missense_Mutation_p.Q175K|TCP11_ENST00000373974.4_Missense_Mutation_p.Q204K|TCP11_ENST00000311875.5_Missense_Mutation_p.Q250K|TCP11_ENST00000412155.2_Missense_Mutation_p.Q199K|TCP11_ENST00000444780.2_Missense_Mutation_p.Q245K			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	237					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.Q250K(1)|p.Q175K(1)		breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						ATACTAGGCTGCTTATTGAGG	0.418																																							uc003okd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)	5						c.(748-750)CAG>AAG		t-complex 11 isoform 1							320.0	337.0	331.0					6																	35088692		2203	4300	6503	SO:0001583	missense	6954				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr6:35088692G>T		CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.709C>A	6.37:g.35088692G>T	ENSP00000425995:p.Gln237Lys					TCP11_uc003ojz.1_Missense_Mutation_p.Q175K|TCP11_uc003oka.2_Missense_Mutation_p.Q175K|TCP11_uc003okb.2_Missense_Mutation_p.Q174K|TCP11_uc003okc.2_Missense_Mutation_p.Q174K|TCP11_uc011dsu.1_Missense_Mutation_p.Q232K|TCP11_uc011dsv.1_Missense_Mutation_p.Q199K|TCP11_uc011dsw.1_Missense_Mutation_p.Q204K	p.Q250K	NM_001093728	NP_001087197	Q8WWU5	TCP11_HUMAN			6	929	-			237					B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	ENST00000512012.1	37	c.748C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.00|16.00	2.997523|2.997523	0.54147|0.54147	.|.	.|.	ENSG00000124678|ENSG00000124678	ENST00000502480|ENST00000373979;ENST00000412155;ENST00000244645;ENST00000373977;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012;ENST00000486638	.|T;T;T;T;T;T;T;T;T	.|0.11604	.|2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76	4.32|4.32	2.32|2.32	0.28847|0.28847	.|.	.|0.512498	.|0.20186	.|N	.|0.097407	T|T	0.10551|0.10551	0.0258|0.0258	M|M	0.83603|0.83603	2.65|2.65	0.22771|0.22771	N|N	0.998754|0.998754	.|P;P;P;P;P;P	.|0.44281	.|0.633;0.633;0.633;0.831;0.633;0.721	.|P;P;P;P;P;B	.|0.54100	.|0.543;0.543;0.622;0.742;0.622;0.373	T|T	0.14504|0.14504	-1.0470|-1.0470	5|10	.|0.22109	.|T	.|0.4	-4.9275|-4.9275	5.3519|5.3519	0.16040|0.16040	0.086:0.1487:0.6222:0.1432|0.086:0.1487:0.6222:0.1432	.|.	.|204;199;245;310;237;175	.|B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.|.;.;.;.;TCP11_HUMAN;.	E|K	44|175;199;175;199;250;245;204;174;237;96	.|ENSP00000363091:Q175K;ENSP00000402816:Q199K;ENSP00000244645:Q175K;ENSP00000308708:Q250K;ENSP00000404479:Q245K;ENSP00000363085:Q204K;ENSP00000415320:Q174K;ENSP00000425995:Q237K;ENSP00000421103:Q96K	.|ENSP00000244645:Q175K	A|Q	-|-	2|1	0|0	TCP11|TCP11	35196670|35196670	0.993000|0.993000	0.37304|0.37304	0.709000|0.709000	0.30452|0.30452	0.170000|0.170000	0.22686|0.22686	1.320000|1.320000	0.33666|0.33666	1.128000|1.128000	0.42052|0.42052	0.563000|0.563000	0.77884|0.77884	GCA|CAG		0.418	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728		111	280	1	0	1.9213e-43	0.00361	3.62595e-43	111	280				
STK38	11329	broad.mit.edu	37	6	36485593	36485593	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:36485593C>A	ENST00000229812.7	-	6	700	c.415G>T	c.(415-417)Gac>Tac	p.D139Y		NM_007271.2	NP_009202.1			serine/threonine kinase 38									p.D139Y(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACTAGAATGTCACGCTCCGCA	0.403																																					Colon(180;997 3561 16158)	Colon(180;997 3561 16158)	uc003omg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6						c.(415-417)GAC>TAC		serine/threonine kinase 38							120.0	110.0	113.0					6																	36485593		2203	4300	6503	SO:0001583	missense	11329				intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity	g.chr6:36485593C>A		CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.415G>T	6.37:g.36485593C>A	ENSP00000229812:p.Asp139Tyr					STK38_uc003omh.2_Missense_Mutation_p.D139Y|STK38_uc003omi.2_Missense_Mutation_p.D139Y	p.D139Y	NM_007271	NP_009202	Q15208	STK38_HUMAN			5	1003	-			139			Protein kinase.			Missense_Mutation	SNP	ENST00000229812.7	37	c.415G>T	CCDS4822.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745517	0.89663	.	.	ENSG00000112079	ENST00000229812	T	0.64991	-0.13	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74520	0.3727	L	0.59912	1.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75277	-0.3374	10	0.87932	D	0	.	20.2019	0.98263	0.0:1.0:0.0:0.0	.	139	Q15208	STK38_HUMAN	Y	139	ENSP00000229812:D139Y	ENSP00000229812:D139Y	D	-	1	0	STK38	36593571	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.776000	0.95493	0.655000	0.94253	GAC		0.403	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040346.1	NM_007271		17	59	1	0	9.7654e-05	0.007413	0.000113129	17	59				
LRRC73	221424	broad.mit.edu	37	6	43476063	43476063	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:43476063C>A	ENST00000372441.1	-	3	1429	c.529G>T	c.(529-531)Gtc>Ttc	p.V177F		NM_001012974.1	NP_001012992.1	Q5JTD7	LRC73_HUMAN	leucine rich repeat containing 73	177								p.V177F(1)									AGATTGAGGACGCGGACCTGG	0.607																																							uc003ovk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(529-531)GTC>TTC		hypothetical protein LOC221424							53.0	53.0	53.0					6																	43476063		2203	4300	6503	SO:0001583	missense	221424							g.chr6:43476063C>A		CCDS34456.1	6p21.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000204052	ENSG00000204052			21375	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 154"""	C6orf154			Standard	NM_001012974		Approved	dJ337H4.2	uc003ovk.2	Q5JTD7	OTTHUMG00000014737	ENST00000372441.1:c.529G>T	6.37:g.43476063C>A	ENSP00000361518:p.Val177Phe					C6orf154_uc003ovj.1_Intron	p.V177F	NM_001012974	NP_001012992	Q5JTD7	CF154_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)		3	1430	-	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		177			LRR 5.			Missense_Mutation	SNP	ENST00000372441.1	37	c.529G>T	CCDS34456.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795588	0.70452	.	.	ENSG00000204052	ENST00000372441	T	0.55234	0.53	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.34629	0.0904	L	0.47716	1.5	0.80722	D	1	P	0.47910	0.902	B	0.43680	0.427	T	0.19386	-1.0307	10	0.10377	T	0.69	-17.8451	17.4538	0.87600	0.0:1.0:0.0:0.0	.	177	Q5JTD7	CF154_HUMAN	F	177	ENSP00000361518:V177F	ENSP00000361518:V177F	V	-	1	0	C6orf154	43584041	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.434000	0.66526	2.533000	0.85409	0.650000	0.86243	GTC		0.607	LRRC73-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040635.1	NM_001012974		18	25	1	0	3.32936e-07	0.006122	4.15191e-07	18	25				
RHAG	6005	broad.mit.edu	37	6	49578778	49578778	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:49578778G>T	ENST00000371175.4	-	7	1052	c.1026C>A	c.(1024-1026)ggC>ggA	p.G342G	RHAG_ENST00000229810.7_Intron	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	342					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.G342G(1)		NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					TGCCTGCAAGGCCTCCCACTA	0.473																																					Ovarian(176;476 2003 7720 43408 44749)	Ovarian(176;476 2003 7720 43408 44749)	uc003ozk.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|skin(1)	2						c.(1024-1026)GGC>GGA		Rh-associated glycoprotein							97.0	93.0	94.0					6																	49578778		2203	4300	6503	SO:0001819	synonymous_variant	6005				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding	g.chr6:49578778G>T		CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.1026C>A	6.37:g.49578778G>T						RHAG_uc010jzl.2_Silent_p.G342G|RHAG_uc010jzm.2_Intron	p.G342G	NM_000324	NP_000315	Q02094	RHAG_HUMAN			7	1088	-	Lung NSC(77;0.0255)		342			Helical; (Potential).		B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Silent	SNP	ENST00000371175.4	37	c.1026C>A	CCDS4927.1																																																																																				0.473	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043806.1			14	52	1	0	1.3612e-06	0.003163	1.66806e-06	14	52				
PGK2	5232	broad.mit.edu	37	6	49754274	49754274	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:49754274C>A	ENST00000304801.3	-	1	779	c.627G>T	c.(625-627)ctG>ctT	p.L209L		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	209					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.L209L(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CAAGTATAGCCAGAAAGGGTC	0.428																																							uc003ozu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(625-627)CTG>CTT		phosphoglycerate kinase 2							116.0	113.0	114.0					6																	49754274		2203	4300	6503	SO:0001819	synonymous_variant	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49754274C>A	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.627G>T	6.37:g.49754274C>A							p.L209L	NM_138733	NP_620061	P07205	PGK2_HUMAN			1	734	-	Lung NSC(77;0.0402)		209					B2R6Y8|Q9H107	Silent	SNP	ENST00000304801.3	37	c.627G>T	CCDS4930.1																																																																																				0.428	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			35	84	1	0	4.34311e-12	0.003271	6.43873e-12	35	84				
GSTA2	2939	broad.mit.edu	37	6	52617725	52617725	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:52617725G>A	ENST00000493422.1	-	5	496	c.341C>T	c.(340-342)cCt>cTt	p.P114L		NM_000846.4	NP_000837.3	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	114	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.P114L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Chloroquine(DB00608)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Vitamin E(DB00163)	TTGTTCCTCAGGTTGACTAAA	0.388																																							uc003pay.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(340-342)CCT>CTT		glutathione S-transferase alpha 2	Aminophenazone(DB01424)|Amsacrine(DB00276)|Busulfan(DB01008)|Chlorambucil(DB00291)|Chloroquine(DB00608)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Mechlorethamine(DB00888)|Praziquantel(DB01058)|Vitamin E(DB00163)						225.0	213.0	217.0					6																	52617725		2203	4300	6503	SO:0001583	missense	2939				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr6:52617725G>A	AL109918	CCDS4944.1	6p12.2	2012-06-21	2008-11-26		ENSG00000244067	ENSG00000244067	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4627	protein-coding gene	gene with protein product		138360	"""glutathione S-transferase A2"""	GST2			Standard	NM_000846		Approved		uc003pay.3	P09210	OTTHUMG00000016263	ENST00000493422.1:c.341C>T	6.37:g.52617725G>A	ENSP00000420168:p.Pro114Leu						p.P114L	NM_000846	NP_000837	P09210	GSTA2_HUMAN			5	491	-	Lung NSC(77;0.118)		114			GST C-terminal.		Q12759|Q16491|Q9NTY6	Missense_Mutation	SNP	ENST00000493422.1	37	c.341C>T	CCDS4944.1	.	.	.	.	.	.	.	.	.	.	g	8.344	0.829391	0.16749	.	.	ENSG00000244067	ENST00000493422	T	0.02197	4.4	2.26	1.36	0.22044	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.216123	0.29868	N	0.010987	T	0.01870	0.0059	M	0.91717	3.235	0.09310	N	1	B	0.26363	0.147	B	0.29524	0.103	T	0.28490	-1.0042	10	0.87932	D	0	.	4.687	0.12762	0.0:0.2479:0.4988:0.2533	.	114	P09210	GSTA2_HUMAN	L	114	ENSP00000420168:P114L	ENSP00000420168:P114L	P	-	2	0	GSTA2	52725684	0.043000	0.20138	0.012000	0.15200	0.078000	0.17371	1.716000	0.37981	0.516000	0.28340	0.306000	0.20318	CCT		0.388	GSTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043589.1	NM_000846		4	244	0	0	0	0.009096	0	4	244				
LRRC1	55227	broad.mit.edu	37	6	53706983	53706983	+	Missense_Mutation	SNP	G	G	T	rs368836742		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:53706983G>T	ENST00000370888.1	+	2	512	c.235G>T	c.(235-237)Gca>Tca	p.A79S	LRRC1_ENST00000370882.1_Missense_Mutation_p.A79S	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	79						cytoplasm (GO:0005737)|membrane (GO:0016020)		p.A79S(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		TCCAGAAATAGCAAACTTCAT	0.403																																							uc003pcd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(235-237)GCA>TCA		leucine rich repeat containing 1		G	SER/ALA	0,4406		0,0,2203	100.0	102.0	101.0		235	5.6	1.0	6		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRRC1	NM_018214.4	99	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	79/525	53706983	1,13005	2203	4300	6503	SO:0001583	missense	55227					cytoplasm|membrane		g.chr6:53706983G>T	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.235G>T	6.37:g.53706983G>T	ENSP00000359925:p.Ala79Ser						p.A79S	NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0745)	2	512	+	Lung NSC(77;0.0147)		79			LRR 3.		Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	c.235G>T	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402803	0.83230	0.0	1.16E-4	ENSG00000137269	ENST00000370888;ENST00000370882	T;T	0.56444	0.46;0.46	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.38241	0.1033	N	0.03917	-0.325	0.80722	D	1	D	0.56746	0.977	P	0.59357	0.856	T	0.51498	-0.8698	10	0.38643	T	0.18	.	18.8619	0.92276	0.0:0.0:1.0:0.0	.	79	Q9BTT6	LRRC1_HUMAN	S	79	ENSP00000359925:A79S;ENSP00000359919:A79S	ENSP00000359919:A79S	A	+	1	0	LRRC1	53814942	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.761000	0.94854	0.655000	0.94253	GCA		0.403	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168		15	47	1	0	0.000566183	0.00499	0.000633966	15	47				
COL21A1	81578	broad.mit.edu	37	6	56021688	56021688	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:56021688C>T	ENST00000244728.5	-	10	1828	c.1431G>A	c.(1429-1431)aaG>aaA	p.K477K	COL21A1_ENST00000535941.1_Silent_p.K477K|COL21A1_ENST00000370819.1_Silent_p.K474K	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	477	Collagen-like 1.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.K477K(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TACTCACAGGCTTACCATCTT	0.448																																							uc003pcs.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1429-1431)AAG>AAA		collagen, type XXI, alpha 1 precursor							64.0	62.0	63.0					6																	56021688		1903	4122	6025	SO:0001819	synonymous_variant	81578				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr6:56021688C>T	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1431G>A	6.37:g.56021688C>T						COL21A1_uc003pct.1_Intron|COL21A1_uc011dxi.1_Silent_p.K477K|COL21A1_uc003pcu.1_Silent_p.K474K	p.K477K	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		10	1663	-	Lung NSC(77;0.0483)		477			Collagen-like 1.		A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	37	c.1431G>A	CCDS55025.1																																																																																				0.448	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			4	8	0	0	0	0.009096	0	4	8				
COL19A1	1310	broad.mit.edu	37	6	70878090	70878091	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:70878090_70878091GG>TT	ENST00000322773.4	+	39	2626_2627	c.2524_2525GG>TT	c.(2524-2526)GGg>TTg	p.G842L	COL19A1_ENST00000393344.1_Missense_Mutation_p.G464L	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	842	Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.G842L(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CAGTTACCCAGGGCCACCCGGT	0.371																																							uc003pfc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(2524-2526)GGG>TTG		alpha 1 type XIX collagen precursor																																				SO:0001583	missense	1310				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging	g.chr6:70878090_70878091GG>TT		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	Exception_encountered	6.37:g.70878090_70878091delinsTT	ENSP00000316030:p.Gly842Leu						p.G842L	NM_001858	NP_001849	Q14993	COJA1_HUMAN			39	2641_2642	+			842			Triple-helical region 5 (COL5).		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	DNP	ENST00000322773.4	37	c.2524_2525GG>TT	CCDS4970.1																																																																																				0.371	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			8	22	0	0	0	0.004672	0	8	22				
TTK	7272	broad.mit.edu	37	6	80749948	80749948	+	Silent	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:80749948C>G	ENST00000369798.2	+	20	2454	c.2343C>G	c.(2341-2343)tcC>tcG	p.S781S	TTK_ENST00000509894.1_Silent_p.S780S|TTK_ENST00000230510.3_Silent_p.S780S	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	781	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.S781S(1)|p.S765S(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AGAGGATATCCATTCCTGAGC	0.299																																							uc003pjc.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11						c.(2341-2343)TCC>TCG		TTK protein kinase							65.0	71.0	69.0					6																	80749948		2202	4295	6497	SO:0001819	synonymous_variant	7272				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr6:80749948C>G		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2343C>G	6.37:g.80749948C>G						TTK_uc003pjb.3_Silent_p.S780S	p.S781S	NM_003318	NP_003309	P33981	TTK_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0321)	20	2417	+		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)	781			Protein kinase.		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Silent	SNP	ENST00000369798.2	37	c.2343C>G	CCDS4993.1																																																																																				0.299	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2			16	42	0	0	0	0.006122	0	16	42				
RIPPLY2	134701	broad.mit.edu	37	6	84567041	84567041	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:84567041C>A	ENST00000369689.1	+	4	471	c.320C>A	c.(319-321)gCc>gAc	p.A107D	CYB5R4_ENST00000369679.4_5'Flank|RIPPLY2_ENST00000369687.1_Missense_Mutation_p.A49D|CYB5R4_ENST00000369681.5_5'Flank	NM_001009994.1	NP_001009994.1	Q5TAB7	RIPP2_HUMAN	ripply transcriptional repressor 2	107	Ripply homology domain. {ECO:0000255}.				bone morphogenesis (GO:0060349)|determination of left/right symmetry (GO:0007368)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression (GO:0010468)|somite rostral/caudal axis specification (GO:0032525)|somitogenesis (GO:0001756)	nucleus (GO:0005634)		p.A107D(1)		large_intestine(2)|lung(4)|urinary_tract(1)	7						CCAATTCAAGCCACAATTTCA	0.313																																							uc003pke.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(319-321)GCC>GAC		ripply2 protein							53.0	60.0	57.0					6																	84567041		2202	4292	6494	SO:0001583	missense	134701				somite rostral/caudal axis specification	nucleus		g.chr6:84567041C>A	BC130460	CCDS34493.1	6q14.2	2013-07-23	2013-07-23	2008-05-07	ENSG00000203877	ENSG00000203877			21390	protein-coding gene	gene with protein product		609891	"""chromosome 6 open reading frame 159"", ""ripply2 homolog (zebrafish)"""	C6orf159			Standard	NM_001009994		Approved	dJ237I15.1	uc003pke.3	Q5TAB7	OTTHUMG00000015117	ENST00000369689.1:c.320C>A	6.37:g.84567041C>A	ENSP00000358703:p.Ala107Asp					CYB5R4_uc003pkf.2_5'Flank	p.A107D	NM_001009994	NP_001009994	Q5TAB7	RIPP2_HUMAN			4	471	+			107			Ripply homology domain.		Q5TAB6	Missense_Mutation	SNP	ENST00000369689.1	37	c.320C>A	CCDS34493.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815529	0.90790	.	.	ENSG00000203877	ENST00000369689;ENST00000369687	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.81777	0.4894	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82444	-0.0454	9	0.87932	D	0	-19.2795	19.8946	0.96949	0.0:1.0:0.0:0.0	.	107	Q5TAB7	RIPP2_HUMAN	D	107;49	.	ENSP00000358701:A49D	A	+	2	0	RIPPLY2	84623760	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.228000	0.65310	2.937000	0.99478	0.650000	0.86243	GCC		0.313	RIPPLY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041360.1	NM_001009994		29	59	1	0	5.61819e-17	0.005443	9.35384e-17	29	59				
SPACA1	81833	broad.mit.edu	37	6	88773885	88773885	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:88773885G>T	ENST00000237201.1	+	6	796	c.679G>T	c.(679-681)Gtc>Ttc	p.V227F	SPACA1_ENST00000462690.1_Intron	NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	227					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)		p.V227F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		GACCATAGGAGTCATTATCTG	0.368																																							uc003pmn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(679-681)GTC>TTC		sperm acrosome associated 1 precursor							156.0	150.0	152.0					6																	88773885		2203	4300	6503	SO:0001583	missense	81833					integral to membrane		g.chr6:88773885G>T	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.679G>T	6.37:g.88773885G>T	ENSP00000237201:p.Val227Phe						p.V227F	NM_030960	NP_112222	Q9HBV2	SACA1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.11)	6	796	+		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)	227			Helical; (Potential).			Missense_Mutation	SNP	ENST00000237201.1	37	c.679G>T	CCDS5014.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304472	0.40795	.	.	ENSG00000118434	ENST00000237201	T	0.30714	1.52	5.68	3.9	0.45041	.	0.333260	0.25642	N	0.029269	T	0.38054	0.1026	M	0.67953	2.075	0.37119	D	0.90073	D	0.71674	0.998	D	0.69142	0.962	T	0.40346	-0.9568	10	0.87932	D	0	-7.8416	9.0849	0.36574	0.1687:0.0:0.8313:0.0	.	227	Q9HBV2	SACA1_HUMAN	F	227	ENSP00000237201:V227F	ENSP00000237201:V227F	V	+	1	0	SPACA1	88830604	1.000000	0.71417	0.971000	0.41717	0.111000	0.19643	3.351000	0.52232	1.419000	0.47118	0.585000	0.79938	GTC		0.368	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041459.1			40	78	1	0	2.87052e-16	0.005524	4.72966e-16	40	78				
WASF1	8936	broad.mit.edu	37	6	110428292	110428292	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:110428292C>A	ENST00000392589.1	-	7	1364	c.528G>T	c.(526-528)aaG>aaT	p.K176N	WASF1_ENST00000392588.1_Missense_Mutation_p.K176N|WASF1_ENST00000392587.2_Missense_Mutation_p.K176N|WASF1_ENST00000359451.2_Missense_Mutation_p.K176N|WASF1_ENST00000392586.1_Missense_Mutation_p.K176N	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	176					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)	p.K176N(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		TCTGCTTCCTCTTTTCCTTCC	0.294																																							uc003ptv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(526-528)AAG>AAT		Wiskott-Aldrich syndrome protein family member							118.0	114.0	115.0					6																	110428292		2203	4297	6500	SO:0001583	missense	8936				actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding	g.chr6:110428292C>A	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.528G>T	6.37:g.110428292C>A	ENSP00000376368:p.Lys176Asn					WASF1_uc003ptw.1_Missense_Mutation_p.K176N|WASF1_uc003ptx.1_Missense_Mutation_p.K176N|WASF1_uc003pty.1_Missense_Mutation_p.K176N|WASF1_uc003ptz.1_Missense_Mutation_p.K176N	p.K176N	NM_003931	NP_003922	Q92558	WASF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)	7	1365	-		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)	176					E1P5F2|Q5SZK7	Missense_Mutation	SNP	ENST00000392589.1	37	c.528G>T	CCDS5080.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548080	0.65311	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	5.22	4.35	0.52113	.	0.088013	0.85682	D	0.000000	T	0.38852	0.1056	M	0.83953	2.67	0.50632	D	0.999883	P	0.41080	0.737	B	0.28305	0.088	T	0.55897	-0.8068	10	0.87932	D	0	.	14.4531	0.67399	0.0:0.9283:0.0:0.0717	.	176	Q92558	WASF1_HUMAN	N	176	ENSP00000376365:K176N;ENSP00000376366:K176N;ENSP00000376368:K176N;ENSP00000376367:K176N;ENSP00000352425:K176N;ENSP00000407041:K176N	ENSP00000352425:K176N	K	-	3	2	WASF1	110534985	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.464000	0.45067	1.313000	0.45069	0.655000	0.94253	AAG		0.294	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931		12	41	1	0	0.000151284	0.001855	0.000174622	12	41				
CDC40	51362	broad.mit.edu	37	6	110551182	110551182	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:110551182G>T	ENST00000368932.1	+	16	1689	c.1588G>T	c.(1588-1590)Gga>Tga	p.G530*	CDC40_ENST00000368930.1_Intron|CDC40_ENST00000307731.1_Nonsense_Mutation_p.G530*|CDC40_ENST00000445340.2_Intron			O60508	PRP17_HUMAN	cell division cycle 40	530					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.G530*(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		AGATGGAAATGGAAAATTAAA	0.353																																							uc003pua.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1588-1590)GGA>TGA		cell division cycle 40 homolog							79.0	76.0	77.0					6																	110551182		2203	4300	6503	SO:0001587	stop_gained	51362				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm		g.chr6:110551182G>T	AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.1588G>T	6.37:g.110551182G>T	ENSP00000357928:p.Gly530*						p.G530*	NM_015891	NP_056975	O60508	PRP17_HUMAN		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)	15	1612	+		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)	530			WD 6.		B2RBC5|O75471|Q5SRN0|Q9UPG1	Nonsense_Mutation	SNP	ENST00000368932.1	37	c.1588G>T	CCDS5081.1	.	.	.	.	.	.	.	.	.	.	G	38	7.029677	0.98013	.	.	ENSG00000168438	ENST00000368932;ENST00000307731	.	.	.	5.89	5.89	0.94794	.	0.144445	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-9.23	20.2578	0.98434	0.0:0.0:1.0:0.0	.	.	.	.	X	530	.	ENSP00000304370:G530X	G	+	1	0	CDC40	110657875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.466000	0.97665	2.784000	0.95788	0.643000	0.83706	GGA		0.353	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891		12	43	1	0	0.000219431	0.00245	0.000250105	12	43				
LAMA4	3910	broad.mit.edu	37	6	112537579	112537579	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:112537579C>G	ENST00000230538.7	-	3	684	c.287G>C	c.(286-288)gGa>gCa	p.G96A	RP1-142L7.9_ENST00000603682.1_lincRNA|LAMA4_ENST00000389463.4_Missense_Mutation_p.G96A|LAMA4_ENST00000431543.2_Missense_Mutation_p.G96A|LAMA4_ENST00000524032.1_5'UTR|LAMA4_ENST00000424408.2_Missense_Mutation_p.G96A|LAMA4_ENST00000522006.1_Missense_Mutation_p.G96A	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	96	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.G96A(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CACACAGTATCCTGAGCCGTC	0.468																																							uc003pvu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(286-288)GGA>GCA		laminin, alpha 4 isoform 1 precursor							122.0	101.0	108.0					6																	112537579		2203	4300	6503	SO:0001583	missense	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112537579C>G		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.287G>C	6.37:g.112537579C>G	ENSP00000230538:p.Gly96Ala					LAMA4_uc003pvv.2_Missense_Mutation_p.G96A|LAMA4_uc003pvt.2_Missense_Mutation_p.G96A|LAMA4_uc003pvw.2_Missense_Mutation_p.G96A	p.G96A	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	3	596	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	96			Laminin EGF-like 1.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	c.287G>C	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529851	0.64860	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881;ENST00000521398;ENST00000542588;ENST00000368639;ENST00000519932;ENST00000431543	T;T;T;T;T;D;D	0.97529	-0.47;-0.47;-0.47;-0.47;-0.47;-4.42;-4.42	5.84	5.84	0.93424	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.98991	0.9656	H	0.95745	3.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.996	D	0.99399	1.0927	10	0.66056	D	0.02	.	17.6392	0.88130	0.0:1.0:0.0:0.0	.	96;96;96	Q6LET9;Q16363;Q16363-2	.;LAMA4_HUMAN;.	A	96	ENSP00000230538:G96A;ENSP00000429488:G96A;ENSP00000374114:G96A;ENSP00000416470:G96A;ENSP00000430336:G96A;ENSP00000428583:G96A;ENSP00000412136:G96A	ENSP00000230538:G96A	G	-	2	0	LAMA4	112644272	1.000000	0.71417	0.999000	0.59377	0.330000	0.28571	5.260000	0.65490	2.748000	0.94277	0.650000	0.86243	GGA		0.468	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		15	32	0	0	0	0.00499	0	15	32				
