#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CHD5	26038	broad.mit.edu	37	1	6188908	6188908	+	Silent	SNP	G	G	A	rs542019061		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:6188908G>A	ENST00000262450.3	-	23	3708	c.3609C>T	c.(3607-3609)gaC>gaT	p.D1203D	CHD5_ENST00000378021.1_Silent_p.D60D	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.D1203D(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CCTCCACGTCGTCCTTGAAGA	0.672																																							uc001amb.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12						c.(3607-3609)GAC>GAT		chromodomain helicase DNA binding protein 5							49.0	38.0	42.0					1																	6188908		2203	4300	6503	SO:0001819	synonymous_variant	26038				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	g.chr1:6188908G>A	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3609C>T	1.37:g.6188908G>A						CHD5_uc001alz.1_Silent_p.D60D|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	p.D1203D	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)	23	3709	-	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	1203					A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	ENST00000262450.3	37	c.3609C>T	CCDS57.1																																																																																				0.672	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		16	28	0	0	0	0.006122	0	16	28				
BAI2	576	broad.mit.edu	37	1	32198202	32198202	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:32198202C>T	ENST00000373658.3	-	27	3977	c.3636G>A	c.(3634-3636)gtG>gtA	p.V1212V	BAI2_ENST00000527361.1_Silent_p.V1179V|BAI2_ENST00000373655.2_Silent_p.V1212V|BAI2_ENST00000398547.1_Silent_p.V1145V|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000398538.1_Silent_p.V1200V|BAI2_ENST00000398542.1_Silent_p.V1112V|BAI2_ENST00000398556.3_Silent_p.V1127V|BAI2_ENST00000440175.2_Silent_p.V821V|BAI2_ENST00000257070.4_Silent_p.V1179V	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1212					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V1212V(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGCACTTCACCACATCCTGGA	0.652																																							uc001btn.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13						c.(3634-3636)GTG>GTA		brain-specific angiogenesis inhibitor 2							46.0	41.0	43.0					1																	32198202		2203	4300	6503	SO:0001819	synonymous_variant	576				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:32198202C>T	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.3636G>A	1.37:g.32198202C>T						BAI2_uc001btm.2_Silent_p.V206V|BAI2_uc001btp.1_Silent_p.V206V|BAI2_uc010ogn.1_Silent_p.V182V|BAI2_uc010ogo.1_Silent_p.V821V|BAI2_uc010ogp.1_Silent_p.V1145V|BAI2_uc010ogq.1_Silent_p.V1179V|BAI2_uc001bto.2_Silent_p.V1212V	p.V1212V	NM_001703	NP_001694	O60241	BAI2_HUMAN		STAD - Stomach adenocarcinoma(196;0.0557)	27	3990	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)	1212			Cytoplasmic (Potential).		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	ENST00000373658.3	37	c.3636G>A	CCDS346.2																																																																																				0.652	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703		5	29	0	0	0	0.000602	0	5	29				
RNF19B	127544	broad.mit.edu	37	1	33402700	33402700	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:33402700G>T	ENST00000373456.7	-	9	1905	c.1906C>A	c.(1906-1908)Ccc>Acc	p.P636T	RNF19B_ENST00000356990.5_3'UTR|RNF19B_ENST00000235150.4_Missense_Mutation_p.P635T	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	636					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P445T(1)		endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TGTCTGCAGGGGGGATCCTCT	0.567																																							uc010oho.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1906-1908)CCC>ACC		ring finger protein 19B isoform a							142.0	127.0	132.0					1																	33402700		2203	4300	6503	SO:0001583	missense	127544					integral to membrane	ligase activity|protein binding|zinc ion binding	g.chr1:33402700G>T	AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.1906C>A	1.37:g.33402700G>T	ENSP00000362555:p.Pro636Thr					RNF19B_uc001bwm.3_3'UTR|RNF19B_uc010ohp.1_Missense_Mutation_p.P635T	p.P636T	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN			9	1906	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)	636					B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	ENST00000373456.7	37	c.1906C>A	CCDS372.2	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275965	0.23307	.	.	ENSG00000116514	ENST00000373456;ENST00000235150	T;T	0.28069	1.63;1.63	4.81	0.203	0.15195	.	0.851408	0.10756	N	0.637746	T	0.12902	0.0313	N	0.19112	0.55	0.23984	N	0.99627	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.33979	-0.9847	10	0.02654	T	1	.	2.6724	0.05071	0.2371:0.1212:0.5177:0.1241	.	635;636	G3XA82;Q6ZMZ0	.;RN19B_HUMAN	T	636;635	ENSP00000362555:P636T;ENSP00000235150:P635T	ENSP00000235150:P635T	P	-	1	0	RNF19B	33175287	0.924000	0.31332	0.974000	0.42286	0.990000	0.78478	0.455000	0.21843	-0.133000	0.11537	0.537000	0.68136	CCC		0.567	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011465.3	NM_153341		17	145	1	0	4.35082e-09	0.010504	5.57517e-09	17	145				
RAB3B	5865	broad.mit.edu	37	1	52442781	52442781	+	Silent	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:52442781T>C	ENST00000371655.3	-	2	221	c.9A>G	c.(7-9)tcA>tcG	p.S3S		NM_002867.3	NP_002858.2	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	3					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle size (GO:0097494)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.S3S(1)		large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9						CATCTGTCACTGAAGCCATCT	0.468																																							uc001cth.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(7-9)TCA>TCG		RAB3B, member RAS oncogene family							97.0	88.0	91.0					1																	52442781		2203	4300	6503	SO:0001819	synonymous_variant	5865				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr1:52442781T>C	BC005035	CCDS560.1	1p32-p31	2008-02-05			ENSG00000169213	ENSG00000169213		"""RAB, member RAS oncogene"""	9778	protein-coding gene	gene with protein product		179510					Standard	NM_002867		Approved		uc001cth.3	P20337	OTTHUMG00000008627	ENST00000371655.3:c.9A>G	1.37:g.52442781T>C							p.S3S	NM_002867	NP_002858	P20337	RAB3B_HUMAN			2	134	-			3					Q5VUL2|Q9BSI1	Silent	SNP	ENST00000371655.3	37	c.9A>G	CCDS560.1																																																																																				0.468	RAB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023816.1	NM_002867		22	58	0	0	0	0.012319	0	22	58				
WLS	79971	broad.mit.edu	37	1	68620819	68620819	+	Missense_Mutation	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:68620819T>C	ENST00000262348.4	-	4	882	c.629A>G	c.(628-630)aAt>aGt	p.N210S	WLS_ENST00000370976.3_Missense_Mutation_p.N119S|WLS_ENST00000491811.1_5'UTR|GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000354777.2_Missense_Mutation_p.N208S|GNG12-AS1_ENST00000420587.1_RNA|WLS_ENST00000540432.1_Missense_Mutation_p.N210S	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	210	Interacts with Wnt proteins. {ECO:0000250}.				anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)	p.N208S(1)|p.N210S(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						AATTCCCACATTGATTTTCTT	0.423																																							uc001def.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(628-630)AAT>AGT		G protein-coupled receptor 177 isoform 1							269.0	245.0	253.0					1																	68620819		2203	4300	6503	SO:0001583	missense	79971				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity	g.chr1:68620819T>C	BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.629A>G	1.37:g.68620819T>C	ENSP00000262348:p.Asn210Ser					uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Missense_Mutation_p.N208S|WLS_uc001deg.1_Missense_Mutation_p.N119S|WLS_uc009wbf.1_Missense_Mutation_p.N165S	p.N210S	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN			4	900	-			210			Lumenal (Potential).|Interacts with Wnt proteins (By similarity).		B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	ENST00000262348.4	37	c.629A>G	CCDS642.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.5|26.5	4.746443|4.746443	0.89663|0.89663	.|.	.|.	ENSG00000116729|ENSG00000116729	ENST00000534713|ENST00000540432;ENST00000354777;ENST00000262348;ENST00000370976;ENST00000533537;ENST00000530486;ENST00000370973	.|T;T;T;T	.|0.56275	.|0.56;0.56;0.47;0.49	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.042337	.|0.85682	.|D	.|0.000000	T|T	0.68091|0.68091	0.2963|0.2963	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.87578	.|0.994;0.995;0.998;0.994	T|T	0.71619|0.71619	-0.4538|-0.4538	5|10	.|0.54805	.|T	.|0.06	-29.3998|-29.3998	16.2773|16.2773	0.82651|0.82651	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|210;119;210;208	.|F5H4K0;Q5JRS7;Q5T9L3;Q5T9L3-2	.|.;.;WLS_HUMAN;.	V|S	113|210;208;210;119;77;165;77	.|ENSP00000446112:N210S;ENSP00000346829:N208S;ENSP00000262348:N210S;ENSP00000360015:N119S	.|ENSP00000262348:N210S	M|N	-|-	1|2	0|0	WLS|WLS	68393407|68393407	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.983000|0.983000	0.72400|0.72400	7.485000|7.485000	0.81204|0.81204	2.249000|2.249000	0.74217|0.74217	0.450000|0.450000	0.29827|0.29827	ATG|AAT		0.423	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025368.1	NM_024911		81	182	0	0	0	0.01441	0	81	182				
SLC44A5	204962	broad.mit.edu	37	1	75805301	75805301	+	Missense_Mutation	SNP	A	A	T	rs202031898		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:75805301A>T	ENST00000370855.5	-	4	180	c.67T>A	c.(67-69)Tat>Aat	p.Y23N	SLC44A5_ENST00000535611.1_5'UTR|SLC44A5_ENST00000370859.3_Missense_Mutation_p.Y23N|SLC44A5_ENST00000469525.1_5'UTR	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	23					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y23N(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TCTGGGTCATATGTCCTTGGA	0.343																																							uc001dgu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(67-69)TAT>AAT		solute carrier family 44, member 5 isoform A							196.0	215.0	209.0					1																	75805301		2203	4300	6503	SO:0001583	missense	204962					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr1:75805301A>T	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.67T>A	1.37:g.75805301A>T	ENSP00000359892:p.Tyr23Asn					SLC44A5_uc001dgt.2_Missense_Mutation_p.Y23N|SLC44A5_uc001dgs.2_5'UTR|SLC44A5_uc001dgr.2_5'UTR|SLC44A5_uc010oqz.1_Missense_Mutation_p.Y62N|SLC44A5_uc010ora.1_Missense_Mutation_p.Y17N|SLC44A5_uc010orb.1_5'UTR	p.Y23N	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN			4	211	-			23			Cytoplasmic (Potential).		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	c.67T>A	CCDS667.1	.	.	.	.	.	.	.	.	.	.	A	13.17	2.158083	0.38119	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535790	T;T	0.42900	0.96;0.96	5.54	1.9	0.25705	.	0.606369	0.16980	N	0.191724	T	0.35653	0.0939	L	0.55990	1.75	0.09310	N	0.999999	P;P;D;D	0.58268	0.604;0.813;0.982;0.981	B;P;P;D	0.65684	0.245;0.49;0.873;0.937	T	0.13176	-1.0519	10	0.37606	T	0.19	-2.296	7.4848	0.27425	0.7473:0.0:0.2527:0.0	.	17;62;23;23	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2	.;.;CTL5_HUMAN;.	N	23;62;23;16	ENSP00000359896:Y23N;ENSP00000359892:Y23N	ENSP00000359892:Y23N	Y	-	1	0	SLC44A5	75577889	0.203000	0.23435	0.001000	0.08648	0.549000	0.35272	1.605000	0.36815	0.128000	0.18479	-0.297000	0.09499	TAT		0.343	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697		165	306	0	0	0	0.01441	0	165	306				
ST6GALNAC3	256435	broad.mit.edu	37	1	77093235	77093235	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:77093235C>T	ENST00000328299.3	+	4	870	c.722C>T	c.(721-723)aCc>aTc	p.T241I		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	241					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.T241I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						ATAAATGACACCTACTGCAAG	0.403																																							uc001dhh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(721-723)ACC>ATC		sialyltransferase 7C isoform 1							155.0	149.0	151.0					1																	77093235		2203	4300	6503	SO:0001583	missense	256435				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:77093235C>T		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.722C>T	1.37:g.77093235C>T	ENSP00000329214:p.Thr241Ile					ST6GALNAC3_uc010orh.1_Intron	p.T241I	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN			4	885	+			241			Lumenal (Potential).		Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	c.722C>T	CCDS672.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611445	0.66558	.	.	ENSG00000184005	ENST00000328299;ENST00000394993	T	0.32023	1.47	5.52	5.52	0.82312	.	0.115244	0.64402	D	0.000018	T	0.36826	0.0981	M	0.62723	1.935	0.52501	D	0.999957	P	0.43973	0.823	P	0.51266	0.664	T	0.04203	-1.0969	10	0.49607	T	0.09	-20.7771	18.0055	0.89208	0.0:1.0:0.0:0.0	.	241	Q8NDV1	SIA7C_HUMAN	I	241;240	ENSP00000329214:T241I	ENSP00000329214:T241I	T	+	2	0	ST6GALNAC3	76865823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.471000	0.60182	2.773000	0.95371	0.650000	0.86243	ACC		0.403	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996		29	117	0	0	0	0.010818	0	29	117				
GBP5	115362	broad.mit.edu	37	1	89732742	89732742	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:89732742C>A	ENST00000370459.3	-	5	650	c.523G>T	c.(523-525)Gac>Tac	p.D175Y	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Missense_Mutation_p.D175Y			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	175	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.D175Y(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		CACACTAAGTCTGGGAAGAAG	0.488																																							uc001dnc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(523-525)GAC>TAC		guanylate-binding protein 5							131.0	130.0	131.0					1																	89732742		2203	4300	6503	SO:0001583	missense	115362					plasma membrane	GTP binding|GTPase activity	g.chr1:89732742C>A	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.523G>T	1.37:g.89732742C>A	ENSP00000359488:p.Asp175Tyr					GBP5_uc001dnd.2_Missense_Mutation_p.D175Y|GBP5_uc001dne.1_Missense_Mutation_p.D175Y	p.D175Y	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN		all cancers(265;0.00784)|Epithelial(280;0.0286)	6	1060	-			175					B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	c.523G>T	CCDS722.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716892	0.68844	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.75367	-0.93;-0.93;-0.93	4.5	3.58	0.41010	Guanylate-binding protein, N-terminal (1);	0.482751	0.22206	N	0.063169	T	0.81607	0.4858	M	0.90595	3.13	0.32089	N	0.592118	D	0.89917	1.0	D	0.83275	0.996	T	0.80291	-0.1444	10	0.87932	D	0	-14.1389	5.9211	0.19082	0.1882:0.7139:0.0:0.0978	.	175	Q96PP8	GBP5_HUMAN	Y	175	ENSP00000340396:D175Y;ENSP00000359488:D175Y;ENSP00000403010:D175Y	ENSP00000340396:D175Y	D	-	1	0	GBP5	89505330	0.011000	0.17503	1.000000	0.80357	0.960000	0.62799	0.009000	0.13219	1.294000	0.44707	0.449000	0.29647	GAC		0.488	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942		44	140	1	0	1.7489e-18	0.011902	2.62336e-18	44	140				
S100A13	6284	broad.mit.edu	37	1	153591462	153591462	+	Missense_Mutation	SNP	G	G	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:153591462G>C	ENST00000392623.1	-	3	396	c.206C>G	c.(205-207)tCg>tGg	p.S69W	S100A14_ENST00000368700.3_5'Flank|S100A13_ENST00000392622.1_Missense_Mutation_p.S69W|S100A13_ENST00000339556.4_Missense_Mutation_p.S69W|S100A14_ENST00000344616.2_5'Flank|S100A13_ENST00000368699.1_Missense_Mutation_p.S69W|S100A13_ENST00000440685.2_Missense_Mutation_p.S69W|S100A14_ENST00000368701.1_5'Flank|S100A14_ENST00000368702.1_5'Flank|S100A13_ENST00000491177.1_5'UTR	NM_001024212.1	NP_001019383.1	Q99584	S10AD_HUMAN	S100 calcium binding protein A13	69					cytokine secretion (GO:0050663)|interleukin-1 alpha secretion (GO:0050703)|mast cell degranulation (GO:0043303)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cell shape (GO:0008360)|response to copper ion (GO:0046688)|response to electrical stimulus (GO:0051602)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mast cell granule (GO:0042629)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)	p.S69W(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)|Olopatadine(DB00768)	CTTGAGCTCCGAGTCCTGATT	0.483																																					NSCLC(156;1296 1989 17590 30930 49554)	NSCLC(156;1296 1989 17590 30930 49554)	uc001fcf.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(205-207)TCG>TGG		S100 calcium binding protein A13	Amlexanox(DB01025)						216.0	219.0	218.0					1																	153591462		2203	4300	6503	SO:0001583	missense	6284				interleukin-1 alpha secretion|mast cell degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|extracellular space|nucleus|perinuclear region of cytoplasm	calcium ion binding|copper ion binding|fibroblast growth factor 1 binding|lipid binding|protein homodimerization activity|RAGE receptor binding|zinc ion binding	g.chr1:153591462G>C	AK097132	CCDS30874.1	1q21	2008-02-05	2001-11-28		ENSG00000189171	ENSG00000189171		"""S100 calcium binding proteins"""	10490	protein-coding gene	gene with protein product		601989	"""S100 calcium-binding protein A13"""			8985590	Standard	XM_005245434		Approved		uc001fch.3	Q99584	OTTHUMG00000036641	ENST00000392623.1:c.206C>G	1.37:g.153591462G>C	ENSP00000376399:p.Ser69Trp					S100A14_uc001fce.2_5'Flank|S100A13_uc001fcg.2_Missense_Mutation_p.S69W|S100A13_uc009woh.2_Missense_Mutation_p.S69W|S100A13_uc001fch.2_Missense_Mutation_p.S69W|S100A13_uc001fci.2_Missense_Mutation_p.S69W|S100A13_uc001fcj.2_Missense_Mutation_p.S69W	p.S69W	NM_001024213	NP_001019384	Q99584	S10AD_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		3	365	-	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		69			2.		Q52PI9|Q6FGF8	Missense_Mutation	SNP	ENST00000392623.1	37	c.206C>G	CCDS30874.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578747	0.46006	.	.	ENSG00000189171	ENST00000339556;ENST00000368699;ENST00000440685;ENST00000392623;ENST00000392622	T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67	5.46	5.46	0.80206	EF-hand-like domain (1);	0.706063	0.13147	N	0.410206	T	0.27559	0.0677	.	.	.	0.53688	D	0.999973	D	0.69078	0.997	D	0.64410	0.925	T	0.00670	-1.1617	9	0.87932	D	0	.	14.8736	0.70478	0.0:0.0:1.0:0.0	.	69	Q99584	S10AD_HUMAN	W	69	ENSP00000344822:S69W;ENSP00000357688:S69W;ENSP00000392767:S69W;ENSP00000376399:S69W;ENSP00000376398:S69W	ENSP00000344822:S69W	S	-	2	0	S100A13	151858086	0.969000	0.33509	0.951000	0.38953	0.166000	0.22503	2.431000	0.44775	2.590000	0.87494	0.558000	0.71614	TCG		0.483	S100A13-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089109.3	NM_005979		15	407	0	0	0	0.007413	0	15	407				
GATAD2B	57459	broad.mit.edu	37	1	153790562	153790562	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:153790562C>A	ENST00000368655.4	-	5	926	c.683G>T	c.(682-684)cGg>cTg	p.R228L		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	228					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R228L(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGCCCCAGGCCGAGAGGGAAG	0.517																																							uc001fdb.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(682-684)CGG>CTG		GATA zinc finger domain containing 2B							129.0	132.0	131.0					1																	153790562		2203	4300	6503	SO:0001583	missense	57459					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:153790562C>A	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.683G>T	1.37:g.153790562C>A	ENSP00000357644:p.Arg228Leu						p.R228L	NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		5	927	-	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		228					D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	c.683G>T	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	C	32	5.192080	0.94923	.	.	ENSG00000143614	ENST00000368655	T	0.33865	1.39	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	L	0.36672	1.1	0.80722	D	1	D	0.60160	0.987	D	0.65010	0.931	T	0.04855	-1.0922	10	0.34782	T	0.22	-15.4977	18.6818	0.91548	0.0:1.0:0.0:0.0	.	228	Q8WXI9	P66B_HUMAN	L	228	ENSP00000357644:R228L	ENSP00000357644:R228L	R	-	2	0	GATAD2B	152057186	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.172000	0.58243	2.712000	0.92718	0.407000	0.27541	CGG		0.517	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699		42	170	1	0	3.61848e-18	0.007835	5.39598e-18	42	170				
NUP210L	91181	broad.mit.edu	37	1	153998192	153998192	+	Splice_Site	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:153998192C>A	ENST00000368559.3	-	30	4019	c.3948G>T	c.(3946-3948)agG>agT	p.R1316S	NUP210L_ENST00000271854.3_Splice_Site_p.R1316S|NUP210L_ENST00000368553.1_Splice_Site_p.R249S	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1316					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.R1316S(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CAGCTCCTTCCCTAGGGAACA	0.473																																							uc001fdw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11						c.(3946-3948)AGG>AGT		nucleoporin 210kDa-like isoform 1							181.0	167.0	171.0					1																	153998192		1892	4129	6021	SO:0001630	splice_region_variant	91181					integral to membrane		g.chr1:153998192C>A	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.3948-1G>T	1.37:g.153998192C>A						NUP210L_uc009woq.2_Missense_Mutation_p.R225S|NUP210L_uc010peh.1_Missense_Mutation_p.R1316S	p.R1316S	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)		30	4020	-	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		1316					E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	c.3948G>T	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746758	0.69418	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.28069	3.19;1.63;2.97	5.73	2.84	0.33178	.	0.000000	0.85682	D	0.000000	T	0.21347	0.0514	M	0.67397	2.05	0.36357	D	0.860448	D;D	0.56521	0.976;0.976	P;P	0.47206	0.541;0.541	T	0.03945	-1.0990	10	0.52906	T	0.07	.	8.9806	0.35964	0.0:0.7716:0.0:0.2284	.	1316;1316	E7EP56;Q5VU65	.;P210L_HUMAN	S	1316;249;1316	ENSP00000357547:R1316S;ENSP00000357541:R249S;ENSP00000271854:R1316S	ENSP00000271854:R1316S	R	-	3	2	NUP210L	152264816	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	1.785000	0.38684	0.346000	0.23899	0.561000	0.74099	AGG		0.473	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	Missense_Mutation	14	280	1	0	0.00316338	0.003163	0.00344727	14	280				