TBC1D32	221322	broad.mit.edu	37	6	121642831	121642831	+	Missense_Mutation	SNP	C	C	A	rs368973341		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:121642831C>A	ENST00000398212.2	-	2	314	c.265G>T	c.(265-267)Ggc>Tgc	p.G89C	TBC1D32_ENST00000275159.6_Missense_Mutation_p.G89C	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	89					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)	p.G89C(1)									GTATCATAGCCGCATTCTTCA	0.383																																							uc003pyo.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(265-267)GGC>TGC		hypothetical protein LOC221322							271.0	247.0	255.0					6																	121642831		1886	4131	6017	SO:0001583	missense	221322				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity	g.chr6:121642831C>A	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.265G>T	6.37:g.121642831C>A	ENSP00000381270:p.Gly89Cys					C6orf170_uc003pyq.1_RNA	p.G89C	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN		GBM - Glioblastoma multiforme(226;0.00521)	2	333	-			89					Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	ENST00000398212.2	37	c.265G>T	CCDS43501.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068549	0.36470	.	.	ENSG00000146350	ENST00000275159;ENST00000398212;ENST00000422369	T;T;T	0.32515	1.45;1.45;1.45	5.44	4.58	0.56647	.	0.124473	0.52532	D	0.000068	T	0.42471	0.1204	M	0.62723	1.935	0.45366	D	0.998352	D	0.89917	1.0	D	0.79784	0.993	T	0.45338	-0.9268	10	0.62326	D	0.03	-22.5684	14.4346	0.67272	0.0:0.9291:0.0:0.0709	.	89	Q96NH3	BROMI_HUMAN	C	89	ENSP00000275159:G89C;ENSP00000381270:G89C;ENSP00000397993:G89C	ENSP00000275159:G89C	G	-	1	0	C6orf170	121684530	1.000000	0.71417	0.893000	0.35052	0.041000	0.13682	4.048000	0.57390	1.330000	0.45394	-0.166000	0.13349	GGC		0.383	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730		34	122	1	0	3.03874e-20	0.003271	5.2949e-20	34	122				
LAMA2	3908	broad.mit.edu	37	6	129465106	129465106	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:129465106G>A	ENST00000421865.2	+	5	749	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	234	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.E234K(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AGAACTGCTAGAATTTACCTC	0.393																																							uc003qbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(1)|skin(1)	10						c.(700-702)GAA>AAA		laminin alpha 2 subunit isoform a precursor							107.0	104.0	105.0					6																	129465106		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129465106G>A	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.700G>A	6.37:g.129465106G>A	ENSP00000400365:p.Glu234Lys					LAMA2_uc003qbo.2_Missense_Mutation_p.E234K	p.E234K	NM_000426	NP_000417	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	5	805	+			234			Laminin N-terminal.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.700G>A	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934925	0.73442	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.78816	-1.21	5.09	5.09	0.68999	Laminin, N-terminal (3);	0.132402	0.51477	D	0.000091	T	0.77505	0.4140	L	0.49571	1.57	0.49582	D	0.999803	P;P	0.50528	0.924;0.936	P;P	0.51657	0.676;0.63	T	0.80670	-0.1279	10	0.87932	D	0	.	18.8712	0.92315	0.0:0.0:1.0:0.0	.	234;234	A6NF00;P24043	.;LAMA2_HUMAN	K	234	ENSP00000400365:E234K	ENSP00000346769:E234K	E	+	1	0	LAMA2	129506799	1.000000	0.71417	0.975000	0.42487	0.219000	0.24729	7.183000	0.77697	2.535000	0.85469	0.467000	0.42956	GAA		0.393	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			16	49	0	0	0	0.006122	0	16	49				
LAMA2	3908	broad.mit.edu	37	6	129785559	129785559	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:129785559T>A	ENST00000421865.2	+	50	7166	c.7117T>A	c.(7117-7119)Tcg>Acg	p.S2373T		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2373	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.S2373T(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AACATTTTCTTCGAGTGCTCT	0.428																																							uc003qbn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(1)|skin(1)	10						c.(7117-7119)TCG>ACG		laminin alpha 2 subunit isoform a precursor							276.0	224.0	241.0					6																	129785559		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129785559T>A	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7117T>A	6.37:g.129785559T>A	ENSP00000400365:p.Ser2373Thr					LAMA2_uc003qbo.2_Missense_Mutation_p.S2373T	p.S2373T	NM_000426	NP_000417	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	49	7222	+			2373			Laminin G-like 2.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.7117T>A	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.839395	0.51057	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.76316	-1.01	5.87	5.87	0.94306	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.172642	0.53938	D	0.000060	T	0.67258	0.2874	L	0.43152	1.355	0.53688	D	0.999976	P;P	0.48162	0.906;0.906	P;P	0.45610	0.487;0.487	T	0.68413	-0.5415	9	.	.	.	.	16.2554	0.82515	0.0:0.0:0.0:1.0	.	2374;2373	A6NF00;P24043	.;LAMA2_HUMAN	T	2373;2372;2373;391	ENSP00000400365:S2373T	.	S	+	1	0	LAMA2	129827252	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.507000	0.60434	2.233000	0.73108	0.533000	0.62120	TCG		0.428	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			37	122	0	0	0	0.007835	0	37	122				
BCLAF1	9774	broad.mit.edu	37	6	136596819	136596819	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:136596819T>C	ENST00000531224.1	-	6	1955	c.1703A>G	c.(1702-1704)gAc>gGc	p.D568G	BCLAF1_ENST00000527536.1_Missense_Mutation_p.D568G|BCLAF1_ENST00000527759.1_Missense_Mutation_p.D566G|BCLAF1_ENST00000353331.4_Missense_Mutation_p.D566G|BCLAF1_ENST00000530767.1_Missense_Mutation_p.D395G|BCLAF1_ENST00000392348.2_Missense_Mutation_p.D566G	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	568					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.D568G(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AAGCAGCCTGTCTTTAGTCAA	0.388																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1702-1704)GAC>GGC		BCL2-associated transcription factor 1 isoform							137.0	128.0	131.0					6																	136596819		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136596819T>C	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1703A>G	6.37:g.136596819T>C	ENSP00000435210:p.Asp568Gly					BCLAF1_uc003qgw.1_Missense_Mutation_p.D395G|BCLAF1_uc003qgy.1_Missense_Mutation_p.D566G|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.D566G	p.D568G	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	6	1956	-	Colorectal(23;0.24)		568					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.1703A>G	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.699553	0.68501	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31;2.31	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000002	T	0.24547	0.0595	L	0.40543	1.245	0.80722	D	1	P;D;P;D	0.64830	0.947;0.971;0.947;0.994	P;P;P;D	0.70487	0.908;0.85;0.908;0.969	T	0.01800	-1.1271	10	0.87932	D	0	-9.3608	16.0973	0.81135	0.0:0.0:0.0:1.0	.	566;566;568;395	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	G	568;566;568;395;566;566;568	ENSP00000435210:D568G;ENSP00000229446:D566G;ENSP00000435441:D568G;ENSP00000436501:D395G;ENSP00000434826:D566G;ENSP00000376159:D566G;ENSP00000431734:D568G	ENSP00000229446:D566G	D	-	2	0	BCLAF1	136638512	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.826000	0.75298	2.263000	0.75096	0.377000	0.23210	GAC		0.388	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		4	112	0	0	0	0.001984	0	4	112				
IL20RA	53832	broad.mit.edu	37	6	137325893	137325893	+	Silent	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:137325893T>C	ENST00000316649.5	-	6	964	c.729A>G	c.(727-729)caA>caG	p.Q243Q	IL20RA_ENST00000541547.1_Silent_p.Q194Q|IL20RA_ENST00000367748.1_Silent_p.Q132Q|IL20RA_ENST00000468393.1_5'UTR	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	243					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)		p.Q243Q(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		ACTCTGATGATTGATCTGTAA	0.378																																							uc003qhj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)	4						c.(727-729)CAA>CAG		interleukin 20 receptor, alpha precursor							95.0	106.0	102.0					6																	137325893		2203	4300	6503	SO:0001819	synonymous_variant	53832					integral to membrane	receptor activity	g.chr6:137325893T>C	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.729A>G	6.37:g.137325893T>C						IL20RA_uc011edl.1_Silent_p.Q194Q|IL20RA_uc003qhk.2_Silent_p.Q132Q|IL20RA_uc003qhi.2_5'UTR	p.Q243Q	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN		GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)	6	1162	-	Colorectal(23;0.24)		243			Extracellular (Potential).		B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Silent	SNP	ENST00000316649.5	37	c.729A>G	CCDS5181.1																																																																																				0.378	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432		20	68	0	0	0	0.002299	0	20	68				
TAB2	23118	broad.mit.edu	37	6	149700010	149700010	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:149700010G>T	ENST00000367456.1	+	4	1536	c.959G>T	c.(958-960)gGa>gTa	p.G320V	TAB2_ENST00000286332.5_Missense_Mutation_p.G320V|TAB2_ENST00000536230.1_Missense_Mutation_p.G288V|TAB2_ENST00000392282.1_Missense_Mutation_p.G320V|TAB2_ENST00000538427.1_Missense_Mutation_p.G320V			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	320					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.G320V(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						ATTTCAACAGGACCTCGAAAA	0.413																																							uc003qmj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(958-960)GGA>GTA		mitogen-activated protein kinase kinase kinase 7							91.0	89.0	90.0					6																	149700010		2203	4300	6503	SO:0001583	missense	23118				activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding	g.chr6:149700010G>T	AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.959G>T	6.37:g.149700010G>T	ENSP00000356426:p.Gly320Val					TAB2_uc011eec.1_Missense_Mutation_p.G288V|TAB2_uc010kia.1_Missense_Mutation_p.G320V|TAB2_uc010kib.1_Missense_Mutation_p.G320V|TAB2_uc003qmk.3_RNA	p.G320V	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN			3	1137	+			320					B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Missense_Mutation	SNP	ENST00000367456.1	37	c.959G>T	CCDS5214.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.985707	0.53934	.	.	ENSG00000055208	ENST00000536230;ENST00000392282;ENST00000538427;ENST00000367456;ENST00000286332	D;D;D;D;D	0.84298	-1.83;-1.75;-1.77;-1.77;-1.77	6.07	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.76898	0.4052	L	0.34521	1.04	0.80722	D	1	P;P	0.36065	0.535;0.535	B;B	0.42959	0.403;0.403	T	0.81468	-0.0919	10	0.87932	D	0	-10.9123	15.3002	0.73945	0.0666:0.0:0.9334:0.0	.	288;320	B4DIR9;Q9NYJ8	.;TAB2_HUMAN	V	288;320;320;320;320	ENSP00000443206:G288V;ENSP00000376106:G320V;ENSP00000445752:G320V;ENSP00000356426:G320V;ENSP00000286332:G320V	ENSP00000286332:G320V	G	+	2	0	TAB2	149741703	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	9.230000	0.95299	1.590000	0.49995	-0.225000	0.12378	GGA		0.413	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042633.3			19	47	1	0	3.99206e-14	0.007413	6.2077e-14	19	47				
MAP3K4	4216	broad.mit.edu	37	6	161470454	161470454	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:161470454A>G	ENST00000392142.4	+	3	1298	c.1150A>G	c.(1150-1152)Aaa>Gaa	p.K384E	MAP3K4_ENST00000366919.2_Missense_Mutation_p.K384E|MAP3K4_ENST00000366920.2_Missense_Mutation_p.K384E|MAP3K4_ENST00000348824.7_Missense_Mutation_p.K384E	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	384					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.K384E(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		ATATGCTGCAAAAGACTTCCA	0.403																																							uc003qtn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|skin(2)|stomach(1)	9						c.(1150-1152)AAA>GAA		mitogen-activated protein kinase kinase kinase 4							76.0	78.0	77.0					6																	161470454		2203	4300	6503	SO:0001583	missense	4216				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr6:161470454A>G	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1150A>G	6.37:g.161470454A>G	ENSP00000375986:p.Lys384Glu					MAP3K4_uc010kkc.1_Missense_Mutation_p.K384E|MAP3K4_uc003qto.2_Missense_Mutation_p.K384E|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	p.K384E	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)	3	1292	+		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)	384					A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	c.1150A>G	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	A	14.11	2.437223	0.43224	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.96	4.78	0.61160	.	0.145419	0.47455	D	0.000232	T	0.12178	0.0296	L	0.41236	1.265	0.09310	N	1	P;P	0.44627	0.804;0.839	B;B	0.41666	0.363;0.278	T	0.18903	-1.0322	10	0.07325	T	0.83	-16.8855	13.2645	0.60125	0.8676:0.1324:0.0:0.0	.	384;384	Q9Y6R4-2;Q9Y6R4	.;M3K4_HUMAN	E	384	ENSP00000355886:K384E;ENSP00000375986:K384E;ENSP00000355887:K384E;ENSP00000297332:K384E	ENSP00000297332:K384E	K	+	1	0	MAP3K4	161390444	1.000000	0.71417	0.005000	0.12908	0.951000	0.60555	5.327000	0.65881	1.038000	0.40049	0.528000	0.53228	AAA		0.403	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			11	38	0	0	0	0.008291	0	11	38				
C6orf118	168090	broad.mit.edu	37	6	165715241	165715241	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:165715241G>A	ENST00000230301.8	-	2	590	c.570C>T	c.(568-570)gcC>gcT	p.A190A	C6orf118_ENST00000543069.1_Silent_p.A86A	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	190								p.A190A(1)		breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CTCTGGACCCGGCCTCCTGGT	0.632																																							uc003qum.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(568-570)GCC>GCT		hypothetical protein LOC168090							42.0	46.0	44.0					6																	165715241		2203	4300	6503	SO:0001819	synonymous_variant	168090							g.chr6:165715241G>A		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.570C>T	6.37:g.165715241G>A						C6orf118_uc011egi.1_RNA	p.A190A	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	2	606	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	190					Q8TC11	Silent	SNP	ENST00000230301.8	37	c.570C>T	CCDS5288.1																																																																																				0.632	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		10	45	0	0	0	0.008291	0	10	45				
T	6862	broad.mit.edu	37	6	166574331	166574331	+	Missense_Mutation	SNP	C	C	A	rs372221322		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr6:166574331C>A	ENST00000296946.2	-	8	1496	c.1028G>T	c.(1027-1029)aGc>aTc	p.S343I	T_ENST00000366871.3_Missense_Mutation_p.S285I	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	343					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S343I(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		TTACCTGGAGCTGGTAGGTGG	0.542									Chordoma, Familial Clustering of																														uc003quu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1027-1029)AGC>ATC		transcription factor T							135.0	123.0	127.0					6																	166574331		2203	4300	6503	SO:0001583	missense	6862	Chordoma_Familial_Clustering_of	Familial Cancer Database		anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity	g.chr6:166574331C>A	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.1028G>T	6.37:g.166574331C>A	ENSP00000296946:p.Ser343Ile					T_uc003qut.1_Missense_Mutation_p.S344I|T_uc003quv.1_Missense_Mutation_p.S285I	p.S343I	NM_003181	NP_003172	O15178	BRAC_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)	8	1521	-		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)	343					E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	37	c.1028G>T	CCDS5290.1	.	.	.	.	.	.	.	.	.	.	C	8.512	0.866699	0.17250	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D	0.83755	-1.73;-1.76	4.88	3.95	0.45737	.	0.583741	0.17061	N	0.188573	T	0.71434	0.3339	M	0.62723	1.935	0.29326	N	0.867004	B;B;B	0.22683	0.072;0.073;0.072	B;B;B	0.24848	0.043;0.056;0.043	T	0.67503	-0.5654	10	0.45353	T	0.12	.	12.9244	0.58252	0.0:0.706:0.294:0.0	.	285;343;285	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	I	343;343;285	ENSP00000296946:S343I;ENSP00000355836:S285I	ENSP00000296946:S343I	S	-	2	0	T	166494321	0.937000	0.31787	0.563000	0.28383	0.029000	0.11900	0.711000	0.25764	2.409000	0.81822	0.655000	0.94253	AGC		0.542	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181		26	43	1	0	4.22769e-11	0.00632	6.15289e-11	26	43				
THSD7A	221981	broad.mit.edu	37	7	11675994	11675994	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:11675994G>T	ENST00000423059.4	-	2	1036	c.785C>A	c.(784-786)aCc>aAc	p.T262N	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	262					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T262N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CATTGAGCAGGTGCTCCAGGG	0.572										HNSCC(18;0.044)																													uc003ssf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(784-786)ACC>AAC		thrombospondin, type I, domain containing 7A							85.0	83.0	84.0					7																	11675994		2027	4175	6202	SO:0001583	missense	221981					integral to membrane		g.chr7:11675994G>T		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.785C>A	7.37:g.11675994G>T	ENSP00000406482:p.Thr262Asn	HNSCC(18;0.044)					p.T262N	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	2	1037	-			262			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000423059.4	37	c.785C>A	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	4.725	0.134887	0.09032	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.58652	0.32	5.62	5.62	0.85841	.	0.664954	0.16996	N	0.191117	T	0.45175	0.1329	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.20184	0.028	T	0.18272	-1.0342	10	0.21014	T	0.42	.	15.2267	0.73357	0.0695:0.0:0.9305:0.0	.	262	Q9UPZ6	THS7A_HUMAN	N	262	ENSP00000406482:T262N	ENSP00000262042:T262N	T	-	2	0	THSD7A	11642519	0.026000	0.19158	0.378000	0.26068	0.269000	0.26545	2.094000	0.41719	2.810000	0.96702	0.585000	0.79938	ACC		0.572	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		15	58	1	0	4.75885e-15	0.00499	7.643e-15	15	58				
AHR	196	broad.mit.edu	37	7	17374516	17374516	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:17374516G>A	ENST00000242057.4	+	8	1557	c.914G>A	c.(913-915)aGa>aAa	p.R305K		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	305	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R305K(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AACAGAGGAAGAATTGTTTTA	0.333																																							uc011jxz.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	urinary_tract(1)|kidney(1)|pancreas(1)	3						c.(913-915)AGA>AAA		aryl hydrocarbon receptor precursor							108.0	104.0	105.0					7																	17374516		2203	4300	6503	SO:0001583	missense	196				apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding	g.chr7:17374516G>A	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.914G>A	7.37:g.17374516G>A	ENSP00000242057:p.Arg305Lys					AHR_uc003stt.3_RNA	p.R305K	NM_001621	NP_001612	P35869	AHR_HUMAN			8	1527	+	Lung NSC(10;0.0392)|all_lung(11;0.0754)		305			PAS 2.		A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	c.914G>A	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	G	1.080	-0.667318	0.03428	.	.	ENSG00000106546	ENST00000242057	T	0.03951	3.75	5.65	-10.0	0.00425	PAS fold-3 (1);PAS (1);	0.637512	0.16386	N	0.216677	T	0.00967	0.0032	N	0.00808	-1.17	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32375	-0.9909	10	0.02654	T	1	.	10.1493	0.42782	0.3701:0.1987:0.4312:0.0	.	305	P35869	AHR_HUMAN	K	305	ENSP00000242057:R305K	ENSP00000242057:R305K	R	+	2	0	AHR	17341041	0.065000	0.20965	0.006000	0.13384	0.358000	0.29455	0.394000	0.20834	-1.648000	0.01510	-0.918000	0.02743	AGA		0.333	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621		3	88	0	0	0	0.004672	0	3	88				
HDAC9	9734	broad.mit.edu	37	7	18687575	18687575	+	Silent	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:18687575T>C	ENST00000432645.2	+	9	1194	c.1194T>C	c.(1192-1194)caT>caC	p.H398H	HDAC9_ENST00000417496.2_Silent_p.H396H|HDAC9_ENST00000405010.3_Silent_p.H398H|HDAC9_ENST00000524023.1_Silent_p.H321H|HDAC9_ENST00000406072.1_Silent_p.H385H|HDAC9_ENST00000428307.2_Silent_p.H354H|HDAC9_ENST00000401921.1_Silent_p.H357H|HDAC9_ENST00000456174.2_Silent_p.H370H|HDAC9_ENST00000406451.4_Silent_p.H398H|HDAC9_ENST00000441542.2_Silent_p.H401H	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	398					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.H401H(2)|p.H398H(1)|p.H396H(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	TCCTGCAGCATTTATTATTGA	0.458																																							uc003suh.2		NA																	4	Substitution - coding silent(4)		lung(4)	lung(2)|central_nervous_system(2)|kidney(1)	5						c.(1192-1194)CAT>CAC		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						33.0	34.0	34.0					7																	18687575		1960	4155	6115	SO:0001819	synonymous_variant	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18687575T>C	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1194T>C	7.37:g.18687575T>C						HDAC9_uc003sue.2_Silent_p.H398H|HDAC9_uc011jyd.1_Silent_p.H398H|HDAC9_uc003sui.2_Silent_p.H401H|HDAC9_uc003suj.2_Silent_p.H357H|HDAC9_uc011jya.1_Silent_p.H395H|HDAC9_uc003sua.1_Silent_p.H376H|HDAC9_uc011jyb.1_Silent_p.H354H|HDAC9_uc003sud.1_Silent_p.H398H|HDAC9_uc011jyc.1_Silent_p.H357H|HDAC9_uc003suf.1_Silent_p.H429H|HDAC9_uc010kud.1_Silent_p.H401H|HDAC9_uc011jye.1_Silent_p.H370H|HDAC9_uc011jyf.1_Silent_p.H321H|HDAC9_uc010kue.1_Silent_p.H141H	p.H398H	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN			9	1235	+	all_lung(11;0.187)		398					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	37	c.1194T>C	CCDS47555.1																																																																																				0.458	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			5	14	0	0	0	0.000602	0	5	14				
ABCB5	340273	broad.mit.edu	37	7	20793041	20793041	+	Missense_Mutation	SNP	G	G	T	rs372306266		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:20793041G>T	ENST00000404938.2	+	27	4140	c.3488G>T	c.(3487-3489)aGa>aTa	p.R1163I	ABCB5_ENST00000258738.6_Missense_Mutation_p.R718I	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	1163	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.R1163I(1)|p.R718I(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CAGAAACAAAGACTAGCTATT	0.418																																							uc003suw.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(2152-2154)AGA>ATA		ATP-binding cassette, sub-family B, member 5							101.0	103.0	102.0					7																	20793041		2203	4300	6503	SO:0001583	missense	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20793041G>T	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.3488G>T	7.37:g.20793041G>T	ENSP00000384881:p.Arg1163Ile					ABCB5_uc010kuh.2_Missense_Mutation_p.R1163I	p.R718I	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN			18	2699	+			718			Cytoplasmic (Potential).|ABC transporter 2.		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.2153G>T	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883695	0.91740	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.89810	-2.57;-2.57	5.02	5.02	0.67125	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000013	D	0.95484	0.8533	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96210	0.9152	10	0.87932	D	0	.	17.2588	0.87064	0.0:0.0:1.0:0.0	.	1163;718	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	I	1163;718	ENSP00000384881:R1163I;ENSP00000258738:R718I	ENSP00000258738:R718I	R	+	2	0	ABCB5	20759566	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.483000	0.97937	2.595000	0.87683	0.555000	0.69702	AGA		0.418	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		26	44	1	0	2.44723e-14	0.004656	3.84306e-14	26	44				
DNAH11	8701	broad.mit.edu	37	7	21827064	21827064	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:21827064A>G	ENST00000409508.3	+	60	9818	c.9787A>G	c.(9787-9789)Att>Gtt	p.I3263V	DNAH11_ENST00000328843.6_Missense_Mutation_p.I3270V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3270	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I3270V(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CAAAGAGCACATTCCAGAGAA	0.373									Kartagener syndrome																														uc003svc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(9808-9810)ATT>GTT		dynein, axonemal, heavy chain 11							95.0	90.0	92.0					7																	21827064		1831	4091	5922	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21827064A>G	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.9787A>G	7.37:g.21827064A>G	ENSP00000475939:p.Ile3263Val						p.I3270V	NM_003777	NP_003768	Q96DT5	DYH11_HUMAN			61	9839	+			3270			Stalk (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.9808A>G		.	.	.	.	.	.	.	.	.	.	A	16.58	3.163543	0.57476	.	.	ENSG00000105877	ENST00000328843	T	0.78126	-1.15	5.74	5.74	0.90152	Dynein heavy chain, coiled coil stalk (1);	0.051667	0.85682	D	0.000000	D	0.85566	0.5726	.	.	.	0.58432	D	0.999994	D	0.67145	0.996	D	0.63381	0.914	D	0.86827	0.2008	9	0.62326	D	0.03	.	11.9289	0.52835	0.9304:0.0:0.0696:0.0	.	3270	Q96DT5	DYH11_HUMAN	V	3270	ENSP00000330671:I3270V	ENSP00000330671:I3270V	I	+	1	0	DNAH11	21793589	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.018000	0.64054	2.188000	0.69820	0.460000	0.39030	ATT		0.373	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		14	43	0	0	0	0.00245	0	14	43				
GPNMB	10457	broad.mit.edu	37	7	23306169	23306169	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:23306169G>A	ENST00000381990.2	+	7	1249	c.1088G>A	c.(1087-1089)aGg>aAg	p.R363K	GPNMB_ENST00000453162.2_Missense_Mutation_p.R305K|GPNMB_ENST00000258733.4_Missense_Mutation_p.R351K|GPNMB_ENST00000539136.1_Missense_Mutation_p.R252K	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	363					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)	p.R363K(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			GAGCTGAGTAGGATTCCTGAT	0.428																																							uc003swc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)	5						c.(1087-1089)AGG>AAG		glycoprotein (transmembrane) nmb isoform a							94.0	84.0	87.0					7																	23306169		2203	4300	6503	SO:0001583	missense	10457				negative regulation of cell proliferation	melanosome		g.chr7:23306169G>A	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1088G>A	7.37:g.23306169G>A	ENSP00000371420:p.Arg363Lys					GPNMB_uc003swb.2_Missense_Mutation_p.R351K|GPNMB_uc011jyy.1_Missense_Mutation_p.R305K|GPNMB_uc011jyz.1_Missense_Mutation_p.R252K	p.R363K	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	GBM - Glioblastoma multiforme(13;0.154)		7	1249	+			363			Extracellular (Potential).		A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	ENST00000381990.2	37	c.1088G>A	CCDS34610.1	.	.	.	.	.	.	.	.	.	.	G	2.950	-0.216940	0.06101	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000425903;ENST00000539136;ENST00000453162	T;T;T;T	0.14266	2.55;2.53;2.55;2.52	5.78	4.62	0.57501	PKD/Chitinase domain (1);	1.317580	0.04802	N	0.433686	T	0.06600	0.0169	N	0.04018	-0.295	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.37361	-0.9709	10	0.07030	T	0.85	-4.9555	6.6237	0.22818	0.7921:0.0:0.0725:0.1353	.	252;305;363;351	F6SKP1;F5GY20;Q14956;Q14956-2	.;.;GPNMB_HUMAN;.	K	351;398;363;246;252;305	ENSP00000258733:R351K;ENSP00000371420:R363K;ENSP00000445266:R252K;ENSP00000405586:R305K	ENSP00000258733:R351K	R	+	2	0	GPNMB	23272694	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.833000	0.27504	1.024000	0.39682	-0.301000	0.09380	AGG		0.428	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340		13	54	0	0	0	0.001855	0	13	54				
IGF2BP3	10643	broad.mit.edu	37	7	23358857	23358857	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:23358857G>C	ENST00000258729.3	-	11	1576	c.1220C>G	c.(1219-1221)aCt>aGt	p.T407S		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	407	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)	p.T407S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						CAGATGAACAGTCTCCGTTTC	0.448																																							uc003swg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1219-1221)ACT>AGT		insulin-like growth factor 2 mRNA binding							147.0	133.0	138.0					7																	23358857		2203	4300	6503	SO:0001583	missense	10643				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr7:23358857G>C	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1220C>G	7.37:g.23358857G>C	ENSP00000258729:p.Thr407Ser					IGF2BP3_uc003swf.2_Missense_Mutation_p.T26S	p.T407S	NM_006547	NP_006538	O00425	IF2B3_HUMAN			11	1486	-			407			KH 3.		A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	ENST00000258729.3	37	c.1220C>G	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851308	0.91355	.	.	ENSG00000136231	ENST00000258729	T	0.64260	-0.09	5.87	5.0	0.66597	K Homology (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.65417	0.2689	L	0.56396	1.775	0.80722	D	1	P	0.40083	0.702	P	0.47528	0.549	T	0.61013	-0.7148	10	0.16420	T	0.52	-0.0395	14.9934	0.71412	0.0681:0.0:0.9319:0.0	.	407	O00425	IF2B3_HUMAN	S	407	ENSP00000258729:T407S	ENSP00000258729:T407S	T	-	2	0	IGF2BP3	23325382	1.000000	0.71417	0.930000	0.37139	0.869000	0.49853	7.905000	0.87416	1.494000	0.48533	0.655000	0.94253	ACT		0.448	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547		30	65	0	0	0	0.009535	0	30	65				