SPTA1	6708	broad.mit.edu	37	1	158656297	158656297	+	Missense_Mutation	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:158656297A>G	ENST00000368147.4	-	1	191	c.11T>C	c.(10-12)tTt>tCt	p.F4S		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	4					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.F4S(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTCCTTTGGAAATTGCTCCAT	0.333																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(10-12)TTT>TCT		spectrin, alpha, erythrocytic 1							60.0	60.0	60.0					1																	158656297		1801	4068	5869	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158656297A>G	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.11T>C	1.37:g.158656297A>G	ENSP00000357129:p.Phe4Ser						p.F4S	NM_003126	NP_003117	P02549	SPTA1_HUMAN			1	210	-	all_hematologic(112;0.0378)		4					Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.11T>C	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	7.562	0.664947	0.14710	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51817	0.86;0.69	4.69	1.16	0.20824	.	.	.	.	.	T	0.10937	0.0267	L	0.34521	1.04	0.09310	N	0.999997	B	0.06786	0.001	B	0.09377	0.004	T	0.37314	-0.9711	9	0.08179	T	0.78	.	6.4629	0.21966	0.7244:0.0:0.2756:0.0	.	4	P02549	SPTA1_HUMAN	S	4	ENSP00000357130:F4S;ENSP00000357129:F4S	ENSP00000357129:F4S	F	-	2	0	SPTA1	156922921	0.000000	0.05858	0.164000	0.22755	0.230000	0.25150	0.305000	0.19254	0.095000	0.17434	0.523000	0.50628	TTT		0.333	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		4	98	0	0	0	0.009096	0	4	98				
RASAL2	9462	broad.mit.edu	37	1	178421741	178421741	+	Missense_Mutation	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:178421741C>G	ENST00000462775.1	+	9	1644	c.1519C>G	c.(1519-1521)Cta>Gta	p.L507V	RASAL2_ENST00000367649.3_Missense_Mutation_p.L655V|RASAL2_ENST00000448150.3_Missense_Mutation_p.L637V	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	507	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.L507V(1)|p.L655V(1)|p.L637V(1)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						ATCTCGGACTCTAACTCTTAT	0.423																																							uc001glr.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|breast(2)|large_intestine(1)	5						c.(1519-1521)CTA>GTA		RAS protein activator like 2 isoform 1							165.0	150.0	155.0					1																	178421741		2203	4299	6502	SO:0001583	missense	9462				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity	g.chr1:178421741C>G	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1519C>G	1.37:g.178421741C>G	ENSP00000420558:p.Leu507Val					RASAL2_uc001glq.2_Missense_Mutation_p.L655V|RASAL2_uc009wxc.2_Missense_Mutation_p.L21V	p.L507V	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN			9	1644	+			507			Ras-GAP.		F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	c.1519C>G	CCDS1322.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.49|18.49	3.636394|3.636394	0.67130|0.67130	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	D;T;D|.	0.91521|.	-2.86;0.46;-2.86|.	5.15|5.15	4.13|4.13	0.48395|0.48395	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);|.	0.000000|.	0.64402|.	D|.	0.000004|.	D|D	0.82318|0.82318	0.5011|0.5011	H|H	0.95114|0.95114	3.625|3.625	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.998;0.999;0.987|.	D;D;D|.	0.87578|.	0.987;0.998;0.986|.	D|D	0.85965|0.85965	0.1473|0.1473	10|5	0.87932|.	D|.	0|.	.|.	10.1221|10.1221	0.42627|0.42627	0.0:0.8264:0.0:0.1736|0.0:0.8264:0.0:0.1736	.|.	637;507;655|.	B1AKC7;Q9UJF2;F8W755|.	.;NGAP_HUMAN;.|.	V|C	637;655;507|57	ENSP00000407768:L637V;ENSP00000356621:L655V;ENSP00000420558:L507V|.	ENSP00000356621:L655V|.	L|S	+|+	1|2	2|0	RASAL2|RASAL2	176688364|176688364	0.996000|0.996000	0.38824|0.38824	0.933000|0.933000	0.37362|0.37362	0.988000|0.988000	0.76386|0.76386	3.234000|3.234000	0.51320|0.51320	2.381000|2.381000	0.81170|0.81170	0.557000|0.557000	0.71058|0.71058	CTA|TCT		0.423	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692		7	178	0	0	0	0.004482	0	7	178				
CACNA1E	777	broad.mit.edu	37	1	181726250	181726250	+	Silent	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:181726250G>T	ENST00000367573.2	+	30	4317	c.4317G>T	c.(4315-4317)ctG>ctT	p.L1439L	CACNA1E_ENST00000367567.4_Silent_p.L1046L|CACNA1E_ENST00000357570.5_Silent_p.L1390L|CACNA1E_ENST00000358338.5_Silent_p.L1371L|CACNA1E_ENST00000360108.3_Silent_p.L1420L|CACNA1E_ENST00000367570.1_Silent_p.L1439L|CACNA1E_ENST00000526775.1_Silent_p.L1420L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1439					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.L1439L(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGTGCAGCCTGGAGAAGAATG	0.468																																							uc001gow.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(4315-4317)CTG>CTT		calcium channel, voltage-dependent, R type,							109.0	105.0	107.0					1																	181726250		1929	4149	6078	SO:0001819	synonymous_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181726250G>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4317G>T	1.37:g.181726250G>T						CACNA1E_uc009wxs.2_Silent_p.L1327L|CACNA1E_uc001gox.1_Silent_p.L665L|CACNA1E_uc009wxt.2_Silent_p.L665L	p.L1439L	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			30	4482	+			1439			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	c.4317G>T	CCDS55664.1																																																																																				0.468	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		6	43	1	0	0.00116845	0.001168	0.00128428	6	43				
CNTN2	6900	broad.mit.edu	37	1	205035635	205035635	+	Nonsense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:205035635G>A	ENST00000331830.4	+	15	2167	c.1883G>A	c.(1882-1884)tGg>tAg	p.W628*		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	628	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.W628*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CAGCTCAGCTGGAGCCGTGGC	0.607																																					Melanoma(183;2548 2817 37099 41192)	Melanoma(183;2548 2817 37099 41192)	uc001hbr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1882-1884)TGG>TAG		contactin 2 precursor							87.0	63.0	71.0					1																	205035635		2203	4300	6503	SO:0001587	stop_gained	6900				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	g.chr1:205035635G>A	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1883G>A	1.37:g.205035635G>A	ENSP00000330633:p.Trp628*					CNTN2_uc001hbq.1_Nonsense_Mutation_p.W519*|CNTN2_uc001hbs.2_Nonsense_Mutation_p.W416*	p.W628*	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		15	2152	+	all_cancers(21;0.144)|Breast(84;0.0437)		628			Fibronectin type-III 1.		P78432|Q5T054	Nonsense_Mutation	SNP	ENST00000331830.4	37	c.1883G>A	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	G	42	9.516684	0.99193	.	.	ENSG00000184144	ENST00000331830	.	.	.	5.97	5.97	0.96955	.	0.000000	0.50627	D	0.000115	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0086	0.97443	0.0:0.0:1.0:0.0	.	.	.	.	X	628	.	ENSP00000330633:W628X	W	+	2	0	CNTN2	203302258	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.669000	0.98622	2.835000	0.97688	0.591000	0.81541	TGG		0.607	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		19	30	0	0	0	0.008871	0	19	30				
ELK4	2005	broad.mit.edu	37	1	205588203	205588203	+	Splice_Site	SNP	T	T	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:205588203T>A	ENST00000357992.4	-	4	1420		c.e4-2		ELK4_ENST00000468523.1_5'Flank	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)						cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.?(1)	SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GATGGGTGTCTGCAATACACA	0.453			T	SLC45A3	prostate																																		uc001hcy.1		NA		Dom	yes		1	1q32	2005	T	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""			E	SLC45A3		prostate		1	Unknown(1)		lung(1)		0						c.e4-1		ELK4 protein isoform a							97.0	89.0	92.0					1																	205588203		2203	4300	6503	SO:0001630	splice_region_variant	2005					cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr1:205588203T>A	M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.1081-2A>T	1.37:g.205588203T>A							p.T361_splice	NM_001973	NP_001964	P28324	ELK4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0908)		4	2331	-	Breast(84;0.07)							P28323|Q6GSJ2	Splice_Site	SNP	ENST00000357992.4	37	c.1081_splice	CCDS1456.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.014372	0.75161	.	.	ENSG00000158711	ENST00000539916;ENST00000357992	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2383	0.65941	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ELK4	203854826	1.000000	0.71417	0.998000	0.56505	0.764000	0.43329	7.499000	0.81566	2.062000	0.61559	0.496000	0.49642	.		0.453	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	NM_021795	Intron	36	43	0	0	0	0.004289	0	36	43				
CR1	1378	broad.mit.edu	37	1	207741262	207741262	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:207741262C>A	ENST00000367049.4	+	25	4046	c.4046C>A	c.(4045-4047)aCa>aAa	p.T1349K	CR1_ENST00000367051.1_Missense_Mutation_p.T899K|CR1_ENST00000400960.2_Missense_Mutation_p.T899K|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367052.1_Intron|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000367053.1_Missense_Mutation_p.T899K	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	899	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.T904K(1)|p.T1349K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTAAATTACACATGCGACCCC	0.498																																							uc001hfy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(2695-2697)ACA>AAA		complement receptor 1 isoform F precursor							138.0	158.0	152.0					1																	207741262		1840	4104	5944	SO:0001583	missense	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207741262C>A	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4046C>A	1.37:g.207741262C>A	ENSP00000356016:p.Thr1349Lys					CR1_uc009xcl.1_Missense_Mutation_p.T449K|CR1_uc001hfx.2_Missense_Mutation_p.T1349K|CR1_uc009xck.1_Missense_Mutation_p.T449K	p.T899K	NM_000573	NP_000564	P17927	CR1_HUMAN			17	2836	+			899			Extracellular (Potential).|Sushi 14.		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	c.2696C>A	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	c	12.05	1.820313	0.32145	.	.	ENSG00000203710	ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	2.73	1.78	0.24846	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.68320	0.2988	M	0.67569	2.06	0.09310	N	1	B;D;P;D	0.69078	0.339;0.975;0.517;0.997	B;P;B;D	0.74674	0.36;0.667;0.364;0.984	T	0.57952	-0.7722	9	0.07644	T	0.81	.	5.9722	0.19359	0.0:0.8482:0.0:0.1518	.	899;449;899;1349	Q5SR44;E9PQN4;P17927;E9PDY4	.;.;CR1_HUMAN;.	K	899;899;899;1349	ENSP00000356018:T899K;ENSP00000356020:T899K;ENSP00000383744:T899K;ENSP00000356016:T1349K	ENSP00000356016:T1349K	T	+	2	0	CR1	205807885	0.000000	0.05858	0.065000	0.19835	0.019000	0.09904	-2.113000	0.01331	0.703000	0.31848	0.491000	0.48974	ACA		0.498	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		73	159	1	0	2.40041e-21	0.01441	3.75525e-21	73	159				
KCNH1	3756	broad.mit.edu	37	1	211192451	211192451	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:211192451G>T	ENST00000271751.4	-	6	733	c.706C>A	c.(706-708)Cct>Act	p.P236T	KCNH1_ENST00000367007.4_Missense_Mutation_p.P236T			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	236					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.P236T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ACATTATAAGGGACCAAGATG	0.418																																							uc001hib.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(706-708)CCT>ACT		potassium voltage-gated channel, subfamily H,							103.0	97.0	99.0					1																	211192451		2203	4300	6503	SO:0001583	missense	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:211192451G>T	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.706C>A	1.37:g.211192451G>T	ENSP00000271751:p.Pro236Thr					KCNH1_uc001hic.2_Missense_Mutation_p.P236T	p.P236T	NM_172362	NP_758872	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	6	876	-			236			Helical; Name=Segment S1; (Potential).		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	c.706C>A	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113284	0.77210	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98012	-4.66;-4.66	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.98975	0.9651	M	0.91140	3.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99727	1.1011	10	0.87932	D	0	.	17.4587	0.87614	0.0:0.0:1.0:0.0	.	236;236	Q14CL3;O95259	.;KCNH1_HUMAN	T	236	ENSP00000271751:P236T;ENSP00000355974:P236T	ENSP00000271751:P236T	P	-	1	0	KCNH1	209259074	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.424000	0.97464	2.366000	0.80165	0.462000	0.41574	CCT		0.418	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		44	58	1	0	2.47872e-24	0.010771	3.92593e-24	44	58				
USH2A	7399	broad.mit.edu	37	1	216108066	216108066	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:216108066G>A	ENST00000307340.3	-	38	7578	c.7192C>T	c.(7192-7194)Ctc>Ttc	p.L2398F	USH2A_ENST00000366943.2_Missense_Mutation_p.L2398F	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2398	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.L2398F(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCATCGATGAGCACCCAAAGG	0.363										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(7192-7194)CTC>TTC		usherin isoform B							113.0	105.0	108.0					1																	216108066		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216108066G>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7192C>T	1.37:g.216108066G>A	ENSP00000305941:p.Leu2398Phe	HNSCC(13;0.011)					p.L2398F	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	38	7579	-			2398			Extracellular (Potential).|Fibronectin type-III 10.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.7192C>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	6.758	0.508724	0.12883	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55930	0.49;0.49	5.81	4.89	0.63831	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.404030	0.17908	N	0.157947	T	0.45115	0.1326	L	0.46157	1.445	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.32025	-0.9922	10	0.51188	T	0.08	.	9.878	0.41216	0.2013:0.0:0.7987:0.0	.	2398	O75445	USH2A_HUMAN	F	2398	ENSP00000305941:L2398F;ENSP00000355910:L2398F	ENSP00000305941:L2398F	L	-	1	0	USH2A	214174689	0.602000	0.26916	0.812000	0.32479	0.913000	0.54294	2.206000	0.42779	2.736000	0.93811	0.655000	0.94253	CTC		0.363	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		73	92	0	0	0	0.01441	0	73	92				
HLX	3142	broad.mit.edu	37	1	221053723	221053723	+	Missense_Mutation	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:221053723A>G	ENST00000366903.6	+	1	2025	c.524A>G	c.(523-525)aAa>aGa	p.K175R	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_5'Flank	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	175					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.K175R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		AAAGACCTCAAATTTGGAATT	0.622																																							uc001hmv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(523-525)AAA>AGA		H2.0-like homeobox							33.0	41.0	38.0					1																	221053723		2141	4238	6379	SO:0001583	missense	3142				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:221053723A>G	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.524A>G	1.37:g.221053723A>G	ENSP00000355870:p.Lys175Arg						p.K175R	NM_021958	NP_068777	Q14774	HLX_HUMAN		GBM - Glioblastoma multiforme(131;0.00914)	1	981	+			175					B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	c.524A>G	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	A	34	5.304517	0.95601	.	.	ENSG00000136630	ENST00000366903	T	0.32988	1.43	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000008	T	0.44787	0.1310	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.42413	-0.9453	10	0.62326	D	0.03	-11.3975	14.7136	0.69251	1.0:0.0:0.0:0.0	.	175	Q14774	HLX_HUMAN	R	175	ENSP00000355870:K175R	ENSP00000355870:K175R	K	+	2	0	HLX	219120346	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.015000	0.93640	1.954000	0.56735	0.533000	0.62120	AAA		0.622	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958		12	51	0	0	0	0.010729	0	12	51				
OR2M3	127062	broad.mit.edu	37	1	248366562	248366562	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:248366562C>A	ENST00000456743.1	+	1	231	c.193C>A	c.(193-195)Caa>Aaa	p.Q65K		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q65K(1)		endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCTCCTCAGCCAACTGTCCCT	0.547																																							uc010pzg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(193-195)CAA>AAA		olfactory receptor, family 2, subfamily M,							351.0	323.0	333.0					1																	248366562		2203	4300	6503	SO:0001583	missense	127062				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248366562C>A		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.193C>A	1.37:g.248366562C>A	ENSP00000389625:p.Gln65Lys						p.Q65K	NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	193	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		65			Helical; Name=2; (Potential).		B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	37	c.193C>A	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428846	0.43122	.	.	ENSG00000228198	ENST00000456743	T	0.02944	4.1	2.44	1.45	0.22620	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30723	U	0.009016	T	0.11367	0.0277	M	0.77712	2.385	0.09310	N	1	D	0.69078	0.997	D	0.66847	0.947	T	0.02064	-1.1220	10	0.87932	D	0	.	9.0723	0.36500	0.4677:0.5322:0.0:0.0	.	65	Q8NG83	OR2M3_HUMAN	K	65	ENSP00000389625:Q65K	ENSP00000389625:Q65K	Q	+	1	0	OR2M3	246433185	0.000000	0.05858	0.127000	0.21898	0.437000	0.31866	-0.556000	0.05992	0.312000	0.23038	0.405000	0.27470	CAA		0.547	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689		75	331	1	0	9.35569e-46	0.01441	1.55928e-45	75	331				
OR2T10	127069	broad.mit.edu	37	1	248756148	248756148	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:248756148G>T	ENST00000330500.2	-	1	952	c.922C>A	c.(922-924)Cag>Aag	p.Q308K	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q308K(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGAGGTTTCTGCACGCTCAGC	0.383																																							uc010pzn.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(922-924)CAG>AAG		olfactory receptor, family 2, subfamily T,							49.0	56.0	54.0					1																	248756148		2038	4234	6272	SO:0001583	missense	127069				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248756148G>T		CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.922C>A	1.37:g.248756148G>T	ENSP00000329210:p.Gln308Lys						p.Q308K	NM_001004693	NP_001004693	Q8NGZ9	O2T10_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	922	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		308			Cytoplasmic (Potential).		B2RNK7	Missense_Mutation	SNP	ENST00000330500.2	37	c.922C>A	CCDS31121.1	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.213627	0.00289	.	.	ENSG00000184022	ENST00000330500	T	0.34472	1.36	2.02	-4.03	0.04021	.	.	.	.	.	T	0.08403	0.0209	N	0.00483	-1.445	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.26087	-1.0113	9	0.28530	T	0.3	.	3.8262	0.08855	0.0:0.2986:0.3769:0.3245	.	308	Q8NGZ9	O2T10_HUMAN	K	308	ENSP00000329210:Q308K	ENSP00000329210:Q308K	Q	-	1	0	OR2T10	246822771	0.007000	0.16637	0.000000	0.03702	0.002000	0.02628	0.804000	0.27098	-0.817000	0.04335	-0.567000	0.04161	CAG		0.383	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	NM_001004693		42	19	1	0	3.54909e-21	0.011902	5.45191e-21	42	19				
TUBB8	347688	broad.mit.edu	37	10	93905	93905	+	Missense_Mutation	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:93905T>C	ENST00000309812.4	-	4	489	c.427A>G	c.(427-429)Act>Gct	p.T143A	TUBB8_ENST00000447903.2_Missense_Mutation_p.T71A|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_3'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	143					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CCAGACCCAGTCCCCCCACCC	0.587																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	0				ovary(1)	1						c.(427-429)ACT>GCT		tubulin, beta 8 isoform 1							60.0	55.0	57.0					10																	93905		2203	4300	6503	SO:0001583	missense	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:93905T>C	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.427A>G	10.37:g.93905T>C	ENSP00000311042:p.Thr143Ala					TUBB8_uc009xhe.2_Missense_Mutation_p.T106A|TUBB8_uc010pzs.1_Missense_Mutation_p.T71A	p.T143A	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	4	427	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	143			GTP (Potential).		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	c.427A>G	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.369382	0.42003	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	D	0.82081	-1.57	.	.	.	Tubulin, conserved site (1);Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	U	0.000006	D	0.93337	0.7876	H	0.99404	4.55	0.32788	N	0.5016	D;D	0.89917	0.979;1.0	D;D	0.97110	0.973;1.0	D	0.89503	0.3765	9	0.87932	D	0	.	4.5487	0.12098	0.0:6.0E-4:0.0:0.9994	.	106;143	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	A	71;109;106;143	ENSP00000403895:T71A	ENSP00000272035:T109A	T	-	1	0	RP11-631M21.2	83905	1.000000	0.71417	0.651000	0.29564	0.656000	0.38851	5.418000	0.66429	0.103000	0.17682	0.102000	0.15555	ACT		0.587	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		3	60	0	0	0	0.004672	0	3	60				