AC005013.5	0	broad.mit.edu	37	7	28996417	28996417	+	lincRNA	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:28996417C>A	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							GGCGAGGGATCCGCGCAGGAT	0.662																																							uc003szt.2		NA																	0					0						c.(1246-1248)GAT>TAT		TLR4 interactor with leucine rich repeats							39.0	49.0	46.0					7																	28996417		2081	4207	6288			9865				inflammatory response|innate immune response|regulation of cytokine production involved in immune response|toll-like receptor 4 signaling pathway	lipopolysaccharide receptor complex	lipopolysaccharide binding	g.chr7:28996417C>A																													7.37:g.28996417C>A						uc003szu.1_5'Flank	p.D416Y	NM_014817	NP_055632	Q7L0X0	TRIL_HUMAN			3	1613	-			416			Extracellular (Potential).|LRRCT.			Missense_Mutation	SNP	ENST00000436594.1	37	c.1246G>T																																																																																					0.662	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000327953.3			16	43	1	0	3.32936e-07	0.006122	4.15191e-07	16	43				
EEPD1	80820	broad.mit.edu	37	7	36338682	36338682	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:36338682G>T	ENST00000242108.4	+	8	2295	c.1577G>T	c.(1576-1578)gGg>gTg	p.G526V	EEPD1_ENST00000534978.1_Missense_Mutation_p.G526V	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	526					DNA repair (GO:0006281)		DNA binding (GO:0003677)	p.G526V(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						TCTTGGGGCGGGGTGGCTTCT	0.587																																							uc003tfa.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1576-1578)GGG>GTG		endonuclease/exonuclease/phosphatase family							85.0	78.0	80.0					7																	36338682		2203	4300	6503	SO:0001583	missense	80820				DNA repair		DNA binding	g.chr7:36338682G>T	AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	ENST00000242108.4:c.1577G>T	7.37:g.36338682G>T	ENSP00000242108:p.Gly526Val						p.G526V	NM_030636	NP_085139	Q7L9B9	EEPD1_HUMAN			8	2217	+			526					Q96K64|Q9C0F7	Missense_Mutation	SNP	ENST00000242108.4	37	c.1577G>T	CCDS34619.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618664	0.87460	.	.	ENSG00000122547	ENST00000242108;ENST00000534978	D;D	0.94758	-3.51;-3.51	5.17	5.17	0.71159	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.96790	0.8952	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97249	0.9896	10	0.87932	D	0	-18.7957	19.0687	0.93123	0.0:0.0:1.0:0.0	.	526	Q7L9B9	EEPD1_HUMAN	V	526	ENSP00000242108:G526V;ENSP00000442692:G526V	ENSP00000242108:G526V	G	+	2	0	EEPD1	36305207	1.000000	0.71417	0.903000	0.35520	0.817000	0.46193	9.355000	0.97087	2.568000	0.86640	0.462000	0.41574	GGG		0.587	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337602.1	NM_030636		18	46	1	0	1.45105e-14	0.006122	2.30142e-14	18	46				
INHBA	3624	broad.mit.edu	37	7	41730000	41730000	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:41730000G>C	ENST00000242208.4	-	3	775	c.529C>G	c.(529-531)Cag>Gag	p.Q177E	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Missense_Mutation_p.Q177E	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	177					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.Q177E(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TTCTGCTGCTGGAAGAGGCGG	0.572										TSP Lung(11;0.080)																													uc003thq.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(1)	6						c.(529-531)CAG>GAG		inhibin beta A precursor							105.0	98.0	100.0					7																	41730000		2203	4300	6503	SO:0001583	missense	3624				cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity	g.chr7:41730000G>C		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.529C>G	7.37:g.41730000G>C	ENSP00000242208:p.Gln177Glu	TSP Lung(11;0.080)				INHBA_uc003thr.2_Missense_Mutation_p.Q177E	p.Q177E	NM_002192	NP_002183	P08476	INHBA_HUMAN			2	764	-			177					Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	c.529C>G	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	18.21	3.573966	0.65765	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.64085	-0.08;-0.08	6.06	6.06	0.98353	Transforming growth factor-beta, N-terminal (1);	0.353943	0.30269	N	0.010013	T	0.64472	0.2601	L	0.50333	1.59	0.54753	D	0.999985	P	0.45768	0.866	P	0.45660	0.489	T	0.57602	-0.7783	10	0.23302	T	0.38	-24.1378	20.6208	0.99490	0.0:0.0:1.0:0.0	.	177	P08476	INHBA_HUMAN	E	177	ENSP00000242208:Q177E;ENSP00000397197:Q177E	ENSP00000242208:Q177E	Q	-	1	0	INHBA	41696525	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.572000	0.82409	2.882000	0.98803	0.655000	0.94253	CAG		0.572	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			19	55	0	0	0	0.00333	0	19	55				
ZNF716	441234	broad.mit.edu	37	7	57522855	57522855	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:57522855G>T	ENST00000420713.1	+	3	355	c.243G>T	c.(241-243)gaG>gaT	p.E81D		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	81	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E81D(2)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						AGAGAAATGAGATGGTAGCCA	0.413																																							uc011kdi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(241-243)GAG>GAT		zinc finger protein 716							96.0	76.0	82.0					7																	57522855		692	1591	2283	SO:0001583	missense	441234							g.chr7:57522855G>T	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.243G>T	7.37:g.57522855G>T	ENSP00000394248:p.Glu81Asp						p.E81D	NM_001159279	NP_001152751					3	355	+									Missense_Mutation	SNP	ENST00000420713.1	37	c.243G>T	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835608	0.32421	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.05717	3.4	0.793	0.793	0.18632	Krueppel-associated box (1);	.	.	.	.	T	0.05044	0.0135	L	0.33710	1.025	0.22199	N	0.999298	B	0.09022	0.002	B	0.08055	0.003	T	0.38200	-0.9672	9	0.48119	T	0.1	.	4.8964	0.13753	0.0:0.0:1.0:0.0	.	69	A6NP11	ZN716_HUMAN	D	81;69	ENSP00000394248:E81D	ENSP00000387687:E69D	E	+	3	2	ZNF716	57526797	0.000000	0.05858	0.727000	0.30756	0.729000	0.41735	-0.693000	0.05121	0.283000	0.22279	0.289000	0.19496	GAG		0.413	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		15	63	1	0	0.00244969	0.00245	0.00266326	15	63				
WBSCR17	64409	broad.mit.edu	37	7	70880936	70880937	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:70880936_70880937GG>TT	ENST00000333538.5	+	4	1285_1286	c.651_652GG>TT	c.(649-654)gtGGta>gtTTta	p.V218L	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	218	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V218L(1)|p.V217V(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TGGTGAAGGTGGTAAGAAATCA	0.53																																							uc003tvy.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7						c.(649-654)GTGGTA>GTTTTA		UDP-GalNAc:polypeptide																																				SO:0001583	missense	64409					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr7:70880936_70880937GG>TT	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	Exception_encountered	7.37:g.70880936_70880937delinsTT	ENSP00000329654:p.Val218Leu					WBSCR17_uc003tvz.2_5'UTR	p.V218L	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN			4	651_652	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)	218			Catalytic subdomain A.|Lumenal (Potential).		Q8NFV9|Q9NTA8	Missense_Mutation	DNP	ENST00000333538.5	37	c.651_652GG>TT	CCDS5540.1																																																																																				0.530	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		11	25	0	0	0	0.004672	0	11	25				
PCLO	27445	broad.mit.edu	37	7	82579217	82579217	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:82579217C>T	ENST00000333891.9	-	6	11024	c.10687G>A	c.(10687-10689)Ggc>Agc	p.G3563S	PCLO_ENST00000423517.2_Missense_Mutation_p.G3563S|PCLO_ENST00000437081.1_Missense_Mutation_p.G283S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.G3563S(2)|p.G3494S(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCTAAACTGCCCCCTTTGTAA	0.448																																							uc003uhx.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(7)	7						c.(10687-10689)GGC>AGC		piccolo isoform 1							175.0	165.0	168.0					7																	82579217		1962	4161	6123	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82579217C>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10687G>A	7.37:g.82579217C>T	ENSP00000334319:p.Gly3563Ser					PCLO_uc003uhv.2_Missense_Mutation_p.G3563S|PCLO_uc010lec.2_Missense_Mutation_p.G528S	p.G3563S	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			6	10976	-			3494						Missense_Mutation	SNP	ENST00000333891.9	37	c.10687G>A	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826181	0.50739	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.16743	2.32;2.33	5.61	4.73	0.59995	.	.	.	.	.	T	0.23133	0.0559	L	0.47716	1.5	0.34944	D	0.750571	B;P;P	0.51351	0.297;0.944;0.944	B;P;P	0.47075	0.129;0.536;0.536	T	0.34329	-0.9833	9	0.87932	D	0	.	14.7069	0.69198	0.0:0.9299:0.0:0.0701	.	3494;3563;3563	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	S	3494;3563;3563;283	ENSP00000334319:G3563S;ENSP00000388393:G3563S	ENSP00000334319:G3563S	G	-	1	0	PCLO	82417153	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.977000	0.76141	1.361000	0.45981	0.655000	0.94253	GGC		0.448	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		14	47	0	0	0	0.00499	0	14	47				
ABCB4	5244	broad.mit.edu	37	7	87041230	87041230	+	Missense_Mutation	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:87041230A>G	ENST00000265723.4	-	23	3014	c.2903T>C	c.(2902-2904)aTg>aCg	p.M968T	ABCB4_ENST00000545634.1_Missense_Mutation_p.M968T|ABCB4_ENST00000358400.3_Intron|ABCB4_ENST00000453593.1_Intron|ABCB4_ENST00000359206.3_Missense_Mutation_p.M968T	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	968	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.M968T(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TCTGAAGCGCATATGTCCATT	0.308																																							uc003uiv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)|pancreas(1)	6						c.(2902-2904)ATG>ACG		ATP-binding cassette, subfamily B, member 4							60.0	57.0	58.0					7																	87041230		2203	4300	6503	SO:0001583	missense	5244				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity	g.chr7:87041230A>G	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2903T>C	7.37:g.87041230A>G	ENSP00000265723:p.Met968Thr					ABCB4_uc003uiw.1_Missense_Mutation_p.M968T|ABCB4_uc003uix.1_Intron	p.M968T	NM_018849	NP_061337	P21439	MDR3_HUMAN			23	2979	-	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		968			Extracellular (By similarity).|ABC transmembrane type-1 2.		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	c.2903T>C	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	A	12.91	2.080018	0.36662	.	.	ENSG00000005471	ENST00000359206;ENST00000265723;ENST00000545634	T;T;T	0.80994	-1.44;-1.44;-1.44	5.48	5.48	0.80851	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.280019	0.42172	D	0.000744	T	0.74313	0.3700	L	0.37800	1.135	0.53688	D	0.999977	B;B	0.27068	0.138;0.167	B;B	0.33690	0.105;0.168	T	0.71902	-0.4452	10	0.41790	T	0.15	-27.116	11.5032	0.50450	0.928:0.0:0.072:0.0	.	968;968	P21439-2;P21439	.;MDR3_HUMAN	T	968	ENSP00000352135:M968T;ENSP00000265723:M968T;ENSP00000437465:M968T	ENSP00000265723:M968T	M	-	2	0	ABCB4	86879166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.372000	0.73123	2.082000	0.62665	0.533000	0.62120	ATG		0.308	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443		10	35	0	0	0	0.006214	0	10	35				
SAMD9L	219285	broad.mit.edu	37	7	92764413	92764413	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:92764413T>C	ENST00000318238.4	-	5	2088	c.872A>G	c.(871-873)gAa>gGa	p.E291G	SAMD9L_ENST00000437805.1_Missense_Mutation_p.E291G|SAMD9L_ENST00000411955.1_Missense_Mutation_p.E291G	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	291					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.E291G(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CAGAAGGACTTCCACAAACCT	0.363																																							uc003umh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(871-873)GAA>GGA		sterile alpha motif domain containing 9-like							102.0	107.0	105.0					7																	92764413		2203	4299	6502	SO:0001583	missense	219285							g.chr7:92764413T>C	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.872A>G	7.37:g.92764413T>C	ENSP00000326247:p.Glu291Gly					SAMD9L_uc003umj.1_Missense_Mutation_p.E291G|SAMD9L_uc003umi.1_Missense_Mutation_p.E291G|SAMD9L_uc010lfb.1_Missense_Mutation_p.E291G|SAMD9L_uc003umk.1_Missense_Mutation_p.E291G|SAMD9L_uc010lfc.1_Missense_Mutation_p.E291G|SAMD9L_uc010lfd.1_Missense_Mutation_p.E291G|SAMD9L_uc011khx.1_Intron	p.E291G	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	2088	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		291					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	c.872A>G	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.615112	0.66672	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.17054	2.3;2.3;2.3	4.95	4.95	0.65309	.	0.161186	0.40222	N	0.001159	T	0.37293	0.0998	M	0.65498	2.005	0.49687	D	0.999817	D	0.63046	0.992	P	0.62298	0.9	T	0.17806	-1.0357	10	0.72032	D	0.01	-15.2369	14.425	0.67210	0.0:0.0:0.0:1.0	.	291	Q8IVG5	SAM9L_HUMAN	G	291	ENSP00000326247:E291G;ENSP00000405760:E291G;ENSP00000408796:E291G	ENSP00000326247:E291G	E	-	2	0	SAMD9L	92602349	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.796000	0.85898	2.078000	0.62432	0.377000	0.23210	GAA		0.363	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		49	93	0	0	0	0.00361	0	49	93				
DYNC1I1	1780	broad.mit.edu	37	7	95662065	95662065	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:95662065G>T	ENST00000324972.6	+	12	1447	c.1254G>T	c.(1252-1254)tgG>tgT	p.W418C	DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.W381C|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.W401C|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.W381C|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.W401C|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.W398C	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	418					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.W418C(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGTGTTCCTGGAGCCTGGACA	0.438																																							uc003uoc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)	4						c.(1252-1254)TGG>TGT		dynein, cytoplasmic 1, intermediate chain 1							236.0	184.0	201.0					7																	95662065		2203	4300	6503	SO:0001583	missense	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95662065G>T	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1254G>T	7.37:g.95662065G>T	ENSP00000320130:p.Trp418Cys					DYNC1I1_uc003uod.3_Missense_Mutation_p.W401C|DYNC1I1_uc003uob.2_Missense_Mutation_p.W381C|DYNC1I1_uc003uoe.3_Missense_Mutation_p.W398C|DYNC1I1_uc010lfl.2_Missense_Mutation_p.W407C	p.W418C	NM_004411	NP_004402	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		12	1531	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		418			WD 3.		B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	c.1254G>T	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.651150	0.67472	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58	4.47	4.47	0.54385	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	M	0.93720	3.45	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.64188	-0.6466	10	0.87932	D	0	-12.1148	18.4514	0.90704	0.0:0.0:1.0:0.0	.	401;398;401;418;381	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	C	401;418;381;398;381;401	ENSP00000392337:W401C;ENSP00000320130:W418C;ENSP00000438377:W381C;ENSP00000398118:W398C;ENSP00000352348:W381C;ENSP00000412444:W401C	ENSP00000320130:W418C	W	+	3	0	DYNC1I1	95500001	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.771000	0.95319	0.561000	0.74099	TGG		0.438	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		28	64	1	0	1.68575e-08	0.007291	2.20605e-08	28	64				
LAMB1	3912	broad.mit.edu	37	7	107592472	107592472	+	Silent	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:107592472G>A	ENST00000222399.6	-	23	3506	c.3276C>T	c.(3274-3276)ttC>ttT	p.F1092F	LAMB1_ENST00000393561.1_Silent_p.F1116F	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1092	Laminin EGF-like 12. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.F1092F(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						AAGATGGCCCGAAGGAATGAG	0.577																																							uc003vew.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(3274-3276)TTC>TTT		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						52.0	39.0	43.0					7																	107592472		2203	4300	6503	SO:0001819	synonymous_variant	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107592472G>A	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3276C>T	7.37:g.107592472G>A						LAMB1_uc003vev.2_Silent_p.F1116F	p.F1092F	NM_002291	NP_002282	P07942	LAMB1_HUMAN			23	3611	-			1092			Laminin EGF-like 12.		Q14D91	Silent	SNP	ENST00000222399.6	37	c.3276C>T	CCDS5750.1																																																																																				0.577	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		4	24	0	0	0	0.009096	0	4	24				
CPED1	79974	broad.mit.edu	37	7	120629670	120629670	+	5'UTR	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:120629670C>A	ENST00000310396.5	+	0	462				CPED1_ENST00000495036.1_3'UTR|CPED1_ENST00000340646.5_5'Flank|CPED1_ENST00000450913.2_5'UTR	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1							endoplasmic reticulum (GO:0005783)											TGAAGCTGAACTGGTCATGGT	0.502																																							uc003vjq.3		NA																	0				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(-7--3)AACTG>AAATG		hypothetical protein LOC79974 isoform 1							130.0	115.0	120.0					7																	120629670		2203	4300	6503	SO:0001623	5_prime_UTR_variant	79974					endoplasmic reticulum		g.chr7:120629670C>A		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.-6C>A	7.37:g.120629670C>A						C7orf58_uc003vjr.1_Translation_Start_Site|C7orf58_uc003vjs.3_Translation_Start_Site		NM_024913	NP_079189	A4D0V7	CG058_HUMAN			2	442	+	all_neural(327;0.117)							A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Translation_Start_Site	SNP	ENST00000310396.5	37	c.-5C>A	CCDS34739.1																																																																																				0.502	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		18	46	1	0	1.37522e-17	0.007413	2.31387e-17	18	46				
PTPRZ1	5803	broad.mit.edu	37	7	121651939	121651939	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:121651939G>T	ENST00000393386.2	+	12	3250	c.2839G>T	c.(2839-2841)Gca>Tca	p.A947S	PTPRZ1_ENST00000483028.1_Intron|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	947					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A947S(2)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TTACAGTTCTGCAATACCTGT	0.448																																							uc003vjy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(2839-2841)GCA>TCA		protein tyrosine phosphatase, receptor-type,							160.0	139.0	146.0					7																	121651939		2203	4300	6503	SO:0001583	missense	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121651939G>T	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2839G>T	7.37:g.121651939G>T	ENSP00000377047:p.Ala947Ser					PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	p.A947S	NM_002851	NP_002842	P23471	PTPRZ_HUMAN			12	3234	+			947			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	c.2839G>T	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	G	9.523	1.108699	0.20714	.	.	ENSG00000106278	ENST00000393386	T	0.46819	0.86	5.57	3.37	0.38596	.	0.364768	0.26804	N	0.022418	T	0.40322	0.1112	L	0.53249	1.67	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.32745	-0.9895	10	0.44086	T	0.13	.	8.5897	0.33679	0.0769:0.0:0.5579:0.3651	.	947	P23471	PTPRZ_HUMAN	S	947	ENSP00000377047:A947S	ENSP00000377047:A947S	A	+	1	0	PTPRZ1	121439175	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.787000	0.26858	1.293000	0.44690	0.650000	0.86243	GCA		0.448	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		28	79	1	0	3.65163e-15	0.00632	5.87958e-15	28	79				
PTPRZ1	5803	broad.mit.edu	37	7	121652034	121652034	+	Silent	SNP	C	C	G	rs377203515		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:121652034C>G	ENST00000393386.2	+	12	3345	c.2934C>G	c.(2932-2934)acC>acG	p.T978T	PTPRZ1_ENST00000483028.1_Intron|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	978					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T978T(2)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						CGTTAATAACCCCAACTGCAT	0.453																																							uc003vjy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(2932-2934)ACC>ACG		protein tyrosine phosphatase, receptor-type,							139.0	136.0	137.0					7																	121652034		2203	4300	6503	SO:0001819	synonymous_variant	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121652034C>G	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2934C>G	7.37:g.121652034C>G						PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	p.T978T	NM_002851	NP_002842	P23471	PTPRZ_HUMAN			12	3329	+			978			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	c.2934C>G	CCDS34740.1																																																																																				0.453	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		44	89	0	0	0	0.00361	0	44	89				
COPG2	26958	broad.mit.edu	37	7	130295897	130295897	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:130295897C>G	ENST00000445977.2	-	9	753	c.664G>C	c.(664-666)Ggt>Cgt	p.G222R				Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2	222					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)	structural molecule activity (GO:0005198)	p.G222R(1)		large_intestine(1)	1	Melanoma(18;0.0435)					GACTTGAGACCAGATTTAGTA	0.403																																							uc003vqh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(664-666)GGT>CGT		coatomer protein complex, subunit gamma 2							112.0	106.0	108.0					7																	130295897		1904	4124	6028	SO:0001583	missense	26958				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity	g.chr7:130295897C>G	AF157833	CCDS75662.1	7q32	2010-06-22			ENSG00000158623	ENSG00000158623			2237	protein-coding gene	gene with protein product	"""coat protein, nonclathrin, gamma-2-cop"""	604355				10556286, 10995575	Standard	NM_001290033		Approved	2-COP	uc003vqh.1	Q9UBF2	OTTHUMG00000155364	ENST00000445977.2:c.664G>C	7.37:g.130295897C>G	ENSP00000393912:p.Gly222Arg						p.G222R	NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN			9	754	-	Melanoma(18;0.0435)		222					A6NH74|Q2NLA0|Q54AC3|Q8WVW8	Missense_Mutation	SNP	ENST00000445977.2	37	c.664G>C		.	.	.	.	.	.	.	.	.	.	C	22.8	4.341035	0.81911	.	.	ENSG00000158623	ENST00000445977;ENST00000330992	T;T	0.26518	1.73;1.73	5.31	4.43	0.53597	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.056703	0.64402	U	0.000001	T	0.35480	0.0933	L	0.56769	1.78	0.80722	D	1	P	0.48407	0.91	P	0.52066	0.689	T	0.05716	-1.0868	10	0.23891	T	0.37	-7.8499	12.8418	0.57806	0.0:0.9202:0.0:0.0798	.	222	Q9UBF2	COPG2_HUMAN	R	222	ENSP00000393912:G222R;ENSP00000331218:G222R	ENSP00000331218:G222R	G	-	1	0	COPG2	129946434	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.775000	0.62346	1.250000	0.43966	0.561000	0.74099	GGT		0.403	COPG2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_012133		14	46	0	0	0	0.001855	0	14	46				
NUP205	23165	broad.mit.edu	37	7	135261743	135261743	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:135261743G>T	ENST00000285968.6	+	5	541	c.515G>T	c.(514-516)cGc>cTc	p.R172L	NUP205_ENST00000440390.2_5'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	172					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.R172L(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						ATGACAACACGCTTTACAGAT	0.363																																							uc003vsw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(514-516)CGC>CTC		nucleoporin 205kDa							110.0	106.0	107.0					7																	135261743		2203	4300	6503	SO:0001583	missense	23165				carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr7:135261743G>T	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.515G>T	7.37:g.135261743G>T	ENSP00000285968:p.Arg172Leu					NUP205_uc011kqa.1_RNA	p.R172L	NM_015135	NP_055950	Q92621	NU205_HUMAN			5	546	+			172					A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	c.515G>T	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097625	0.56075	.	.	ENSG00000155561	ENST00000285968	T	0.29917	1.55	5.61	3.81	0.43845	.	0.044427	0.85682	D	0.000000	T	0.39332	0.1074	L	0.51422	1.61	0.80722	D	1	D	0.59767	0.986	P	0.55615	0.78	T	0.06409	-1.0828	10	0.27082	T	0.32	-2.688	11.8876	0.52610	0.1408:0.0:0.8592:0.0	.	172	Q92621	NU205_HUMAN	L	172	ENSP00000285968:R172L	ENSP00000285968:R172L	R	+	2	0	NUP205	134912283	1.000000	0.71417	0.974000	0.42286	0.282000	0.26991	3.626000	0.54245	0.744000	0.32741	-0.229000	0.12294	CGC		0.363	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			28	27	1	0	2.85442e-18	0.002096	4.81541e-18	28	27				
NUP205	23165	broad.mit.edu	37	7	135333220	135333220	+	Silent	SNP	A	A	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:135333220A>G	ENST00000285968.6	+	43	5981	c.5955A>G	c.(5953-5955)ttA>ttG	p.L1985L		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1985					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.L1985L(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TTGAAGGATTATATTCAAAAG	0.413																																							uc003vsw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(5953-5955)TTA>TTG		nucleoporin 205kDa							103.0	103.0	103.0					7																	135333220		2203	4300	6503	SO:0001819	synonymous_variant	23165				carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr7:135333220A>G	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.5955A>G	7.37:g.135333220A>G						NUP205_uc003vsx.2_RNA	p.L1985L	NM_015135	NP_055950	Q92621	NU205_HUMAN			43	5986	+			1985					A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	c.5955A>G	CCDS34759.1																																																																																				0.413	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			17	40	0	0	0	0.006122	0	17	40				
UBN2	254048	broad.mit.edu	37	7	138946381	138946381	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:138946381C>A	ENST00000473989.3	+	6	1289	c.1289C>A	c.(1288-1290)aCc>aAc	p.T430N	UBN2_ENST00000288561.8_Missense_Mutation_p.T347N	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	430						extracellular space (GO:0005615)|nucleus (GO:0005634)		p.T347N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						GAAAATGGAACCACCACCCAG	0.483																																							uc011kqr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1288-1290)ACC>AAC		ubinuclein 2							76.0	74.0	74.0					7																	138946381		1919	4127	6046	SO:0001583	missense	254048							g.chr7:138946381C>A	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1289C>A	7.37:g.138946381C>A	ENSP00000418648:p.Thr430Asn					UBN2_uc003vuv.2_Missense_Mutation_p.T153N	p.T430N	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN			6	1289	+			430					A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	37	c.1289C>A	CCDS43655.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.670|3.670	-0.067626|-0.067626	0.07273|0.07273	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000483726|ENST00000473989;ENST00000288561	.|T;T	.|0.28666	.|1.6;1.6	5.72|5.72	-1.04|-1.04	0.10068|0.10068	.|.	.|0.547563	.|0.21963	.|N	.|0.066565	T|T	0.07773|0.07773	0.0195|0.0195	N|N	0.01048|0.01048	-1.04|-1.04	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.38156|0.38156	-0.9674|-0.9674	5|9	.|.	.|.	.|.	-1.586|-1.586	7.6898|7.6898	0.28561|0.28561	0.3248:0.5043:0.1709:0.0|0.3248:0.5043:0.1709:0.0	.|.	.|430	.|Q6ZU65	.|UBN2_HUMAN	T|N	199|430;347	.|ENSP00000418648:T430N;ENSP00000288561:T347N	.|.	P|T	+|+	1|2	0|0	UBN2|UBN2	138596921|138596921	0.001000|0.001000	0.12720|0.12720	0.886000|0.886000	0.34754|0.34754	0.980000|0.980000	0.70556|0.70556	-0.022000|-0.022000	0.12480|0.12480	-0.158000|-0.158000	0.11040|0.11040	-0.262000|-0.262000	0.10625|0.10625	CCA|ACC		0.483	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569		15	42	1	0	1.3612e-06	0.003163	1.66806e-06	15	42				