SFMBT2	57713	broad.mit.edu	37	10	7423846	7423846	+	Missense_Mutation	SNP	C	C	A	rs566901683		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:7423846C>A	ENST00000361972.4	-	2	105	c.15G>T	c.(13-15)ttG>ttT	p.L5F	SFMBT2_ENST00000397160.3_Missense_Mutation_p.L5F|SFMBT2_ENST00000379711.2_Missense_Mutation_p.L5F|SFMBT2_ENST00000379713.3_Missense_Mutation_p.L5F|SFMBT2_ENST00000397167.1_Missense_Mutation_p.L5F	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	5					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.L5F(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TGGAAGCTGACAAAGTGCTCT	0.398																																							uc009xio.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						c.(13-15)TTG>TTT		Scm-like with four mbt domains 2							117.0	110.0	112.0					10																	7423846		2203	4300	6503	SO:0001583	missense	57713				regulation of transcription, DNA-dependent	nucleus		g.chr10:7423846C>A	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.15G>T	10.37:g.7423846C>A	ENSP00000355109:p.Leu5Phe					SFMBT2_uc001ijn.1_Missense_Mutation_p.L5F|SFMBT2_uc010qay.1_Missense_Mutation_p.L5F|SFMBT2_uc001ijo.1_Missense_Mutation_p.L5F	p.L5F	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN			2	106	-			5					A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	c.15G>T	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418780	0.25552	.	.	ENSG00000198879	ENST00000361972;ENST00000397167;ENST00000379713;ENST00000379711;ENST00000397160	T;T;T;T;T	0.34859	2.4;2.4;1.73;1.34;1.34	5.41	2.52	0.30459	.	0.224065	0.23110	N	0.051813	T	0.16599	0.0399	N	0.16478	0.41	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.24154	-1.0168	10	0.09843	T	0.71	.	5.0919	0.14713	0.0:0.6454:0.1723:0.1822	.	5;5	Q5T981;Q5VUG0	.;SMBT2_HUMAN	F	5	ENSP00000355109:L5F;ENSP00000380353:L5F;ENSP00000369035:L5F;ENSP00000369033:L5F;ENSP00000380346:L5F	ENSP00000355109:L5F	L	-	3	2	SFMBT2	7463852	0.465000	0.25815	0.003000	0.11579	0.027000	0.11550	0.569000	0.23638	0.656000	0.30886	0.650000	0.86243	TTG		0.398	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880		12	45	1	0	0.000151284	0.001855	0.000170697	12	45				
ITGA8	8516	broad.mit.edu	37	10	15646211	15646211	+	Missense_Mutation	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:15646211T>C	ENST00000378076.3	-	20	2467	c.2114A>G	c.(2113-2115)aAc>aGc	p.N705S	ITGA8_ENST00000477064.1_5'UTR	NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	705					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.N705S(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						CATTACCTTGTTGTTGCGTTC	0.378																																							uc001ioc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(2113-2115)AAC>AGC		integrin, alpha 8 precursor							210.0	174.0	186.0					10																	15646211		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15646211T>C	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2114A>G	10.37:g.15646211T>C	ENSP00000367316:p.Asn705Ser					ITGA8_uc010qcb.1_Missense_Mutation_p.N690S	p.N705S	NM_003638	NP_003629	P53708	ITA8_HUMAN			20	2114	-			705			Extracellular (Potential).		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.2114A>G	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	T	7.972	0.749230	0.15710	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.43688	0.94	5.65	3.12	0.35913	Integrin alpha-2 (1);	0.535957	0.23964	N	0.042829	T	0.32436	0.0829	M	0.61703	1.905	0.25738	N	0.985191	B;B	0.13594	0.006;0.008	B;B	0.17979	0.011;0.02	T	0.30650	-0.9971	10	0.11485	T	0.65	.	4.4387	0.11562	0.1384:0.1775:0.0:0.6841	.	690;705	F5H818;P53708	.;ITA8_HUMAN	S	705;690	ENSP00000367316:N705S	ENSP00000367316:N705S	N	-	2	0	ITGA8	15686217	0.954000	0.32549	0.997000	0.53966	0.821000	0.46438	-0.037000	0.12164	0.413000	0.25759	0.528000	0.53228	AAC		0.378	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		24	111	0	0	0	0.00333	0	24	111				
CCDC7	79741	broad.mit.edu	37	10	33137562	33137562	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:33137562C>T	ENST00000375030.2	+	20	2035	c.1417C>T	c.(1417-1419)Cgt>Tgt	p.R473C	C10orf68_ENST00000375025.4_Missense_Mutation_p.R578C|C10orf68_ENST00000375028.3_Missense_Mutation_p.R518C			Q9H943	CJ068_HUMAN		514								p.R514C(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						GTCCGTACAACGTCAAGAAGG	0.294																																							uc001iwn.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1540-1542)CGT>TGT		chromosome 10 open reading frame 68							74.0	73.0	73.0					10																	33137562		2202	4291	6493	SO:0001583	missense	79741							g.chr10:33137562C>T																												ENST00000375030.2:c.1417C>T	10.37:g.33137562C>T	ENSP00000364170:p.Arg473Cys					C10orf68_uc001iwl.1_Missense_Mutation_p.R473C|C10orf68_uc001iwm.1_Missense_Mutation_p.R518C|C10orf68_uc010qei.1_Missense_Mutation_p.R490C|C10orf68_uc001iwo.3_RNA	p.R514C	NM_024688	NP_078964	Q9H943	CJ068_HUMAN			19	2013	+			514					B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	ENST00000375030.2	37	c.1540C>T		.	.	.	.	.	.	.	.	.	.	.	11.95	1.791670	0.31685	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.33654	1.42;1.41;1.4;1.4	2.91	0.767	0.18482	.	.	.	.	.	T	0.28732	0.0712	L	0.36672	1.1	0.09310	N	1	D;P;D;D	0.67145	0.996;0.955;0.996;0.976	P;B;P;B	0.47573	0.55;0.276;0.55;0.431	T	0.17471	-1.0368	9	0.87932	D	0	.	2.5289	0.04698	0.2837:0.5332:0.0:0.1831	.	495;514;518;473	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	C	514;473;518;578;490	ENSP00000303710:R514C;ENSP00000364170:R473C;ENSP00000364168:R518C;ENSP00000364165:R578C	ENSP00000303710:R514C	R	+	1	0	C10orf68	33177568	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.633000	0.05483	0.190000	0.20209	0.491000	0.48974	CGT		0.294	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2			10	80	0	0	0	0.010729	0	10	80				
MSMB	4477	broad.mit.edu	37	10	51562320	51562320	+	Nonsense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:51562320A>T	ENST00000358559.2	+	4	352	c.265A>T	c.(265-267)Aag>Tag	p.K89*	NCOA4_ENST00000374087.4_5'Flank|MSMB_ENST00000298239.6_Silent_p.S53S|NCOA4_ENST00000430396.2_5'Flank|NCOA4_ENST00000414907.2_5'Flank|NCOA4_ENST00000438493.1_5'Flank|NCOA4_ENST00000452682.1_5'Flank	NM_002443.3	NP_002434.1	P08118	MSMB_HUMAN	microseminoprotein, beta-	89						extracellular space (GO:0005615)|nucleus (GO:0005634)		p.K89*(1)		lung(4)|ovary(2)|prostate(1)	7						AAGAATCTTCAAGAAGGAGGA	0.448																																							uc001jiq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(265-267)AAG>TAG		beta-microseminoprotein isoform a precursor							183.0	177.0	179.0					10																	51562320		2203	4300	6503	SO:0001587	stop_gained	4477	Hereditary_Prostate_Cancer				extracellular space|nucleus		g.chr10:51562320A>T	BC005257	CCDS73095.1, CCDS73096.1	10q11.2	2014-05-06			ENSG00000138294	ENSG00000263639			7372	protein-coding gene	gene with protein product		157145				1783399	Standard	NM_002443		Approved	PSP-94, PSP57, PSP94, IGBF, MSP, MSPB, PN44, PRPS, PSP	uc001jiq.3	P08118	OTTHUMG00000188315	ENST00000358559.2:c.265A>T	10.37:g.51562320A>T	ENSP00000351363:p.Lys89*					PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|MSMB_uc001jir.2_Silent_p.S53S|NCOA4_uc009xon.2_5'Flank|NCOA4_uc010qhd.1_5'Flank|NCOA4_uc001jis.3_5'Flank|NCOA4_uc010qhe.1_5'Flank|NCOA4_uc010qhf.1_5'Flank	p.K89*	NM_002443	NP_002434	P08118	MSMB_HUMAN			4	297	+			89					B1API6|P11999|Q13125|Q6IAY9|Q9UC59	Nonsense_Mutation	SNP	ENST00000358559.2	37	c.265A>T	CCDS7235.1	.	.	.	.	.	.	.	.	.	.	A	10.56	1.384099	0.25031	.	.	ENSG00000138294	ENST00000358559	.	.	.	3.92	-2.16	0.07080	.	0.528179	0.18770	N	0.131653	.	.	.	.	.	.	0.18873	N	0.999989	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.4856	1.7626	0.02995	0.2101:0.4601:0.108:0.2218	.	.	.	.	X	89	.	ENSP00000351363:K89X	K	+	1	0	MSMB	51232326	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.090000	0.15025	-0.432000	0.07297	-0.340000	0.08031	AAG		0.448	MSMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048034.1	NM_002443, NM_138634		25	148	0	0	0	0.00333	0	25	148				
KIF20B	9585	broad.mit.edu	37	10	91469165	91469165	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:91469165C>T	ENST00000371728.3	+	4	363	c.298C>T	c.(298-300)Cgg>Tgg	p.R100W	KIF20B_ENST00000416354.1_Missense_Mutation_p.R100W|KIF20B_ENST00000394289.2_Missense_Mutation_p.R100W|KIF20B_ENST00000260753.4_Missense_Mutation_p.R100W	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	100	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.R100W(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CATCCTTGGTCGGTTAAGTGA	0.368																																							uc001kgs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(298-300)CGG>TGG		M-phase phosphoprotein 1							104.0	103.0	104.0					10																	91469165		2203	4300	6503	SO:0001583	missense	9585				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding	g.chr10:91469165C>T	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.298C>T	10.37:g.91469165C>T	ENSP00000360793:p.Arg100Trp					KIF20B_uc001kgr.1_Missense_Mutation_p.R100W	p.R100W	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN			4	370	+			100			Kinesin-motor.		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37	c.298C>T		.	.	.	.	.	.	.	.	.	.	C	16.73	3.204970	0.58234	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728;ENST00000439656;ENST00000447580	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	5.26	4.33	0.51752	Kinesin, motor domain (4);	0.553896	0.14998	N	0.286298	D	0.85120	0.5624	M	0.80982	2.52	0.39232	D	0.963693	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.981	D	0.85547	0.1219	10	0.72032	D	0.01	-0.2195	9.6696	0.40004	0.1422:0.7842:0.0:0.0736	.	100;100	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	W	100	ENSP00000260753:R100W;ENSP00000411545:R100W;ENSP00000377830:R100W;ENSP00000360793:R100W;ENSP00000390946:R100W	ENSP00000260753:R100W	R	+	1	2	KIF20B	91459145	1.000000	0.71417	0.543000	0.28128	0.641000	0.38312	1.406000	0.34646	1.274000	0.44362	0.655000	0.94253	CGG		0.368	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195		16	147	0	0	0	0.004007	0	16	147				
CPN1	1369	broad.mit.edu	37	10	101814132	101814132	+	Silent	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:101814132G>T	ENST00000370418.3	-	7	1334	c.1083C>A	c.(1081-1083)gtC>gtA	p.V361V		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	361					response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.V361V(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		TAATCCCACTGACAGAAATGA	0.448																																							uc001kql.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|pancreas(1)	4						c.(1081-1083)GTC>GTA		carboxypeptidase N, polypeptide 1 precursor							210.0	180.0	190.0					10																	101814132		2203	4300	6503	SO:0001819	synonymous_variant	1369				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding	g.chr10:101814132G>T	X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.1083C>A	10.37:g.101814132G>T							p.V361V	NM_001308	NP_001299	P15169	CBPN_HUMAN		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)	7	1343	-		Colorectal(252;0.234)	361					B1AP59	Silent	SNP	ENST00000370418.3	37	c.1083C>A	CCDS7486.1																																																																																				0.448	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308		15	73	1	0	1.15088e-07	0.004007	1.41093e-07	15	73				
CFAP58	159686	broad.mit.edu	37	10	106125670	106125670	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:106125670G>T	ENST00000369704.3	+	5	830	c.696G>T	c.(694-696)atG>atT	p.M232I	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		232						extracellular space (GO:0005615)		p.M232I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AGGCAGACATGGACAGCAGGC	0.502																																							uc001kyh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(694-696)ATG>ATT		coiled-coil domain containing 147							71.0	73.0	72.0					10																	106125670		2203	4300	6503	SO:0001583	missense	159686							g.chr10:106125670G>T																												ENST00000369704.3:c.696G>T	10.37:g.106125670G>T	ENSP00000358718:p.Met232Ile						p.M232I	NM_001008723	NP_001008723	Q5T655	CC147_HUMAN		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)	5	830	+		Colorectal(252;0.103)|Breast(234;0.122)	232			Potential.		D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	37	c.696G>T	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.244048	0.22796	.	.	ENSG00000120051	ENST00000369704	T	0.26810	1.71	5.97	5.97	0.96955	.	0.145441	0.85682	D	0.000000	T	0.14098	0.0341	N	0.13098	0.295	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.18903	-1.0322	10	0.15952	T	0.53	-32.5336	10.3492	0.43924	0.0689:0.0:0.7968:0.1344	.	232	Q5T655	CC147_HUMAN	I	232	ENSP00000358718:M232I	ENSP00000358718:M232I	M	+	3	0	CCDC147	106115660	1.000000	0.71417	1.000000	0.80357	0.192000	0.23643	3.296000	0.51802	2.828000	0.97474	0.655000	0.94253	ATG		0.502	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1			7	28	1	0	8.12818e-05	0.001984	9.21194e-05	7	28				
PNLIPRP2	5408	broad.mit.edu	37	10	118383478	118383478	+	RNA	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr10:118383478A>T	ENST00000298771.7	+	0	97				PNLIPRP2_ENST00000433618.4_RNA|PNLIPRP2_ENST00000537242.1_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)	p.Q24H(2)		endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		GCTACGGACAACTTGGCTGCT	0.488																																							uc001lcq.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)	1						c.(73-75)CAA>CAT		pancreatic lipase-related protein 2							92.0	92.0	92.0					10																	118383478		1905	4136	6041			5408				galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity	g.chr10:118383478A>T	M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118383478A>T						PNLIPRP2_uc009xyu.1_RNA|PNLIPRP2_uc009xyv.1_RNA	p.Q25H	NM_005396	NP_005387	P54317	LIPR2_HUMAN		all cancers(201;0.015)	5	98	+			24					A8K627|Q6IB55	Missense_Mutation	SNP	ENST00000298771.7	37	c.75A>T		.	.	.	.	.	.	.	.	.	.	A	10.14	1.267407	0.23136	.	.	ENSG00000165862	ENST00000537242	D	0.90788	-2.73	5.65	-5.85	0.02311	Lipase, N-terminal (1);	1.743620	0.03614	N	0.235259	T	0.79793	0.4507	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.64028	-0.6503	9	0.36615	T	0.2	.	2.1557	0.03811	0.2729:0.3828:0.0955:0.2489	.	24	P54317	LIPR2_HUMAN	H	24	ENSP00000446346:Q24H	ENSP00000446346:Q24H	Q	+	3	2	PNLIPRP2	118373468	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-2.354000	0.01089	-0.472000	0.06881	-0.542000	0.04241	CAA		0.488	PNLIPRP2-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000050546.6	NM_005396		13	41	0	0	0	0.004007	0	13	41				
OR51A7	119687	broad.mit.edu	37	11	4929304	4929304	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:4929304G>T	ENST00000359350.4	+	1	705	c.705G>T	c.(703-705)aaG>aaT	p.K235N	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K235N(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAGGCTTAAGGCCCTAAATA	0.478																																							uc010qyq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(703-705)AAG>AAT		olfactory receptor, family 51, subfamily A,							233.0	205.0	214.0					11																	4929304		2201	4298	6499	SO:0001583	missense	119687				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4929304G>T	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.705G>T	11.37:g.4929304G>T	ENSP00000352305:p.Lys235Asn						p.K235N	NM_001004749	NP_001004749	Q8NH64	O51A7_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	705	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	235			Cytoplasmic (Potential).		Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	37	c.705G>T	CCDS31364.1	.	.	.	.	.	.	.	.	.	.	G	4.399	0.073673	0.08485	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.51071	0.72	5.02	-0.522	0.11928	GPCR, rhodopsin-like superfamily (1);	0.266897	0.26369	N	0.024768	T	0.64260	0.2582	H	0.97051	3.93	0.22961	N	0.998503	B	0.25105	0.118	B	0.39771	0.309	T	0.64491	-0.6395	10	0.87932	D	0	.	7.0374	0.25000	0.4708:0.1167:0.4124:0.0	.	235	Q8NH64	O51A7_HUMAN	N	235;235;224	ENSP00000352305:K235N	ENSP00000352305:K235N	K	+	3	2	OR51A7	4885880	0.003000	0.15002	0.007000	0.13788	0.014000	0.08584	-0.034000	0.12225	-0.546000	0.06216	-1.945000	0.00491	AAG		0.478	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749		35	124	1	0	9.78485e-24	0.013726	1.54021e-23	35	124				
OR52H1	390067	broad.mit.edu	37	11	5565818	5565818	+	Silent	SNP	T	T	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:5565818T>A	ENST00000322653.4	-	1	961	c.936A>T	c.(934-936)atA>atT	p.I312I	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I312I(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAACAAAAGTATAACCTTAT	0.388																																							uc010qzh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(934-936)ATA>ATT		olfactory receptor, family 52, subfamily H,							127.0	123.0	125.0					11																	5565818		2201	4297	6498	SO:0001819	synonymous_variant	390067				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5565818T>A	AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.936A>T	11.37:g.5565818T>A						HBG2_uc001mak.1_Intron	p.I312I	NM_001005289	NP_001005289	Q8NGJ2	O52H1_HUMAN		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	936	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	312			Cytoplasmic (Potential).		B9EH26|Q6IF79	Silent	SNP	ENST00000322653.4	37	c.936A>T	CCDS31386.1																																																																																				0.388	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143400.1	NM_001005289		16	50	0	0	0	0.00499	0	16	50				
NELL1	4745	broad.mit.edu	37	11	21594952	21594952	+	Nonsense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:21594952C>A	ENST00000357134.5	+	19	2531	c.2379C>A	c.(2377-2379)tgC>tgA	p.C793*	NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000298925.5_Nonsense_Mutation_p.C821*|NELL1_ENST00000325319.5_Nonsense_Mutation_p.C736*|NELL1_ENST00000532434.1_Nonsense_Mutation_p.C746*	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	793					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.C793*(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CCTGTAAATGCAAGGTAATTG	0.468																																							uc001mqe.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(2377-2379)TGC>TGA		nel-like 1 isoform 1 precursor							131.0	117.0	122.0					11																	21594952		2203	4300	6503	SO:0001587	stop_gained	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21594952C>A	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2379C>A	11.37:g.21594952C>A	ENSP00000349654:p.Cys793*					NELL1_uc001mqf.2_Nonsense_Mutation_p.C746*|NELL1_uc009yid.2_Nonsense_Mutation_p.C821*|NELL1_uc010rdo.1_Nonsense_Mutation_p.C736*|NELL1_uc010rdp.1_Nonsense_Mutation_p.C506*|NELL1_uc001mqh.2_Nonsense_Mutation_p.C338*	p.C793*	NM_006157	NP_006148	Q92832	NELL1_HUMAN			19	2532	+			793			VWFC 5.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Nonsense_Mutation	SNP	ENST00000357134.5	37	c.2379C>A	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	c	39	7.691941	0.98434	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8351	19.8844	0.96908	0.0:1.0:0.0:0.0	.	.	.	.	X	821;793;736;746	.	ENSP00000298925:C821X	C	+	3	2	NELL1	21551528	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.460000	0.60108	2.704000	0.92352	0.550000	0.68814	TGC		0.468	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		21	78	1	0	2.98393e-07	0.00278	3.60617e-07	21	78				
MUC15	143662	broad.mit.edu	37	11	26582625	26582625	+	Missense_Mutation	SNP	C	C	T	rs560016592		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:26582625C>T	ENST00000455601.2	-	4	1110	c.992G>A	c.(991-993)cGt>cAt	p.R331H	MUC15_ENST00000529533.1_Missense_Mutation_p.R358H|ANO3_ENST00000529242.1_Intron|ANO3_ENST00000531568.1_Intron|ANO3_ENST00000537978.1_Intron|ANO3_ENST00000525139.1_Intron|MUC15_ENST00000527569.1_Missense_Mutation_p.R308H|MUC15_ENST00000281268.8_Missense_Mutation_p.R308H|ANO3_ENST00000256737.3_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.R358H	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	331					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R331H(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						TACAGAAGTACGAAGTGGAGG	0.378																																							uc001mqx.2		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(991-993)CGT>CAT		mucin 15 isoform b							178.0	163.0	168.0					11																	26582625		2203	4300	6503	SO:0001583	missense	143662					extracellular region|integral to membrane|plasma membrane		g.chr11:26582625C>T	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.992G>A	11.37:g.26582625C>T	ENSP00000397339:p.Arg331His					ANO3_uc010rdr.1_Intron|ANO3_uc001mqt.3_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Missense_Mutation_p.R358H|MUC15_uc001mqy.2_Missense_Mutation_p.R308H	p.R331H	NM_145650	NP_663625	Q8N387	MUC15_HUMAN			4	1258	-			331			Cytoplasmic (Potential).		B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	ENST00000455601.2	37	c.992G>A	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997644	0.35226	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.39787	1.11;1.06;1.11;1.06;1.11	5.33	2.29	0.28610	.	0.000000	0.49916	D	0.000136	T	0.36663	0.0975	L	0.32530	0.975	0.09310	N	0.999999	D;P;P	0.69078	0.997;0.917;0.917	P;B;B	0.52598	0.703;0.291;0.291	T	0.15435	-1.0437	10	0.87932	D	0	-10.0199	4.5326	0.12013	0.1475:0.539:0.0:0.3135	.	308;331;358	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	H	331;358;308;358;308	ENSP00000397339:R331H;ENSP00000416753:R358H;ENSP00000281268:R308H;ENSP00000431983:R358H;ENSP00000431945:R308H	ENSP00000281268:R308H	R	-	2	0	MUC15	26539201	0.450000	0.25697	0.686000	0.30086	0.099000	0.18886	0.682000	0.25335	0.755000	0.32990	-0.186000	0.12905	CGT		0.378	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650		8	106	0	0	0	0.00308	0	8	106				
OR5D13	390142	broad.mit.edu	37	11	55541680	55541680	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:55541680C>A	ENST00000361760.1	+	1	767	c.767C>A	c.(766-768)aCt>aAt	p.T256N		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T256N(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				TTCCATGGAACTATCCTTTTC	0.448																																							uc010ril.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(766-768)ACT>AAT		olfactory receptor, family 5, subfamily D,							130.0	107.0	115.0					11																	55541680		2200	4296	6496	SO:0001583	missense	390142				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55541680C>A	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.767C>A	11.37:g.55541680C>A	ENSP00000354800:p.Thr256Asn						p.T256N	NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN			1	767	+		all_epithelial(135;0.196)	256			Helical; Name=6; (Potential).		Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	37	c.767C>A	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.868371	0.32977	.	.	ENSG00000198877	ENST00000361760	T	0.00289	8.28	3.82	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34986	U	0.003535	T	0.00815	0.0027	H	0.95224	3.64	0.09310	N	1	D	0.53151	0.958	D	0.63381	0.914	T	0.15636	-1.0430	10	0.87932	D	0	-14.9769	9.4175	0.38530	0.0:0.8873:0.0:0.1127	.	256	Q8NGL4	OR5DD_HUMAN	N	256	ENSP00000354800:T256N	ENSP00000354800:T256N	T	+	2	0	OR5D13	55298256	0.002000	0.14202	0.444000	0.26895	0.195000	0.23768	1.437000	0.34991	0.722000	0.32252	0.486000	0.48141	ACT		0.448	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967		17	77	1	0	0.000566183	0.00499	0.000630466	17	77				
OR5T3	390154	broad.mit.edu	37	11	56020310	56020310	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:56020310C>A	ENST00000303059.3	+	1	635	c.635C>A	c.(634-636)cCt>cAt	p.P212H		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P212H(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TGTGATATGCCTCCTCTCCTT	0.408																																							uc010rjd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(634-636)CCT>CAT		olfactory receptor, family 5, subfamily T,							267.0	246.0	253.0					11																	56020310		2201	4295	6496	SO:0001583	missense	390154				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56020310C>A	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.635C>A	11.37:g.56020310C>A	ENSP00000305403:p.Pro212His						p.P212H	NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN			1	635	+	Esophageal squamous(21;0.00448)		212			Extracellular (Potential).		Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	37	c.635C>A	CCDS31524.1	.	.	.	.	.	.	.	.	.	.	C	9.523	1.108721	0.20714	.	.	ENSG00000172489	ENST00000303059	T	0.00224	8.51	4.65	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000245	T	0.00524	0.0017	M	0.86178	2.8	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.31194	-0.9952	10	0.87932	D	0	.	9.5025	0.39026	0.0:0.6958:0.0:0.3042	.	212	Q8NGG3	OR5T3_HUMAN	H	212	ENSP00000305403:P212H	ENSP00000305403:P212H	P	+	2	0	OR5T3	55776886	0.000000	0.05858	0.119000	0.21687	0.132000	0.20833	-0.504000	0.06375	0.694000	0.31654	-0.148000	0.13756	CCT		0.408	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747		91	187	1	0	3.60193e-44	0.01441	5.88776e-44	91	187				
OR8K3	219473	broad.mit.edu	37	11	56086612	56086612	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:56086612A>T	ENST00000312711.1	+	1	830	c.830A>T	c.(829-831)tAc>tTc	p.Y277F		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y277F(1)		central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TCCATATTTTACACCCTGGTT	0.393																																							uc010rjf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(829-831)TAC>TTC		olfactory receptor, family 8, subfamily K,							88.0	77.0	80.0					11																	56086612		2201	4296	6497	SO:0001583	missense	219473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56086612A>T	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.830A>T	11.37:g.56086612A>T	ENSP00000323555:p.Tyr277Phe						p.Y277F	NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN			1	830	+	Esophageal squamous(21;0.00448)		277			Helical; Name=7; (Potential).		Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	c.830A>T	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.189447	0.38707	.	.	ENSG00000181689	ENST00000312711	T	0.00305	8.18	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000091	T	0.00666	0.0022	M	0.87038	2.855	0.27232	N	0.959389	P	0.49961	0.93	P	0.60345	0.873	T	0.15150	-1.0447	10	0.72032	D	0.01	.	12.487	0.55879	1.0:0.0:0.0:0.0	.	277	Q8NH51	OR8K3_HUMAN	F	277	ENSP00000323555:Y277F	ENSP00000323555:Y277F	Y	+	2	0	OR8K3	55843188	0.082000	0.21442	0.995000	0.50966	0.032000	0.12392	2.314000	0.43743	1.888000	0.54679	0.386000	0.25728	TAC		0.393	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202		25	53	0	0	0	0.004656	0	25	53				
OR5M8	219484	broad.mit.edu	37	11	56258623	56258623	+	Missense_Mutation	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:56258623T>C	ENST00000327216.2	-	1	248	c.224A>G	c.(223-225)aAt>aGt	p.N75S		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N75S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					TGGAGTCACATTGGAAGAGAA	0.473																																							uc001nix.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(223-225)AAT>AGT		olfactory receptor, family 5, subfamily M,							82.0	79.0	80.0					11																	56258623		2201	4296	6497	SO:0001583	missense	219484				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56258623T>C	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.224A>G	11.37:g.56258623T>C	ENSP00000323354:p.Asn75Ser						p.N75S	NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN			1	224	-	Esophageal squamous(21;0.00352)		75			Extracellular (Potential).		B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	ENST00000327216.2	37	c.224A>G	CCDS31533.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.463756	0.00171	.	.	ENSG00000181371	ENST00000327216	T	0.00428	7.44	4.13	-0.09	0.13667	GPCR, rhodopsin-like superfamily (1);	0.227183	0.21976	N	0.066380	T	0.00178	0.0005	N	0.13299	0.325	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.38415	-0.9662	10	0.15066	T	0.55	-12.3385	0.8136	0.01098	0.3298:0.1016:0.1694:0.3992	.	75	Q8NGP6	OR5M8_HUMAN	S	75	ENSP00000323354:N75S	ENSP00000323354:N75S	N	-	2	0	OR5M8	56015199	0.000000	0.05858	0.004000	0.12327	0.005000	0.04900	-0.538000	0.06120	0.117000	0.18138	0.440000	0.28878	AAT		0.473	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282		32	59	0	0	0	0.009535	0	32	59				
OR5A1	219982	broad.mit.edu	37	11	59211538	59211538	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:59211538G>T	ENST00000302030.2	+	1	922	c.897G>T	c.(895-897)gaG>gaT	p.E299D		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E299D(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						GGAACAAAGAGATCAAGGATG	0.433																																							uc001nnx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(895-897)GAG>GAT		olfactory receptor, family 5, subfamily A,							173.0	169.0	170.0					11																	59211538		2201	4295	6496	SO:0001583	missense	219982				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59211538G>T	AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.897G>T	11.37:g.59211538G>T	ENSP00000303096:p.Glu299Asp						p.E299D	NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN			1	897	+			299			Cytoplasmic (Potential).		B9EH58|Q6IFF2|Q96RB1	Missense_Mutation	SNP	ENST00000302030.2	37	c.897G>T	CCDS31561.1	.	.	.	.	.	.	.	.	.	.	G	8.268	0.812783	0.16537	.	.	ENSG00000172320	ENST00000302030	T	0.37411	1.2	5.86	-1.33	0.09172	.	0.234008	0.29572	N	0.011761	T	0.15046	0.0363	N	0.24115	0.695	0.33098	D	0.538808	B	0.18461	0.028	B	0.16289	0.015	T	0.25047	-1.0143	10	0.08381	T	0.77	-13.2621	3.2179	0.06705	0.3326:0.1074:0.4509:0.1092	.	299	Q8NGJ0	OR5A1_HUMAN	D	299	ENSP00000303096:E299D	ENSP00000303096:E299D	E	+	3	2	OR5A1	58968114	0.409000	0.25368	0.995000	0.50966	0.784000	0.44337	-0.322000	0.08007	-0.114000	0.11936	-0.182000	0.12963	GAG		0.433	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728		61	124	1	0	1.79293e-35	0.01441	2.91209e-35	61	124				
KCTD14	65987	broad.mit.edu	37	11	77728273	77728273	+	Missense_Mutation	SNP	G	G	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:77728273G>C	ENST00000353172.5	-	2	178	c.134C>G	c.(133-135)aCc>aGc	p.T45S	NDUFC2-KCTD14_ENST00000528251.1_3'UTR|NDUFC2-KCTD14_ENST00000530054.1_3'UTR|RP11-7I15.3_ENST00000533697.1_RNA|KCTD14_ENST00000533144.1_Missense_Mutation_p.T15S	NM_001203260.1|NM_001203262.1|NM_001282406.1|NM_023930.3	NP_001190189.1|NP_001190191.1|NP_001269335.1|NP_076419.2	Q9BQ13	KCD14_HUMAN	potassium channel tetramerization domain containing 14	45	BTB.				protein homooligomerization (GO:0051260)			p.T45S(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	15	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			CAGGGTGGTGGTGTGGAACTC	0.582																																					NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)	NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)	uc001oyw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(133-135)ACC>AGC		potassium channel tetramerisation domain							61.0	58.0	59.0					11																	77728273		2200	4292	6492	SO:0001583	missense	65987					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr11:77728273G>C	BC001062	CCDS8255.2, CCDS60908.1	11q13.4	2013-06-20	2013-06-20		ENSG00000151364	ENSG00000151364			23295	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 14"""			12477932	Standard	NM_023930		Approved	MGC2376	uc001oyw.4	Q9BQ13	OTTHUMG00000150224	ENST00000353172.5:c.134C>G	11.37:g.77728273G>C	ENSP00000316482:p.Thr45Ser						p.T45S	NM_023930	NP_076419	Q9BQ13	KCD14_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;1e-24)		2	159	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		45			BTB.		B2R9R8	Missense_Mutation	SNP	ENST00000353172.5	37	c.134C>G	CCDS8255.2	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228431	0.58777	.	.	ENSG00000151364	ENST00000353172;ENST00000533144	T;T	0.75589	-0.95;-0.95	4.89	3.99	0.46301	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.108055	0.64402	D	0.000009	T	0.71736	0.3375	L	0.41079	1.255	0.80722	D	1	P	0.48089	0.905	P	0.49752	0.621	T	0.70684	-0.4804	10	0.38643	T	0.18	.	12.2362	0.54516	0.0814:0.0:0.9186:0.0	.	45	Q9BQ13	KCD14_HUMAN	S	45;15	ENSP00000316482:T45S;ENSP00000431155:T15S	ENSP00000316482:T45S	T	-	2	0	KCTD14	77405921	1.000000	0.71417	0.719000	0.30619	0.911000	0.54048	2.080000	0.41586	1.280000	0.44463	0.561000	0.74099	ACC		0.582	KCTD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316888.1	NM_023930		20	34	0	0	0	0.010504	0	20	34				
GRM5	2915	broad.mit.edu	37	11	88780748	88780748	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:88780748G>T	ENST00000305447.4	-	1	442	c.293C>A	c.(292-294)tCc>tAc	p.S98Y	GRM5_ENST00000455756.2_Missense_Mutation_p.S98Y|GRM5_ENST00000305432.5_Missense_Mutation_p.S98Y|GRM5_ENST00000393297.1_Missense_Mutation_p.S98Y|GRM5_ENST00000418177.2_Missense_Mutation_p.S98Y|GRM5_ENST00000393294.3_Missense_Mutation_p.S98Y	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	98					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.S98Y(2)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ATGCCAGCAGGAGTCCCTTAT	0.517																																							uc001pcq.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(292-294)TCC>TAC		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						94.0	80.0	85.0					11																	88780748		2201	4299	6500	SO:0001583	missense	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88780748G>T	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.293C>A	11.37:g.88780748G>T	ENSP00000306138:p.Ser98Tyr					GRM5_uc009yvm.2_Missense_Mutation_p.S98Y|GRM5_uc009yvn.1_Missense_Mutation_p.S98Y	p.S98Y	NM_001143831	NP_001137303	P41594	GRM5_HUMAN			1	493	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	98			Extracellular (Potential).		Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	c.293C>A	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156361	0.78114	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297;ENST00000393294	T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.38	5.38	0.77491	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.82176	0.4980	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.82006	-0.0671	9	.	.	.	.	19.1332	0.93415	0.0:0.0:1.0:0.0	.	98;98;98	A8MT20;P41594-2;P41594	.;.;GRM5_HUMAN	Y	98	ENSP00000402912:S98Y;ENSP00000405690:S98Y;ENSP00000305905:S98Y;ENSP00000306138:S98Y;ENSP00000376975:S98Y;ENSP00000376972:S98Y	.	S	-	2	0	GRM5	88420396	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.832000	0.86757	2.502000	0.84385	0.563000	0.77884	TCC		0.517	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		18	20	1	0	1.33834e-09	0.007413	1.73236e-09	18	20				
AMOTL1	154810	broad.mit.edu	37	11	94532826	94532826	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:94532826G>A	ENST00000433060.2	+	3	611	c.470G>A	c.(469-471)cGc>cAc	p.R157H	AMOTL1_ENST00000317837.9_Missense_Mutation_p.R157H|AMOTL1_ENST00000317829.8_Missense_Mutation_p.R107H	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	157					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)	p.R157H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CAGTCAGCACGCCAAGAACCG	0.547																																							uc001pfb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(469-471)CGC>CAC		angiomotin like 1							70.0	75.0	73.0					11																	94532826		2129	4246	6375	SO:0001583	missense	154810					cytoplasm|tight junction	identical protein binding	g.chr11:94532826G>A	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.470G>A	11.37:g.94532826G>A	ENSP00000387739:p.Arg157His					AMOTL1_uc001pfc.2_Missense_Mutation_p.R107H	p.R157H	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN			3	640	+		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)	157					Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	c.470G>A	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079916	0.76528	.	.	ENSG00000166025	ENST00000317829;ENST00000542840;ENST00000317837;ENST00000433060	T;T;T	0.07800	3.16;3.16;3.16	5.04	5.04	0.67666	.	0.088725	0.44285	D	0.000478	T	0.30386	0.0763	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.973;0.992	T	0.01925	-1.1246	9	.	.	.	-12.1894	18.3622	0.90379	0.0:0.0:1.0:0.0	.	107;157	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	H	107;163;157;157	ENSP00000320968:R107H;ENSP00000323474:R157H;ENSP00000387739:R157H	.	R	+	2	0	AMOTL1	94172474	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.184000	0.94893	2.339000	0.79563	0.555000	0.69702	CGC		0.547	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847		5	18	0	0	0	0.000602	0	5	18				
LAYN	143903	broad.mit.edu	37	11	111425981	111425981	+	Missense_Mutation	SNP	A	A	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:111425981A>C	ENST00000375615.3	+	6	833	c.648A>C	c.(646-648)gaA>gaC	p.E216D	LAYN_ENST00000436913.2_Missense_Mutation_p.E63D|LAYN_ENST00000525126.1_Missense_Mutation_p.E216D|LAYN_ENST00000533265.1_Missense_Mutation_p.E208D|LAYN_ENST00000375614.2_Missense_Mutation_p.E208D|LAYN_ENST00000528924.1_3'UTR	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	216						cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.E208D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	AAACACAGGAAGAAGATGCCA	0.403																																					Ovarian(17;551 586 12136 22082 22900)	Ovarian(17;551 586 12136 22082 22900)	uc001plr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(646-648)GAA>GAC		layilin							79.0	75.0	77.0					11																	111425981		2201	4297	6498	SO:0001583	missense	143903					cell surface|integral to membrane|ruffle	hyaluronic acid binding|sugar binding	g.chr11:111425981A>C		CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.648A>C	11.37:g.111425981A>C	ENSP00000364765:p.Glu216Asp					LAYN_uc001plp.1_Missense_Mutation_p.E208D|LAYN_uc001plq.1_Missense_Mutation_p.E216D|LAYN_uc001pls.1_Missense_Mutation_p.E208D|LAYN_uc010rwg.1_Missense_Mutation_p.E63D|LAYN_uc010rwh.1_Missense_Mutation_p.E64D	p.E216D	NM_178834	NP_849156	Q6UX15	LAYN_HUMAN		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	6	984	+		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)	216			Extracellular (Potential).		A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	ENST00000375615.3	37	c.648A>C	CCDS58178.1	.	.	.	.	.	.	.	.	.	.	A	14.32	2.500827	0.44455	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000525126;ENST00000436913;ENST00000533265;ENST00000541011;ENST00000530962	T;T;T;T	0.06142	3.89;3.48;3.34;4.04	4.99	2.67	0.31697	.	0.643331	0.16002	N	0.234272	T	0.04182	0.0116	N	0.19112	0.55	0.22446	N	0.999092	B;B;B;B;B	0.31769	0.187;0.339;0.094;0.339;0.152	B;B;B;B;B	0.29716	0.106;0.076;0.037;0.076;0.08	T	0.45396	-0.9264	9	.	.	.	-3.0222	8.6224	0.33868	0.7551:0.0:0.2449:0.0	.	63;208;216;216;208	B4DJU0;E9PMI0;Q6UX15;E9PQU7;Q6UX15-2	.;.;LAYN_HUMAN;.;.	D	208;216;216;63;208;171;64	ENSP00000364764:E208D;ENSP00000364765:E216D;ENSP00000434328:E216D;ENSP00000434972:E208D	.	E	+	3	2	LAYN	110931191	1.000000	0.71417	0.914000	0.36105	0.958000	0.62258	1.378000	0.34328	0.131000	0.18576	-1.139000	0.01908	GAA		0.403	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391187.1	NM_178834		6	58	0	0	0	0.00308	0	6	58				
HYOU1	10525	broad.mit.edu	37	11	118922237	118922237	+	Missense_Mutation	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:118922237T>C	ENST00000404233.3	-	13	1563	c.1439A>G	c.(1438-1440)aAa>aGa	p.K480R	HYOU1_ENST00000543287.1_Missense_Mutation_p.K393R|HYOU1_ENST00000525859.1_Missense_Mutation_p.K480R|HYOU1_ENST00000529972.1_Missense_Mutation_p.K480R	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	480					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.K480R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		GGTGATGACTTTGCGTTGAGG	0.562																																							uc001puu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1438-1440)AAA>AGA		hypoxia up-regulated 1 precursor							220.0	181.0	194.0					11																	118922237		2200	4295	6495	SO:0001583	missense	10525					endoplasmic reticulum lumen	ATP binding|protein binding	g.chr11:118922237T>C	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.1439A>G	11.37:g.118922237T>C	ENSP00000384144:p.Lys480Arg					HYOU1_uc001put.2_Missense_Mutation_p.K445R|HYOU1_uc010ryu.1_Missense_Mutation_p.K500R|HYOU1_uc010ryv.1_Missense_Mutation_p.K369R|HYOU1_uc001pux.3_Missense_Mutation_p.K480R|HYOU1_uc010ryw.1_RNA|HYOU1_uc001puw.1_Missense_Mutation_p.K480R	p.K480R	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)	13	1632	-	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)	480					A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	37	c.1439A>G	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.000295	0.93227	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.01099	5.34;5.34;5.34;5.34;5.34	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.06188	0.0160	M	0.66378	2.025	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.986;0.999;0.986;0.986	T	0.12785	-1.0534	10	0.62326	D	0.03	-20.938	15.3401	0.74290	0.0:0.0:0.0:1.0	.	471;524;480;480	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	R	480;471;480;480;329;480;523;393;480	ENSP00000384144:K480R;ENSP00000437313:K480R;ENSP00000433397:K480R;ENSP00000442727:K393R;ENSP00000431874:K480R	ENSP00000278752:K471R	K	-	2	0	HYOU1	118427447	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.525000	0.81892	2.208000	0.71279	0.533000	0.62120	AAA		0.562	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389		21	49	0	0	0	0.010504	0	21	49				
GRIK4	2900	broad.mit.edu	37	11	120690598	120690598	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr11:120690598C>T	ENST00000527524.2	+	6	767	c.480C>T	c.(478-480)acC>acT	p.T160T	GRIK4_ENST00000438375.2_Silent_p.T160T	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	160					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.T160T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TCAACTGCACCACCGCCTGCC	0.537																																							uc001pxn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(478-480)ACC>ACT		glutamate receptor KA1 precursor	L-Glutamic Acid(DB00142)						169.0	159.0	162.0					11																	120690598		2203	4299	6502	SO:0001819	synonymous_variant	2900				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr11:120690598C>T	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.480C>T	11.37:g.120690598C>T						GRIK4_uc009zav.1_Silent_p.T160T|GRIK4_uc009zaw.1_Silent_p.T160T|GRIK4_uc009zax.1_Silent_p.T160T	p.T160T	NM_014619	NP_055434	Q16099	GRIK4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	6	767	+		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)	160			Extracellular (Potential).		A8K9L1	Silent	SNP	ENST00000527524.2	37	c.480C>T	CCDS8433.1																																																																																				0.537	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619		8	198	0	0	0	0.008291	0	8	198				
SLC6A13	6540	broad.mit.edu	37	12	330154	330154	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:330154G>T	ENST00000343164.4	-	15	1821	c.1769C>A	c.(1768-1770)aCc>aAc	p.T590N	SLC6A13_ENST00000539668.1_5'Flank|SLC6A13_ENST00000445055.2_Missense_Mutation_p.T498N	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	590					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.T590N(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GAGCAGTGAGGTCCTGGGGGT	0.657																																							uc001qic.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1768-1770)ACC>AAC		solute carrier family 6 (neurotransmitter							57.0	52.0	53.0					12																	330154		2203	4300	6503	SO:0001583	missense	6540				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr12:330154G>T	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1769C>A	12.37:g.330154G>T	ENSP00000339260:p.Thr590Asn					SLC6A13_uc009zdj.1_Missense_Mutation_p.T580N|SLC6A13_uc010sdl.1_Missense_Mutation_p.T498N	p.T590N	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)		15	1822	-	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		590			Cytoplasmic (Potential).		B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	c.1769C>A	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	G	8.500	0.863988	0.17250	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	T;T	0.73897	-0.76;-0.79	4.15	4.15	0.48705	.	2585.220000	0.00633	U	0.000488	T	0.61311	0.2337	N	0.08118	0	0.09310	N	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.44034	-0.9354	10	0.17832	T	0.49	.	14.7887	0.69824	0.0:0.0:1.0:0.0	.	498;569;590	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	N	498;569;590	ENSP00000407104:T498N;ENSP00000339260:T590N	ENSP00000318097:T569N	T	-	2	0	SLC6A13	200415	0.735000	0.28153	0.372000	0.25991	0.294000	0.27393	2.685000	0.46959	2.159000	0.67721	0.448000	0.29417	ACC		0.657	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615		6	26	1	0	0.00116845	0.001168	0.00128428	6	26				
C12orf5	57103	broad.mit.edu	37	12	4459026	4459026	+	Missense_Mutation	SNP	T	T	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:4459026T>G	ENST00000179259.4	+	4	301	c.234T>G	c.(232-234)gaT>gaG	p.D78E	C12orf5_ENST00000537251.1_3'UTR	NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5	78					intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.D78E(1)		endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			TTTGCAAAGATATGACGGTAA	0.353																																					Colon(1;100 192 35375 49454 52532)	Colon(1;100 192 35375 49454 52532)	uc001qmp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(232-234)GAT>GAG		TP53-induced glycolysis and apoptosis regulator							98.0	101.0	100.0					12																	4459026		2203	4300	6503	SO:0001583	missense	57103					intracellular	fructose-2,6-bisphosphate 2-phosphatase activity	g.chr12:4459026T>G	AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.234T>G	12.37:g.4459026T>G	ENSP00000179259:p.Asp78Glu						p.D78E	NM_020375	NP_065108	Q9NQ88	TIGAR_HUMAN	all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)		4	313	+			78					B2R840	Missense_Mutation	SNP	ENST00000179259.4	37	c.234T>G	CCDS8525.1	.	.	.	.	.	.	.	.	.	.	T	9.594	1.126792	0.20959	.	.	ENSG00000078237	ENST00000179259	D	0.88124	-2.34	4.58	-2.44	0.06502	Histidine phosphatase superfamily, clade-1 (2);	0.354081	0.31660	N	0.007263	T	0.70500	0.3231	N	0.21142	0.635	0.21184	N	0.999761	B	0.23058	0.079	B	0.23419	0.046	T	0.55673	-0.8104	10	0.22109	T	0.4	-19.3443	3.7142	0.08431	0.126:0.4698:0.1281:0.2761	.	78	Q9NQ88	TIGAR_HUMAN	E	78	ENSP00000179259:D78E	ENSP00000179259:D78E	D	+	3	2	C12orf5	4329287	0.588000	0.26799	0.724000	0.30704	0.487000	0.33371	0.119000	0.15626	-0.170000	0.10816	0.533000	0.62120	GAT		0.353	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398290.1	NM_020375		12	89	0	0	0	0.00245	0	12	89				