PRSS58	136541	broad.mit.edu	37	7	141955399	141955399	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:141955399C>T	ENST00000552471.1	-	2	454	c.135G>A	c.(133-135)ctG>ctA	p.L45L	PRSS58_ENST00000547058.2_Silent_p.L45L			Q8IYP2	PRS58_HUMAN	protease, serine, 58	45	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.L45L(1)		kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						GCGGGTGGATCAGGACTCCAG	0.498																																							uc003vxb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(133-135)CTG>CTA		trypsin X3 precursor							82.0	79.0	80.0					7																	141955399		2203	4300	6503	SO:0001819	synonymous_variant	136541				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr7:141955399C>T		CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.135G>A	7.37:g.141955399C>T						TRYX3_uc003vxc.3_Silent_p.L45L	p.L45L	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN			2	455	-	Melanoma(164;0.0272)		45			Peptidase S1.		B3KVJ6|D3DXD2	Silent	SNP	ENST00000552471.1	37	c.135G>A	CCDS5871.1																																																																																				0.498	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317		11	37	0	0	0	0.008291	0	11	37				
PRSS1	5644	broad.mit.edu	37	7	142458452	142458452	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:142458452C>A	ENST00000311737.7	+	2	93	c.87C>A	c.(85-87)aaC>aaA	p.N29K	PRSS1_ENST00000486171.1_Missense_Mutation_p.N29K	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	29	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		N -> I (in PCTT). {ECO:0000269|PubMed:11866271, ECO:0000269|PubMed:15776435, ECO:0000269|PubMed:9322498, ECO:0000269|PubMed:9633818}.|N -> T (in PCTT). {ECO:0000269|PubMed:11788572}.		cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.N29K(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GGGGCTACAACTGTGAGGAGA	0.542																																							uc003wak.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(85-87)AAC>AAA		protease, serine, 1 preproprotein							151.0	147.0	148.0					7																	142458452		2203	4300	6503	SO:0001583	missense	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142458452C>A	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.87C>A	7.37:g.142458452C>A	ENSP00000308720:p.Asn29Lys					uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Intron|PRSS1_uc003wam.2_5'Flank	p.N29K	NM_002769	NP_002760	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		2	104	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	29		N -> I (in PCTT).|N -> T (in PCTT).	Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	c.87C>A	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	C	9.050	0.991858	0.18966	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.87966	-2.32;-2.32	3.49	3.49	0.39957	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.159801	0.56097	D	0.000028	T	0.80048	0.4552	N	0.26042	0.785	0.24376	N	0.994811	B	0.12013	0.005	B	0.19666	0.026	T	0.71454	-0.4588	10	0.44086	T	0.13	.	14.3966	0.67015	0.0:1.0:0.0:0.0	.	29	P07477	TRY1_HUMAN	K	29	ENSP00000417854:N29K;ENSP00000308720:N29K	ENSP00000308720:N29K	N	+	3	2	PRSS1	142138026	1.000000	0.71417	0.996000	0.52242	0.015000	0.08874	2.062000	0.41413	1.879000	0.54435	0.404000	0.27445	AAC		0.542	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			7	128	1	0	8.12818e-05	0.001984	9.43344e-05	7	128				
CLCN1	1180	broad.mit.edu	37	7	143036384	143036384	+	Silent	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:143036384C>T	ENST00000343257.2	+	13	1527	c.1440C>T	c.(1438-1440)ccC>ccT	p.P480P		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	480			P -> L (in MCD). {ECO:0000269|PubMed:8112288}.		chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.P480P(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TGCCCATACCCTGCGGAGGCT	0.488																																							uc003wcr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(1438-1440)CCC>CCT		chloride channel 1, skeletal muscle							222.0	213.0	216.0					7																	143036384		2203	4300	6503	SO:0001819	synonymous_variant	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143036384C>T	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1440C>T	7.37:g.143036384C>T						CLCN1_uc011ktc.1_Silent_p.P92P	p.P480P	NM_000083	NP_000074	P35523	CLCN1_HUMAN			13	1527	+	Melanoma(164;0.205)		480		P -> L (in THD).			A4D2H5|Q2M202	Silent	SNP	ENST00000343257.2	37	c.1440C>T	CCDS5881.1																																																																																				0.488	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		67	142	0	0	0	0.00361	0	67	142				
SSPO	23145	broad.mit.edu	37	7	149522153	149522153	+	RNA	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:149522153G>T	ENST00000378016.2	+	0	13940							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)	p.W32C(1)				Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCTCTGTGGAGGAGGCTGC	0.662																																							uc010lpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13939-13941)GGA>GTA		SCO-spondin precursor							18.0	23.0	22.0					7																	149522153		1894	4108	6002			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149522153G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149522153G>T						SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_Intron|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_Intron	p.G4647V	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		97	13940	+	Melanoma(164;0.165)|Ovarian(565;0.177)		4647			TSP type-1 23.		Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37	c.13940G>T																																																																																					0.662	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				6	6	1	0	0.00116845	0.001168	0.00128792	6	6				
ACTR3B	57180	broad.mit.edu	37	7	152549293	152549293	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:152549293C>T	ENST00000256001.8	+	10	1168	c.1034C>T	c.(1033-1035)gCt>gTt	p.A345V	ACTR3B_ENST00000397282.2_Missense_Mutation_p.A257V|ACTR3B_ENST00000537264.1_Missense_Mutation_p.A257V|ACTR3B_ENST00000377776.3_Intron	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	345						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.A345V(1)		breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		GTGGTGGATGCTAGGCTGAGG	0.602																																							uc003wle.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1033-1035)GCT>GTT		actin-related protein 3-beta isoform 1							105.0	100.0	102.0					7																	152549293		2203	4300	6503	SO:0001583	missense	57180				regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding	g.chr7:152549293C>T		CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.1034C>T	7.37:g.152549293C>T	ENSP00000256001:p.Ala345Val					ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Missense_Mutation_p.A257V|ACTR3B_uc011kvp.1_Missense_Mutation_p.A257V	p.A345V	NM_020445	NP_065178	Q9P1U1	ARP3B_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)	10	1151	+		all_hematologic(28;0.0592)|Prostate(32;0.191)	345					A8MTG1|B4DFW4|Q7Z526|Q96BT2	Missense_Mutation	SNP	ENST00000256001.8	37	c.1034C>T	CCDS5934.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140118	0.37825	.	.	ENSG00000133627	ENST00000256001;ENST00000397282;ENST00000537264	T;T;T	0.07021	3.23;3.23;3.23	5.35	5.35	0.76521	.	0.000000	0.56097	U	0.000026	T	0.17323	0.0416	M	0.82823	2.61	0.46981	D	0.999274	B	0.15930	0.015	B	0.16722	0.016	T	0.01879	-1.1255	10	0.46703	T	0.11	-8.6203	17.6707	0.88216	0.0:1.0:0.0:0.0	.	345	Q9P1U1	ARP3B_HUMAN	V	345;257;257	ENSP00000256001:A345V;ENSP00000380452:A257V;ENSP00000446157:A257V	ENSP00000256001:A345V	A	+	2	0	ACTR3B	152180226	1.000000	0.71417	0.902000	0.35471	0.169000	0.22640	5.490000	0.66881	2.491000	0.84063	0.557000	0.71058	GCT		0.602	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322803.1	NM_020445		9	42	0	0	0	0.008291	0	9	42				
MYOM2	9172	broad.mit.edu	37	8	2027642	2027642	+	Splice_Site	SNP	C	C	T	rs376844864		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:2027642C>T	ENST00000262113.4	+	13	1605	c.1464C>T	c.(1462-1464)gcC>gcT	p.A488A	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	488					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.A488A(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCTCCGCAGCCGTTCATTTGG	0.507																																							uc003wpx.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1462-1464)GCC>GCT		myomesin 2		C		1,4405	2.1+/-5.4	0,1,2202	307.0	300.0	302.0		1464	-10.5	0.0	8		302	0,8600		0,0,4300	no	coding-synonymous-near-splice	MYOM2	NM_003970.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		488/1466	2027642	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	9172				muscle contraction	myosin filament	structural constituent of muscle	g.chr8:2027642C>T		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1463-1C>T	8.37:g.2027642C>T						MYOM2_uc011kwi.1_Intron	p.A488A	NM_003970	NP_003961	P54296	MYOM2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	13	1602	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	488					Q7Z3Y2	Silent	SNP	ENST00000262113.4	37	c.1464C>T	CCDS5957.1																																																																																				0.507	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	Silent	24	145	0	0	0	0.007291	0	24	145				
HTRA4	203100	broad.mit.edu	37	8	38832622	38832622	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:38832622C>T	ENST00000302495.4	+	2	639	c.539C>T	c.(538-540)tCg>tTg	p.S180L	CTD-2544N14.3_ENST00000520863.1_RNA	NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	180					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.S180L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			GTGGCGCCATCGGTGGTTCAC	0.572																																							uc003xmj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(538-540)TCG>TTG		HtrA serine peptidase 4 precursor							125.0	124.0	125.0					8																	38832622		2203	4300	6503	SO:0001583	missense	203100				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity	g.chr8:38832622C>T	AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.539C>T	8.37:g.38832622C>T	ENSP00000305919:p.Ser180Leu						p.S180L	NM_153692	NP_710159	P83105	HTRA4_HUMAN	LUSC - Lung squamous cell carcinoma(45;1.5e-07)		2	654	+		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	180					Q542Z4|Q6PF13	Missense_Mutation	SNP	ENST00000302495.4	37	c.539C>T	CCDS6110.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.785654	0.70337	.	.	ENSG00000169495	ENST00000302495	D	0.89875	-2.58	5.34	5.34	0.76211	Peptidase cysteine/serine, trypsin-like (1);	0.334231	0.25275	N	0.031848	D	0.87341	0.6153	M	0.71581	2.175	0.49389	D	0.999783	P	0.43701	0.815	B	0.32864	0.154	D	0.89735	0.3929	10	0.87932	D	0	-14.7312	18.2073	0.89859	0.0:1.0:0.0:0.0	.	180	P83105	HTRA4_HUMAN	L	180	ENSP00000305919:S180L	ENSP00000305919:S180L	S	+	2	0	HTRA4	38951779	0.997000	0.39634	0.374000	0.26016	0.518000	0.34316	7.493000	0.81493	2.689000	0.91719	0.462000	0.41574	TCG		0.572	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377077.1	NM_153692		5	121	0	0	0	0.001168	0	5	121				
SNTG1	54212	broad.mit.edu	37	8	51442811	51442811	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:51442811A>T	ENST00000522124.1	+	10	1202	c.541A>T	c.(541-543)Aac>Tac	p.N181Y	SNTG1_ENST00000276467.5_Missense_Mutation_p.N181Y|SNTG1_ENST00000518864.1_Missense_Mutation_p.N181Y|SNTG1_ENST00000517473.1_Missense_Mutation_p.N181Y	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	181					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.N181Y(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CTACCATCCCAACAATACAGT	0.428																																							uc010lxy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)	5						c.(541-543)AAC>TAC		syntrophin, gamma 1							172.0	143.0	152.0					8																	51442811		2203	4300	6503	SO:0001583	missense	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51442811A>T	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.541A>T	8.37:g.51442811A>T	ENSP00000429842:p.Asn181Tyr					SNTG1_uc003xqs.1_Missense_Mutation_p.N181Y|SNTG1_uc010lxz.1_Missense_Mutation_p.N181Y|SNTG1_uc011ldl.1_RNA	p.N181Y	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			11	912	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	181					Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	c.541A>T	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421448	0.83559	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.68	5.68	0.88126	Pleckstrin homology domain (1);	0.078133	0.85682	D	0.000000	T	0.59715	0.2214	L	0.47716	1.5	0.80722	D	1	P;B	0.50528	0.936;0.265	P;B	0.53809	0.735;0.229	T	0.62723	-0.6794	10	0.66056	D	0.02	.	14.7555	0.69560	1.0:0.0:0.0:0.0	.	181;181	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	Y	181	ENSP00000429276:N181Y;ENSP00000429842:N181Y;ENSP00000431123:N181Y;ENSP00000276467:N181Y	ENSP00000276467:N181Y	N	+	1	0	SNTG1	51605364	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.593000	0.82686	2.157000	0.67596	0.528000	0.53228	AAC		0.428	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			6	31	0	0	0	0.001168	0	6	31				
PCMTD1	115294	broad.mit.edu	37	8	52733190	52733190	+	Silent	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:52733190G>T	ENST00000360540.5	-	7	1201	c.795C>A	c.(793-795)gcC>gcA	p.A265A	PCMTD1_ENST00000522514.1_Silent_p.A265A|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Silent_p.A189A	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	265						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.A265A(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				GAATCCCCTTGGCCTGCATCT	0.418																																							uc003xqx.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(793-795)GCC>GCA		protein-L-isoaspartate (D-aspartate)							102.0	107.0	105.0					8																	52733190		2203	4296	6499	SO:0001819	synonymous_variant	115294					cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity	g.chr8:52733190G>T		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.795C>A	8.37:g.52733190G>T						PCMTD1_uc011ldm.1_Silent_p.A135A|PCMTD1_uc003xqw.3_Silent_p.A265A|PCMTD1_uc011ldn.1_Silent_p.A77A|PCMTD1_uc010lya.2_Silent_p.A189A	p.A265A	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN			6	1136	-		Lung NSC(129;0.0795)|all_lung(136;0.144)	265					Q96FK9	Silent	SNP	ENST00000360540.5	37	c.795C>A	CCDS6148.1																																																																																				0.418	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937		5	122	1	0	4.68919e-08	0.008291	6.0249e-08	5	122				
ZFHX4	79776	broad.mit.edu	37	8	77764145	77764145	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:77764145C>A	ENST00000521891.2	+	10	5436	c.4988C>A	c.(4987-4989)aCc>aAc	p.T1663N	ZFHX4_ENST00000050961.6_Missense_Mutation_p.T1618N|ZFHX4_ENST00000518282.1_Missense_Mutation_p.T1637N|ZFHX4_ENST00000455469.2_Missense_Mutation_p.T1618N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1618	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.T1663N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGCAAAGATACCCATTTAGAT	0.453										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(4852-4854)ACC>AAC		zinc finger homeodomain 4							89.0	87.0	88.0					8																	77764145		1939	4134	6073	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77764145C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4988C>A	8.37:g.77764145C>A	ENSP00000430497:p.Thr1663Asn	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.T1663N|ZFHX4_uc003yaw.1_Missense_Mutation_p.T1618N	p.T1618N	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	5240	+			1618					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.4853C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	9.975	1.226418	0.22542	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.47528	0.84;0.88;0.85;0.84	4.41	3.52	0.40303	.	0.320649	0.22200	U	0.063248	T	0.21921	0.0528	N	0.08118	0	0.24101	N	0.995876	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.15578	-1.0432	10	0.14252	T	0.57	.	6.1022	0.20053	0.0:0.6767:0.1613:0.162	.	1618;1618;1663	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	N	1663;1663;1618;1618;1637	ENSP00000430497:T1663N;ENSP00000399605:T1618N;ENSP00000050961:T1618N;ENSP00000430848:T1637N	ENSP00000050961:T1618N	T	+	2	0	ZFHX4	77926700	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.441000	0.44864	1.198000	0.43158	0.542000	0.68232	ACC		0.453	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		11	43	1	0	2.27111e-07	0.001368	2.84897e-07	11	43				
GDF6	392255	broad.mit.edu	37	8	97172755	97172755	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:97172755G>A	ENST00000287020.5	-	1	265	c.166C>T	c.(166-168)Cgc>Tgc	p.R56C		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	56					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)		p.R56C(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					TCACTGTCGCGCGGCGCCCGC	0.711																																							uc003yhp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(166-168)CGC>TGC		growth differentiation factor 6 precursor							43.0	52.0	49.0					8																	97172755		2195	4290	6485	SO:0001583	missense	392255				activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr8:97172755G>A		CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.166C>T	8.37:g.97172755G>A	ENSP00000287020:p.Arg56Cys						p.R56C	NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN			1	266	-	Breast(36;2.67e-05)		56					Q6PI58	Missense_Mutation	SNP	ENST00000287020.5	37	c.166C>T	CCDS34926.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633979	0.67130	.	.	ENSG00000156466	ENST00000287020;ENST00000454970;ENST00000435084	D	0.81579	-1.51	4.3	3.4	0.38934	.	4.718310	0.02033	U	0.048655	D	0.82651	0.5083	L	0.36672	1.1	0.30741	N	0.746228	D	0.65815	0.995	P	0.53809	0.735	T	0.68511	-0.5389	10	0.62326	D	0.03	.	9.5025	0.39026	0.0:0.0:0.7886:0.2114	.	56	Q6KF10	GDF6_HUMAN	C	56	ENSP00000287020:R56C	ENSP00000287020:R56C	R	-	1	0	GDF6	97241931	0.927000	0.31430	0.669000	0.29828	0.742000	0.42306	1.663000	0.37429	0.776000	0.33473	0.508000	0.49915	CGC		0.711	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557		32	50	0	0	0	0.004289	0	32	50				
RGS22	26166	broad.mit.edu	37	8	101051226	101051226	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:101051226A>C	ENST00000360863.6	-	14	2293	c.2099T>G	c.(2098-2100)cTg>cGg	p.L700R	RGS22_ENST00000523437.1_Missense_Mutation_p.L688R|RGS22_ENST00000523287.1_Missense_Mutation_p.L519R	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	700					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.L700R(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ATAAGCCTGCAGGTCAAACCA	0.348																																							uc003yjb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(2098-2100)CTG>CGG		regulator of G-protein signaling 22							108.0	97.0	100.0					8																	101051226		1854	4097	5951	SO:0001583	missense	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:101051226A>C	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.2099T>G	8.37:g.101051226A>C	ENSP00000354109:p.Leu700Arg					RGS22_uc003yja.1_Missense_Mutation_p.L519R|RGS22_uc003yjc.1_Missense_Mutation_p.L688R|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	p.L700R	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		14	2294	-			700					A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	c.2099T>G	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.035558	0.75617	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.31769	1.48;1.48;1.48	5.17	5.17	0.71159	Regulator of G protein signalling (1);Regulator of G protein signalling superfamily (1);	0.000000	0.64402	D	0.000017	T	0.53238	0.1784	M	0.61703	1.905	0.39146	D	0.962149	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.996	T	0.60078	-0.7333	10	0.87932	D	0	.	15.0145	0.71573	1.0:0.0:0.0:0.0	.	688;700;519	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	R	700;688;519;688	ENSP00000354109:L700R;ENSP00000429382:L519R;ENSP00000428212:L688R	ENSP00000354109:L700R	L	-	2	0	RGS22	101120402	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.384000	0.73177	1.947000	0.56498	0.482000	0.46254	CTG		0.348	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		10	35	0	0	0	0.006214	0	10	35				
ZFPM2	23414	broad.mit.edu	37	8	106814054	106814054	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:106814054C>G	ENST00000407775.2	+	8	1994	c.1744C>G	c.(1744-1746)Cca>Gca	p.P582A	ZFPM2_ENST00000378472.4_Missense_Mutation_p.P313A|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.P450A|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.P450A	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	582					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P582A(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GGCTAAGTCCCCAGAGTTCCC	0.433																																							uc003ymd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)	5						c.(1744-1746)CCA>GCA		zinc finger protein, multitype 2							138.0	140.0	139.0					8																	106814054		1942	4146	6088	SO:0001583	missense	23414				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding	g.chr8:106814054C>G	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1744C>G	8.37:g.106814054C>G	ENSP00000384179:p.Pro582Ala					ZFPM2_uc011lhs.1_Missense_Mutation_p.P313A	p.P582A	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)		8	1767	+			582					Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	c.1744C>G	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.623022	0.66901	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20463	2.07;2.57;2.57;3.8	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.29491	0.0735	L	0.29908	0.895	0.80722	D	1	D	0.60575	0.988	P	0.54759	0.76	T	0.00405	-1.1760	10	0.38643	T	0.18	.	18.3607	0.90374	0.0:1.0:0.0:0.0	.	582	Q8WW38	FOG2_HUMAN	A	582;450;450;313	ENSP00000384179:P582A;ENSP00000430757:P450A;ENSP00000428720:P450A;ENSP00000367733:P313A	ENSP00000367733:P313A	P	+	1	0	ZFPM2	106883230	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.506000	0.81665	2.777000	0.95525	0.655000	0.94253	CCA		0.433	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			33	99	0	0	0	0.004289	0	33	99				
ANXA13	312	broad.mit.edu	37	8	124696964	124696964	+	Splice_Site	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr8:124696964T>C	ENST00000419625.1	-	10	791		c.e10-2		ANXA13_ENST00000262219.6_Splice_Site	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13						cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)	p.?(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CACATCTCACTGGGCAGGACA	0.522																																							uc003yqu.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.e10-1		annexin A13 isoform a							129.0	104.0	112.0					8																	124696964		2203	4300	6503	SO:0001630	splice_region_variant	312				cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding	g.chr8:124696964T>C	Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.719-2A>G	8.37:g.124696964T>C						ANXA13_uc003yqt.2_Splice_Site_p.V281_splice	p.V240_splice	NM_004306	NP_004297	P27216	ANX13_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		10	792	-	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)							Q9BQR5	Splice_Site	SNP	ENST00000419625.1	37	c.719_splice	CCDS47917.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936927	0.52972	.	.	ENSG00000104537	ENST00000262219;ENST00000419625	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3493	0.74370	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANXA13	124766145	1.000000	0.71417	0.992000	0.48379	0.431000	0.31685	6.681000	0.74523	2.268000	0.75426	0.454000	0.30748	.		0.522	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381308.1	NM_004306	Intron	13	30	0	0	0	0.00245	0	13	30				
KIAA2026	158358	broad.mit.edu	37	9	5921606	5921606	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:5921606C>A	ENST00000399933.3	-	8	4389	c.4390G>T	c.(4390-4392)Gta>Tta	p.V1464L	KIAA2026_ENST00000381461.2_Missense_Mutation_p.V1434L	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1464								p.V639L(1)|p.V1464L(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CCACTGATTACATCTCCATTT	0.388																																							uc003zjq.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(4390-4392)GTA>TTA		hypothetical protein LOC158358							154.0	145.0	148.0					9																	5921606		1961	4157	6118	SO:0001583	missense	158358							g.chr9:5921606C>A	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4390G>T	9.37:g.5921606C>A	ENSP00000382815:p.Val1464Leu					KIAA2026_uc010mht.2_Missense_Mutation_p.V639L	p.V1464L	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	8	4606	-		Acute lymphoblastic leukemia(23;0.158)	1464					A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37	c.4390G>T		.	.	.	.	.	.	.	.	.	.	C	1.861	-0.462565	0.04508	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.76	-0.704	0.11256	.	1.165230	0.06369	N	0.713100	T	0.12561	0.0305	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.21827	-1.0234	9	0.20519	T	0.43	12.2027	2.2147	0.03956	0.1261:0.4505:0.1116:0.3118	.	1464	Q5HYC2	K2026_HUMAN	L	1464;1434	.	ENSP00000370870:V1434L	V	-	1	0	KIAA2026	5911606	0.000000	0.05858	0.051000	0.19133	0.936000	0.57629	-0.573000	0.05874	-0.043000	0.13513	0.484000	0.47621	GTA		0.388	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		18	48	1	0	0.00395357	0.003954	0.00425461	18	48				
SNAPC3	6619	broad.mit.edu	37	9	15433602	15433602	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:15433602G>A	ENST00000380821.3	+	3	621	c.445G>A	c.(445-447)Gcc>Acc	p.A149T	SNAPC3_ENST00000461041.1_3'UTR|RNU6-319P_ENST00000516025.1_RNA	NM_001039697.1	NP_001034786.1	Q92966	SNPC3_HUMAN	small nuclear RNA activating complex, polypeptide 3, 50kDa	149					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription (GO:0009301)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A149T(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(2)	12				GBM - Glioblastoma multiforme(50;2.15e-06)		AATAGATCGAGCCTGCAGACA	0.348																																							uc003zlt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(445-447)GCC>ACC		small nuclear RNA activating complex,							145.0	144.0	144.0					9																	15433602		2203	4300	6503	SO:0001583	missense	6619				regulation of transcription, DNA-dependent|snRNA transcription|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|protein binding	g.chr9:15433602G>A	U71300	CCDS6478.1	9p22.3	2008-07-21	2002-08-29		ENSG00000164975	ENSG00000164975			11136	protein-coding gene	gene with protein product		602348	"""small nuclear RNA activating complex, polypeptide 3, 50kD"""			9003788	Standard	XR_428427		Approved	SNAP50, PTFbeta, MGC33124, MGC132011	uc003zlt.3	Q92966	OTTHUMG00000019583	ENST00000380821.3:c.445G>A	9.37:g.15433602G>A	ENSP00000370200:p.Ala149Thr					SNAPC3_uc011lmt.1_Missense_Mutation_p.A149T|SNAPC3_uc003zlu.2_RNA	p.A149T	NM_001039697	NP_001034786	Q92966	SNPC3_HUMAN		GBM - Glioblastoma multiforme(50;2.15e-06)	3	541	+			149					D3DRI8|Q2VPI6|Q5T285	Missense_Mutation	SNP	ENST00000380821.3	37	c.445G>A	CCDS6478.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.296498	0.23650	.	.	ENSG00000164975	ENST00000380821;ENST00000380807;ENST00000447670;ENST00000421710	T	0.47177	0.85	5.48	3.28	0.37604	.	0.758088	0.12046	N	0.504521	T	0.36880	0.0983	L	0.43152	1.355	0.09310	N	1	B;B	0.34329	0.449;0.124	B;B	0.32864	0.154;0.03	T	0.20638	-1.0269	10	0.40728	T	0.16	-1.9685	7.0168	0.24892	0.0998:0.0:0.7247:0.1755	.	120;149	B4DDR9;Q92966	.;SNPC3_HUMAN	T	149;149;120;149	ENSP00000370200:A149T	ENSP00000370185:A149T	A	+	1	0	SNAPC3	15423602	0.211000	0.23529	0.042000	0.18584	0.970000	0.65996	2.501000	0.45389	1.296000	0.44742	0.655000	0.94253	GCC		0.348	SNAPC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051763.2	NM_001039697		29	74	0	0	0	0.003755	0	29	74				