C12orf5	57103	broad.mit.edu	37	12	4459029	4459029	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:4459029G>T	ENST00000179259.4	+	4	304	c.237G>T	c.(235-237)atG>atT	p.M79I	C12orf5_ENST00000537251.1_3'UTR	NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5	79					intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.M79I(1)		endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			GCAAAGATATGACGGTAAAGT	0.348																																					Colon(1;100 192 35375 49454 52532)	Colon(1;100 192 35375 49454 52532)	uc001qmp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(235-237)ATG>ATT		TP53-induced glycolysis and apoptosis regulator							98.0	101.0	100.0					12																	4459029		2203	4300	6503	SO:0001583	missense	57103					intracellular	fructose-2,6-bisphosphate 2-phosphatase activity	g.chr12:4459029G>T	AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.237G>T	12.37:g.4459029G>T	ENSP00000179259:p.Met79Ile						p.M79I	NM_020375	NP_065108	Q9NQ88	TIGAR_HUMAN	all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)		4	316	+			79					B2R840	Missense_Mutation	SNP	ENST00000179259.4	37	c.237G>T	CCDS8525.1	.	.	.	.	.	.	.	.	.	.	G	2.325	-0.354714	0.05138	.	.	ENSG00000078237	ENST00000179259	T	0.69040	-0.37	4.58	2.71	0.32032	Histidine phosphatase superfamily, clade-1 (2);	0.685331	0.15429	N	0.262823	T	0.28632	0.0709	N	0.00783	-1.19	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.23511	-1.0186	10	0.13853	T	0.58	-7.0264	5.303	0.15788	0.2288:0.0:0.6191:0.1521	.	79	Q9NQ88	TIGAR_HUMAN	I	79	ENSP00000179259:M79I	ENSP00000179259:M79I	M	+	3	0	C12orf5	4329290	0.998000	0.40836	0.901000	0.35422	0.386000	0.30323	1.017000	0.29989	1.249000	0.43950	0.655000	0.94253	ATG		0.348	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398290.1	NM_020375		11	87	1	0	4.36969e-10	0.001855	5.77343e-10	11	87				
ALG10B	144245	broad.mit.edu	37	12	38714267	38714267	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:38714267G>T	ENST00000308742.4	+	3	990	c.674G>T	c.(673-675)gGa>gTa	p.G225V	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	225					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.G225V(1)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				CCTATTAAAGGACCATTTGCA	0.393																																							uc001rln.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(673-675)GGA>GTA		asparagine-linked glycosylation 10 homolog B							85.0	91.0	89.0					12																	38714267		2200	4294	6494	SO:0001583	missense	144245				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:38714267G>T	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.674G>T	12.37:g.38714267G>T	ENSP00000310120:p.Gly225Val					ALG10B_uc001rlo.3_Missense_Mutation_p.G195V|ALG10B_uc010skk.1_Missense_Mutation_p.G165V	p.G225V	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN			3	813	+	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)	225			Cytoplasmic (Potential).		B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	c.674G>T	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	N	2.494	-0.316750	0.05386	.	.	ENSG00000175548	ENST00000308742	T	0.30182	1.54	3.09	3.09	0.35607	.	0.242267	0.41294	D	0.000913	T	0.31482	0.0798	M	0.76328	2.33	0.80722	D	1	P	0.39352	0.669	B	0.38106	0.265	T	0.13656	-1.0501	10	0.15952	T	0.53	.	12.4259	0.55546	0.0:0.0:1.0:0.0	.	225	Q5I7T1	AG10B_HUMAN	V	225	ENSP00000310120:G225V	ENSP00000310120:G225V	G	+	2	0	ALG10B	37000534	1.000000	0.71417	0.268000	0.24571	0.099000	0.18886	2.754000	0.47532	2.033000	0.60031	0.549000	0.68633	GGA		0.393	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620		21	111	1	0	3.65163e-15	0.00632	5.29071e-15	21	111				
ARID2	196528	broad.mit.edu	37	12	46243560	46243560	+	Splice_Site	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:46243560G>T	ENST00000334344.6	+	14	2084		c.e14+1		ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000479608.1_Splice_Site|ARID2_ENST00000444670.1_Splice_Site|ARID2_ENST00000422737.1_Splice_Site	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.?(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCACCTGCAGGTGTTAATTTT	0.313			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					1	Unknown(1)		lung(1)	ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.e14+1		AT rich interactive domain 2 (ARID, RFX-like)							194.0	182.0	186.0					12																	46243560		2203	4300	6503	SO:0001630	splice_region_variant	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46243560G>T		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1912+1G>T	12.37:g.46243560G>T						ARID2_uc001ror.2_Splice_Site_p.G638_splice|ARID2_uc009zkg.1_Splice_Site_p.G94_splice|ARID2_uc009zkh.1_Splice_Site_p.G265_splice|ARID2_uc001rou.1_5'Flank	p.G638_splice	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	14	1912	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)						Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Splice_Site	SNP	ENST00000334344.6	37	c.1912_splice	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124438	0.56613	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0617	0.71961	0.0:0.0:0.8582:0.1418	.	.	.	.	.	-1	.	.	.	+	.	.	ARID2	44529827	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.966000	0.70395	2.793000	0.96121	0.655000	0.94253	.		0.313	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	Intron	14	128	1	0	9.31168e-06	0.001855	1.08424e-05	14	128				
KRT75	9119	broad.mit.edu	37	12	52825359	52825359	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:52825359C>T	ENST00000252245.5	-	4	1058	c.838G>A	c.(838-840)Gag>Aag	p.E280K		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	280	Coil 1B.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E280K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		AAGTTGATCTCCTCGGGCAGA	0.483																																							uc001saj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(838-840)GAG>AAG		keratin 75							178.0	152.0	161.0					12																	52825359		2203	4300	6503	SO:0001583	missense	9119					keratin filament	structural molecule activity	g.chr12:52825359C>T	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.838G>A	12.37:g.52825359C>T	ENSP00000252245:p.Glu280Lys						p.E280K	NM_004693	NP_004684	O95678	K2C75_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.192)	4	860	-			280			Coil 1B.|Rod.		B4DQU4|Q9NSA9	Missense_Mutation	SNP	ENST00000252245.5	37	c.838G>A	CCDS8827.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452850	0.63290	.	.	ENSG00000170454	ENST00000252245	D	0.93019	-3.15	6.07	5.18	0.71444	Filament (1);	0.113159	0.38605	N	0.001622	D	0.97663	0.9234	H	0.96691	3.865	0.37886	D	0.930542	D	0.63046	0.992	D	0.67900	0.954	D	0.99938	1.1382	10	0.87932	D	0	.	13.6698	0.62418	0.0:0.601:0.399:0.0	.	280	O95678	K2C75_HUMAN	K	280	ENSP00000252245:E280K	ENSP00000252245:E280K	E	-	1	0	KRT75	51111626	0.939000	0.31865	0.835000	0.33067	0.108000	0.19459	1.996000	0.40776	1.579000	0.49836	0.655000	0.94253	GAG		0.483	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693		4	55	0	0	0	0.001168	0	4	55				
KRT1	3848	broad.mit.edu	37	12	53072009	53072009	+	Splice_Site	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:53072009T>C	ENST00000252244.3	-	3	865		c.e3-2			NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1						complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						TCCTCATACCTGCAGGAAAGC	0.403																																							uc001sau.1		NA																	1	Unknown(1)		lung(1)	ovary(1)|skin(1)	2						c.e3-1		keratin 1							111.0	90.0	97.0					12																	53072009		2203	4300	6503	SO:0001630	splice_region_variant	3848				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding	g.chr12:53072009T>C	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.807-2A>G	12.37:g.53072009T>C						KRT1_uc001sav.1_Splice_Site_p.K269_splice	p.K269_splice	NM_006121	NP_006112	P04264	K2C1_HUMAN			3	866	-								B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Splice_Site	SNP	ENST00000252244.3	37	c.807_splice	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	T	14.37	2.515983	0.44763	.	.	ENSG00000167768	ENST00000252244	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3165	0.74085	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT1	51358276	1.000000	0.71417	0.969000	0.41365	0.398000	0.30690	8.037000	0.88933	2.084000	0.62774	0.533000	0.62120	.		0.403	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	Intron	9	25	0	0	0	0.006214	0	9	25				
LRIG3	121227	broad.mit.edu	37	12	59272706	59272706	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:59272706G>T	ENST00000320743.3	-	14	2269	c.1983C>A	c.(1981-1983)ttC>ttA	p.F661L	LRIG3_ENST00000379141.4_Missense_Mutation_p.F601L	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	661	Ig-like C2-type 2.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F661L(1)	LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			CCACGATAAAGAACACGTCAT	0.542			T	ROS1	NSCLC																																		uc001sqr.2		NA		Dom	yes		12	12q14.1	121227		leucine-rich repeats and immunoglobulin-like domains 3			E					1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(1981-1983)TTC>TTA		leucine-rich repeats and immunoglobulin-like							168.0	127.0	141.0					12																	59272706		2203	4300	6503	SO:0001583	missense	121227					integral to membrane		g.chr12:59272706G>T	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1983C>A	12.37:g.59272706G>T	ENSP00000326759:p.Phe661Leu					LRIG3_uc009zqh.2_Missense_Mutation_p.F601L|LRIG3_uc010ssh.1_RNA	p.F661L	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	GBM - Glioblastoma multiforme(1;1.17e-18)		14	2229	-			661			Ig-like C2-type 2.		Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	37	c.1983C>A	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243006	0.79912	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.11821	2.74;2.74	5.5	5.5	0.81552	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38837	N	0.001544	T	0.05181	0.0138	N	0.00017	-2.84	0.58432	D	0.999999	P;D	0.76494	0.668;0.999	B;D	0.81914	0.389;0.995	T	0.62987	-0.6737	9	.	.	.	.	12.7121	0.57096	0.0752:0.0:0.9248:0.0	.	601;661	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	L	601;661	ENSP00000368436:F601L;ENSP00000326759:F661L	.	F	-	3	2	LRIG3	57558973	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.023000	0.49666	2.585000	0.87301	0.462000	0.41574	TTC		0.542	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377		9	79	1	0	0.00448238	0.004482	0.00482282	9	79				
NAV3	89795	broad.mit.edu	37	12	78582552	78582552	+	Missense_Mutation	SNP	T	T	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:78582552T>A	ENST00000397909.2	+	33	6223	c.6050T>A	c.(6049-6051)cTc>cAc	p.L2017H	NAV3_ENST00000228327.6_Missense_Mutation_p.L1995H|NAV3_ENST00000552300.1_Intron|NAV3_ENST00000266692.7_Missense_Mutation_p.L1818H|NAV3_ENST00000536525.2_Missense_Mutation_p.L1995H			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2017						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.L1995H(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACTGTGAACCTCAAAGGTAAA	0.378										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(6049-6051)CTC>CAC		neuron navigator 3							83.0	77.0	79.0					12																	78582552		1865	4100	5965	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78582552T>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6050T>A	12.37:g.78582552T>A	ENSP00000381007:p.Leu2017His	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.L1995H|NAV3_uc010sub.1_Missense_Mutation_p.L1474H|NAV3_uc009zsf.2_Missense_Mutation_p.L826H	p.L2017H	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			33	6223	+			2017					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.6050T>A		.	.	.	.	.	.	.	.	.	.	T	25.2	4.612939	0.87258	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	T;T;T;T;T	0.52526	0.75;0.75;0.75;0.66;1.45	5.95	5.95	0.96441	.	0.000000	0.32671	U	0.005798	T	0.70552	0.3237	M	0.77486	2.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.986;0.998;0.994;0.999	T	0.74417	-0.3672	10	0.87932	D	0	-8.7125	16.4288	0.83833	0.0:0.0:0.0:1.0	.	1995;1818;2017;1995	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.;.;NAV3_HUMAN;.	H	1995;2017;1995;1818;609;617	ENSP00000446132:L1995H;ENSP00000381007:L2017H;ENSP00000228327:L1995H;ENSP00000266692:L1818H;ENSP00000448303:L617H	ENSP00000228327:L1995H	L	+	2	0	NAV3	77106683	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.975000	0.88055	2.282000	0.76494	0.533000	0.62120	CTC		0.378	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		16	44	0	0	0	0.003163	0	16	44				
LUM	4060	broad.mit.edu	37	12	91502379	91502379	+	Missense_Mutation	SNP	G	G	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:91502379G>C	ENST00000266718.4	-	2	832	c.378C>G	c.(376-378)aaC>aaG	p.N126K	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	126					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.N126K(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						CTGTCAGGTTGTTGTGGTTTA	0.418																																							uc001tbm.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(376-378)AAC>AAG		lumican precursor							100.0	103.0	102.0					12																	91502379		2203	4300	6503	SO:0001583	missense	4060				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent	g.chr12:91502379G>C	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.378C>G	12.37:g.91502379G>C	ENSP00000266718:p.Asn126Lys					LUM_uc001tbn.2_Intron	p.N126K	NM_002345	NP_002336	P51884	LUM_HUMAN			2	767	-			126			LRR 3.		B2R6R5|Q96QM7	Missense_Mutation	SNP	ENST00000266718.4	37	c.378C>G	CCDS9038.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944032	0.73672	.	.	ENSG00000139329	ENST00000266718	T	0.72835	-0.69	5.6	3.74	0.42951	.	0.000000	0.85682	D	0.000000	D	0.88310	0.6402	H	0.96633	3.855	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.91005	0.4845	10	0.87932	D	0	-10.3697	12.707	0.57065	0.1196:0.0:0.8804:0.0	.	126	P51884	LUM_HUMAN	K	126	ENSP00000266718:N126K	ENSP00000266718:N126K	N	-	3	2	LUM	90026510	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.435000	0.66532	2.648000	0.89879	0.557000	0.71058	AAC		0.418	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345		20	74	0	0	0	0.010504	0	20	74				
TBX5	6910	broad.mit.edu	37	12	114837318	114837318	+	Splice_Site	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr12:114837318C>T	ENST00000310346.4	-	4	1028	c.362G>A	c.(361-363)tGg>tAg	p.W121*	TBX5_ENST00000405440.2_Splice_Site_p.W121*|TBX5_ENST00000526441.1_Splice_Site_p.W121*|TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000349716.5_Splice_Site_p.W71*	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	121					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.W121*(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CAGTGCCTACCATTTATTATC	0.423																																					NSCLC(152;1358 1980 4050 23898 40356)	NSCLC(152;1358 1980 4050 23898 40356)	uc001tvo.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(6)|pancreas(1)|skin(1)	8						c.(361-363)TGG>TAG		T-box 5 isoform 1							149.0	152.0	151.0					12																	114837318		2203	4300	6503	SO:0001630	splice_region_variant	6910				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr12:114837318C>T	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.362+1G>A	12.37:g.114837318C>T						TBX5_uc001tvp.2_Nonsense_Mutation_p.W121*|TBX5_uc001tvq.2_Nonsense_Mutation_p.W71*|TBX5_uc010syv.1_Nonsense_Mutation_p.W121*	p.W121*	NM_181486	NP_852259	Q99593	TBX5_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0893)	4	857	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		121			T-box.		A6ND77|O15301|Q96TB0|Q9Y4I2	Nonsense_Mutation	SNP	ENST00000310346.4	37	c.362G>A	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	C	42	9.455137	0.99175	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	.	.	.	4.74	4.74	0.60224	.	0.064907	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2817	0.90101	0.0:1.0:0.0:0.0	.	.	.	.	X	71;121;18;121;121	.	.	W	-	2	0	TBX5	113321701	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.278000	0.78587	2.619000	0.88677	0.561000	0.74099	TGG		0.423	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	Nonsense_Mutation	21	123	0	0	0	0.00333	0	21	123				
HSPH1	10808	broad.mit.edu	37	13	31719733	31719733	+	Silent	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr13:31719733C>A	ENST00000320027.5	-	11	1895	c.1551G>T	c.(1549-1551)ctG>ctT	p.L517L	HSPH1_ENST00000429785.2_Silent_p.L336L|HSPH1_ENST00000380405.4_Silent_p.L517L|HSPH1_ENST00000445273.2_Silent_p.L519L|HSPH1_ENST00000380406.5_Silent_p.L476L	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	517					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.L517L(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		GTCTCTGATTCAGACACTCCA	0.423																																							uc001utj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1549-1551)CTG>CTT		heat shock 105kD							128.0	117.0	121.0					13																	31719733		2203	4300	6503	SO:0001819	synonymous_variant	10808				positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding	g.chr13:31719733C>A	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.1551G>T	13.37:g.31719733C>A						HSPH1_uc001utk.2_Silent_p.L517L|HSPH1_uc010aaw.2_Silent_p.L476L|HSPH1_uc001utl.2_Silent_p.L519L|HSPH1_uc010tds.1_Silent_p.L441L	p.L517L	NM_006644	NP_006635	Q92598	HS105_HUMAN		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)	11	1949	-		Lung SC(185;0.0257)	517					B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Silent	SNP	ENST00000320027.5	37	c.1551G>T	CCDS9340.1																																																																																				0.423	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1			6	42	1	0	0.00116845	0.001168	0.00128428	6	42				
KL	9365	broad.mit.edu	37	13	33634951	33634951	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr13:33634951C>A	ENST00000380099.3	+	4	1743	c.1735C>A	c.(1735-1737)Cag>Aag	p.Q579K	KL_ENST00000426690.2_3'UTR|KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	579	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.Q579K(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		TGCTGCCATCCAGCCCCAGAT	0.498																																							uc001uus.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(1735-1737)CAG>AAG		klotho precursor							168.0	145.0	153.0					13																	33634951		2203	4300	6503	SO:0001583	missense	9365				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding	g.chr13:33634951C>A	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1735C>A	13.37:g.33634951C>A	ENSP00000369442:p.Gln579Lys					KL_uc001uur.1_3'UTR	p.Q579K	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)	4	1743	+	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)	579			Glycosyl hydrolase-1 2.|Extracellular (Potential).		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	c.1735C>A	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.742982	0.00675	.	.	ENSG00000133116	ENST00000380099	T	0.25085	1.82	5.44	-0.742	0.11108	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.173858	0.47455	D	0.000227	T	0.06735	0.0172	N	0.01729	-0.75	0.25017	N	0.991366	B	0.06786	0.001	B	0.08055	0.003	T	0.40961	-0.9535	10	0.02654	T	1	-9.9916	9.3033	0.37858	0.5109:0.319:0.1702:0.0	.	579	Q9UEF7	KLOT_HUMAN	K	579	ENSP00000369442:Q579K	ENSP00000369442:Q579K	Q	+	1	0	KL	32532951	0.996000	0.38824	0.489000	0.27452	0.089000	0.18198	0.484000	0.22308	-0.062000	0.13088	0.563000	0.77884	CAG		0.498	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1			34	57	1	0	1.30998e-17	0.005524	1.94213e-17	34	57				
TRPC4	7223	broad.mit.edu	37	13	38237641	38237641	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr13:38237641G>T	ENST00000379705.3	-	6	2457	c.1600C>A	c.(1600-1602)Cta>Ata	p.L534I	TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000358477.2_Missense_Mutation_p.L534I|TRPC4_ENST00000379673.2_Missense_Mutation_p.L534I|TRPC4_ENST00000379679.1_Missense_Mutation_p.L361I|TRPC4_ENST00000379681.3_Missense_Mutation_p.L534I|TRPC4_ENST00000355779.2_Missense_Mutation_p.L534I|TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000447043.1_Missense_Mutation_p.L534I|TRPC4_ENST00000338947.5_Missense_Mutation_p.L361I			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	534					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.L534I(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		AATTGATTTAGGCCATTTGCA	0.373																																							uc001uws.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)	6						c.(1600-1602)CTA>ATA		transient receptor potential cation channel,							82.0	79.0	80.0					13																	38237641		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38237641G>T	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1600C>A	13.37:g.38237641G>T	ENSP00000369027:p.Leu534Ile					TRPC4_uc010abv.2_Missense_Mutation_p.L114I|TRPC4_uc001uwt.2_Missense_Mutation_p.L534I|TRPC4_uc010tey.1_Missense_Mutation_p.L534I|TRPC4_uc010abw.2_Missense_Mutation_p.L361I|TRPC4_uc010abx.2_Missense_Mutation_p.L534I|TRPC4_uc010aby.2_Missense_Mutation_p.L534I	p.L534I	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	6	1835	-			534			Extracellular (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.1600C>A	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783002	0.70222	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01	6.08	3.03	0.35002	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98381	0.9462	M	0.71206	2.165	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.996;1.0;0.968;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.986;0.999;0.975;0.999	D	0.98134	1.0432	10	0.59425	D	0.04	-13.0653	9.5483	0.39295	0.3499:0.0:0.6501:0.0	.	534;534;534;361;534;534	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	I	534;534;361;361;534;534;534;534	ENSP00000369027:L534I;ENSP00000369003:L534I;ENSP00000342580:L361I;ENSP00000369001:L361I;ENSP00000348025:L534I;ENSP00000351264:L534I;ENSP00000368995:L534I;ENSP00000414316:L534I	ENSP00000342580:L361I	L	-	1	2	TRPC4	37135641	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	2.393000	0.44442	0.912000	0.36772	0.655000	0.94253	CTA		0.373	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		4	73	1	0	0.00024832	0.009096	0.00027895	4	73				
STOML3	161003	broad.mit.edu	37	13	39546705	39546705	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr13:39546705C>A	ENST00000379631.4	-	4	600	c.256G>T	c.(256-258)Gat>Tat	p.D86Y	STOML3_ENST00000423210.1_Missense_Mutation_p.D77Y	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	86					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)		p.D86Y(1)		breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		ACAAACACATCTATGCATGGC	0.373																																							uc001uwx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(256-258)GAT>TAT		stomatin-like 3 isoform 1							161.0	145.0	150.0					13																	39546705		2203	4300	6503	SO:0001583	missense	161003					integral to membrane|plasma membrane		g.chr13:39546705C>A	BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.256G>T	13.37:g.39546705C>A	ENSP00000368952:p.Asp86Tyr					STOML3_uc010tez.1_Missense_Mutation_p.D77Y	p.D86Y	NM_145286	NP_660329	Q8TAV4	STML3_HUMAN		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)	4	394	-		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)	86			Cytoplasmic (Potential).		B4E285|Q5JS35	Missense_Mutation	SNP	ENST00000379631.4	37	c.256G>T	CCDS9367.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.754830	0.89843	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	D;D	0.94417	-3.42;-3.42	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.98204	0.9406	H	0.95114	3.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.99153	1.0859	10	0.87932	D	0	-26.659	18.2171	0.89889	0.0:1.0:0.0:0.0	.	77;86	B4E285;Q8TAV4	.;STML3_HUMAN	Y	86;77	ENSP00000368952:D86Y;ENSP00000401989:D77Y	ENSP00000368952:D86Y	D	-	1	0	STOML3	38444705	1.000000	0.71417	0.952000	0.39060	0.984000	0.73092	7.453000	0.80700	2.724000	0.93272	0.655000	0.94253	GAT		0.373	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044604.2			32	82	1	0	2.20474e-14	0.003755	3.15847e-14	32	82				
PCDH9	5101	broad.mit.edu	37	13	67801795	67801796	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr13:67801795_67801796GC>TG	ENST00000377865.2	-	1	911_912	c.777_778GC>CA	c.(775-780)gtGCat>gtCAat	p.H260N	PCDH9_ENST00000377861.3_Missense_Mutation_p.H260N|PCDH9_ENST00000456367.1_Missense_Mutation_p.H260N|PCDH9_ENST00000328454.5_Missense_Mutation_p.H260N|PCDH9_ENST00000544246.1_Missense_Mutation_p.H260N			Q9HC56	PCDH9_HUMAN	protocadherin 9	260	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H260N(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TCTGGAATATGCACCTCCACTT	0.47																																							uc001vik.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(775-780)GTGCAT>GTCAAT		protocadherin 9 isoform 1 precursor																																				SO:0001583	missense	5101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr13:67801795_67801796GC>TG	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.777_778delinsTG	13.37:g.67801795_67801796delinsTG	ENSP00000367096:p.His260Asn					PCDH9_uc001vil.2_Missense_Mutation_p.H260N|PCDH9_uc010thl.1_Missense_Mutation_p.H260N|PCDH9_uc001vin.3_Missense_Mutation_p.H260N	p.H260N	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN		GBM - Glioblastoma multiforme(99;0.00819)	2	1469_1470	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	260			Extracellular (Potential).|Cadherin 3.		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	DNP	ENST00000377865.2	37	c.777_778GC>CA	CCDS9444.1																																																																																				0.470	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487		5	62	0	0	0	0.004672	0	5	62				
SLITRK6	84189	broad.mit.edu	37	13	86369625	86369626	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr13:86369625_86369626GG>TT	ENST00000400286.2	-	2	1616_1617	c.1018_1019CC>AA	c.(1018-1020)CCa>AAa	p.P340K		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	340	LRRNT 2.				adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.P340K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		AAGTCCTGATGGGGATAGGACT	0.446																																							uc001vll.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1018-1020)CCA>AAA		slit and trk like 6 precursor																																				SO:0001583	missense	84189					integral to membrane		g.chr13:86369625_86369626GG>TT	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1018_1019delinsTT	13.37:g.86369625_86369626delinsTT	ENSP00000383143:p.Pro340Lys					SLITRK6_uc010afe.1_Missense_Mutation_p.P105K	p.P340K	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN		GBM - Glioblastoma multiforme(99;0.0456)	2	1477_1478	-	all_neural(89;0.117)|Medulloblastoma(90;0.163)		340			Extracellular (Potential).|LRRNT 2.		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	DNP	ENST00000400286.2	37	c.1018_1019CC>AA	CCDS41903.1																																																																																				0.446	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229		35	75	0	0	0	0.004672	0	35	75				
OR11H12	440153	broad.mit.edu	37	14	19377684	19377684	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr14:19377684G>T	ENST00000550708.1	+	1	163	c.91G>T	c.(91-93)Ggt>Tgt	p.G31C		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G31C(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATACTCCAAGGTTTCACTTG	0.413																																							uc010tkp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(91-93)GGT>TGT		olfactory receptor, family 11, subfamily H,							57.0	59.0	58.0					14																	19377684		2199	4296	6495	SO:0001583	missense	440153				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:19377684G>T		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.91G>T	14.37:g.19377684G>T	ENSP00000449002:p.Gly31Cys						p.G31C	NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	91	+	all_cancers(95;0.00108)		31			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000550708.1	37	c.91G>T	CCDS32017.1	.	.	.	.	.	.	.	.	.	.	g	7.947	0.744051	0.15710	.	.	ENSG00000257115	ENST00000550708	T	0.00662	5.93	.	.	.	.	0.000000	0.41396	U	0.000899	T	0.05135	0.0137	H	0.96239	3.79	0.27325	N	0.956923	D	0.89917	1.0	D	0.87578	0.998	T	0.05007	-1.0912	8	0.87932	D	0	.	2.8235	0.05479	0.409:0.0:0.591:0.0	.	31	B2RN74	O11HC_HUMAN	C	31	ENSP00000449002:G31C	ENSP00000449002:G31C	G	+	1	0	CR383656.1	18447684	0.981000	0.34729	0.020000	0.16555	0.036000	0.12997	3.747000	0.55134	0.413000	0.25759	0.064000	0.15345	GGT		0.413	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354		21	148	1	0	7.45023e-12	0.010504	1.03815e-11	21	148				
PRKD1	5587	broad.mit.edu	37	14	30100003	30100003	+	Silent	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr14:30100003G>A	ENST00000331968.5	-	10	1846	c.1617C>T	c.(1615-1617)gcC>gcT	p.A539A	PRKD1_ENST00000415220.2_Silent_p.A547A	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	539	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.A539A(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CGGGCATAAGGGCATGCTGGA	0.537																																							uc001wqh.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)|large_intestine(2)|ovary(2)|skin(1)	8						c.(1615-1617)GCC>GCT		protein kinase D1							182.0	141.0	155.0					14																	30100003		2203	4300	6503	SO:0001819	synonymous_variant	5587				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr14:30100003G>A		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1617C>T	14.37:g.30100003G>A							p.A539A	NM_002742	NP_002733	Q15139	KPCD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)	10	1798	-	Hepatocellular(127;0.0604)		539			PH.		A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	37	c.1617C>T	CCDS9637.1																																																																																				0.537	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742		7	109	0	0	0	0.001984	0	7	109				
STRN3	29966	broad.mit.edu	37	14	31374737	31374737	+	Missense_Mutation	SNP	A	A	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr14:31374737A>C	ENST00000357479.5	-	15	2112	c.1916T>G	c.(1915-1917)tTt>tGt	p.F639C	STRN3_ENST00000355683.5_Missense_Mutation_p.F555C	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	639					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		ACAGCCTATAAAGTCAACTGA	0.348																																							uc001wqu.2		NA																	0					0						c.(1915-1917)TTT>TGT		nuclear autoantigen isoform 1							103.0	95.0	97.0					14																	31374737		2203	4299	6502	SO:0001583	missense	29966				negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity	g.chr14:31374737A>C		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1916T>G	14.37:g.31374737A>C	ENSP00000350071:p.Phe639Cys					STRN3_uc001wqv.2_Missense_Mutation_p.F555C|STRN3_uc010tpj.1_RNA	p.F639C	NM_001083893	NP_001077362	Q13033	STRN3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)	15	2132	-	Hepatocellular(127;0.0877)|Breast(36;0.148)		639					A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	ENST00000357479.5	37	c.1916T>G	CCDS41938.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.135939	0.77662	.	.	ENSG00000196792	ENST00000355683;ENST00000357479	D;D	0.84146	-1.81;-1.81	5.75	4.6	0.57074	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.92711	0.7683	M	0.88241	2.94	0.80722	D	1	D;D	0.76494	0.999;0.983	D;P	0.79108	0.992;0.635	D	0.93072	0.6483	10	0.87932	D	0	-8.4597	11.7897	0.52063	0.9311:0.0:0.0689:0.0	.	555;639	Q13033-2;Q13033	.;STRN3_HUMAN	C	555;639	ENSP00000347909:F555C;ENSP00000350071:F639C	ENSP00000347909:F555C	F	-	2	0	STRN3	30444488	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.248000	0.95456	0.992000	0.38840	0.482000	0.46254	TTT		0.348	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574		5	165	0	0	0	0.001168	0	5	165				
AHNAK2	113146	broad.mit.edu	37	14	105412058	105412058	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr14:105412058G>T	ENST00000333244.5	-	7	9849	c.9730C>A	c.(9730-9732)Ccc>Acc	p.P3244T	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3244						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3244T(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCTATCTGGGGGCCCTTGCGA	0.612																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(9730-9732)CCC>ACC		AHNAK nucleoprotein 2							131.0	94.0	106.0					14																	105412058		1872	4071	5943	SO:0001583	missense	113146					nucleus		g.chr14:105412058G>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9730C>A	14.37:g.105412058G>T	ENSP00000353114:p.Pro3244Thr					AHNAK2_uc001ypx.2_Missense_Mutation_p.P3144T	p.P3244T	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	9850	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3244					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.9730C>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	9.642	1.139177	0.21205	.	.	ENSG00000185567	ENST00000333244	T	0.02709	4.19	2.73	2.73	0.32206	.	.	.	.	.	T	0.16854	0.0405	M	0.93978	3.48	0.20074	N	0.999936	D	0.89917	1.0	D	0.91635	0.999	T	0.06972	-1.0797	9	0.39692	T	0.17	.	5.6562	0.17644	0.1563:0.0:0.8437:0.0	.	3244	Q8IVF2	AHNK2_HUMAN	T	3244	ENSP00000353114:P3244T	ENSP00000353114:P3244T	P	-	1	0	AHNAK2	104483103	0.035000	0.19736	0.009000	0.14445	0.002000	0.02628	0.000000	0.12993	1.536000	0.49237	0.313000	0.20887	CCC		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		21	61	1	0	1.04352e-10	0.003755	1.40792e-10	21	61				
DUOX1	53905	broad.mit.edu	37	15	45444641	45444641	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr15:45444641C>T	ENST00000321429.4	+	26	3758	c.3351C>T	c.(3349-3351)ctC>ctT	p.L1117L	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Silent_p.L1117L|DUOX1_ENST00000561166.1_Silent_p.L763L	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1117	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.L1117L(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		AAACCTTCCTCAACCGCTACG	0.612																																							uc001zus.1		NA																	2	Substitution - coding silent(2)	p.L1117L(1)	ovary(1)|lung(1)	ovary(5)|skin(2)|breast(1)	8						c.(3349-3351)CTC>CTT		dual oxidase 1 precursor							207.0	160.0	176.0					15																	45444641		2198	4298	6496	SO:0001819	synonymous_variant	53905				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity	g.chr15:45444641C>T	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3351C>T	15.37:g.45444641C>T						DUOX1_uc001zut.1_Silent_p.L1117L|DUOX1_uc010bee.1_Silent_p.L497L|DUOX1_uc001zuu.2_Silent_p.L259L	p.L1117L	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)	26	3697	+		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	1117			Ferric oxidoreductase.|Interaction with TXNDC11 (By similarity).|Cytoplasmic (Potential).		A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	ENST00000321429.4	37	c.3351C>T	CCDS32221.1																																																																																				0.612	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434		4	33	0	0	0	0.001168	0	4	33				
GATM	2628	broad.mit.edu	37	15	45661562	45661562	+	Missense_Mutation	SNP	C	C	A	rs80338737		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr15:45661562C>A	ENST00000396659.3	-	3	785	c.446G>T	c.(445-447)tGg>tTg	p.W149L	GATM_ENST00000558336.1_Missense_Mutation_p.W149L	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	149					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)	p.W149L(1)		biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	CTTCAATGACCAGTCAATGGG	0.373																																							uc001zvc.2		NA																	1	Substitution - Missense(1)		lung(1)		0	GRCh37	CM013263	GATM	M	rs80338737	c.(445-447)TGG>TTG		L-arginine:glycine amidinotransferase precursor	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)						112.0	109.0	110.0					15																	45661562		2198	4298	6496	SO:0001583	missense	2628				creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding	g.chr15:45661562C>A	S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.446G>T	15.37:g.45661562C>A	ENSP00000379895:p.Trp149Leu					GATM_uc001zvb.2_Missense_Mutation_p.W20L|GATM_uc010uev.1_Missense_Mutation_p.W202L	p.W149L	NM_001482	NP_001473	P50440	GATM_HUMAN		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	3	775	-		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	149					B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	ENST00000396659.3	37	c.446G>T	CCDS10122.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.726029	0.89298	.	.	ENSG00000171766	ENST00000396659	T	0.45276	0.9	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.48840	0.1522	M	0.78456	2.415	0.80722	D	1	P;P	0.44627	0.839;0.751	B;B	0.42386	0.386;0.216	T	0.44081	-0.9351	10	0.16896	T	0.51	-6.956	18.1532	0.89682	0.0:1.0:0.0:0.0	.	149;149	P50440-3;P50440	.;GATM_HUMAN	L	149	ENSP00000379895:W149L	ENSP00000379895:W149L	W	-	2	0	GATM	43448854	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.395000	0.79876	2.885000	0.99019	0.655000	0.94253	TGG		0.373	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254220.2	NM_001482		24	96	1	0	7.41945e-09	0.005443	9.4598e-09	24	96				
ATP8B4	79895	broad.mit.edu	37	15	50271825	50271825	+	Silent	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr15:50271825G>A	ENST00000284509.6	-	12	1164	c.1023C>T	c.(1021-1023)tcC>tcT	p.S341S	ATP8B4_ENST00000558959.1_5'UTR|ATP8B4_ENST00000559829.1_Silent_p.S341S|RNA5SP394_ENST00000364216.1_RNA	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	341						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S341S(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TCACATATAAGGAAATGGGTA	0.308																																							uc001zxu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(1021-1023)TCC>TCT		ATPase class I type 8B member 4							89.0	102.0	98.0					15																	50271825		2196	4294	6490	SO:0001819	synonymous_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50271825G>A	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1023C>T	15.37:g.50271825G>A						ATP8B4_uc010ber.2_Silent_p.S214S|ATP8B4_uc010ufd.1_Silent_p.S214S|ATP8B4_uc010ufe.1_RNA	p.S341S	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	12	1165	-		all_lung(180;0.00183)	341			Helical; (Potential).		Q9H727	Silent	SNP	ENST00000284509.6	37	c.1023C>T	CCDS32238.1																																																																																				0.308	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		10	139	0	0	0	0.010729	0	10	139				
VPS13C	54832	broad.mit.edu	37	15	62226466	62226466	+	Missense_Mutation	SNP	A	A	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr15:62226466A>C	ENST00000261517.5	-	49	5893	c.5820T>G	c.(5818-5820)ttT>ttG	p.F1940L	VPS13C_ENST00000395896.4_Missense_Mutation_p.F1940L|VPS13C_ENST00000395898.3_Missense_Mutation_p.F1897L|VPS13C_ENST00000249837.3_Missense_Mutation_p.F1897L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.F1940L(2)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ATTCAAAGTGAAAGTCAAATT	0.318																																							uc002agz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(5818-5820)TTT>TTG		vacuolar protein sorting 13C protein isoform 2A							127.0	138.0	135.0					15																	62226466		2203	4298	6501	SO:0001583	missense	54832				protein localization			g.chr15:62226466A>C	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.5820T>G	15.37:g.62226466A>C	ENSP00000261517:p.Phe1940Leu					VPS13C_uc002aha.2_Missense_Mutation_p.F1897L|VPS13C_uc002ahb.1_Missense_Mutation_p.F1940L|VPS13C_uc002ahc.1_Missense_Mutation_p.F1897L	p.F1940L	NM_020821	NP_065872	Q709C8	VP13C_HUMAN			49	5894	-			1940						Missense_Mutation	SNP	ENST00000261517.5	37	c.5820T>G	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.886922	0.52014	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.31247	1.5;1.5;1.5	5.19	1.65	0.23941	.	0.113640	0.64402	D	0.000015	T	0.41834	0.1176	M	0.77820	2.39	0.58432	D	0.999992	P;B;P;B	0.36412	0.529;0.282;0.552;0.185	B;B;P;B	0.46510	0.22;0.22;0.519;0.109	T	0.25779	-1.0122	10	0.59425	D	0.04	.	8.6051	0.33769	0.6008:0.0:0.3992:0.0	.	1897;1940;1897;1940	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	L	1897;1940;1940;1940	ENSP00000249837:F1897L;ENSP00000261517:F1940L;ENSP00000379233:F1940L	ENSP00000249837:F1897L	F	-	3	2	VPS13C	60013758	0.998000	0.40836	0.999000	0.59377	0.977000	0.68977	0.384000	0.20668	0.026000	0.15269	0.528000	0.53228	TTT		0.318	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		16	160	0	0	0	0.006122	0	16	160				
LOC645752	645752	broad.mit.edu	37	15	78207569	78207569	+	lincRNA	SNP	G	G	A	rs56314252	byFrequency	TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr15:78207569G>A	ENST00000565869.1	+	0	0				RN7SL214P_ENST00000487317.2_RNA																							GATCTGCTGTGCAGTGGGGTT	0.572																																							uc010bky.2		NA																	0					0						c.(1342-1344)GCA>GTA		SubName: Full=GOLGA6 protein; Flags: Fragment;																																						645752							g.chr15:78207569G>A																													15.37:g.78207569G>A						LOC645752_uc010umq.1_Missense_Mutation_p.A95V|uc002bcw.1_5'Flank|uc002bcx.1_5'Flank	p.A448V	NR_027024						18	2107	-									Missense_Mutation	SNP	ENST00000565869.1	37	c.1343C>T																																																																																					0.572	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1			4	56	0	0	0	0.001168	0	4	56				
ALPK3	57538	broad.mit.edu	37	15	85411371	85411371	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr15:85411371C>T	ENST00000258888.5	+	14	5575	c.5408C>T	c.(5407-5409)cCt>cTt	p.P1803L		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1803	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P1803L(2)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGCTGCTTCCCTGCCCTGCTG	0.647																																							uc002ble.2		NA																	2	Substitution - Missense(2)		lung(2)	stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12						c.(5407-5409)CCT>CTT		alpha-kinase 3							105.0	117.0	113.0					15																	85411371		2203	4299	6502	SO:0001583	missense	57538				heart development	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr15:85411371C>T	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.5408C>T	15.37:g.85411371C>T	ENSP00000258888:p.Pro1803Leu					ALPK3_uc010upc.1_Missense_Mutation_p.P104L	p.P1803L	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		14	5575	+			1803			Alpha-type protein kinase.		Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	c.5408C>T	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846046	0.71603	.	.	ENSG00000136383	ENST00000258888	T	0.14266	2.52	4.62	4.62	0.57501	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.22898	0.0553	L	0.42245	1.32	0.58432	D	0.999999	D;D	0.69078	0.997;0.983	D;P	0.65874	0.939;0.901	T	0.01557	-1.1325	10	0.02654	T	1	-10.5344	15.4035	0.74861	0.0:1.0:0.0:0.0	.	104;1803	B4DU37;Q96L96	.;ALPK3_HUMAN	L	1803	ENSP00000258888:P1803L	ENSP00000258888:P1803L	P	+	2	0	ALPK3	83212375	0.985000	0.35326	0.757000	0.31301	0.808000	0.45660	4.381000	0.59587	2.560000	0.86352	0.556000	0.70494	CCT		0.647	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		19	138	0	0	0	0.008871	0	19	138				
CACNA1H	8912	broad.mit.edu	37	16	1272752	1272752	+	IGR	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr16:1272752G>T	ENST00000348261.5	+	0	8084				TPSG1_ENST00000234798.4_Silent_p.L137L	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit						aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)	p.L137L(1)		breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TCCGGCTGGAGAGGGTCACGG	0.682																																							uc002ckw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(409-411)CTC>CTA		transmembrane tryptase preproprotein							42.0	45.0	44.0					16																	1272752		2199	4300	6499	SO:0001628	intergenic_variant	25823				proteolysis	integral to plasma membrane	serine-type endopeptidase activity	g.chr16:1272752G>T	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180			16.37:g.1272752G>T							p.L137L	NM_012467	NP_036599	Q9NRR2	TRYG1_HUMAN			4	413	-		Hepatocellular(780;0.00369)	137			Peptidase S1.		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	c.411C>A	CCDS45375.1																																																																																				0.682	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407		12	39	1	0	2.27111e-07	0.013537	2.75778e-07	12	39				