KLHL9	55958	broad.mit.edu	37	9	21334168	21334168	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:21334168C>A	ENST00000359039.4	-	1	1211	c.691G>T	c.(691-693)Gat>Tat	p.D231Y	KLHL9_ENST00000537938.1_Missense_Mutation_p.D163Y			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	231	BACK.				cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.D231Y(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		GCAGCATAATCCATCCGAGGG	0.423																																							uc003zoy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(691-693)GAT>TAT		kelch-like 9							100.0	97.0	98.0					9																	21334168		2203	4300	6503	SO:0001583	missense	55958				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody		g.chr9:21334168C>A	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.691G>T	9.37:g.21334168C>A	ENSP00000351933:p.Asp231Tyr					KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	p.D231Y	NM_018847	NP_061335	Q9P2J3	KLHL9_HUMAN		Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)	1	1262	-			231			BACK.		Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	37	c.691G>T	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938634	0.34189	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.69306	-0.39;-0.39	5.37	5.37	0.77165	BTB/Kelch-associated (2);	0.109140	0.64402	D	0.000010	T	0.67906	0.2943	L	0.34521	1.04	0.58432	D	0.99999	B	0.32893	0.389	P	0.45558	0.485	T	0.69785	-0.5051	10	0.66056	D	0.02	.	16.9779	0.86319	0.0:1.0:0.0:0.0	.	231	Q9P2J3	KLHL9_HUMAN	Y	231;163	ENSP00000351933:D231Y;ENSP00000437733:D163Y	ENSP00000351933:D231Y	D	-	1	0	KLHL9	21324168	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.408000	0.80041	2.688000	0.91661	0.650000	0.86243	GAT		0.423	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847		22	43	1	0	3.8784e-16	0.001882	6.35738e-16	22	43				
ACO1	48	broad.mit.edu	37	9	32424649	32424649	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:32424649T>A	ENST00000309951.6	+	10	1312	c.1174T>A	c.(1174-1176)Tgc>Agc	p.C392S	ACO1_ENST00000541043.1_Missense_Mutation_p.C293S|ACO1_ENST00000379923.1_Missense_Mutation_p.C392S	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	392					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.C392S(2)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		CTTTGAGAGCTGCCTTGGAGC	0.502																																							uc003zqw.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1174-1176)TGC>AGC		aconitase 1							95.0	103.0	101.0					9																	32424649		2203	4300	6503	SO:0001583	missense	48				citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding	g.chr9:32424649T>A	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.1174T>A	9.37:g.32424649T>A	ENSP00000309477:p.Cys392Ser					ACO1_uc010mjh.1_Missense_Mutation_p.C226S|ACO1_uc003zqx.3_Missense_Mutation_p.C392S|ACO1_uc003zqy.3_RNA	p.C392S	NM_002197	NP_002188	P21399	ACOC_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)	10	1329	+			392					D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	37	c.1174T>A	CCDS6525.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.031286	0.75504	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.39787	1.06;1.06;1.06	5.75	5.75	0.90469	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.000000	0.85682	D	0.000000	T	0.51635	0.1686	L	0.35644	1.08	0.80722	D	1	D;B	0.54772	0.968;0.001	D;B	0.70935	0.971;0.072	T	0.37888	-0.9686	10	0.13853	T	0.58	-18.3643	15.3282	0.74182	0.0:0.0:0.0:1.0	.	428;392	Q59FI0;P21399	.;ACOC_HUMAN	S	428;392;392;392;293	ENSP00000309477:C392S;ENSP00000369255:C392S;ENSP00000438733:C293S	ENSP00000309477:C392S	C	+	1	0	ACO1	32414649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.927000	0.87577	2.320000	0.78422	0.528000	0.53228	TGC		0.502	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197		23	64	0	0	0	0.00333	0	23	64				
TAF1L	138474	broad.mit.edu	37	9	32630549	32630549	+	Missense_Mutation	SNP	T	T	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:32630549T>C	ENST00000242310.4	-	1	5118	c.5029A>G	c.(5029-5031)Acg>Gcg	p.T1677A	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1677					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.T1677A(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCTCGAGACGTACTGAGGGAT	0.483																																							uc003zrg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(5029-5031)ACG>GCG		TBP-associated factor RNA polymerase 1-like							215.0	198.0	204.0					9																	32630549		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32630549T>C	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.5029A>G	9.37:g.32630549T>C	ENSP00000418379:p.Thr1677Ala					uc003zrh.1_5'Flank	p.T1677A	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	5119	-			1677					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.5029A>G	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	T	6.421	0.445869	0.12164	.	.	ENSG00000122728	ENST00000242310	T	0.06849	3.25	0.479	0.479	0.16796	.	0.374315	0.33217	N	0.005144	T	0.02193	0.0068	N	0.02539	-0.55	0.09310	N	0.999994	B	0.09022	0.002	B	0.08055	0.003	T	0.46484	-0.9188	10	0.07325	T	0.83	.	5.1959	0.15236	0.0:1.0E-4:0.0:0.9999	.	1677	Q8IZX4	TAF1L_HUMAN	A	1677	ENSP00000418379:T1677A	ENSP00000418379:T1677A	T	-	1	0	TAF1L	32620549	0.992000	0.36948	0.943000	0.38184	0.089000	0.18198	0.093000	0.15086	0.426000	0.26116	0.164000	0.16699	ACG		0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			61	125	0	0	0	0.00361	0	61	125				
TAF1L	138474	broad.mit.edu	37	9	32631092	32631092	+	Missense_Mutation	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:32631092A>T	ENST00000242310.4	-	1	4575	c.4486T>A	c.(4486-4488)Tgt>Agt	p.C1496S	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1496					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.C1496S(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTTTCATCACAGAGATCCAGC	0.408																																							uc003zrg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(4486-4488)TGT>AGT		TBP-associated factor RNA polymerase 1-like							186.0	173.0	178.0					9																	32631092		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32631092A>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4486T>A	9.37:g.32631092A>T	ENSP00000418379:p.Cys1496Ser					uc003zrh.1_5'Flank	p.C1496S	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	4576	-			1496					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.4486T>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	A	16.82	3.227435	0.58668	.	.	ENSG00000122728	ENST00000242310	T	0.18502	2.21	0.489	0.489	0.16854	Bromodomain (3);	0.000000	0.85682	D	0.000000	T	0.18257	0.0438	M	0.72894	2.215	0.52099	D	0.999947	P	0.41569	0.755	B	0.41946	0.371	T	0.02721	-1.1119	10	0.72032	D	0.01	.	5.2121	0.15322	0.9999:0.0:1.0E-4:0.0	.	1496	Q8IZX4	TAF1L_HUMAN	S	1496	ENSP00000418379:C1496S	ENSP00000418379:C1496S	C	-	1	0	TAF1L	32621092	1.000000	0.71417	0.996000	0.52242	0.458000	0.32498	2.108000	0.41854	0.431000	0.26258	0.172000	0.16884	TGT		0.408	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			36	104	0	0	0	0.003271	0	36	104				
SMC5	23137	broad.mit.edu	37	9	72879306	72879306	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:72879306G>T	ENST00000361138.5	+	2	330	c.272G>T	c.(271-273)tGt>tTt	p.C91F		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	91					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.C91F(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						AGCATTGTGTGTGCCATTTGC	0.373																																							uc004ahr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(271-273)TGT>TTT		SMC5 protein							149.0	146.0	147.0					9																	72879306		2203	4300	6503	SO:0001583	missense	23137				DNA recombination|DNA repair	chromosome|nucleus	ATP binding	g.chr9:72879306G>T	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.272G>T	9.37:g.72879306G>T	ENSP00000354957:p.Cys91Phe						p.C91F	NM_015110	NP_055925	Q8IY18	SMC5_HUMAN			2	389	+			91					A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	c.272G>T	CCDS6632.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649223	0.87958	.	.	ENSG00000198887	ENST00000361138	T	0.66815	-0.23	5.65	5.65	0.86999	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.84629	0.5514	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85962	0.1471	10	0.72032	D	0.01	-12.3301	19.6731	0.95918	0.0:0.0:1.0:0.0	.	91	Q8IY18	SMC5_HUMAN	F	91	ENSP00000354957:C91F	ENSP00000354957:C91F	C	+	2	0	SMC5	72069126	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.224000	0.95209	2.817000	0.96982	0.563000	0.77884	TGT		0.373	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110		13	63	1	0	1.99824e-07	0.00499	2.53668e-07	13	63				
SMC5	23137	broad.mit.edu	37	9	72965093	72965093	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:72965093G>A	ENST00000361138.5	+	23	3011	c.2953G>A	c.(2953-2955)Gaa>Aaa	p.E985K	SMC5_ENST00000471372.1_3'UTR	NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	985					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.E985K(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TCAACTGCATGAATTAACTCC	0.328																																							uc004ahr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2953-2955)GAA>AAA		SMC5 protein							91.0	90.0	91.0					9																	72965093		2203	4300	6503	SO:0001583	missense	23137				DNA recombination|DNA repair	chromosome|nucleus	ATP binding	g.chr9:72965093G>A	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.2953G>A	9.37:g.72965093G>A	ENSP00000354957:p.Glu985Lys					SMC5_uc011lry.1_Missense_Mutation_p.E130K	p.E985K	NM_015110	NP_055925	Q8IY18	SMC5_HUMAN			23	3070	+			985					A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	c.2953G>A	CCDS6632.1	.	.	.	.	.	.	.	.	.	.	G	35	5.487723	0.96323	.	.	ENSG00000198887	ENST00000361138	T	0.80033	-1.33	6.07	6.07	0.98685	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.87637	0.6227	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.80894	-0.1178	10	0.06099	T	0.92	-25.6605	20.6525	0.99598	0.0:0.0:1.0:0.0	.	985	Q8IY18	SMC5_HUMAN	K	985	ENSP00000354957:E985K	ENSP00000354957:E985K	E	+	1	0	SMC5	72154913	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.417000	0.97391	2.890000	0.99128	0.585000	0.79938	GAA		0.328	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110		9	72	0	0	0	0.004482	0	9	72				
PCSK5	5125	broad.mit.edu	37	9	78710935	78710935	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:78710935G>C	ENST00000545128.1	+	8	1562	c.1024G>C	c.(1024-1026)Gga>Cga	p.G342R	PCSK5_ENST00000376752.4_Missense_Mutation_p.G342R|PCSK5_ENST00000376767.3_Missense_Mutation_p.G342R	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	342	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.G342R(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TGCAGAAAGCGGAAAGAAACC	0.512																																							uc004ajz.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(1)	3						c.(1024-1026)GGA>CGA		proprotein convertase subtilisin/kexin type 5							162.0	130.0	141.0					9																	78710935		2203	4300	6503	SO:0001583	missense	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78710935G>C		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1024G>C	9.37:g.78710935G>C	ENSP00000446280:p.Gly342Arg					PCSK5_uc004ajy.2_Missense_Mutation_p.G342R|PCSK5_uc004aka.2_RNA	p.G342R	NM_006200	NP_006191	Q92824	PCSK5_HUMAN			8	1562	+			342			Catalytic.		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.1024G>C	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135073	0.94517	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	D	0.94364	0.8188	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94455	0.7671	10	0.54805	T	0.06	-19.8324	20.6013	0.99457	0.0:0.0:1.0:0.0	.	342;342	Q92824-2;B1AMG5	.;.	R	342;45;342;342;342;15	ENSP00000446280:G342R;ENSP00000365958:G342R;ENSP00000365943:G342R;ENSP00000411654:G15R	ENSP00000365943:G342R	G	+	1	0	PCSK5	77900755	1.000000	0.71417	0.907000	0.35723	0.885000	0.51271	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	GGA		0.512	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				8	50	0	0	0	0.00308	0	8	50				
SPATA31E1	286234	broad.mit.edu	37	9	90501444	90501444	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:90501444C>T	ENST00000325643.5	+	4	2108	c.2042C>T	c.(2041-2043)tCt>tTt	p.S681F		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	681					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.S681F(1)									TCCCAGCCTTCTGACTTTGCA	0.612																																							uc004app.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2041-2043)TCT>TTT		chromosome 9 open reading frame 79							46.0	58.0	54.0					9																	90501444		2203	4299	6502	SO:0001583	missense	286234					integral to membrane		g.chr9:90501444C>T	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2042C>T	9.37:g.90501444C>T	ENSP00000322640:p.Ser681Phe					C9orf79_uc004apo.1_Missense_Mutation_p.S493F	p.S681F	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN			4	2077	+			681					B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	c.2042C>T	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	c	9.405	1.079054	0.20227	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.11169	2.8	2.43	0.468	0.16732	.	1.528850	0.04280	N	0.343627	T	0.14485	0.0350	L	0.38175	1.15	0.09310	N	1	D;P	0.56521	0.976;0.703	P;B	0.52424	0.698;0.318	T	0.14117	-1.0484	10	0.87932	D	0	.	2.7356	0.05239	0.2808:0.5545:0.0:0.1647	.	681;333	Q6ZUB1;Q8NA33	CI079_HUMAN;.	F	681;333	ENSP00000322640:S681F	ENSP00000322640:S681F	S	+	2	0	C9orf79	89691264	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.178000	0.16820	0.117000	0.18138	-0.319000	0.08680	TCT		0.612	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		9	40	0	0	0	0.008291	0	9	40				
SPATA31E1	286234	broad.mit.edu	37	9	90501555	90501555	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:90501555G>T	ENST00000325643.5	+	4	2219	c.2153G>T	c.(2152-2154)cGg>cTg	p.R718L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	718					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R718L(1)									GACCCAAGCCGGGATCAAGGC	0.572																																							uc004app.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2152-2154)CGG>CTG		chromosome 9 open reading frame 79							45.0	52.0	50.0					9																	90501555		2203	4300	6503	SO:0001583	missense	286234					integral to membrane		g.chr9:90501555G>T	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2153G>T	9.37:g.90501555G>T	ENSP00000322640:p.Arg718Leu					C9orf79_uc004apo.1_Missense_Mutation_p.R530L	p.R718L	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN			4	2188	+			718					B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	c.2153G>T	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	g	10.28	1.305372	0.23736	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.07444	3.19	2.43	-4.86	0.03132	.	6.312630	0.00397	N	0.000051	T	0.07638	0.0192	L	0.38175	1.15	0.09310	N	1	P;P	0.43633	0.813;0.637	B;B	0.41412	0.356;0.154	T	0.16217	-1.0410	10	0.32370	T	0.25	.	5.1083	0.14796	0.429:0.2611:0.3099:0.0	.	718;370	Q6ZUB1;Q8NA33	CI079_HUMAN;.	L	718;370	ENSP00000322640:R718L	ENSP00000322640:R718L	R	+	2	0	C9orf79	89691375	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	-1.743000	0.01834	-2.469000	0.00531	-1.012000	0.02466	CGG		0.572	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		14	32	1	0	9.31168e-06	0.001855	1.1153e-05	14	32				
NOL8	55035	broad.mit.edu	37	9	95062203	95062203	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:95062203C>T	ENST00000535387.1	-	12	3156	c.3157G>A	c.(3157-3159)Gaa>Aaa	p.E1053K	NOL8_ENST00000358855.4_Missense_Mutation_p.E1023K|NOL8_ENST00000442668.2_Missense_Mutation_p.E1091K|NOL8_ENST00000545558.1_Missense_Mutation_p.E1091K|NOL8_ENST00000542053.1_Missense_Mutation_p.E1023K					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						TCTGTTTCTTCAGTAACATCT	0.378																																							uc004arv.2		NA																	0				ovary(1)	1						c.(3271-3273)GAA>AAA		nucleolar protein 8							240.0	230.0	233.0					9																	95062203		1847	4089	5936	SO:0001583	missense	55035				DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding	g.chr9:95062203C>T	AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.3157G>A	9.37:g.95062203C>T	ENSP00000441300:p.Glu1053Lys					NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Missense_Mutation_p.E323K|NOL8_uc011ltw.1_Missense_Mutation_p.E1023K	p.E1091K	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN			14	3608	-			1091						Missense_Mutation	SNP	ENST00000535387.1	37	c.3271G>A	CCDS47993.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046829	0.75846	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053	T;T;T;T;T	0.17854	2.25;2.28;2.25;2.52;2.28	5.22	4.32	0.51571	.	0.188150	0.45867	D	0.000323	T	0.13157	0.0319	L	0.28115	0.83	0.53005	D	0.999965	B;B	0.23735	0.008;0.09	B;B	0.25506	0.024;0.061	T	0.05886	-1.0858	10	0.59425	D	0.04	-29.8456	10.8503	0.46767	0.0:0.796:0.1309:0.0732	.	1023;1091	Q76FK4-2;Q76FK4	.;NOL8_HUMAN	K	1091;1055;1023;1091;1053;1023	ENSP00000401177:E1091K;ENSP00000351723:E1023K;ENSP00000441140:E1091K;ENSP00000441300:E1053K;ENSP00000440709:E1023K	ENSP00000351723:E1023K	E	-	1	0	NOL8	94102024	0.827000	0.29292	0.991000	0.47740	0.910000	0.53928	0.884000	0.28214	1.529000	0.49120	-0.143000	0.13931	GAA		0.378	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2	NM_017948		5	209	0	0	0	0.000602	0	5	209				
TDRD7	23424	broad.mit.edu	37	9	100222868	100222868	+	Missense_Mutation	SNP	G	G	T	rs566332281		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:100222868G>T	ENST00000355295.4	+	7	1559	c.1264G>T	c.(1264-1266)Ggt>Tgt	p.G422C	TDRD7_ENST00000422139.2_Missense_Mutation_p.G348C	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	422					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)	p.G422C(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				GCAAGCACATGGTGATAATGA	0.418																																							uc004axj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1264-1266)GGT>TGT		tudor domain containing 7							96.0	91.0	93.0					9																	100222868		2203	4300	6503	SO:0001583	missense	23424				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding	g.chr9:100222868G>T	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.1264G>T	9.37:g.100222868G>T	ENSP00000347444:p.Gly422Cys					TDRD7_uc011lux.1_Missense_Mutation_p.G348C	p.G422C	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN			7	1489	+		Acute lymphoblastic leukemia(62;0.158)	422			Lotus/OST-HTH 3.		A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	ENST00000355295.4	37	c.1264G>T	CCDS6725.1	.	.	.	.	.	.	.	.	.	.	G	7.277	0.608299	0.14002	.	.	ENSG00000196116	ENST00000355295;ENST00000422139	T;T	0.11821	2.74;2.74	5.49	3.6	0.41247	.	0.903587	0.09978	N	0.731378	T	0.11153	0.0272	L	0.36672	1.1	0.09310	N	1	P	0.52463	0.953	B	0.36959	0.237	T	0.17715	-1.0360	10	0.56958	D	0.05	-7.5341	10.5474	0.45068	0.2135:0.0:0.7865:0.0	.	422	Q8NHU6	TDRD7_HUMAN	C	422;348	ENSP00000347444:G422C;ENSP00000413608:G348C	ENSP00000347444:G422C	G	+	1	0	TDRD7	99262689	0.034000	0.19679	0.065000	0.19835	0.198000	0.23893	2.334000	0.43920	1.425000	0.47237	0.655000	0.94253	GGT		0.418	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290		25	49	1	0	3.65163e-15	0.00632	5.87958e-15	25	49				
GRIN3A	116443	broad.mit.edu	37	9	104449121	104449121	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:104449121C>A	ENST00000361820.3	-	2	1661	c.1061G>T	c.(1060-1062)tGg>tTg	p.W354L		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	354					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.W354L(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCCCAGCACCCAACGAAGTTC	0.517																																							uc004bbp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(1060-1062)TGG>TTG		glutamate receptor, ionotropic,	Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)						67.0	61.0	63.0					9																	104449121		2203	4300	6503	SO:0001583	missense	116443				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding	g.chr9:104449121C>A		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1061G>T	9.37:g.104449121C>A	ENSP00000355155:p.Trp354Leu					GRIN3A_uc004bbq.1_Missense_Mutation_p.W354L	p.W354L	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN			2	1662	-		Acute lymphoblastic leukemia(62;0.0568)	354			Extracellular (Potential).		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	c.1061G>T	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467962	0.63625	.	.	ENSG00000198785	ENST00000361820	D	0.88124	-2.34	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.86372	0.5917	L	0.39147	1.195	0.80722	D	1	B	0.30763	0.294	B	0.37144	0.242	D	0.84800	0.0784	10	0.87932	D	0	.	20.1374	0.98035	0.0:1.0:0.0:0.0	.	354	Q8TCU5	NMD3A_HUMAN	L	354	ENSP00000355155:W354L	ENSP00000355155:W354L	W	-	2	0	GRIN3A	103488942	1.000000	0.71417	0.997000	0.53966	0.828000	0.46876	7.617000	0.83032	2.763000	0.94921	0.563000	0.77884	TGG		0.517	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			7	23	1	0	0.00829132	0.008291	0.00881819	7	23				
OR13D1	286365	broad.mit.edu	37	9	107457241	107457241	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:107457241C>A	ENST00000318763.5	+	1	582	c.539C>A	c.(538-540)tCc>tAc	p.S180Y		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S180Y(1)		large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						GCTGCATGGTCCTGGATCATA	0.463																																							uc011lvs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(538-540)TCC>TAC		olfactory receptor, family 13, subfamily D,							150.0	134.0	140.0					9																	107457241		2203	4300	6503	SO:0001583	missense	286365				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107457241C>A		CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.539C>A	9.37:g.107457241C>A	ENSP00000317357:p.Ser180Tyr						p.S180Y	NM_001004484	NP_001004484	Q8NGV5	O13D1_HUMAN			1	539	+			180			Helical; Name=4; (Potential).		B9EIS1|Q6IFL1	Missense_Mutation	SNP	ENST00000318763.5	37	c.539C>A	CCDS35094.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500541	0.26861	.	.	ENSG00000179055	ENST00000318763	T	0.39056	1.1	3.69	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.133711	0.34338	N	0.004059	T	0.75466	0.3853	H	0.98027	4.13	0.30446	N	0.775729	D	0.89917	1.0	D	0.79784	0.993	T	0.80464	-0.1371	10	0.87932	D	0	.	12.9444	0.58364	0.0:1.0:0.0:0.0	.	180	Q8NGV5	O13D1_HUMAN	Y	180	ENSP00000317357:S180Y	ENSP00000317357:S180Y	S	+	2	0	OR13D1	106497062	0.000000	0.05858	0.984000	0.44739	0.172000	0.22775	0.765000	0.26546	1.883000	0.54544	0.609000	0.83330	TCC		0.463	OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053483.1			19	81	1	0	5.3912e-06	0.006122	6.46944e-06	19	81				
MUSK	4593	broad.mit.edu	37	9	113563055	113563055	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:113563055C>A	ENST00000374448.4	+	15	2531	c.2397C>A	c.(2395-2397)ggC>ggA	p.G799G	MUSK_ENST00000189978.5_Silent_p.G799G|MUSK_ENST00000416899.2_Silent_p.G791G	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	799	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G799G(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						TCTCCTATGGCCTGCAGCCCT	0.542																																							uc004bey.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(2)|central_nervous_system(1)	6						c.(2395-2397)GGC>GGA		skeletal muscle receptor tyrosine kinase							65.0	63.0	64.0					9																	113563055		2020	4199	6219	SO:0001819	synonymous_variant	4593				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr9:113563055C>A	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.2397C>A	9.37:g.113563055C>A						MUSK_uc004bez.1_Silent_p.G379G	p.G799G	NM_005592	NP_005583	O15146	MUSK_HUMAN			14	2495	+			799			Protein kinase.|Cytoplasmic (Potential).		Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Silent	SNP	ENST00000374448.4	37	c.2397C>A	CCDS48005.1																																																																																				0.542	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				9	29	1	0	0.00621372	0.006214	0.00661964	9	29				
KIAA0368	23392	broad.mit.edu	37	9	114188022	114188022	+	Splice_Site	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:114188022C>T	ENST00000338205.5	-	10	1356		c.e10+1		KIAA0368_ENST00000259335.4_Splice_Site			Q5VYK3	ECM29_HUMAN	KIAA0368						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)		p.?(1)		NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TAAAGACTTACGTTATACAAA	0.308																																							uc004bfe.1		NA																	1	Unknown(1)		lung(1)		0						c.e12+1		KIAA0368 protein							69.0	69.0	69.0					9																	114188022		1808	4067	5875	SO:0001630	splice_region_variant	23392							g.chr9:114188022C>T	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1136+1G>A	9.37:g.114188022C>T						KIAA0368_uc010muc.1_Splice_Site_p.T379_splice	p.T557_splice	NM_001080398	NP_001073867					12	1670	-								O15074|Q8WU82	Splice_Site	SNP	ENST00000338205.5	37	c.1670_splice		.	.	.	.	.	.	.	.	.	.	C	27.0	4.786581	0.90367	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.561	0.95373	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0368	113227843	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.279000	0.78599	2.696000	0.92011	0.655000	0.94253	.		0.308	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	Intron	4	60	0	0	0	0.000602	0	4	60				
ASTN2	23245	broad.mit.edu	37	9	119858355	119858355	+	Missense_Mutation	SNP	G	G	T	rs201476193	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:119858355G>T	ENST00000313400.4	-	5	1344	c.1244C>A	c.(1243-1245)aCg>aAg	p.T415K	ASTN2_ENST00000361209.2_Missense_Mutation_p.T364K|AL354981.1_ENST00000583553.1_RNA|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.T415K			O75129	ASTN2_HUMAN	astrotactin 2	415					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.T364K(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTACTGCTCCGTGTAGAATGT	0.507																																							uc004bjs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(1243-1245)ACG>AAG		astrotactin 2 isoform c							140.0	109.0	119.0					9																	119858355		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:119858355G>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1244C>A	9.37:g.119858355G>T	ENSP00000314038:p.Thr415Lys					ASTN2_uc004bjr.1_Missense_Mutation_p.T415K|ASTN2_uc004bjt.1_Missense_Mutation_p.T364K	p.T415K	NM_198187	NP_937830	O75129	ASTN2_HUMAN			5	1345	-			415			Cytoplasmic (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.1244C>A		.	.	.	.	.	.	.	.	.	.	G	17.05	3.290074	0.59976	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.17528	2.41;2.41;2.27;2.49	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.29223	0.0727	L	0.29908	0.895	0.46609	D	0.999126	D;D;D	0.89917	0.991;0.993;1.0	P;D;D	0.76071	0.873;0.972;0.987	T	0.01390	-1.1367	9	.	.	.	-12.984	15.5262	0.75910	0.0:0.0:1.0:0.0	.	364;415;415	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	K	415;415;142;364	ENSP00000314038:T415K;ENSP00000363108:T415K;ENSP00000363098:T142K;ENSP00000354504:T364K	.	T	-	2	0	ASTN2	118898176	1.000000	0.71417	0.979000	0.43373	0.854000	0.48673	5.541000	0.67212	2.488000	0.83962	0.491000	0.48974	ACG		0.507	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		10	44	1	0	7.03913e-09	0.001368	9.4449e-09	10	44				
OR1N1	138883	broad.mit.edu	37	9	125288842	125288842	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:125288842C>A	ENST00000304880.2	-	1	730	c.731G>T	c.(730-732)tGc>tTc	p.C244F		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C244F(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						ACAAACAACGCAGAGGTGGGA	0.552																																							uc004bmn.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|breast(1)|skin(1)	3						c.(730-732)TGC>TTC		olfactory receptor, family 1, subfamily N,							113.0	98.0	103.0					9																	125288842		2203	4300	6503	SO:0001583	missense	138883				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125288842C>A	U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.731G>T	9.37:g.125288842C>A	ENSP00000306974:p.Cys244Phe						p.C244F	NM_012363	NP_036495	Q8NGS0	OR1N1_HUMAN			1	731	-			244			Helical; Name=6; (Potential).		A3KFM1|O43870|Q6IF16|Q96R93	Missense_Mutation	SNP	ENST00000304880.2	37	c.731G>T	CCDS6844.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599384	0.66332	.	.	ENSG00000171505	ENST00000304880	T	0.35236	1.32	3.75	-4.96	0.03038	GPCR, rhodopsin-like superfamily (1);	0.529694	0.13904	U	0.354685	T	0.29817	0.0745	N	0.20807	0.61	0.09310	N	1	D	0.55800	0.973	P	0.54815	0.761	T	0.34625	-0.9821	10	0.87932	D	0	.	9.326	0.37993	0.105:0.1551:0.6538:0.0861	.	244	Q8NGS0	OR1N1_HUMAN	F	244	ENSP00000306974:C244F	ENSP00000306974:C244F	C	-	2	0	OR1N1	124328663	0.000000	0.05858	0.000000	0.03702	0.935000	0.57460	-3.221000	0.00552	-0.713000	0.04981	0.545000	0.68477	TGC		0.552	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053938.1			13	25	1	0	3.27435e-08	0.00245	4.24132e-08	13	25				