TMEM204	79652	broad.mit.edu	37	16	1604799	1604799	+	Silent	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr16:1604799C>A	ENST00000566264.1	+	3	1156	c.453C>A	c.(451-453)atC>atA	p.I151I	IFT140_ENST00000426508.2_Intron|IFT140_ENST00000439987.2_Intron|TMEM204_ENST00000253934.5_Silent_p.I151I	NM_024600.5	NP_078876.2	Q9BSN7	TM204_HUMAN	transmembrane protein 204	151					lymph vessel development (GO:0001945)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to stress (GO:0006950)|smooth muscle cell differentiation (GO:0051145)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I151I(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Hepatocellular(780;0.219)				TCCTGGTCATCGGGCTCGTGA	0.587																																							uc002cmc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(451-453)ATC>ATA		transmembrane protein 204							126.0	129.0	128.0					16																	1604799		2009	4172	6181	SO:0001819	synonymous_variant	79652				response to stress	adherens junction|integral to membrane		g.chr16:1604799C>A		CCDS42098.1	16p13.3	2008-02-05	2008-01-08	2008-01-08		ENSG00000131634			14158	protein-coding gene	gene with protein product		611002	"""chromosome 16 open reading frame 30"""	C16orf30			Standard	NM_024600		Approved	FLJ20898	uc002cmc.3	Q9BSN7		ENST00000566264.1:c.453C>A	16.37:g.1604799C>A						IFT140_uc002clz.2_Intron|IFT140_uc002cmb.2_Intron|TMEM204_uc002cmd.2_Silent_p.I151I|TMEM204_uc010brr.1_Silent_p.I151I|uc010brs.1_5'Flank	p.I151I	NM_024600	NP_078876	Q9BSN7	TM204_HUMAN			4	851	+		Hepatocellular(780;0.219)	151			Helical; (Potential).		D3DU76|Q3KRC1|Q9H7G5	Silent	SNP	ENST00000566264.1	37	c.453C>A	CCDS42098.1																																																																																				0.587	TMEM204-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432610.1	NM_024600		35	67	1	0	3.09479e-21	0.006999	4.78285e-21	35	67				
NPIPB6	728741	broad.mit.edu	37	16	28354495	28354495	+	Silent	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr16:28354495T>C	ENST00000532254.1	-	7	1396	c.711A>G	c.(709-711)gcA>gcG	p.A237A	NPIPB6_ENST00000533640.1_Silent_p.A219A	NM_001282524.1	NP_001269453.1	E9PJ23	NPIB6_HUMAN	nuclear pore complex interacting protein family, member B6	237								p.A237A(2)									GATGCTCCGCTGCCACCATTC	0.493																																							uc010vcq.1		NA																	2	Substitution - coding silent(2)		lung(2)		NA						c.(655-657)GCA>GCG		SubName: Full=LOC728741 protein;																																				SO:0001819	synonymous_variant	0							g.chr16:28354495T>C		CCDS61892.1	16p11.2	2013-06-11			ENSG00000198156	ENSG00000198156			37454	protein-coding gene	gene with protein product							Standard	XM_005255741		Approved			E9PJ23	OTTHUMG00000166319	ENST00000532254.1:c.711A>G	16.37:g.28354495T>C						uc010vcr.1_Silent_p.A237A	p.A219A							7	710	-									Silent	SNP	ENST00000532254.1	37	c.657A>G																																																																																					0.493	NPIPB6-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389133.1	XM_001717652		5	73	0	0	0	0.000602	0	5	73				
ITGAL	3683	broad.mit.edu	37	16	30522454	30522454	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr16:30522454A>T	ENST00000356798.6	+	24	2963	c.2783A>T	c.(2782-2784)cAg>cTg	p.Q928L	ITGAL_ENST00000358164.5_Missense_Mutation_p.Q844L|ITGAL_ENST00000433423.2_Missense_Mutation_p.Q162L	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	928					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.Q928L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	ATCCTCATCCAGGAGTAAGTT	0.577																																					NSCLC(110;1462 1641 3311 33990 49495)	NSCLC(110;1462 1641 3311 33990 49495)	uc002dyi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10						c.(2782-2784)CAG>CTG		integrin alpha L isoform a precursor	Efalizumab(DB00095)						185.0	158.0	167.0					16																	30522454		2197	4300	6497	SO:0001583	missense	3683				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity	g.chr16:30522454A>T		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2783A>T	16.37:g.30522454A>T	ENSP00000349252:p.Gln928Leu					ITGAL_uc002dyj.3_Missense_Mutation_p.Q844L|ITGAL_uc010vev.1_Missense_Mutation_p.Q162L	p.Q928L	NM_002209	NP_002200	P20701	ITAL_HUMAN			24	2959	+			928			Extracellular (Potential).		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	c.2783A>T	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715274	0.48622	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.45668	0.89;0.89;0.89	5.0	5.0	0.66597	Integrin alpha-2 (1);	0.543255	0.16658	N	0.204891	T	0.35098	0.0920	N	0.22421	0.69	0.80722	D	1	P;B;B	0.46277	0.875;0.404;0.033	P;B;B	0.45856	0.495;0.288;0.055	T	0.17868	-1.0355	10	0.62326	D	0.03	.	11.1513	0.48460	1.0:0.0:0.0:0.0	.	162;844;928	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	L	928;844;162	ENSP00000349252:Q928L;ENSP00000350886:Q844L;ENSP00000409377:Q162L	ENSP00000349252:Q928L	Q	+	2	0	ITGAL	30429955	0.735000	0.28153	0.900000	0.35374	0.161000	0.22273	4.431000	0.59915	1.898000	0.54952	0.454000	0.30748	CAG		0.577	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			16	54	0	0	0	0.004007	0	16	54				
BCAR1	9564	broad.mit.edu	37	16	75276608	75276608	+	Silent	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr16:75276608C>G	ENST00000162330.5	-	2	519	c.393G>C	c.(391-393)ccG>ccC	p.P131P	BCAR1_ENST00000535626.2_Intron|BCAR1_ENST00000418647.3_Silent_p.P177P|BCAR1_ENST00000420641.3_Silent_p.P149P|BCAR1_ENST00000393420.6_Silent_p.P131P|BCAR1_ENST00000538440.2_Silent_p.P131P|BCAR1_ENST00000546196.1_Silent_p.P102P|BCAR1_ENST00000393422.2_Silent_p.P149P|BCAR1_ENST00000542031.2_Silent_p.P129P	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	131	Substrate for kinases. {ECO:0000250}.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GGCTGGGACCCGGGACTTGGT	0.632																																							uc002fdv.2		NA																	0				central_nervous_system(5)|breast(2)|prostate(1)	8						c.(391-393)CCG>CCC		breast cancer anti-estrogen resistance 1							90.0	94.0	93.0					16																	75276608		2198	4300	6498	SO:0001819	synonymous_variant	9564				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity	g.chr16:75276608C>G	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.393G>C	16.37:g.75276608C>G						BCAR1_uc010cgu.2_Silent_p.P102P|BCAR1_uc010vna.1_Silent_p.P129P|BCAR1_uc010vnb.1_Silent_p.P177P|BCAR1_uc002fdw.2_Silent_p.P131P|BCAR1_uc010vnc.1_Intron|BCAR1_uc010vnd.1_Silent_p.P149P|BCAR1_uc002fdx.2_Silent_p.P149P	p.P131P	NM_014567	NP_055382	P56945	BCAR1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	2	516	-			131			Substrate for kinases (By similarity).		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Silent	SNP	ENST00000162330.5	37	c.393G>C	CCDS10915.1																																																																																				0.632	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567		5	204	0	0	0	0.001984	0	5	204				
NEURL4	84461	broad.mit.edu	37	17	7221815	7221815	+	Splice_Site	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:7221815T>C	ENST00000399464.2	-	23	3878	c.3863A>G	c.(3862-3864)cAg>cGg	p.Q1288R	NEURL4_ENST00000315614.7_Splice_Site_p.Q1286R|NEURL4_ENST00000574120.1_5'UTR|RP11-542C16.2_ENST00000575474.1_Splice_Site_p.R102G|NEURL4_ENST00000570460.1_Splice_Site_p.Q1264R|GPS2_ENST00000380728.2_5'Flank	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	1288	NHR 6. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Q1288R(1)|p.Q1286R(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCACTAACCTGCTCACACTG	0.627																																							uc002gga.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(3862-3864)CAG>CGG		neuralized homolog 4 isoform 1							38.0	44.0	42.0					17																	7221815		2139	4229	6368	SO:0001630	splice_region_variant	84461						protein binding	g.chr17:7221815T>C		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.3864+1A>G	17.37:g.7221815T>C						NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_5'UTR|NEURL4_uc002ggb.1_Missense_Mutation_p.Q1286R	p.Q1288R	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN			23	3870	-			1288			NHR 6.		Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	c.3863A>G	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.813869	0.50527	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.35236	1.32;1.32	5.29	4.21	0.49690	NEUZ (1);	0.000000	0.85682	D	0.000000	T	0.41003	0.1140	M	0.80847	2.515	0.37115	D	0.900538	B;B	0.28713	0.22;0.141	B;B	0.31614	0.133;0.063	T	0.42378	-0.9455	10	0.38643	T	0.18	-16.0072	10.0867	0.42423	0.0:0.0808:0.0:0.9192	.	1286;1288	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	R	1286;1288	ENSP00000319826:Q1286R;ENSP00000382390:Q1288R	ENSP00000319826:Q1286R	Q	-	2	0	NEURL4	7162539	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.008000	0.76341	0.843000	0.35070	0.379000	0.24179	CAG		0.627	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	Missense_Mutation	3	12	0	0	0	0.004672	0	3	12				
MYH2	4620	broad.mit.edu	37	17	10429087	10429087	+	Missense_Mutation	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:10429087C>G	ENST00000245503.5	-	31	4678	c.4294G>C	c.(4294-4296)Gag>Cag	p.E1432Q	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.E1432Q	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1432					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.E1432Q(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						ATGAGGTCCTCGACCTCATTC	0.542																																							uc010coi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(4294-4296)GAG>CAG		myosin heavy chain IIa							87.0	81.0	83.0					17																	10429087		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10429087C>G		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4294G>C	17.37:g.10429087C>G	ENSP00000245503:p.Glu1432Gln					uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.E1432Q|MYH2_uc010coj.2_Intron	p.E1432Q	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN			31	4422	-			1432			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.4294G>C	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847805	0.91277	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.82526	-1.62;-1.62	4.9	4.9	0.64082	Myosin tail (1);	0.000000	0.39687	U	0.001290	D	0.94398	0.8198	H	0.97682	4.055	0.58432	D	0.999995	D	0.59357	0.985	D	0.68483	0.958	D	0.96302	0.9222	10	0.87932	D	0	.	18.2698	0.90064	0.0:1.0:0.0:0.0	.	1432	Q9UKX2	MYH2_HUMAN	Q	1432	ENSP00000245503:E1432Q;ENSP00000380367:E1432Q	ENSP00000245503:E1432Q	E	-	1	0	MYH2	10369812	1.000000	0.71417	0.989000	0.46669	0.951000	0.60555	7.651000	0.83577	2.558000	0.86282	0.313000	0.20887	GAG		0.542	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		43	56	0	0	0	0.011902	0	43	56				
AATF	26574	broad.mit.edu	37	17	35388909	35388909	+	Splice_Site	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:35388909A>G	ENST00000225402.5	+	11	1798		c.e11-1		MIR2909_ENST00000581942.1_RNA	NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor						apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				TGCTTTATTTAGGTTTCATGT	0.388																																					NSCLC(49;901 1159 19183 41572 46244)	NSCLC(49;901 1159 19183 41572 46244)	uc002hni.2		NA																	0					0						c.e11-2		apoptosis antagonizing transcription factor							205.0	174.0	184.0					17																	35388909		2203	4300	6503	SO:0001630	splice_region_variant	26574				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of superoxide anion generation|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to DNA damage stimulus	centrosome|focal adhesion|nucleolus	leucine zipper domain binding|sequence-specific DNA binding transcription factor activity	g.chr17:35388909A>G	AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.1548-1A>G	17.37:g.35388909A>G						AATF_uc002hnj.2_Splice_Site	p.R516_splice	NM_012138	NP_036270	Q9NY61	AATF_HUMAN			11	1799	+		Breast(25;0.00607)						A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Splice_Site	SNP	ENST00000225402.5	37	c.1548_splice	CCDS32632.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221709	0.79464	.	.	ENSG00000108270	ENST00000225402	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.27	0.82612	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AATF	32463022	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.141000	0.77330	2.248000	0.74166	0.533000	0.62120	.		0.388	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138	Intron	4	123	0	0	0	0.000602	0	4	123				
KRT222	125113	broad.mit.edu	37	17	38818199	38818199	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:38818199A>T	ENST00000476049.1	-	2	235	c.194T>A	c.(193-195)cTg>cAg	p.L65Q	KRT222_ENST00000394052.3_Missense_Mutation_p.L65Q			Q8N1A0	KT222_HUMAN	keratin 222	65						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.L65Q(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(2)|skin(1)	15						TTCCACTTGCAGGTGGTGCCA	0.458																																							uc002hvc.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(193-195)CTG>CAG		truncated type I keratin KA21							220.0	214.0	216.0					17																	38818199		2203	4300	6503	SO:0001583	missense	125113					intermediate filament	structural molecule activity	g.chr17:38818199A>T	AK092967	CCDS11371.1	17q21.2	2013-06-25	2009-08-25	2009-08-25	ENSG00000213424	ENSG00000213424		"""-"""	28695	protein-coding gene	gene with protein product			"""keratin 222 pseudogene"""	KRT222P		16831889	Standard	NM_152349		Approved	KA21, MGC45562	uc002hvc.2	Q8N1A0	OTTHUMG00000133374	ENST00000476049.1:c.194T>A	17.37:g.38818199A>T	ENSP00000463483:p.Leu65Gln					KRT222_uc010wfk.1_RNA|KRT222_uc002hvb.2_Missense_Mutation_p.L25Q|KRT222_uc010cxc.2_Missense_Mutation_p.L25Q	p.L65Q	NM_152349	NP_689562	Q8N1A0	KT222_HUMAN			2	259	-			65			Potential.		Q7Z368	Missense_Mutation	SNP	ENST00000476049.1	37	c.194T>A	CCDS11371.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.991697	0.93106	.	.	ENSG00000213424	ENST00000394049;ENST00000394052	D	0.91295	-2.82	5.9	5.9	0.94986	Filament (1);	0.098933	0.42821	U	0.000656	D	0.95974	0.8689	M	0.88570	2.965	0.58432	D	0.999996	D;D	0.76494	0.999;0.992	D;D	0.73380	0.98;0.935	D	0.96616	0.9456	10	0.87932	D	0	-8.9944	16.3155	0.82918	1.0:0.0:0.0:0.0	.	25;65	Q8N1A0-2;Q8N1A0	.;KT222_HUMAN	Q	25;65	ENSP00000377616:L65Q	ENSP00000377613:L25Q	L	-	2	0	KRT222	36071725	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.676000	0.91199	2.260000	0.74910	0.528000	0.53228	CTG		0.458	KRT222-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000447539.1	NM_152349		95	171	0	0	0	0.01441	0	95	171				
DHX8	1659	broad.mit.edu	37	17	41594634	41594634	+	Missense_Mutation	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:41594634A>G	ENST00000262415.3	+	18	2815	c.2743A>G	c.(2743-2745)Acc>Gcc	p.T915A	DHX8_ENST00000540306.1_Missense_Mutation_p.T915A	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	915	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.T915A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		AATGCTGACCACCAACGTGCC	0.512																																					NSCLC(56;1548 1661 49258 49987)	NSCLC(56;1548 1661 49258 49987)	uc002idu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|pancreas(1)	4						c.(2743-2745)ACC>GCC		DEAH (Asp-Glu-Ala-His) box polypeptide 8							133.0	99.0	110.0					17																	41594634		2203	4300	6503	SO:0001583	missense	1659					catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding	g.chr17:41594634A>G	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.2743A>G	17.37:g.41594634A>G	ENSP00000262415:p.Thr915Ala					DHX8_uc010wif.1_Missense_Mutation_p.T824A|DHX8_uc010wig.1_Missense_Mutation_p.T915A	p.T915A	NM_004941	NP_004932	Q14562	DHX8_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.08)	18	2816	+		Breast(137;0.00908)	915			Helicase C-terminal.			Missense_Mutation	SNP	ENST00000262415.3	37	c.2743A>G	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.520619	0.85495	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.02579	4.24;4.24	5.8	5.8	0.92144	Helicase, C-terminal (1);	0.054457	0.64402	D	0.000001	T	0.04907	0.0132	L	0.27053	0.805	0.80722	D	1	P;B	0.45126	0.851;0.204	P;B	0.47573	0.55;0.298	T	0.48364	-0.9042	10	0.66056	D	0.02	.	15.3296	0.74196	1.0:0.0:0.0:0.0	.	915;915	F5H658;Q14562	.;DHX8_HUMAN	A	915	ENSP00000437886:T915A;ENSP00000262415:T915A	ENSP00000262415:T915A	T	+	1	0	DHX8	38950160	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.145000	0.94634	2.226000	0.72624	0.459000	0.35465	ACC		0.512	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1			3	32	0	0	0	0.004672	0	3	32				
FZD2	2535	broad.mit.edu	37	17	42635330	42635330	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:42635330C>T	ENST00000315323.3	+	1	406	c.274C>T	c.(274-276)Ctg>Ttg	p.L92L		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	92	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.L92L(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCGCTTCTTCCTGTGCTCCAT	0.642																																							uc002igx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)	3						c.(274-276)CTG>TTG		frizzled 2 precursor							122.0	114.0	117.0					17																	42635330		2203	4300	6503	SO:0001819	synonymous_variant	2535				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr17:42635330C>T	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.274C>T	17.37:g.42635330C>T							p.L92L	NM_001466	NP_001457	Q14332	FZD2_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.189)	1	406	+		Prostate(33;0.0181)	92			FZ.|Extracellular (Potential).		Q0VG82	Silent	SNP	ENST00000315323.3	37	c.274C>T	CCDS11484.1																																																																																				0.642	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466		5	78	0	0	0	0.001984	0	5	78				
BZRAP1	9256	broad.mit.edu	37	17	56389902	56389902	+	Silent	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:56389902C>A	ENST00000343736.4	-	17	2443	c.2280G>T	c.(2278-2280)gtG>gtT	p.V760V	BZRAP1_ENST00000355701.3_Silent_p.V760V|BZRAP1_ENST00000268893.6_Silent_p.V700V			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	760						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)	p.V760V(2)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGCTCCTTCCCACACTGCTTT	0.647																																							uc002ivx.3		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(2)|skin(1)	3						c.(2278-2280)GTG>GTT		peripheral benzodiazepine receptor-associated							78.0	63.0	68.0					17																	56389902		2203	4300	6503	SO:0001819	synonymous_variant	9256					mitochondrion	benzodiazepine receptor binding	g.chr17:56389902C>A	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2280G>T	17.37:g.56389902C>A						BZRAP1_uc010dcs.2_Silent_p.V700V|BZRAP1_uc010wnt.1_Silent_p.V760V	p.V760V	NM_004758	NP_004749	O95153	RIMB1_HUMAN			17	3151	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		760					O75111|Q8N5W3	Silent	SNP	ENST00000343736.4	37	c.2280G>T	CCDS11605.1																																																																																				0.647	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758		21	54	1	0	5.35356e-11	0.00278	7.33956e-11	21	54				
ARSG	22901	broad.mit.edu	37	17	66339822	66339822	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:66339822G>A	ENST00000448504.2	+	3	1092	c.296G>A	c.(295-297)cGc>cAc	p.R99H	ARSG_ENST00000452479.2_5'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	99					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.R99H(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTTGGCCTTCGCAATGGAGTC	0.602																																							uc002jhc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(295-297)CGC>CAC		Arylsulfatase G precursor							72.0	60.0	64.0					17																	66339822		2203	4300	6503	SO:0001583	missense	22901				sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding	g.chr17:66339822G>A	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.296G>A	17.37:g.66339822G>A	ENSP00000407193:p.Arg99His					ARSG_uc002jhb.1_5'UTR	p.R99H	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)		3	1092	+			99					Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	c.296G>A	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	G	32	5.107893	0.94292	.	.	ENSG00000141337	ENST00000452479	.	.	.	4.86	4.86	0.63082	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.78220	0.4249	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80777	-0.1231	9	0.87932	D	0	.	17.7751	0.88504	0.0:0.0:1.0:0.0	.	99	Q96EG1	ARSG_HUMAN	H	99	.	ENSP00000413953:R99H	R	+	2	0	ARSG	63851417	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	8.229000	0.89791	2.514000	0.84764	0.650000	0.86243	CGC		0.602	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960		5	49	0	0	0	0.001168	0	5	49				
MRPS7	51081	broad.mit.edu	37	17	73261910	73261910	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:73261910C>T	ENST00000245539.6	+	5	862	c.635C>T	c.(634-636)gCt>gTt	p.A212V	MRPS7_ENST00000579002.1_Missense_Mutation_p.A241V	NM_015971.3	NP_057055.2	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7	212					translation (GO:0006412)	cytosolic small ribosomal subunit (GO:0022627)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.A212V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)	6	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			CTGCTGGAGGCTTTCCATAAC	0.577																																							uc002jnm.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(634-636)GCT>GTT		mitochondrial ribosomal protein S7 precursor							86.0	81.0	82.0					17																	73261910		2203	4300	6503	SO:0001583	missense	51081				translation	cytosolic small ribosomal subunit|mitochondrion	protein binding|RNA binding|structural constituent of ribosome	g.chr17:73261910C>T	AB051348	CCDS11718.1	17q25.1	2012-09-13				ENSG00000125445		"""Mitochondrial ribosomal proteins / small subunits"""	14499	protein-coding gene	gene with protein product		611974					Standard	NM_015971		Approved	MRP-S, RP-S7, RPMS7	uc002jnm.4	Q9Y2R9		ENST00000245539.6:c.635C>T	17.37:g.73261910C>T	ENSP00000245539:p.Ala212Val					MRPS7_uc002jnn.3_Missense_Mutation_p.A241V	p.A212V	NM_015971	NP_057055	Q9Y2R9	RT07_HUMAN	all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)		5	868	+	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		212					B2R9N5|Q53GD6	Missense_Mutation	SNP	ENST00000245539.6	37	c.635C>T	CCDS11718.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856331	0.71834	.	.	ENSG00000125445	ENST00000245539	T	0.58506	0.33	6.17	6.17	0.99709	Ribosomal protein S7 domain (3);	0.000000	0.85682	D	0.000000	D	0.86087	0.5849	H	0.97365	3.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89592	0.3828	10	0.87932	D	0	-8.1493	20.8794	0.99867	0.0:1.0:0.0:0.0	.	212	Q9Y2R9	RT07_HUMAN	V	212	ENSP00000245539:A212V	ENSP00000245539:A212V	A	+	2	0	MRPS7	70773505	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCT		0.577	MRPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446666.1	NM_015971		17	56	0	0	0	0.010504	0	17	56				