CRB2	286204	broad.mit.edu	37	9	126137497	126137497	+	Splice_Site	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:126137497T>A	ENST00000373631.3	+	12	3509	c.3508T>A	c.(3508-3510)Tgt>Agt	p.C1170S	CRB2_ENST00000373629.2_Splice_Site_p.C838S	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1170	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)	p.C1170S(1)		NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CCTCTCCAGGTGTCAGGTCCC	0.617																																							uc004bnx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3508-3510)TGT>AGT		crumbs homolog 2 precursor							60.0	65.0	63.0					9																	126137497		2203	4300	6503	SO:0001630	splice_region_variant	286204					extracellular region|integral to membrane|plasma membrane	calcium ion binding	g.chr9:126137497T>A	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3507-1T>A	9.37:g.126137497T>A							p.C1170S	NM_173689	NP_775960	Q5IJ48	CRUM2_HUMAN			12	3600	+			1170			Extracellular (Potential).|EGF-like 14.		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	c.3508T>A	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	.	24.8	4.569404	0.86439	.	.	ENSG00000148204	ENST00000373631;ENST00000373629	D;D	0.95588	-2.65;-3.75	4.87	4.87	0.63330	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.48286	D	0.000189	D	0.98280	0.9430	H	0.94423	3.535	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99552	1.0966	10	0.87932	D	0	.	14.6481	0.68774	0.0:0.0:0.0:1.0	.	1170	Q5IJ48	CRUM2_HUMAN	S	1170;838	ENSP00000362734:C1170S;ENSP00000362732:C838S	ENSP00000362732:C838S	C	+	1	0	CRB2	125177318	1.000000	0.71417	0.997000	0.53966	0.218000	0.24690	4.723000	0.61965	2.052000	0.61016	0.459000	0.35465	TGT		0.617	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	Missense_Mutation	32	19	0	0	0	0.004878	0	32	19				
LMX1B	4010	broad.mit.edu	37	9	129376847	129376847	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:129376847C>A	ENST00000373474.4	+	1	126	c.119C>A	c.(118-120)gCc>gAc	p.A40D	LMX1B_ENST00000526117.1_Missense_Mutation_p.A40D|LMX1B_ENST00000355497.5_Missense_Mutation_p.A40D|RP11-123K19.1_ENST00000432418.1_RNA|LMX1B_ENST00000561065.1_Missense_Mutation_p.A17D|RP11-123K19.1_ENST00000451449.2_RNA|LMX1B_ENST00000425646.2_Missense_Mutation_p.A17D|RP11-123K19.1_ENST00000425370.1_RNA			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	40					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A40D(1)|p.A17D(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CCCGGGCCCGCCACTCTGGGG	0.716									Nail-Patella Syndrome																												Pancreas(110;1796 2278 18357 20466)	Pancreas(110;1796 2278 18357 20466)	uc004bqj.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(49-51)GCC>GAC		LIM homeobox transcription factor 1, beta							12.0	13.0	13.0					9																	129376847		2160	4235	6395	SO:0001583	missense	4010	Nail-Patella_Syndrome	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:129376847C>A	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.119C>A	9.37:g.129376847C>A	ENSP00000362573:p.Ala40Asp					LMX1B_uc004bqi.2_Missense_Mutation_p.A17D|LMX1B_uc011maa.1_Missense_Mutation_p.A17D	p.A17D	NM_002316	NP_002307	O60663	LMX1B_HUMAN			1	100	+			17					F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	c.50C>A	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	c	18.00	3.525207	0.64747	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	D;D;D;D	0.86366	-1.96;-1.95;-2.11;-2.04	3.57	3.57	0.40892	.	0.000000	0.85682	U	0.000000	T	0.76800	0.4038	N	0.24115	0.695	0.58432	D	0.999996	B;B;P	0.34977	0.346;0.222;0.478	B;B;B	0.30179	0.086;0.036;0.112	T	0.75434	-0.3319	10	0.30078	T	0.28	.	13.8189	0.63309	0.0:1.0:0.0:0.0	.	17;17;40	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	D	40;40;40;17	ENSP00000436930:A40D;ENSP00000362573:A40D;ENSP00000347684:A40D;ENSP00000390923:A17D	ENSP00000347684:A40D	A	+	2	0	LMX1B	128416668	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.532000	0.73825	1.569000	0.49696	0.388000	0.25769	GCC		0.716	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2			4	3	1	0	0.00909568	0.009096	0.00960939	4	3				
CDK9	1025	broad.mit.edu	37	9	130550579	130550579	+	Silent	SNP	C	C	T	rs202049005		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:130550579C>T	ENST00000373264.4	+	5	619	c.519C>T	c.(517-519)gcC>gcT	p.A173A	CDK9_ENST00000373265.2_Silent_p.A290A|CDK9_ENST00000480353.1_3'UTR|MIR3960_ENST00000583311.1_RNA	NM_001261.3	NP_001252.1	P50750	CDK9_HUMAN	cyclin-dependent kinase 9	173	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|DNA repair (GO:0006281)|gene expression (GO:0010467)|negative regulation of cell cycle arrest (GO:0071157)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of DNA repair (GO:0006282)|regulation of histone modification (GO:0031056)|replication fork arrest (GO:0043111)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|positive transcription elongation factor complex b (GO:0008024)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA binding (GO:0003677)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.A173A(1)		lung(1)	1						TGGCCCGGGCCTTCAGCCTGG	0.612																																							uc004bse.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(517-519)GCC>GCT		cyclin-dependent kinase 9							33.0	30.0	31.0					9																	130550579		2203	4300	6503	SO:0001819	synonymous_variant	1025				cell proliferation|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription elongation factor complex	ATP binding|cyclin-dependent protein kinase activity|DNA binding|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr9:130550579C>T	L25676	CCDS6879.1	9q34.1	2011-11-08	2007-11-21		ENSG00000136807	ENSG00000136807		"""Cyclin-dependent kinases"""	1780	protein-coding gene	gene with protein product		603251	"""cyclin-dependent kinase 9 (CDC2-related kinase)"""	CDC2L4		8170997, 9356449	Standard	NM_001261		Approved	PITALRE, C-2k, TAK	uc004bse.2	P50750	OTTHUMG00000020715	ENST00000373264.4:c.519C>T	9.37:g.130550579C>T							p.A173A	NM_001261	NP_001252	P50750	CDK9_HUMAN			5	642	+			173			Protein kinase.		Q5JU24|Q5JU25|Q5U006|Q96TF1	Silent	SNP	ENST00000373264.4	37	c.519C>T	CCDS6879.1																																																																																				0.612	CDK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054235.1			5	19	0	0	0	0.000602	0	5	19				
LRRC8A	56262	broad.mit.edu	37	9	131670679	131670679	+	Silent	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:131670679G>C	ENST00000259324.5	+	3	1759	c.1236G>C	c.(1234-1236)acG>acC	p.T412T	LRRC8A_ENST00000372600.4_Silent_p.T412T|LRRC8A_ENST00000372599.3_Silent_p.T412T	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	412					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.T412T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						ACGAGTGGACGCTGGACAAGC	0.587																																							uc004bwl.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1234-1236)ACG>ACC		leucine rich repeat containing 8 family, member							63.0	58.0	60.0					9																	131670679		2203	4300	6503	SO:0001819	synonymous_variant	56262				pre-B cell differentiation	integral to membrane		g.chr9:131670679G>C	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1236G>C	9.37:g.131670679G>C						LRRC8A_uc010myp.2_Silent_p.T412T|LRRC8A_uc010myq.2_Silent_p.T412T	p.T412T	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN			3	1490	+			412			LRR 2.		Q6UXM2|Q8NCI0|Q9P2B1	Silent	SNP	ENST00000259324.5	37	c.1236G>C	CCDS35155.1																																																																																				0.587	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594		6	38	0	0	0	0.001984	0	6	38				
NUP214	8021	broad.mit.edu	37	9	134034830	134034830	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:134034830G>T	ENST00000359428.5	+	18	2641	c.2497G>T	c.(2497-2499)Gac>Tac	p.D833Y	RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000417798.2_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.D834Y|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.D823Y|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000589128.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000589540.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	833	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.D833Y(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TGATGTTCTAGACTTGGAGTG	0.348			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	Pancreas(4;24 48 25510 30394 32571)	uc004cag.2		NA		Dom	yes		9	9q34.1	8021	T	nucleoporin 214kDa (CAN)			L	DEK|SET|ABL1		AML|T-ALL		1	Substitution - Missense(1)		lung(1)	breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16						c.(2497-2499)GAC>TAC		nucleoporin 214kDa							90.0	81.0	84.0					9																	134034830		2203	4300	6503	SO:0001583	missense	8021				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding	g.chr9:134034830G>T	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.2497G>T	9.37:g.134034830G>T	ENSP00000352400:p.Asp833Tyr					NUP214_uc004cah.2_Missense_Mutation_p.D823Y|NUP214_uc004cai.2_Missense_Mutation_p.D263Y|NUP214_uc004caf.1_Missense_Mutation_p.D822Y|NUP214_uc010mzf.2_Missense_Mutation_p.D131Y	p.D833Y	NM_005085	NP_005076	P35658	NU214_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)	18	2608	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	833			11 X 5 AA approximate repeats.		A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	c.2497G>T	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691373	0.88735	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605	T;T;T	0.59906	0.23;0.28;0.31	5.9	5.9	0.94986	.	0.000000	0.44902	D	0.000403	T	0.61451	0.2348	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.91635	0.999;0.995;0.994;0.995	T	0.70004	-0.4991	10	0.87932	D	0	-26.8323	19.2703	0.94006	0.0:0.0:1.0:0.0	.	822;427;823;833	P35658-2;Q5JUP9;P35658-4;P35658	.;.;.;NU214_HUMAN	Y	833;823;834;822;427;262	ENSP00000352400:D833Y;ENSP00000396576:D823Y;ENSP00000405014:D834Y	ENSP00000352400:D833Y	D	+	1	0	NUP214	133024651	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	7.307000	0.78920	2.806000	0.96561	0.655000	0.94253	GAC		0.348	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		17	20	1	0	2.35188e-11	0.006122	3.4545e-11	17	20				
ADAMTSL2	9719	broad.mit.edu	37	9	136405802	136405802	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:136405802C>A	ENST00000354484.4	+	6	1052	c.495C>A	c.(493-495)gcC>gcA	p.A165A	ADAMTSL2_ENST00000393060.1_Silent_p.A165A|ADAMTSL2_ENST00000393061.3_Silent_p.A274A	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	165			A -> T (in GPHYSD1). {ECO:0000269|PubMed:21415077}.		negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A165A(1)		kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		TGGTCCCCGCCCGCGACGGCA	0.572																																							uc011mdl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(493-495)GCC>GCA		ADAMTS-like 2 precursor							60.0	49.0	53.0					9																	136405802		2203	4300	6503	SO:0001819	synonymous_variant	9719				negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding	g.chr9:136405802C>A	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.495C>A	9.37:g.136405802C>A						ADAMTSL2_uc004cei.2_Silent_p.A165A	p.A165A	NM_001145320	NP_001138792	Q86TH1	ATL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)	6	1052	+			165					B1B0D5|O60345	Silent	SNP	ENST00000354484.4	37	c.495C>A	CCDS6976.1																																																																																				0.572	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694		15	28	1	0	9.16793e-09	0.00499	1.21223e-08	15	28				
VAV2	7410	broad.mit.edu	37	9	136633629	136633629	+	Missense_Mutation	SNP	C	C	A	rs145738821		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:136633629C>A	ENST00000371850.3	-	29	2555	c.2524G>T	c.(2524-2526)Gtg>Ttg	p.V842L	VAV2_ENST00000406606.3_Missense_Mutation_p.V803L|VAV2_ENST00000371851.1_Missense_Mutation_p.V832L	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	842	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V842L(1)|p.V803L(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		ATCCTCACCACGTCACCCTCC	0.652																																							uc004ces.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						c.(2524-2526)GTG>TTG		vav 2 guanine nucleotide exchange factor isoform							89.0	81.0	84.0					9																	136633629		2203	4300	6503	SO:0001583	missense	7410				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity	g.chr9:136633629C>A		CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.2524G>T	9.37:g.136633629C>A	ENSP00000360916:p.Val842Leu					VAV2_uc004cer.2_Missense_Mutation_p.V803L	p.V842L	NM_001134398	NP_001127870	P52735	VAV2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)	29	2570	-			842			SH3 2.		A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	c.2524G>T	CCDS48053.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155404	0.57259	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;T	0.09255	3.0;3.0;3.0	4.81	2.87	0.33458	Src homology-3 domain (4);Variant SH3 (1);	0.249709	0.39909	N	0.001234	T	0.08268	0.0206	N	0.10916	0.065	0.43195	D	0.995036	P;B	0.35468	0.503;0.01	B;B	0.40444	0.329;0.09	T	0.32771	-0.9894	10	0.39692	T	0.17	.	14.5568	0.68106	0.0:0.721:0.279:0.0	.	842;803	P52735;P52735-3	VAV2_HUMAN;.	L	842;832;803;832	ENSP00000360916:V842L;ENSP00000360917:V832L;ENSP00000385362:V803L	ENSP00000317258:V832L	V	-	1	0	VAV2	135623450	1.000000	0.71417	0.993000	0.49108	0.524000	0.34500	2.435000	0.44811	0.390000	0.25115	0.563000	0.77884	GTG		0.652	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			14	38	1	0	0.000308642	0.003163	0.000346813	14	38				
WDR5	11091	broad.mit.edu	37	9	137017125	137017125	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:137017125C>T	ENST00000358625.3	+	9	776	c.605C>T	c.(604-606)tCa>tTa	p.S202L	WDR5_ENST00000425041.1_Missense_Mutation_p.S202L	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	202					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)		p.S202L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		GACACCGCCTCAGGCCAGTGC	0.562																																							uc004cey.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(604-606)TCA>TTA		WD repeat domain 5							159.0	156.0	157.0					9																	137017125		2203	4300	6503	SO:0001583	missense	11091				histone H3 acetylation|histone H3-K4 methylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex|MLL1 complex|Set1C/COMPASS complex	protein binding	g.chr9:137017125C>T	AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.605C>T	9.37:g.137017125C>T	ENSP00000351446:p.Ser202Leu					WDR5_uc004cez.2_Missense_Mutation_p.S202L	p.S202L	NM_017588	NP_060058	P61964	WDR5_HUMAN		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)	9	776	+		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)	202			WD 4.		Q91VA5|Q9NWX7|Q9UGP9	Missense_Mutation	SNP	ENST00000358625.3	37	c.605C>T	CCDS6981.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719621	0.68844	.	.	ENSG00000196363	ENST00000358625;ENST00000425041	D;D	0.82711	-1.64;-1.64	3.75	3.75	0.43078	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.085476	0.49916	D	0.000137	T	0.81978	0.4937	M	0.78637	2.42	0.80722	D	1	P	0.39535	0.677	B	0.35073	0.195	D	0.85830	0.1391	10	0.87932	D	0	.	14.4966	0.67691	0.0:1.0:0.0:0.0	.	202	P61964	WDR5_HUMAN	L	202	ENSP00000351446:S202L;ENSP00000401889:S202L	ENSP00000351446:S202L	S	+	2	0	WDR5	136006946	1.000000	0.71417	0.675000	0.29917	0.862000	0.49288	6.916000	0.75776	1.811000	0.52892	0.462000	0.41574	TCA		0.562	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254621.1	NM_052821		5	140	0	0	0	0.000602	0	5	140				
COL5A1	1289	broad.mit.edu	37	9	137676916	137676916	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:137676916G>C	ENST00000371817.3	+	30	2980	c.2566G>C	c.(2566-2568)Ggt>Cgt	p.G856R		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	856	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.G856R(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TGGTGACCCCGGTCCTCTGGG	0.647																																							uc004cfe.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(2566-2568)GGT>CGT		alpha 1 type V collagen preproprotein							34.0	39.0	37.0					9																	137676916		2203	4300	6503	SO:0001583	missense	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137676916G>C	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2566G>C	9.37:g.137676916G>C	ENSP00000360882:p.Gly856Arg						p.G856R	NM_000093	NP_000084	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	30	2948	+		Myeloproliferative disorder(178;0.0341)	856			Triple-helical region.		Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	c.2566G>C	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	g	18.35	3.604875	0.66445	.	.	ENSG00000130635	ENST00000371817	D	0.98807	-5.15	4.41	4.41	0.53225	.	0.000000	0.85682	U	0.000000	D	0.99408	0.9791	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98352	1.0544	10	0.87932	D	0	.	15.7721	0.78176	0.0:0.0:1.0:0.0	.	856	P20908	CO5A1_HUMAN	R	856	ENSP00000360882:G856R	ENSP00000360882:G856R	G	+	1	0	COL5A1	136816737	1.000000	0.71417	0.811000	0.32455	0.335000	0.28730	8.451000	0.90343	2.004000	0.58718	0.306000	0.20318	GGT		0.647	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		5	25	0	0	0	0.000602	0	5	25				
NLGN4X	57502	broad.mit.edu	37	X	5821830	5821830	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:5821830T>A	ENST00000381095.3	-	5	1516	c.889A>T	c.(889-891)Act>Tct	p.T297S	NLGN4X_ENST00000381093.2_Missense_Mutation_p.T317S|NLGN4X_ENST00000538097.1_Missense_Mutation_p.T297S|NLGN4X_ENST00000381092.1_Missense_Mutation_p.T297S|NLGN4X_ENST00000275857.6_Missense_Mutation_p.T297S	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	297					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.T297S(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AATATCCGAGTGTACTTGGCC	0.557																																							uc010ndh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(889-891)ACT>TCT		X-linked neuroligin 4 precursor							112.0	82.0	92.0					X																	5821830		2203	4298	6501	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821830T>A	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.889A>T	X.37:g.5821830T>A	ENSP00000370485:p.Thr297Ser					NLGN4X_uc004crp.2_Missense_Mutation_p.T317S|NLGN4X_uc004crq.2_Missense_Mutation_p.T297S|NLGN4X_uc010ndi.2_Missense_Mutation_p.T334S|NLGN4X_uc004crr.2_Missense_Mutation_p.T297S|NLGN4X_uc010ndj.2_Missense_Mutation_p.T297S	p.T297S	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			5	1390	-			297			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.889A>T	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.111496	0.56398	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33	3.93	3.93	0.45458	Carboxylesterase, type B (1);	.	.	.	.	T	0.58250	0.2109	L	0.52759	1.655	0.58432	D	0.999993	P;P;B	0.43857	0.819;0.688;0.226	P;P;B	0.48921	0.595;0.595;0.272	T	0.56366	-0.7991	8	.	.	.	.	11.4714	0.50270	0.0:0.0:0.0:1.0	.	354;297;317	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	S	297;317;297;297;297	ENSP00000370485:T297S;ENSP00000370483:T317S;ENSP00000275857:T297S;ENSP00000370482:T297S;ENSP00000439203:T297S	.	T	-	1	0	NLGN4X	5831830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.225000	0.65294	1.278000	0.44430	0.486000	0.48141	ACT		0.557	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		18	20	0	0	0	0.008871	0	18	20				
DMD	1756	broad.mit.edu	37	X	32430028	32430028	+	Silent	SNP	A	A	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:32430028A>T	ENST00000357033.4	-	30	4280	c.4074T>A	c.(4072-4074)gcT>gcA	p.A1358A	DMD_ENST00000378677.2_Silent_p.A1354A	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1358					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.A1354A(1)|p.A17A(1)|p.A1353A(1)|p.A1358A(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCCTCCTTACAGCCTAAAAAG	0.393																																							uc004dda.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(4072-4074)GCT>GCA		dystrophin Dp427m isoform							80.0	66.0	70.0					X																	32430028		2202	4300	6502	SO:0001819	synonymous_variant	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32430028A>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4074T>A	X.37:g.32430028A>T						DMD_uc004dcw.2_Silent_p.A14A|DMD_uc004dcx.2_Silent_p.A17A|DMD_uc004dcz.2_Silent_p.A1235A|DMD_uc004dcy.1_Silent_p.A1354A|DMD_uc004ddb.1_Silent_p.A1350A|DMD_uc010ngo.1_Intron	p.A1358A	NM_004006	NP_003997	P11532	DMD_HUMAN			30	4318	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1358			Spectrin 9.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	c.4074T>A	CCDS14233.1																																																																																				0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		18	3	0	0	0	0.007413	0	18	3				
FAM47B	170062	broad.mit.edu	37	X	34962859	34962859	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:34962859C>A	ENST00000329357.5	+	1	1947	c.1911C>A	c.(1909-1911)gaC>gaA	p.D637E		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	637								p.D637E(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						ACAAAGAAGACGTCACAGATG	0.378																																							uc004ddi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1909-1911)GAC>GAA		hypothetical protein LOC170062							116.0	104.0	108.0					X																	34962859		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34962859C>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1911C>A	X.37:g.34962859C>A	ENSP00000328307:p.Asp637Glu						p.D637E	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	1929	+			637					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.1911C>A	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	0.042	-1.279869	0.01410	.	.	ENSG00000189132	ENST00000329357	T	0.17854	2.25	0.843	-0.939	0.10408	.	.	.	.	.	T	0.07458	0.0188	N	0.16903	0.455	0.09310	N	1	B	0.24186	0.099	B	0.20577	0.03	T	0.42481	-0.9449	8	0.09843	T	0.71	.	.	.	.	.	637	Q8NA70	FA47B_HUMAN	E	637	ENSP00000328307:D637E	ENSP00000328307:D637E	D	+	3	2	FAM47B	34872780	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.643000	0.05421	-0.318000	0.08665	0.292000	0.19580	GAC		0.378	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		38	19	1	0	1.07121e-22	0.006999	1.94099e-22	38	19				
CACNA1F	778	broad.mit.edu	37	X	49065117	49065117	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:49065117G>T	ENST00000376265.2	-	43	5075	c.5014C>A	c.(5014-5016)Cgc>Agc	p.R1672S	CACNA1F_ENST00000323022.5_Missense_Mutation_p.R1661S|CACNA1F_ENST00000376251.1_Missense_Mutation_p.R1607S	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1672					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R1672S(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGCCCCGGCGAGCTGAGGGC	0.567																																							uc004dnb.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)|kidney(1)|skin(1)	6						c.(5014-5016)CGC>AGC		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						55.0	52.0	53.0					X																	49065117		2203	4300	6503	SO:0001583	missense	778				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chrX:49065117G>T	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5014C>A	X.37:g.49065117G>T	ENSP00000365441:p.Arg1672Ser					CACNA1F_uc010nip.2_Missense_Mutation_p.R1661S	p.R1672S	NM_005183	NP_005174	O60840	CAC1F_HUMAN			43	5076	-			1672			Cytoplasmic (Potential).		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	c.5014C>A	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	G	8.599	0.886327	0.17540	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.96265	-3.96;-3.88;-3.88	5.01	5.01	0.66863	.	3.067170	0.01074	N	0.004868	D	0.95053	0.8398	L	0.43152	1.355	0.34921	D	0.748479	B;B	0.22683	0.073;0.001	B;B	0.26094	0.066;0.002	T	0.77925	-0.2405	10	0.26408	T	0.33	.	13.1307	0.59380	0.0:0.0:1.0:0.0	.	1661;1672	F5CIQ9;O60840	.;CAC1F_HUMAN	S	1607;1661;1672	ENSP00000365427:R1607S;ENSP00000321618:R1661S;ENSP00000365441:R1672S	ENSP00000321618:R1661S	R	-	1	0	CACNA1F	48952061	0.995000	0.38212	0.799000	0.32177	0.178000	0.23041	3.984000	0.56923	2.403000	0.81681	0.600000	0.82982	CGC		0.567	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		12	9	1	0	4.36969e-10	0.001855	6.09457e-10	12	9				
PPP1R3F	89801	broad.mit.edu	37	X	49142326	49142326	+	Missense_Mutation	SNP	G	G	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:49142326G>A	ENST00000055335.6	+	4	1190	c.1174G>A	c.(1174-1176)Gca>Aca	p.A392T	PPP1R3F_ENST00000438316.1_Missense_Mutation_p.A63T|PPP1R3F_ENST00000466508.1_Missense_Mutation_p.A46T|PPP1R3F_ENST00000376188.1_Missense_Mutation_p.A46T|PPP1R3F_ENST00000495799.1_Missense_Mutation_p.A46T	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	392					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)	p.A392T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					TGGCAACCCCGCAGAAGAAGG	0.592																																							uc004dnh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1174-1176)GCA>ACA		protein phosphatase 1, regulatory (inhibitor)							47.0	45.0	46.0					X																	49142326		2203	4300	6503	SO:0001583	missense	89801					integral to membrane		g.chrX:49142326G>A		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1174G>A	X.37:g.49142326G>A	ENSP00000055335:p.Ala392Thr					PPP1R3F_uc011mnd.1_Missense_Mutation_p.A63T|PPP1R3F_uc004dni.2_Missense_Mutation_p.A46T|PPP1R3F_uc004dnj.1_Missense_Mutation_p.A46T	p.A392T	NM_033215	NP_149992	Q6ZSY5	PPR3F_HUMAN			4	1190	+	Ovarian(276;0.236)		392			Extracellular (Potential).		A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	ENST00000055335.6	37	c.1174G>A	CCDS35254.1	.	.	.	.	.	.	.	.	.	.	G	0.172	-1.070840	0.01918	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	T;T;T;T;T	0.54866	0.97;0.97;0.55;0.97;0.97	5.03	1.12	0.20585	.	0.697416	0.12536	N	0.460350	T	0.26702	0.0653	N	0.08118	0	0.21020	N	0.9998	B;B;B	0.11235	0.0;0.0;0.004	B;B;B	0.04013	0.001;0.001;0.001	T	0.18808	-1.0325	10	0.72032	D	0.01	3.1423	1.8875	0.03241	0.1571:0.4963:0.1552:0.1914	.	63;77;392	F5H262;A2VDJ8;Q6ZSY5	.;.;PPR3F_HUMAN	T	46;63;392;46;46	ENSP00000420687:A46T;ENSP00000415548:A63T;ENSP00000055335:A392T;ENSP00000417535:A46T;ENSP00000365359:A46T	ENSP00000055335:A392T	A	+	1	0	PPP1R3F	49029270	0.013000	0.17824	0.777000	0.31699	0.616000	0.37450	0.279000	0.18771	0.043000	0.15746	-0.311000	0.09066	GCA		0.592	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215		7	8	0	0	0	0.008291	0	7	8				
HUWE1	10075	broad.mit.edu	37	X	53642720	53642720	+	Silent	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:53642720C>A	ENST00000342160.3	-	21	2491	c.2034G>T	c.(2032-2034)acG>acT	p.T678T	HUWE1_ENST00000218328.8_Silent_p.T678T|HUWE1_ENST00000262854.6_Silent_p.T678T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	678					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.T678T(2)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGATGGCAGTCGTTGCATCTG	0.458																																							uc004dsp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(2032-2034)ACG>ACT		HECT, UBA and WWE domain containing 1							196.0	136.0	156.0					X																	53642720		2203	4300	6503	SO:0001819	synonymous_variant	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53642720C>A	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.2034G>T	X.37:g.53642720C>A							p.T678T	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN			22	2436	-			678					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	c.2034G>T	CCDS35301.1																																																																																				0.458	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		13	6	1	0	4.36969e-10	0.001855	6.09457e-10	13	6				
HUWE1	10075	broad.mit.edu	37	X	53643940	53643940	+	Missense_Mutation	SNP	C	C	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:53643940C>T	ENST00000342160.3	-	20	2405	c.1948G>A	c.(1948-1950)Gat>Aat	p.D650N	HUWE1_ENST00000218328.8_Missense_Mutation_p.D650N|HUWE1_ENST00000262854.6_Missense_Mutation_p.D650N			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	650					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.D650N(2)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CCAAGGGGATCAGAACTTCTC	0.403																																							uc004dsp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(1948-1950)GAT>AAT		HECT, UBA and WWE domain containing 1							39.0	36.0	37.0					X																	53643940		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53643940C>T	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.1948G>A	X.37:g.53643940C>T	ENSP00000340648:p.Asp650Asn						p.D650N	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN			21	2350	-			650					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.1948G>A	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	32	5.172368	0.94807	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.52983	0.93;0.93;0.64	5.45	5.45	0.79879	E3 ubiquitin ligase, domain of unknown function DUF913 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67059	0.2853	M	0.64404	1.975	0.58432	D	0.999998	D	0.89917	1.0	D	0.79784	0.993	T	0.70230	-0.4929	10	0.87932	D	0	.	17.0476	0.86508	0.0:1.0:0.0:0.0	.	650	Q7Z6Z7	HUWE1_HUMAN	N	650	ENSP00000340648:D650N;ENSP00000262854:D650N;ENSP00000218328:D650N	ENSP00000218328:D650N	D	-	1	0	HUWE1	53660665	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.421000	0.80204	2.289000	0.77006	0.594000	0.82650	GAT		0.403	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		8	7	0	0	0	0.004482	0	8	7				
KIF4A	24137	broad.mit.edu	37	X	69622523	69622523	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:69622523C>A	ENST00000374403.3	+	23	2679	c.2597C>A	c.(2596-2598)gCc>gAc	p.A866D	KIF4A_ENST00000374388.3_Missense_Mutation_p.A866D	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	866	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.A866D(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GCCAAGTGTGCCCTGAAATAT	0.453																																							uc004dyg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(2596-2598)GCC>GAC		kinesin family member 4							79.0	61.0	67.0					X																	69622523		2203	4300	6503	SO:0001583	missense	24137				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chrX:69622523C>A	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2597C>A	X.37:g.69622523C>A	ENSP00000363524:p.Ala866Asp					KIF4A_uc010nkw.2_Missense_Mutation_p.A866D	p.A866D	NM_012310	NP_036442	O95239	KIF4A_HUMAN			23	2724	+			866			Potential.|Interaction with PRC1.		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	c.2597C>A	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709149	0.89018	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.71341	-0.56;-0.53	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000015	D	0.83492	0.5266	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84281	0.0494	9	.	.	.	.	16.4115	0.83713	0.0:1.0:0.0:0.0	.	866	O95239	KIF4A_HUMAN	D	866;866;168	ENSP00000363509:A866D;ENSP00000363524:A866D	.	A	+	2	0	KIF4A	69539248	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.059000	0.76684	2.335000	0.79485	0.600000	0.82982	GCC		0.453	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		10	4	1	0	2.17888e-05	0.006214	2.58057e-05	10	4				
TBX22	50945	broad.mit.edu	37	X	79278703	79278703	+	Missense_Mutation	SNP	A	A	G	rs377085198		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:79278703A>G	ENST00000373294.5	+	2	348	c.320A>G	c.(319-321)gAc>gGc	p.D107G	TBX22_ENST00000373291.1_5'UTR|TBX22_ENST00000373296.3_Missense_Mutation_p.D107G|TBX22_ENST00000442340.1_5'UTR	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	107					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D107G(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AGATTCCATGACATCGGGACT	0.488																																							uc010nmg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						c.(319-321)GAC>GGC		T-box 22 isoform 1		A	GLY/ASP,,GLY/ASP	0,3835		0,0,1632,571	81.0	72.0	75.0		320,,320	3.7	1.0	X		75	1,6727		0,1,2427,1872	no	missense,utr-5,missense	TBX22	NM_001109878.1,NM_001109879.1,NM_016954.2	94,,94	0,1,4059,2443	GG,GA,AA,A		0.0149,0.0,0.0095	probably-damaging,,probably-damaging	107/521,,107/521	79278703	1,10562	2203	4300	6503	SO:0001583	missense	50945				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:79278703A>G	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.320A>G	X.37:g.79278703A>G	ENSP00000362390:p.Asp107Gly					TBX22_uc004edi.1_5'UTR|TBX22_uc004edj.1_Missense_Mutation_p.D107G	p.D107G	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN			3	454	+			107			T-box.		Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	37	c.320A>G	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	A	19.83	3.899319	0.72754	0.0	1.49E-4	ENSG00000122145	ENST00000373296;ENST00000373294	D;D	0.89617	-2.54;-2.54	4.92	3.73	0.42828	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.192533	0.44097	D	0.000498	D	0.88016	0.6324	M	0.67953	2.075	0.80722	D	1	P	0.43578	0.811	B	0.43838	0.433	D	0.86130	0.1574	10	0.72032	D	0.01	.	9.9704	0.41749	0.8314:0.1686:0.0:0.0	.	107	Q9Y458	TBX22_HUMAN	G	107	ENSP00000362393:D107G;ENSP00000362390:D107G	ENSP00000362390:D107G	D	+	2	0	TBX22	79165359	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.293000	0.72731	0.537000	0.28751	0.486000	0.48141	GAC		0.488	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954		20	10	0	0	0	0.010504	0	20	10				
DACH2	117154	broad.mit.edu	37	X	85950089	85950089	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:85950089C>A	ENST00000373125.4	+	5	838	c.838C>A	c.(838-840)Cat>Aat	p.H280N	DACH2_ENST00000510272.1_Missense_Mutation_p.H61N|DACH2_ENST00000373131.1_Missense_Mutation_p.H267N|DACH2_ENST00000508860.1_Missense_Mutation_p.H113N	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	280					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.H267N(1)|p.H280N(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TGGACCCCAACATGGAATTGC	0.468																																							uc004eew.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(838-840)CAT>AAT		dachshund 2 isoform a							64.0	52.0	56.0					X																	85950089		2203	4300	6503	SO:0001583	missense	117154				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding	g.chrX:85950089C>A	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.838C>A	X.37:g.85950089C>A	ENSP00000362217:p.His280Asn					DACH2_uc004eex.2_Missense_Mutation_p.H267N|DACH2_uc010nmq.2_Missense_Mutation_p.H146N|DACH2_uc011mra.1_Missense_Mutation_p.H113N|DACH2_uc010nmr.2_Missense_Mutation_p.H61N	p.H280N	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN			5	1008	+			280					B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	c.838C>A	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	c	12.22	1.871799	0.33069	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D;D	0.83075	-1.68;-1.68	4.99	4.99	0.66335	.	0.081385	0.50627	D	0.000102	T	0.79257	0.4415	L	0.43152	1.355	0.35201	D	0.77425	P;P;P	0.49090	0.824;0.919;0.918	B;B;B	0.43867	0.345;0.434;0.25	T	0.81417	-0.0942	10	0.18276	T	0.48	.	17.4688	0.87640	0.0:1.0:0.0:0.0	.	146;267;280	Q1RMF5;Q96NX9-2;Q96NX9	.;.;DACH2_HUMAN	N	280;267;280;113;61;113	ENSP00000362223:H267N;ENSP00000362217:H280N	ENSP00000345134:H280N	H	+	1	0	DACH2	85836745	1.000000	0.71417	0.994000	0.49952	0.503000	0.33858	3.593000	0.54001	2.050000	0.60909	0.509000	0.49947	CAT		0.468	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281		11	5	1	0	0.000151284	0.001855	0.000174622	11	5				
PCDH11X	27328	broad.mit.edu	37	X	91133828	91133828	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:91133828G>T	ENST00000373094.1	+	2	3434	c.2589G>T	c.(2587-2589)caG>caT	p.Q863H	PCDH11X_ENST00000361655.2_Missense_Mutation_p.Q863H|PCDH11X_ENST00000373097.1_Missense_Mutation_p.Q863H|PCDH11X_ENST00000373088.1_Missense_Mutation_p.Q863H|PCDH11X_ENST00000504220.2_Missense_Mutation_p.Q863H|PCDH11X_ENST00000298274.8_Missense_Mutation_p.Q863H|PCDH11X_ENST00000406881.1_Missense_Mutation_p.Q863H|PCDH11X_ENST00000395337.2_Missense_Mutation_p.Q863H|PCDH11X_ENST00000361724.1_Missense_Mutation_p.Q863H	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	863					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q863H(3)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AAAACAGGCAGATGATAATGA	0.413																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(2)	2						c.(2587-2589)CAG>CAT		protocadherin 11 X-linked isoform c							48.0	48.0	48.0					X																	91133828		2203	4297	6500	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91133828G>T	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.2589G>T	X.37:g.91133828G>T	ENSP00000362186:p.Gln863His					PCDH11X_uc004efl.1_Missense_Mutation_p.Q863H|PCDH11X_uc004efo.1_Missense_Mutation_p.Q863H|PCDH11X_uc010nmv.1_Missense_Mutation_p.Q863H|PCDH11X_uc004efm.1_Missense_Mutation_p.Q863H|PCDH11X_uc004efn.1_Missense_Mutation_p.Q863H|PCDH11X_uc004efh.1_Missense_Mutation_p.Q863H|PCDH11X_uc004efj.1_Missense_Mutation_p.Q863H	p.Q863H	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN			2	3434	+			863			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.2589G>T	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351961	0.41700	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.16	5.16	0.70880	Protocadherin (1);	0.059770	0.64402	D	0.000002	T	0.52008	0.1708	M	0.68952	2.095	0.40979	D	0.98476	D;D;D;D;D;D;D;D	0.67145	0.977;0.987;0.987;0.996;0.996;0.996;0.959;0.959	P;D;D;D;D;D;P;P	0.67725	0.888;0.921;0.921;0.921;0.921;0.953;0.828;0.828	T	0.56220	-0.8015	10	0.59425	D	0.04	.	14.3483	0.66682	0.0:0.0:1.0:0.0	.	863;863;863;863;863;863;863;863	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	H	863	ENSP00000378746:Q863H;ENSP00000362186:Q863H;ENSP00000362189:Q863H;ENSP00000355040:Q863H;ENSP00000362180:Q863H;ENSP00000423762:Q863H;ENSP00000355105:Q863H;ENSP00000384758:Q863H;ENSP00000298274:Q863H	ENSP00000298274:Q863H	Q	+	3	2	PCDH11X	91020484	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	3.559000	0.53756	2.127000	0.65507	0.600000	0.82982	CAG		0.413	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		17	9	1	0	2.48551e-13	0.00499	3.77275e-13	17	9				
CHRDL1	91851	broad.mit.edu	37	X	109919543	109919543	+	Missense_Mutation	SNP	C	C	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:109919543C>G	ENST00000372045.1	-	12	1400	c.1269G>C	c.(1267-1269)atG>atC	p.M423I	CHRDL1_ENST00000482160.1_Missense_Mutation_p.M351I|CHRDL1_ENST00000434224.1_Missense_Mutation_p.M350I|CHRDL1_ENST00000218054.4_Missense_Mutation_p.M429I|CHRDL1_ENST00000394797.4_Missense_Mutation_p.M429I|CHRDL1_ENST00000372042.1_Missense_Mutation_p.M431I|CHRDL1_ENST00000444321.2_Missense_Mutation_p.M430I			Q9BU40	CRDL1_HUMAN	chordin-like 1	423					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.M429I(1)		endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						GACTTGAACACATCTGGCTGA	0.473																																							uc004eou.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1291-1293)ATG>ATC		chordin-like 1 isoform 1 precursor							146.0	117.0	127.0					X																	109919543		2203	4300	6503	SO:0001583	missense	91851				BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region		g.chrX:109919543C>G	AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.1269G>C	X.37:g.109919543C>G	ENSP00000361115:p.Met423Ile					CHRDL1_uc004eov.2_Missense_Mutation_p.M420I|CHRDL1_uc004eow.2_Missense_Mutation_p.M429I|CHRDL1_uc010nps.2_Missense_Mutation_p.M430I|CHRDL1_uc004eot.2_Missense_Mutation_p.M350I|CHRDL1_uc011mss.1_Missense_Mutation_p.M345I	p.M431I	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN			12	1642	-			423					B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37	c.1293G>C		.	.	.	.	.	.	.	.	.	.	C	15.79	2.937570	0.52972	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.30182	2.3;1.54;2.29;2.29;2.56;1.55;2.29	4.79	4.79	0.61399	.	0.187539	0.56097	D	0.000025	T	0.37812	0.1017	L	0.27053	0.805	0.48696	D	0.999693	B;B;B;B;B;P	0.45126	0.304;0.118;0.118;0.118;0.118;0.851	B;B;B;B;B;P	0.55391	0.096;0.073;0.054;0.054;0.073;0.775	T	0.07214	-1.0784	9	.	.	.	-6.6488	17.7162	0.88337	0.0:1.0:0.0:0.0	.	351;430;410;423;431;350	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	I	423;350;429;429;431;351;430	ENSP00000361115:M423I;ENSP00000389627:M350I;ENSP00000218054:M429I;ENSP00000378276:M429I;ENSP00000361112:M431I;ENSP00000418443:M351I;ENSP00000399739:M430I	.	M	-	3	0	CHRDL1	109806199	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.404000	0.66344	2.311000	0.77944	0.600000	0.82982	ATG		0.473	CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234		6	34	0	0	0	0.001984	0	6	34				
UPF3B	65109	broad.mit.edu	37	X	118979178	118979178	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:118979178A>C	ENST00000276201.2	-	4	521	c.452T>G	c.(451-453)gTc>gGc	p.V151G	UPF3B_ENST00000478840.1_5'UTR|UPF3B_ENST00000345865.2_Missense_Mutation_p.V151G	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	151	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V151G(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						GATAGTCCCGACTTTGGTATC	0.338																																							uc004erz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(451-453)GTC>GGC		UPF3 regulator of nonsense transcripts homolog B							139.0	127.0	131.0					X																	118979178		2203	4300	6503	SO:0001583	missense	65109				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding	g.chrX:118979178A>C	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.452T>G	X.37:g.118979178A>C	ENSP00000276201:p.Val151Gly					UPF3B_uc004esa.1_Missense_Mutation_p.V151G	p.V151G	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN			4	529	-			151			Sufficient for association with EJC core.|Necessary for interaction with UPF2.		D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	ENST00000276201.2	37	c.452T>G	CCDS14588.1	.	.	.	.	.	.	.	.	.	.	A	13.40	2.226822	0.39399	.	.	ENSG00000125351	ENST00000276201;ENST00000345865;ENST00000439808	T;T	0.65549	-0.16;-0.16	5.12	3.98	0.46160	Regulator of nonsense-mediated decay, UPF3 (1);	0.275548	0.39083	N	0.001479	T	0.49047	0.1534	L	0.43923	1.385	0.58432	D	0.999997	B;P	0.40794	0.358;0.729	B;B	0.38616	0.106;0.277	T	0.53913	-0.8371	10	0.72032	D	0.01	.	4.6333	0.12513	0.7516:0.0:0.2484:0.0	.	151;151	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	G	151	ENSP00000276201:V151G;ENSP00000245418:V151G	ENSP00000276201:V151G	V	-	2	0	UPF3B	118863206	1.000000	0.71417	1.000000	0.80357	0.392000	0.30506	3.161000	0.50747	1.688000	0.51068	0.481000	0.45027	GTC		0.338	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1			36	22	0	0	0	0.007835	0	36	22				
ARHGAP36	158763	broad.mit.edu	37	X	130215841	130215841	+	Missense_Mutation	SNP	T	T	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:130215841T>A	ENST00000276211.5	+	2	547	c.202T>A	c.(202-204)Tac>Aac	p.Y68N	ARHGAP36_ENST00000370921.1_5'Flank|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.Y56N	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	68					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.Y68N(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						AGAGACTGCTTACCACGAACT	0.572																																							uc004evz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(202-204)TAC>AAC		hypothetical protein LOC158763 precursor							116.0	100.0	106.0					X																	130215841		2203	4300	6503	SO:0001583	missense	158763				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chrX:130215841T>A		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.202T>A	X.37:g.130215841T>A	ENSP00000276211:p.Tyr68Asn					ARHGAP36_uc004ewa.2_Missense_Mutation_p.Y56N|ARHGAP36_uc004ewb.2_Missense_Mutation_p.Y37N|ARHGAP36_uc004ewc.2_5'Flank	p.Y68N	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN			2	547	+			68					B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	c.202T>A	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	T	19.02	3.746908	0.69418	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.14516	2.5;2.53;2.57	4.16	4.16	0.48862	.	0.000000	0.42053	D	0.000761	T	0.19967	0.0480	N	0.19112	0.55	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.995	D;D;D	0.83275	0.991;0.996;0.979	T	0.02307	-1.1179	10	0.72032	D	0.01	.	8.6068	0.33778	0.0:0.0:0.0:1.0	.	37;56;68	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	N	68;56;20;37	ENSP00000276211:Y68N;ENSP00000359960:Y56N;ENSP00000408515:Y37N	ENSP00000276211:Y68N	Y	+	1	0	ARHGAP36	130043522	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.016000	0.57159	1.852000	0.53769	0.441000	0.28932	TAC		0.572	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		48	27	0	0	0	0.00361	0	48	27				
GPR112	139378	broad.mit.edu	37	X	135429209	135429209	+	Missense_Mutation	SNP	G	G	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:135429209G>C	ENST00000394143.1	+	6	3635	c.3344G>C	c.(3343-3345)aGa>aCa	p.R1115T	GPR112_ENST00000412101.1_Missense_Mutation_p.R910T|GPR112_ENST00000370652.1_Missense_Mutation_p.R1115T|GPR112_ENST00000287534.4_Missense_Mutation_p.R1052T|GPR112_ENST00000394141.1_Missense_Mutation_p.R910T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1115					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1115T(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CATTCACTGAGACTCTCCACT	0.478																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(3343-3345)AGA>ACA		G-protein coupled receptor 112							153.0	122.0	132.0					X																	135429209		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135429209G>C	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3344G>C	X.37:g.135429209G>C	ENSP00000377699:p.Arg1115Thr					GPR112_uc010nsb.1_Missense_Mutation_p.R910T|GPR112_uc010nsc.1_Missense_Mutation_p.R882T	p.R1115T	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	3635	+	Acute lymphoblastic leukemia(192;0.000127)		1115			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.3344G>C	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	G	8.176	0.792780	0.16327	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.44482	0.96;0.96;0.92;1.02;0.92	2.82	0.958	0.19619	.	.	.	.	.	T	0.25606	0.0623	L	0.29908	0.895	0.09310	N	1	B;B;B	0.32829	0.386;0.288;0.19	B;B;B	0.31191	0.125;0.118;0.055	T	0.14811	-1.0459	9	0.28530	T	0.3	.	5.389	0.16234	0.3208:0.0:0.6792:0.0	.	1052;910;1115	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	T	1115;1115;910;1052;910	ENSP00000377699:R1115T;ENSP00000359686:R1115T;ENSP00000416526:R910T;ENSP00000287534:R1052T;ENSP00000377697:R910T	ENSP00000287534:R1052T	R	+	2	0	GPR112	135256875	0.682000	0.27624	0.003000	0.11579	0.004000	0.04260	0.602000	0.24134	-0.014000	0.14175	-0.422000	0.05995	AGA		0.478	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			47	36	0	0	0	0.00361	0	47	36				
MAGEC1	9947	broad.mit.edu	37	X	140992863	140992863	+	Splice_Site	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:140992863G>T	ENST00000285879.4	+	3	290		c.e3+1		MAGEC1_ENST00000406005.2_Splice_Site	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1									p.?(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GCCATCATGGGTGAGTTTCTC	0.547										HNSCC(15;0.026)																													uc004fbt.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.e3+1		melanoma antigen family C, 1							145.0	119.0	128.0					X																	140992863		2203	4300	6503	SO:0001630	splice_region_variant	9947						protein binding	g.chrX:140992863G>T	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.4+1G>T	X.37:g.140992863G>T		HNSCC(15;0.026)				MAGEC1_uc010nsl.1_Splice_Site	p.G2_splice	NM_005462	NP_005453	O60732	MAGC1_HUMAN			3	290	+	Acute lymphoblastic leukemia(192;6.56e-05)							A0PK03|O75451|Q8TCV4	Splice_Site	SNP	ENST00000285879.4	37	c.4_splice	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	G	3.225	-0.158673	0.06544	.	.	ENSG00000155495	ENST00000285879;ENST00000370511	.	.	.	0.873	-0.55	0.11825	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999976	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.5447	0.07824	0.0:0.0:0.4606:0.5394	.	.	.	.	.	-1	.	.	.	+	.	.	MAGEC1	140820529	0.063000	0.20901	0.003000	0.11579	0.235000	0.25334	-0.164000	0.09983	-0.196000	0.10366	0.279000	0.19357	.		0.547	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	Intron	18	18	1	0	5.03518e-11	0.007413	7.27813e-11	18	18				
MAGEC1	9947	broad.mit.edu	37	X	140996099	140996099	+	Missense_Mutation	SNP	C	C	A	rs143297640		TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:140996099C>A	ENST00000285879.4	+	4	3195	c.2909C>A	c.(2908-2910)cCt>cAt	p.P970H	MAGEC1_ENST00000406005.2_Missense_Mutation_p.P37H	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	970	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.P970H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAAGTGGACCCTGATGACTCC	0.478										HNSCC(15;0.026)																													uc004fbt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2908-2910)CCT>CAT		melanoma antigen family C, 1							139.0	133.0	135.0					X																	140996099		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140996099C>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2909C>A	X.37:g.140996099C>A	ENSP00000285879:p.Pro970His	HNSCC(15;0.026)				MAGEC1_uc010nsl.1_Missense_Mutation_p.P37H	p.P970H	NM_005462	NP_005453	O60732	MAGC1_HUMAN			4	3195	+	Acute lymphoblastic leukemia(192;6.56e-05)		970			MAGE.		A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.2909C>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	5.279	0.236917	0.10023	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05319	3.46;3.46	0.837	-0.603	0.11630	.	.	.	.	.	T	0.22282	0.0537	M	0.86028	2.79	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.04481	-1.0948	8	0.87932	D	0	.	.	.	.	.	970	O60732	MAGC1_HUMAN	H	970;37	ENSP00000285879:P970H;ENSP00000385500:P37H	ENSP00000285879:P970H	P	+	2	0	MAGEC1	140823765	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.457000	0.06745	-0.229000	0.09854	0.279000	0.19357	CCT		0.478	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		72	54	1	0	1.07363e-35	0.00361	2.00832e-35	72	54				
SLITRK2	84631	broad.mit.edu	37	X	144904367	144904367	+	Missense_Mutation	SNP	G	G	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:144904367G>T	ENST00000370490.1	+	1	4679	c.424G>T	c.(424-426)Gac>Tac	p.D142Y	SLITRK2_ENST00000413937.2_Missense_Mutation_p.D142Y|SLITRK2_ENST00000447897.2_Missense_Mutation_p.D142Y|SLITRK2_ENST00000434188.2_Missense_Mutation_p.D142Y|SLITRK2_ENST00000428560.2_Missense_Mutation_p.D142Y			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	142					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.D142Y(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCCAGGCCGACTACAATTA	0.488																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(424-426)GAC>TAC		SLIT and NTRK-like family, member 2 precursor							96.0	72.0	81.0					X																	144904367		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144904367G>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.424G>T	X.37:g.144904367G>T	ENSP00000359521:p.Asp142Tyr					SLITRK2_uc010nsp.2_Missense_Mutation_p.D142Y|SLITRK2_uc010nso.2_Missense_Mutation_p.D142Y|SLITRK2_uc011mwq.1_Missense_Mutation_p.D142Y|SLITRK2_uc011mwr.1_Missense_Mutation_p.D142Y|SLITRK2_uc011mws.1_Missense_Mutation_p.D142Y|SLITRK2_uc004fcg.2_Missense_Mutation_p.D142Y|SLITRK2_uc011mwt.1_Missense_Mutation_p.D142Y	p.D142Y	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	1414	+	Acute lymphoblastic leukemia(192;6.56e-05)		142			Extracellular (Potential).|LRR 4.		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.424G>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254204	0.80135	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36	5.19	5.19	0.71726	.	0.000000	0.85682	U	0.000000	T	0.66346	0.2780	L	0.48260	1.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68349	-0.5432	10	0.59425	D	0.04	-13.0657	15.0584	0.71933	0.0:0.0:1.0:0.0	.	142	Q9H156	SLIK2_HUMAN	Y	142	ENSP00000334374:D142Y;ENSP00000411681:D142Y;ENSP00000359521:D142Y;ENSP00000397015:D142Y;ENSP00000407347:D142Y;ENSP00000412010:D142Y	ENSP00000334374:D142Y	D	+	1	0	SLITRK2	144712059	1.000000	0.71417	0.936000	0.37596	0.768000	0.43524	9.869000	0.99810	2.141000	0.66446	0.600000	0.82982	GAC		0.488	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		22	18	1	0	1.55795e-14	0.001882	2.45869e-14	22	18				
IL9R	3581	broad.mit.edu	37	X	155233519	155233519	+	Splice_Site	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrX:155233519C>A	ENST00000244174.5	+	4	611	c.432C>A	c.(430-432)caC>caA	p.H144Q	IL9R_ENST00000424344.3_Splice_Site_p.H123Q|IL9R_ENST00000540897.1_Splice_Site_p.T179K|IL9R_ENST00000369423.2_Splice_Site_p.T189K	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	144					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)	p.H144Q(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCCGGAGACACGGTGAGCAGC	0.622																																							uc004fnv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(430-432)CAC>CAA		interleukin 9 receptor precursor							75.0	74.0	74.0					X																	155233519		2203	4296	6499	SO:0001630	splice_region_variant	3581				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity	g.chrX:155233519C>A	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.433+1C>A	X.37:g.155233519C>A						IL9R_uc010nvn.2_Missense_Mutation_p.H123Q|IL9R_uc004fnu.1_Missense_Mutation_p.T189K	p.H144Q	NM_002186	NP_002177	Q01113	IL9R_HUMAN			4	611	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		144			Extracellular (Potential).		B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	c.432C>A	CCDS14771.4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.628|0.628	-0.818370|-0.818370	0.02776|0.02776	.|.	.|.	ENSG00000124334|ENSG00000124334	ENST00000244174;ENST00000424344;ENST00000455739|ENST00000369423;ENST00000540897	T;T|T;T	0.37235|0.28255	1.21;1.21|1.62;1.62	1.29|1.29	-2.59|-2.59	0.06209|0.06209	Fibronectin, type III (1);|.	0.313213|.	0.29218|.	N|.	0.012791|.	T|T	0.16557|0.16557	0.0398|0.0398	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D;D|B	0.76494|0.13594	0.998;0.999|0.008	D;D|B	0.72075|0.06405	0.943;0.976|0.002	T|T	0.20739|0.20739	-1.0266|-1.0266	9|8	0.56958|0.23302	D|T	0.05|0.38	-17.341|-17.341	7.1354|7.1354	0.25525|0.25525	0.0:0.5558:0.0:0.4442|0.0:0.5558:0.0:0.4442	.|.	123;144|189	F5H3Z0;Q01113|B9ZVT0	.;IL9R_HUMAN|.	Q|K	144;123;123|189;179	ENSP00000244174:H144Q;ENSP00000388918:H123Q|ENSP00000358431:T189K;ENSP00000438112:T179K	ENSP00000244174:H144Q|ENSP00000358431:T189K	H|T	+|+	3|2	2|0	IL9R|IL9R	154886713|154886713	0.978000|0.978000	0.34361|0.34361	0.540000|0.540000	0.28089|0.28089	0.442000|0.442000	0.32017|0.32017	-0.458000|-0.458000	0.06737|0.06737	-2.010000|-2.010000	0.00953|0.00953	-1.346000|-1.346000	0.01242|0.01242	CAC|ACG		0.622	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	Missense_Mutation	5	24	1	0	0.00116845	0.001168	0.00128792	5	24				
ZFY	7544	broad.mit.edu	37	Y	2847526	2847526	+	Missense_Mutation	SNP	A	A	C			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrY:2847526A>C	ENST00000155093.3	+	8	2219	c.1898A>C	c.(1897-1899)cAt>cCt	p.H633P	ZFY_ENST00000449237.1_Missense_Mutation_p.H556P|ZFY-AS1_ENST00000417305.1_RNA|ZFY_ENST00000383052.1_Missense_Mutation_p.H633P|ZFY_ENST00000431102.1_Missense_Mutation_p.H442P	NM_003411.3	NP_003402.2	P08048	ZFY_HUMAN	zinc finger protein, Y-linked	633					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H633P(1)		biliary_tract(1)|kidney(3)|large_intestine(1)|lung(3)	8						CAGTGTTTGCATTGCGACCAC	0.403																																							uc004fqj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1897-1899)CAT>CCT		zinc finger protein, Y-linked isoform 1							62.0	57.0	58.0					Y																	2847526		605	1939	2544	SO:0001583	missense	7544				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrY:2847526A>C	L10393	CCDS14774.1, CCDS48200.1, CCDS48201.1	Yp11.3	2013-01-08			ENSG00000067646	ENSG00000067646		"""Zinc fingers, C2H2-type"""	12870	protein-coding gene	gene with protein product		490000				2497060	Standard	NM_001145275		Approved	ZNF911	uc004fqj.3	P08048	OTTHUMG00000036159	ENST00000155093.3:c.1898A>C	Y.37:g.2847526A>C	ENSP00000155093:p.His633Pro					ZFY_uc011nan.1_Missense_Mutation_p.H442P|ZFY_uc010nwe.2_Missense_Mutation_p.H556P	p.H633P	NM_003411	NP_003402	P08048	ZFY_HUMAN			8	2219	+			633			C2H2-type 8.		B4DVF7|Q14021|Q15558|Q1RME9|Q24JR0|Q96TF3	Missense_Mutation	SNP	ENST00000155093.3	37	c.1898A>C	CCDS14774.1																																																																																				0.403	ZFY-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088063.1	NM_003411		25	10	0	0	0	0.00333	0	25	10				
PCDH11Y	83259	broad.mit.edu	37	Y	4967037	4967037	+	Missense_Mutation	SNP	C	C	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chrY:4967037C>A	ENST00000333703.4	+	5	1898	c.1385C>A	c.(1384-1386)gCt>gAt	p.A462D	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.A473D|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.A473D	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	473	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A473D(2)|p.A462D(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GCTGCAGATGCTGGCAAACCT	0.403																																							uc004fqo.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(1417-1419)GCT>GAT		protocadherin 11 Y-linked isoform c																																				SO:0001583	missense	83259				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chrY:4967037C>A	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1385C>A	Y.37:g.4967037C>A	ENSP00000330552:p.Ala462Asp					PCDH11Y_uc010nwg.1_Missense_Mutation_p.A462D|PCDH11Y_uc004fql.1_Missense_Mutation_p.A462D|PCDH11Y_uc004fqm.1_Missense_Mutation_p.A462D|PCDH11Y_uc004fqn.1_Missense_Mutation_p.A473D|PCDH11Y_uc004fqp.1_Missense_Mutation_p.A244D	p.A473D	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN			2	2152	+			473			Cadherin 4.|Extracellular (Potential).		Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	c.1418C>A	CCDS14776.1																																																																																				0.403	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973		21	14	1	0	9.04072e-19	0.003271	1.54153e-18	21	14				
USP33	23032	broad.mit.edu	37	1	78207349	78207349	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:78207349delC	ENST00000370793.1	-	3	473	c.127delG	c.(127-129)gatfs	p.D43fs	USP33_ENST00000370794.3_Frame_Shift_Del_p.D12fs|USP33_ENST00000370792.3_Frame_Shift_Del_p.D43fs|USP33_ENST00000357428.1_Frame_Shift_Del_p.D43fs|USP33_ENST00000528150.1_5'UTR	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	43					axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						CCAACTGAATCCAAATGTGGA	0.313																																					Melanoma(152;72 1870 11110 26780 42647)	Melanoma(152;72 1870 11110 26780 42647)	uc001dht.2		NA																	0				lung(2)|ovary(1)	3						c.(127-129)GATfs		ubiquitin specific protease 33 isoform 1							42.0	44.0	44.0					1																	78207349		2202	4289	6491	SO:0001589	frameshift_variant	23032				axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr1:78207349delC	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.127delG	1.37:g.78207349delC	ENSP00000359829:p.Asp43fs					USP33_uc001dhu.2_Frame_Shift_Del_p.D12fs|USP33_uc001dhv.2_5'Flank|USP33_uc001dhw.2_Frame_Shift_Del_p.D43fs	p.D43fs	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN			3	474	-			43					Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Frame_Shift_Del	DEL	ENST00000370793.1	37	c.127delG	CCDS678.1																																																																																				0.313	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017		7	36	NA	NA	NA	NA	NA	7	36	---	---	---	---
KCNA3	3738	broad.mit.edu	37	1	111216207	111216207	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:111216207delC	ENST00000369769.2	-	1	1448	c.1225delG	c.(1225-1227)gtcfs	p.V409fs		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	409					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	AAAAGGATGACCCCAATAAAG	0.582																																							uc001dzv.1		NA																	0				ovary(4)|pancreas(1)	5						c.(1225-1227)GTCfs		potassium voltage-gated channel, shaker-related							56.0	54.0	55.0					1																	111216207		2203	4300	6503	SO:0001589	frameshift_variant	3738					voltage-gated potassium channel complex	delayed rectifier potassium channel activity	g.chr1:111216207delC	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1225delG	1.37:g.111216207delC	ENSP00000358784:p.Val409fs						p.V409fs	NM_002232	NP_002223	P22001	KCNA3_HUMAN		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	1	1449	-		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)	409			Helical; Name=Segment S5; (Potential).		Q5VWN2	Frame_Shift_Del	DEL	ENST00000369769.2	37	c.1225delG	CCDS828.2																																																																																				0.582	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232		18	27	NA	NA	NA	NA	NA	18	27	---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162326802	162326804	+	In_Frame_Del	DEL	CTT	CTT	-	rs41405649	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	CTT	CTT	-	-	CTT	CTT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:162326802_162326804delCTT	ENST00000361897.5	+	8	1217_1219	c.815_817delCTT	c.(814-819)ccttct>cct	p.S276del	NOS1AP_ENST00000530878.1_In_Frame_Del_p.S271del	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	276					regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			ATGCTGCTCCCTTCTTCTTCCTC	0.611																																							uc001gbv.2		NA																	0				lung(2)|upper_aerodigestive_tract(1)	3						c.(814-819)CCTTCT>CCT		nitric oxide synthase 1 (neuronal) adaptor			,	7,4259		3,1,2129					,	4.6	0.0			163	24,8228		12,0,4114	no	coding,coding	NOS1AP	NM_014697.2,NM_001164757.1	,	15,1,6243	A1A1,A1R,RR		0.2908,0.1641,0.2476	,	,		31,12487				SO:0001651	inframe_deletion	9722				regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding	g.chr1:162326802_162326804delCTT	AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.815_817delCTT	1.37:g.162326808_162326810delCTT	ENSP00000355133:p.Ser276del					NOS1AP_uc010pkr.1_In_Frame_Del_p.S271del|NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_In_Frame_Del_p.S271del	p.S276del	NM_014697	NP_055512	O75052	CAPON_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0537)		8	1202_1204	+	all_hematologic(112;0.203)		276					B7ZLF5|O43564|Q3T551|Q5VU95	In_Frame_Del	DEL	ENST00000361897.5	37	c.815_817delCTT	CCDS1237.1																																																																																				0.611	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060555.2	NM_014697		30	266	NA	NA	NA	NA	NA	30	266	---	---	---	---
DUSP27	92235	broad.mit.edu	37	1	167097478	167097479	+	Frame_Shift_Ins	INS	-	-	A			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr1:167097478_167097479insA	ENST00000361200.2	+	6	3276_3277	c.3110_3111insA	c.(3109-3114)ccagagfs	p.E1038fs	DUSP27_ENST00000271385.5_Frame_Shift_Ins_p.E1038fs|DUSP27_ENST00000443333.1_Frame_Shift_Ins_p.E1038fs|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1038					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GAGGAGAGCCCAGAGCCCTACT	0.584																																							uc001geb.1		NA																	0				ovary(3)	3						c.(3109-3111)CCAfs		dual specificity phosphatase 27																																				SO:0001589	frameshift_variant	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167097478_167097479insA	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3111dupA	1.37:g.167097479_167097479dupA	ENSP00000354483:p.Glu1038fs						p.P1037fs	NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN			5	3110_3111	+			1037					A0AUM4|Q9C074	Frame_Shift_Ins	INS	ENST00000361200.2	37	c.3110_3111insA	CCDS30932.1																																																																																				0.584	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		25	46	NA	NA	NA	NA	NA	25	46	---	---	---	---
MRGPRX1	259249	broad.mit.edu	37	11	18956058	18956058	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr11:18956058delG	ENST00000302797.3	-	1	498	c.274delC	c.(274-276)catfs	p.H92fs	MRGPRX1_ENST00000526914.1_5'UTR|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	92					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GAGATGGTATGGGGGATACTG	0.517																																							uc001mpg.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(274-276)CATfs		MAS-related GPR, member X1							136.0	138.0	137.0					11																	18956058		2194	4287	6481	SO:0001589	frameshift_variant	259249				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18956058delG		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.274delC	11.37:g.18956058delG	ENSP00000305766:p.His92fs						p.H92fs	NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN			1	492	-			92			Extracellular (Potential).		Q4V9L2|Q8TDD8|Q8TDD9	Frame_Shift_Del	DEL	ENST00000302797.3	37	c.274delC	CCDS7846.1																																																																																				0.517	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199		16	142	NA	NA	NA	NA	NA	16	142	---	---	---	---
NPIPA5	100288332	broad.mit.edu	37	16	15457788	15457788	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr16:15457788delG	ENST00000360151.4	-	8	780	c.781delC	c.(781-783)ctgfs	p.L261fs		NM_001277325.1	NP_001264254.1	E9PKD4	NPIA5_HUMAN	nuclear pore complex interacting protein family, member A5	261	Pro-rich.																TTGAGGCTCAGGGAGTTATCA	0.517																																							uc010bvf.1		NA																	0					NA						c.(781-783)CTGfs		RecName: Full=NPIP-like protein 1;																																				SO:0001589	frameshift_variant	0							g.chr16:15457788delG		CCDS59264.1	16p13.11	2013-06-11			ENSG00000183793	ENSG00000183793			41980	protein-coding gene	gene with protein product							Standard	NM_001277325		Approved			E9PKD4	OTTHUMG00000166305	ENST00000360151.4:c.781delC	16.37:g.15457788delG	ENSP00000433597:p.Leu261fs					uc010uzu.1_Frame_Shift_Del_p.L261fs	p.L261fs							8	781	-								Q0P618	Frame_Shift_Del	DEL	ENST00000360151.4	37	c.781delC	CCDS59264.1																																																																																				0.517	NPIPA5-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389069.1			26	17	NA	NA	NA	NA	NA	26	17	---	---	---	---
SPAG7	9552	broad.mit.edu	37	17	4864095	4864095	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr17:4864095delC	ENST00000206020.3	-	2	206	c.139delG	c.(139-141)gagfs	p.E47fs	SPAG7_ENST00000573366.1_5'UTR|SPAG7_ENST00000575142.1_Frame_Shift_Del_p.E36fs	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	47	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.					nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						TTACGAAACTCCACTTTCTGT	0.478																																							uc002gae.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(139-141)GAGfs		sperm associated antigen 7							173.0	164.0	167.0					17																	4864095		1883	4120	6003	SO:0001589	frameshift_variant	9552					nucleus	nucleic acid binding|protein binding	g.chr17:4864095delC	AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.139delG	17.37:g.4864095delC	ENSP00000206020:p.Glu47fs					SPAG7_uc002gad.2_5'UTR|SPAG7_uc002gaf.2_Frame_Shift_Del_p.E47fs	p.E47fs	NM_004890	NP_004881	O75391	SPAG7_HUMAN			2	172	-			47			R3H.|Nuclear localization signal (Potential).		Q96EU5	Frame_Shift_Del	DEL	ENST00000206020.3	37	c.139delG	CCDS42240.1																																																																																				0.478	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890		23	51	NA	NA	NA	NA	NA	23	51	---	---	---	---
ZNF226	7769	broad.mit.edu	37	19	44679818	44679818	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr19:44679818delG	ENST00000590089.1	+	7	770	c.403delG	c.(403-405)gggfs	p.G135fs	ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Frame_Shift_Del_p.G135fs|ZNF226_ENST00000337433.5_Frame_Shift_Del_p.G135fs			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				TTACCAGGTAGGGACAGAACT	0.383																																					Pancreas(115;581 1665 13228 19278 50070)	Pancreas(115;581 1665 13228 19278 50070)	uc002oyp.2		NA																	0					0						c.(403-405)GGGfs		zinc finger protein 226 isoform a							67.0	61.0	63.0					19																	44679818		1841	4094	5935	SO:0001589	frameshift_variant	7769				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44679818delG	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.403delG	19.37:g.44679818delG	ENSP00000465121:p.Gly135fs					ZNF226_uc002oyq.2_Frame_Shift_Del_p.G18fs|ZNF226_uc002oyr.2_Frame_Shift_Del_p.G18fs|ZNF226_uc010ejg.2_3'UTR|ZNF226_uc002oys.2_Frame_Shift_Del_p.G135fs|ZNF226_uc002oyt.2_Frame_Shift_Del_p.G135fs	p.G135fs	NM_001032373	NP_001027545	Q9NYT6	ZN226_HUMAN			6	547	+		Prostate(69;0.0352)|all_neural(266;0.202)	135					Q8WWE6|Q96TE6|Q9NS44	Frame_Shift_Del	DEL	ENST00000590089.1	37	c.403delG	CCDS46102.1																																																																																				0.383	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1			28	28	NA	NA	NA	NA	NA	28	28	---	---	---	---
APOB	338	broad.mit.edu	37	2	21230280	21230280	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:21230280delC	ENST00000233242.1	-	26	9587	c.9460delG	c.(9460-9462)gaafs	p.E3154fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3154					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGTTTTTTCCCATAGAGAG	0.348																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(9460-9462)GAAfs		apolipoprotein B precursor	Atorvastatin(DB01076)						93.0	99.0	97.0					2																	21230280		2203	4300	6503	SO:0001589	frameshift_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21230280delC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9460delG	2.37:g.21230280delC	ENSP00000233242:p.Glu3154fs						p.E3154fs	NM_000384	NP_000375	P04114	APOB_HUMAN			26	9588	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		3154					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	c.9460delG	CCDS1703.1																																																																																				0.348	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			38	94	NA	NA	NA	NA	NA	38	94	---	---	---	---
ZNF804A	91752	broad.mit.edu	37	2	185731105	185731106	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr2:185731105_185731106delGA	ENST00000302277.6	+	2	715_716	c.121_122delGA	c.(121-123)gagfs	p.E41fs		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	41							metal ion binding (GO:0046872)	p.E41Q(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GGACTATGCTGAGAAGGAAAAT	0.356																																							uc002uph.2		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(121-123)GAGfs		zinc finger protein 804A																																				SO:0001589	frameshift_variant	91752					intracellular	zinc ion binding	g.chr2:185731105_185731106delGA	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.121_122delGA	2.37:g.185731107_185731108delGA	ENSP00000303252:p.Glu41fs						p.E41fs	NM_194250	NP_919226	Q7Z570	Z804A_HUMAN			2	715_716	+			41					A7E253|Q6ZN26	Frame_Shift_Del	DEL	ENST00000302277.6	37	c.121_122delGA	CCDS2291.1																																																																																				0.356	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		22	34	NA	NA	NA	NA	NA	22	34	---	---	---	---
TSPEAR	54084	broad.mit.edu	37	21	45941951	45941951	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr21:45941951delC	ENST00000323084.4	-	9	1446	c.1381delG	c.(1381-1383)gcafs	p.A461fs	TSPEAR_ENST00000397916.1_Frame_Shift_Del_p.A393fs|C21orf90_ENST00000465978.1_Intron	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	461					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						AGCCGGGTTGCCGGGTTCCAC	0.617																																							uc002zfe.1		NA																	0					0						c.(1381-1383)GCAfs		chromosome 21 open reading frame 29 precursor							237.0	242.0	240.0					21																	45941951		2203	4300	6503	SO:0001589	frameshift_variant	54084				cell adhesion	extracellular region	structural molecule activity	g.chr21:45941951delC	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1381delG	21.37:g.45941951delC	ENSP00000321987:p.Ala461fs					C21orf29_uc010gpv.1_Frame_Shift_Del_p.A393fs	p.A461fs	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN			9	1447	-			461						Frame_Shift_Del	DEL	ENST00000323084.4	37	c.1381delG	CCDS13712.1																																																																																				0.617	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991		47	136	NA	NA	NA	NA	NA	47	136	---	---	---	---
ARPP21	10777	broad.mit.edu	37	3	35835223	35835223	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:35835223delC	ENST00000187397.4	+	20	2668	c.2212delC	c.(2212-2214)cccfs	p.P738fs	ARPP21_ENST00000458225.1_Frame_Shift_Del_p.P739fs|ARPP21_ENST00000417925.1_Frame_Shift_Del_p.P739fs|ARPP21_ENST00000337271.5_Frame_Shift_Del_p.P719fs|ARPP21_ENST00000476052.1_3'UTR|ARPP21_ENST00000444190.1_Frame_Shift_Del_p.P719fs	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	738	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TCAAGGACTGCCCCAGCAGTC	0.488																																							uc003cgb.2		NA																	0				ovary(2)|skin(1)	3						c.(2212-2214)CCCfs		cyclic AMP-regulated phosphoprotein, 21 kD							90.0	88.0	89.0					3																	35835223		2203	4300	6503	SO:0001589	frameshift_variant	10777					cytoplasm	nucleic acid binding	g.chr3:35835223delC	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.2212delC	3.37:g.35835223delC	ENSP00000187397:p.Pro738fs					ARPP21_uc003cga.2_Frame_Shift_Del_p.P719fs|ARPP21_uc011axy.1_Frame_Shift_Del_p.P739fs|ARPP21_uc003cgf.2_Frame_Shift_Del_p.P574fs|ARPP21_uc003cgg.2_Frame_Shift_Del_p.P261fs	p.P738fs	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN			20	2476	+			738			Gln-rich.		B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Frame_Shift_Del	DEL	ENST00000187397.4	37	c.2212delC	CCDS2661.1																																																																																				0.488	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		14	44	NA	NA	NA	NA	NA	14	44	---	---	---	---
CELSR3	1951	broad.mit.edu	37	3	48688324	48688324	+	Splice_Site	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr3:48688324delC	ENST00000164024.4	-	15	6651		c.e15+1		CELSR3_ENST00000544264.1_Splice_Site	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3						axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGCCTGCTCACCCCGGCAGCC	0.657																																							uc003cul.2		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.e15+1		cadherin EGF LAG seven-pass G-type receptor 3							24.0	28.0	27.0					3																	48688324		2195	4270	6465	SO:0001630	splice_region_variant	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48688324delC	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6370+1G>-	3.37:g.48688324delC						CELSR3_uc003cuf.1_Splice_Site_p.V2194_splice|CELSR3_uc010hkg.2_Splice_Site_p.V102_splice	p.V2124_splice	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	15	6651	-								O75092	Splice_Site	DEL	ENST00000164024.4	37	c.6370_splice	CCDS2775.1																																																																																				0.657	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	Intron	22	40	NA	NA	NA	NA	NA	22	40	---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20550132	20550132	+	Frame_Shift_Del	DEL	A	A	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr4:20550132delA	ENST00000504154.1	+	23	2619	c.2367delA	c.(2365-2367)atafs	p.I789fs	SLIT2_ENST00000273739.5_Frame_Shift_Del_p.I793fs|SLIT2_ENST00000503823.1_Frame_Shift_Del_p.I781fs|SLIT2_ENST00000503837.1_Frame_Shift_Del_p.I785fs|SLIT2_ENST00000509394.2_3'UTR	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	789					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACAACAGAATAAGCACGCTTT	0.368																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(2365-2367)ATAfs		slit homolog 2 precursor							96.0	91.0	93.0					4																	20550132		2203	4300	6503	SO:0001589	frameshift_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20550132delA	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2367delA	4.37:g.20550132delA	ENSP00000422591:p.Ile789fs					SLIT2_uc003gps.1_Frame_Shift_Del_p.I781fs	p.I789fs	NM_004787	NP_004778	O94813	SLIT2_HUMAN			23	2571	+			789			LRR 18.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Frame_Shift_Del	DEL	ENST00000504154.1	37	c.2367delA	CCDS3426.1																																																																																				0.368	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			10	43	NA	NA	NA	NA	NA	10	43	---	---	---	---
RFESD	317671	broad.mit.edu	37	5	94990059	94990059	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr5:94990059delG	ENST00000311364.4	+	4	1615	c.198delG	c.(196-198)ttgfs	p.L66fs	RFESD_ENST00000513950.2_Intron|SPATA9_ENST00000477047.2_Intron|RFESD_ENST00000458310.1_Frame_Shift_Del_p.L119fs|RFESD_ENST00000380005.4_Frame_Shift_Del_p.L119fs	NM_173362.3	NP_775498.1	Q8TAC1	RFESD_HUMAN	Rieske (Fe-S) domain containing	66	Rieske 1. {ECO:0000255|PROSITE- ProRule:PRU00628}.|Rieske 2. {ECO:0000255|PROSITE- ProRule:PRU00628}.						2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			autonomic_ganglia(2)|endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	6		all_cancers(142;0.000215)|all_epithelial(76;7.43e-07)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)|Colorectal(57;0.162)		all cancers(79;5.94e-17)		CTTTACATTTGGGAGATATAG	0.249																																							uc003klf.2		NA																	0					0						c.(196-198)TTGfs		Rieske (Fe-S) domain containing isoform 2							56.0	62.0	60.0					5																	94990059		2188	4289	6477	SO:0001589	frameshift_variant	317671						2 iron, 2 sulfur cluster binding|metal ion binding|oxidoreductase activity	g.chr5:94990059delG	BC035110	CCDS4075.1, CCDS47248.1	5q15	2010-12-07			ENSG00000175449	ENSG00000175449			29587	protein-coding gene	gene with protein product						12477932	Standard	NM_173362		Approved		uc003klg.3	Q8TAC1	OTTHUMG00000121168	ENST00000311364.4:c.198delG	5.37:g.94990059delG	ENSP00000309229:p.Leu66fs					RFESD_uc003klg.2_Frame_Shift_Del_p.L119fs|RFESD_uc011cun.1_Frame_Shift_Del_p.L119fs|SPATA9_uc010jbh.1_Intron|SPATA9_uc003klh.1_Intron|SPATA9_uc003kli.1_Intron	p.L66fs	NM_173362	NP_775498	Q8TAC1	RFESD_HUMAN		all cancers(79;5.94e-17)	4	1590	+		all_cancers(142;0.000215)|all_epithelial(76;7.43e-07)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)|Colorectal(57;0.162)	66			Rieske 2.|Rieske 1.		J3KPH1	Frame_Shift_Del	DEL	ENST00000311364.4	37	c.198delG	CCDS4075.1																																																																																				0.249	RFESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241654.1	NM_173362		30	43	NA	NA	NA	NA	NA	30	43	---	---	---	---
HOXA3	3200	broad.mit.edu	37	7	27149826	27149827	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:27149826_27149827insG	ENST00000396352.4	-	2	632_633	c.433_434insC	c.(433-435)ctgfs	p.L145fs	HOXA3_ENST00000317201.2_Frame_Shift_Ins_p.L145fs|HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	145					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						TGAGTTGAGCAGGGGGCTCTTG	0.594																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	Esophageal Squamous(136;1368 1743 5685 7935 50360)	uc011jzl.1		NA																	0				breast(2)	2						c.(433-435)CTGfs		homeobox A3 isoform a																																				SO:0001589	frameshift_variant	3200				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27149826_27149827insG		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.434dupC	7.37:g.27149831_27149831dupG	ENSP00000379640:p.Leu145fs					HOXA3_uc011jzk.1_5'UTR|HOXA3_uc003syk.2_Frame_Shift_Ins_p.L145fs	p.L145fs	NM_030661	NP_109377	O43365	HXA3_HUMAN			2	633_634	-			145					A4D181	Frame_Shift_Ins	INS	ENST00000396352.4	37	c.433_434insC	CCDS5404.1																																																																																				0.594	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2			21	53	NA	NA	NA	NA	NA	21	53	---	---	---	---
CTTNBP2	83992	broad.mit.edu	37	7	117407198	117407198	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:117407198delC	ENST00000160373.3	-	9	2902	c.2811delG	c.(2809-2811)gggfs	p.G937fs		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	937					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CTGGCTCAAGCCCTCCGTGCC	0.443																																							uc003vjf.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(2809-2811)GGGfs		cortactin binding protein 2							164.0	139.0	147.0					7																	117407198		2203	4300	6503	SO:0001589	frameshift_variant	83992							g.chr7:117407198delC		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2811delG	7.37:g.117407198delC	ENSP00000160373:p.Gly937fs						p.G937fs	NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	9	2903	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		937			ANK 6.		O43389|Q7LG11|Q9C0A5	Frame_Shift_Del	DEL	ENST00000160373.3	37	c.2811delG	CCDS5774.1																																																																																				0.443	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		29	75	NA	NA	NA	NA	NA	29	75	---	---	---	---
TBXAS1	6916	broad.mit.edu	37	7	139719828	139719830	+	In_Frame_Del	DEL	CCG	CCG	-	rs13306050	byFrequency	TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	CCG	CCG	-	-	CCG	CCG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr7:139719828_139719830delCCG	ENST00000336425.5	+	17	1920_1922	c.1531_1533delCCG	c.(1531-1533)ccgdel	p.P511del	TBXAS1_ENST00000263552.6_In_Frame_Del_p.P512del|TBXAS1_ENST00000425687.1_In_Frame_Del_p.P444del|TBXAS1_ENST00000436047.2_In_Frame_Del_p.P512del|TBXAS1_ENST00000411653.1_In_Frame_Del_p.R457del|TBXAS1_ENST00000414508.2_In_Frame_Del_p.R458del|TBXAS1_ENST00000416849.2_In_Frame_Del_p.P558del|TBXAS1_ENST00000448866.1_In_Frame_Del_p.P511del|TBXAS1_ENST00000458722.1_In_Frame_Del_p.P557del			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	511			P -> L (in dbSNP:rs13306050).		arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	ATTTTAGGTACCGCTGCAGCTAG	0.458																																							uc011kqv.1		NA																	0				ovary(2)|breast(1)	3						c.(1672-1674)CCGdel		thromboxane A synthase 1, platelet isoform																																				SO:0001651	inframe_deletion	6916				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity	g.chr7:139719828_139719830delCCG	L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.1531_1533delCCG	7.37:g.139719828_139719830delCCG	ENSP00000338087:p.Pro511del					TBXAS1_uc003vvh.2_In_Frame_Del_p.P512del|TBXAS1_uc010lne.2_In_Frame_Del_p.P444del|TBXAS1_uc003vvi.2_In_Frame_Del_p.P512del|TBXAS1_uc003vvj.2_In_Frame_Del_p.R458del|TBXAS1_uc011kqw.1_In_Frame_Del_p.P492del	p.P558del	NM_001130966	NP_001124438	P24557	THAS_HUMAN			14	1836_1838	+	Melanoma(164;0.0142)		511			Cytoplasmic (Potential).		B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	In_Frame_Del	DEL	ENST00000336425.5	37	c.1672_1674delCCG																																																																																					0.458	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000348373.1			7	36	NA	NA	NA	NA	NA	7	36	---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77502755	77502756	+	Frame_Shift_Ins	INS	-	-	T			TCGA-64-5778-01A-01D-1625-08	TCGA-64-5778-10A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3c540f87-5981-4b7a-b1ab-30c2056c785e	6069cecc-5fc1-47fb-b64b-11e36726037b	g.chr9:77502755_77502756insT	ENST00000360774.1	-	1	254_255	c.17_18insA	c.(16-18)gtcfs	p.V6fs	TRPM6_ENST00000451710.3_Frame_Shift_Ins_p.V6fs|TRPM6_ENST00000361255.3_5'Flank|TRPM6_ENST00000376864.4_Frame_Shift_Ins_p.V6fs|TRPM6_ENST00000376872.3_Frame_Shift_Ins_p.V6fs|TRPM6_ENST00000359047.2_Frame_Shift_Ins_p.V6fs|TRPM6_ENST00000376871.3_Frame_Shift_Ins_p.V6fs|TRPM6_ENST00000449912.2_5'Flank	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	6					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AGCGCTCCAAGACAGGTTGTTC	0.564																																							uc004ajl.1		NA																	0				lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(16-18)GTCfs		transient receptor potential cation channel,																																				SO:0001589	frameshift_variant	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77502755_77502756insT	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.17_18insA	9.37:g.77502755_77502756insT	ENSP00000354006:p.Val6fs					TRPM6_uc004ajk.1_5'Flank|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Frame_Shift_Ins_p.V6fs|TRPM6_uc010mpd.1_Frame_Shift_Ins_p.V6fs|TRPM6_uc010mpe.1_Frame_Shift_Ins_p.V6fs|TRPM6_uc004ajn.1_Frame_Shift_Ins_p.V6fs	p.V6fs	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN			1	255_256	-			6			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Frame_Shift_Ins	INS	ENST00000360774.1	37	c.17_18insA	CCDS6647.1																																																																																				0.564	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		23	124	NA	NA	NA	NA	NA	23	124	---	---	---	---