TMEM105	284186	broad.mit.edu	37	17	79287682	79287682	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:79287682C>A	ENST00000332900.1	-	3	708	c.159G>T	c.(157-159)agG>agT	p.R53S		NM_178520.3	NP_848615.1	Q8N8V8	TM105_HUMAN	transmembrane protein 105	53						integral component of membrane (GO:0016021)		p.R53S(1)		NS(1)|large_intestine(3)|lung(1)|ovary(2)	7	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)			GGGGAGACGTCCTCGGGCCCT	0.607																																							uc002kad.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(157-159)AGG>AGT		transmembrane protein 105							35.0	44.0	41.0					17																	79287682		2201	4297	6498	SO:0001583	missense	284186					integral to membrane		g.chr17:79287682C>A	AK096111	CCDS11781.1	17q25.3	2008-04-21	2008-04-21	2008-04-21		ENSG00000185332			26794	protein-coding gene	gene with protein product							Standard	NM_178520		Approved	FLJ38792	uc002kad.2	Q8N8V8		ENST00000332900.1:c.159G>T	17.37:g.79287682C>A	ENSP00000329795:p.Arg53Ser						p.R53S	NM_178520	NP_848615	Q8N8V8	TM105_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)		3	709	-	all_neural(118;0.0804)|Melanoma(429;0.242)		53						Missense_Mutation	SNP	ENST00000332900.1	37	c.159G>T	CCDS11781.1	.	.	.	.	.	.	.	.	.	.	C	8.184	0.794591	0.16327	.	.	ENSG00000185332	ENST00000332900	T	0.55234	0.53	2.49	-2.81	0.05805	.	.	.	.	.	T	0.28101	0.0693	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.14023	0.01	T	0.19778	-1.0295	9	0.87932	D	0	.	7.0601	0.25121	0.0:0.3493:0.5314:0.1193	.	53	Q8N8V8	TM105_HUMAN	S	53	ENSP00000329795:R53S	ENSP00000329795:R53S	R	-	3	2	TMEM105	76902277	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.681000	0.00837	-0.572000	0.06006	-0.258000	0.10820	AGG		0.607	TMEM105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439607.1	NM_178520		35	66	1	0	2.87052e-16	0.005524	4.2068e-16	35	66				
OSBPL1A	114876	broad.mit.edu	37	18	21898723	21898723	+	Missense_Mutation	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr18:21898723C>G	ENST00000319481.3	-	8	882	c.676G>C	c.(676-678)Gtt>Ctt	p.V226L	MIR320C2_ENST00000390762.1_RNA	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	226	Interaction with RAB7A.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)	p.V226L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TTATTACCAACAAGAATGTGT	0.294																																							uc002kve.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(676-678)GTT>CTT		oxysterol-binding protein-like 1A isoform B							54.0	55.0	54.0					18																	21898723		2203	4294	6497	SO:0001583	missense	114876				cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding	g.chr18:21898723C>G	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.676G>C	18.37:g.21898723C>G	ENSP00000320291:p.Val226Leu					OSBPL1A_uc002kvf.3_Missense_Mutation_p.V6L|MIR320C2_hsa-mir-320c-2|MI0008191_5'Flank	p.V226L	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN			8	850	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		226					B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	c.676G>C	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444098	0.25987	.	.	ENSG00000141447	ENST00000319481	T	0.42131	0.98	5.53	-8.49	0.00931	Ankyrin repeat-containing domain (2);	3.621220	0.00669	N	0.000639	T	0.25494	0.0620	L	0.40543	1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14309	-1.0477	10	0.23302	T	0.38	0.1842	0.8671	0.01206	0.1899:0.2695:0.2794:0.2612	.	226;226	B0YJ56;Q9BXW6	.;OSBL1_HUMAN	L	226	ENSP00000320291:V226L	ENSP00000320291:V226L	V	-	1	0	OSBPL1A	20152721	0.002000	0.14202	0.000000	0.03702	0.910000	0.53928	-0.521000	0.06245	-2.419000	0.00565	-0.310000	0.09108	GTT		0.294	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597		16	39	0	0	0	0.004007	0	16	39				
ST8SIA3	51046	broad.mit.edu	37	18	55024510	55024510	+	Missense_Mutation	SNP	G	G	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr18:55024510G>C	ENST00000324000.3	+	3	2703	c.669G>C	c.(667-669)ttG>ttC	p.L223F		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	223					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.L223F(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		ACAATCTCTTGACTATTCAGG	0.423																																							uc002lgn.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(667-669)TTG>TTC		ST8 alpha-N-acetyl-neuraminide							54.0	55.0	55.0					18																	55024510		2203	4299	6502	SO:0001583	missense	51046				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	g.chr18:55024510G>C	AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.669G>C	18.37:g.55024510G>C	ENSP00000320431:p.Leu223Phe						p.L223F	NM_015879	NP_056963	O43173	SIA8C_HUMAN		READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)	3	1026	+			223			Lumenal (Potential).		A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	ENST00000324000.3	37	c.669G>C	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686921	0.29962	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.16073	2.37	5.85	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.15955	0.0384	L	0.60904	1.88	0.80722	D	1	P	0.39535	0.677	B	0.33121	0.158	T	0.02603	-1.1135	10	0.49607	T	0.09	-3.1986	9.3879	0.38354	0.0769:0.1447:0.7784:0.0	.	223	O43173	SIA8C_HUMAN	F	330;223	ENSP00000320431:L223F	ENSP00000320431:L223F	L	+	3	2	ST8SIA3	53175508	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.957000	0.40392	1.457000	0.47850	0.655000	0.94253	TTG		0.423	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879		13	49	0	0	0	0.013537	0	13	49				
ZNF516	9658	broad.mit.edu	37	18	74154250	74154250	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr18:74154250C>A	ENST00000443185.2	-	3	1078	c.761G>T	c.(760-762)gGc>gTc	p.G254V	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G254V(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GAAGGCCTGGCCACACACCTC	0.682																																							uc010dqx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(760-762)GGC>GTC		zinc finger protein 516							16.0	19.0	18.0					18																	74154250		2007	4187	6194	SO:0001583	missense	9658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:74154250C>A	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.761G>T	18.37:g.74154250C>A	ENSP00000394757:p.Gly254Val					ZNF516_uc002lme.2_RNA	p.G254V	NM_014643	NP_055458	Q92618	ZN516_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)	2	996	-		Prostate(75;0.0869)|Esophageal squamous(42;0.129)	254			C2H2-type 5.			Missense_Mutation	SNP	ENST00000443185.2	37	c.761G>T		.	.	.	.	.	.	.	.	.	.	C	23.4	4.406139	0.83230	.	.	ENSG00000101493	ENST00000443185	T	0.59906	0.23	4.52	4.52	0.55395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.77731	0.4174	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81665	-0.0830	9	0.87932	D	0	-2.9521	17.7817	0.88526	0.0:1.0:0.0:0.0	.	254	Q92618	ZN516_HUMAN	V	254	ENSP00000394757:G254V	ENSP00000394757:G254V	G	-	2	0	ZNF516	72283238	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.329000	0.79170	2.508000	0.84585	0.650000	0.86243	GGC		0.682	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643		9	10	1	0	1.12685e-05	0.004482	1.30612e-05	9	10				
AP3D1	8943	broad.mit.edu	37	19	2114283	2114283	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:2114283C>T	ENST00000345016.5	-	22	2673	c.2442G>A	c.(2440-2442)gaG>gaA	p.E814E	AP3D1_ENST00000355272.6_Silent_p.E814E|AP3D1_ENST00000356926.4_Silent_p.E723E|AP3D1_ENST00000350812.6_Silent_p.E645E	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	814					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.E814E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGGCAGTTTCTCGCTGTCGG	0.537																																							uc002luz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2440-2442)GAG>GAA		adaptor-related protein complex 3, delta 1							136.0	136.0	136.0					19																	2114283		2040	4172	6212	SO:0001819	synonymous_variant	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2114283C>T	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.2442G>A	19.37:g.2114283C>T						AP3D1_uc010dsv.2_5'Flank|AP3D1_uc002luy.2_Silent_p.E723E|AP3D1_uc002lva.2_Silent_p.E814E	p.E814E	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	22	2665	-		Hepatocellular(1079;0.137)	814					O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	ENST00000345016.5	37	c.2442G>A	CCDS42459.1																																																																																				0.537	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			12	41	0	0	0	0.00245	0	12	41				
AP3D1	8943	broad.mit.edu	37	19	2115314	2115314	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:2115314C>T	ENST00000345016.5	-	20	2484	c.2253G>A	c.(2251-2253)aaG>aaA	p.K751K	AP3D1_ENST00000355272.6_Silent_p.K751K|AP3D1_ENST00000356926.4_Silent_p.K660K|AP3D1_ENST00000350812.6_Silent_p.K582K	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	751					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.K751K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTTGCCcttcttctccttct	0.602																																							uc002luz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2251-2253)AAG>AAA		adaptor-related protein complex 3, delta 1							31.0	39.0	36.0					19																	2115314		2125	4219	6344	SO:0001819	synonymous_variant	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2115314C>T	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.2253G>A	19.37:g.2115314C>T						AP3D1_uc002luy.2_Silent_p.K660K|AP3D1_uc002lva.2_Silent_p.K751K	p.K751K	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	20	2476	-		Hepatocellular(1079;0.137)	751			Potential.		O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	ENST00000345016.5	37	c.2253G>A	CCDS42459.1																																																																																				0.602	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			13	47	0	0	0	0.013537	0	13	47				
AP3D1	8943	broad.mit.edu	37	19	2115341	2115341	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:2115341C>T	ENST00000345016.5	-	20	2457	c.2226G>A	c.(2224-2226)agG>agA	p.R742R	AP3D1_ENST00000355272.6_Silent_p.R742R|AP3D1_ENST00000356926.4_Silent_p.R651R|AP3D1_ENST00000350812.6_Silent_p.R573R	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	742					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.R742R(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		tctttttcctcctcttgtcct	0.642																																							uc002luz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2224-2226)AGG>AGA		adaptor-related protein complex 3, delta 1							35.0	43.0	41.0					19																	2115341		2091	4194	6285	SO:0001819	synonymous_variant	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2115341C>T	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.2226G>A	19.37:g.2115341C>T						AP3D1_uc002luy.2_Silent_p.R651R|AP3D1_uc002lva.2_Silent_p.R742R	p.R742R	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	20	2449	-		Hepatocellular(1079;0.137)	742			Potential.		O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	ENST00000345016.5	37	c.2226G>A	CCDS42459.1																																																																																				0.642	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			9	65	0	0	0	0.013537	0	9	65				
AP3D1	8943	broad.mit.edu	37	19	2115379	2115379	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:2115379C>T	ENST00000345016.5	-	20	2419	c.2188G>A	c.(2188-2190)Gag>Aag	p.E730K	AP3D1_ENST00000355272.6_Missense_Mutation_p.E730K|AP3D1_ENST00000356926.4_Missense_Mutation_p.E639K|AP3D1_ENST00000350812.6_Missense_Mutation_p.E561K	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	730					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.E730K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCCGCCGCTCCTCCTCCAGC	0.657																																							uc002luz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2188-2190)GAG>AAG		adaptor-related protein complex 3, delta 1							41.0	49.0	47.0					19																	2115379		2026	4168	6194	SO:0001583	missense	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2115379C>T	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.2188G>A	19.37:g.2115379C>T	ENSP00000344055:p.Glu730Lys					AP3D1_uc002luy.2_Missense_Mutation_p.E639K|AP3D1_uc002lva.2_Missense_Mutation_p.E730K	p.E730K	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	20	2411	-		Hepatocellular(1079;0.137)	730			Potential.		O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	c.2188G>A	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550054	0.45383	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.62364	2.25;0.03;1.6;0.03	4.67	3.6	0.41247	.	0.051240	0.85682	D	0.000000	T	0.50922	0.1644	L	0.58101	1.795	0.58432	D	0.999999	P;B;B	0.35011	0.48;0.048;0.104	B;B;B	0.31442	0.13;0.066;0.07	T	0.50701	-0.8797	10	0.05351	T	0.99	-32.5924	13.454	0.61189	0.0:0.8351:0.1649:0.0	.	730;730;639	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	K	639;730;730;730;561	ENSP00000349398:E639K;ENSP00000344055:E730K;ENSP00000347416:E730K;ENSP00000342321:E561K	ENSP00000341579:E730K	E	-	1	0	AP3D1	2066379	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	4.880000	0.63107	0.904000	0.36572	0.462000	0.41574	GAG		0.657	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			17	80	0	0	0	0.014323	0	17	80				
AP3D1	8943	broad.mit.edu	37	19	2115386	2115386	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:2115386C>T	ENST00000345016.5	-	20	2412	c.2181G>A	c.(2179-2181)ctG>ctA	p.L727L	AP3D1_ENST00000355272.6_Silent_p.L727L|AP3D1_ENST00000356926.4_Silent_p.L636L|AP3D1_ENST00000350812.6_Silent_p.L558L	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	727					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.L727L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCTCCTCCAGCTTCACAT	0.657																																							uc002luz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2179-2181)CTG>CTA		adaptor-related protein complex 3, delta 1							42.0	49.0	47.0					19																	2115386		2010	4157	6167	SO:0001819	synonymous_variant	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2115386C>T	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.2181G>A	19.37:g.2115386C>T						AP3D1_uc002luy.2_Silent_p.L636L|AP3D1_uc002lva.2_Silent_p.L727L	p.L727L	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	20	2404	-		Hepatocellular(1079;0.137)	727			Potential.		O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	ENST00000345016.5	37	c.2181G>A	CCDS42459.1																																																																																				0.657	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			18	76	0	0	0	0.00278	0	18	76				
AP3D1	8943	broad.mit.edu	37	19	2120872	2120872	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:2120872C>T	ENST00000345016.5	-	14	1701	c.1470G>A	c.(1468-1470)ggG>ggA	p.G490G	AP3D1_ENST00000590683.1_5'Flank|AP3D1_ENST00000355272.6_Silent_p.G490G|AP3D1_ENST00000356926.4_Silent_p.G399G|AP3D1_ENST00000350812.6_Silent_p.G321G	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	490					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.G490G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGAGAACTCCCCGCAGATCC	0.637																																							uc002luz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1468-1470)GGG>GGA		adaptor-related protein complex 3, delta 1							31.0	34.0	33.0					19																	2120872		2161	4271	6432	SO:0001819	synonymous_variant	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2120872C>T	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1470G>A	19.37:g.2120872C>T						AP3D1_uc002luy.2_Silent_p.G399G|AP3D1_uc002lva.2_Silent_p.G490G	p.G490G	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	14	1693	-		Hepatocellular(1079;0.137)	490					O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	ENST00000345016.5	37	c.1470G>A	CCDS42459.1																																																																																				0.637	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			6	36	0	0	0	0.001984	0	6	36				
MUC16	94025	broad.mit.edu	37	19	9046894	9046894	+	Silent	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:9046894A>G	ENST00000397910.4	-	5	34940	c.34737T>C	c.(34735-34737)acT>acC	p.T11579T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11581	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T7212T(1)|p.T11579T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGCAGGATGAGTGAGCCACG	0.522																																							uc002mkp.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(34735-34737)ACT>ACC		mucin 16							143.0	140.0	141.0					19																	9046894		1982	4151	6133	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9046894A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34737T>C	19.37:g.9046894A>G							p.T11579T	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			5	34941	-			11581			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.34737T>C	CCDS54212.1																																																																																				0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		3	34	0	0	0	0.004672	0	3	34				
MUC16	94025	broad.mit.edu	37	19	9063968	9063968	+	Silent	SNP	A	A	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:9063968A>C	ENST00000397910.4	-	3	23681	c.23478T>G	c.(23476-23478)gcT>gcG	p.A7826A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7828	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A7826A(2)|p.A3459A(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCAGGGAGGAAGCTAGCTCTG	0.542																																							uc002mkp.2		NA																	3	Substitution - coding silent(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(23476-23478)GCT>GCG		mucin 16							114.0	110.0	111.0					19																	9063968		2061	4216	6277	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9063968A>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23478T>G	19.37:g.9063968A>C							p.A7826A	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	23682	-			7828			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.23478T>G	CCDS54212.1																																																																																				0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		10	69	0	0	0	0.006214	0	10	69				
CDKN2D	1032	broad.mit.edu	37	19	10677830	10677830	+	Missense_Mutation	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:10677830C>G	ENST00000393599.2	-	2	729	c.405G>C	c.(403-405)agG>agC	p.R135S	KRI1_ENST00000537964.1_5'Flank|CDKN2D_ENST00000335766.2_Missense_Mutation_p.R135S|KRI1_ENST00000312962.6_5'Flank|KRI1_ENST00000361821.5_5'Flank	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)	135					autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.R135S(1)		endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			CCCTGGCGTCCCTGCGATGGA	0.612																																							uc002mpa.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(403-405)AGG>AGC		cyclin-dependent kinase inhibitor 2D							103.0	99.0	101.0					19																	10677830		2203	4300	6503	SO:0001583	missense	1032	Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System			anti-apoptosis|autophagic cell death|cell cycle arrest|DNA synthesis involved in DNA repair|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|negative regulation of caspase activity|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|response to retinoic acid|response to UV|response to vitamin D	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding	g.chr19:10677830C>G		CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273		ENST00000393599.2:c.405G>C	19.37:g.10677830C>G	ENSP00000377224:p.Arg135Ser					KRI1_uc002mox.1_5'Flank|KRI1_uc002moy.1_5'Flank|CDKN2D_uc002mpb.2_Missense_Mutation_p.R135S	p.R135S	NM_001800	NP_001791	P55273	CDN2D_HUMAN	Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)		2	707	-			135			ANK 3.		Q13102|Q6FGE9	Missense_Mutation	SNP	ENST00000393599.2	37	c.405G>C	CCDS12244.1	.	.	.	.	.	.	.	.	.	.	c	16.25	3.071359	0.55646	.	.	ENSG00000129355	ENST00000335766;ENST00000393599	T;T	0.66099	-0.19;-0.19	4.81	4.81	0.61882	Ankyrin repeat-containing domain (4);	0.141598	0.47093	D	0.000259	T	0.47229	0.1434	L	0.28694	0.88	0.47065	D	0.999303	B	0.16603	0.018	B	0.13407	0.009	T	0.44221	-0.9342	10	0.05525	T	0.97	-22.1666	16.6132	0.84899	0.0:1.0:0.0:0.0	.	135	P55273	CDN2D_HUMAN	S	135	ENSP00000337056:R135S;ENSP00000377224:R135S	ENSP00000337056:R135S	R	-	3	2	CDKN2D	10538830	0.980000	0.34600	1.000000	0.80357	0.943000	0.58893	0.352000	0.20113	2.214000	0.71695	0.462000	0.41574	AGG		0.612	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452030.1	NM_079421		8	78	0	0	0	0.004482	0	8	78				
FXYD7	53822	broad.mit.edu	37	19	35642229	35642229	+	Missense_Mutation	SNP	T	T	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:35642229T>G	ENST00000270310.2	+	3	218	c.134T>G	c.(133-135)aTc>aGc	p.I45S	FXYD7_ENST00000588265.1_Missense_Mutation_p.I45S|FXYD7_ENST00000586063.1_Missense_Mutation_p.I45S|CTD-2527I21.4_ENST00000592174.1_RNA	NM_022006.1	NP_071289.1	P58549	FXYD7_HUMAN	FXYD domain containing ion transport regulator 7	45					ion transmembrane transport (GO:0034220)|regulation of ion transport (GO:0043269)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)	p.I45S(1)|p.I45T(1)		NS(1)|endometrium(1)|lung(1)	3	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;2.32e-21)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;2.43e-18)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CTCATCGTCATCAGTAAGTGC	0.542																																							uc002nye.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)		0						c.(133-135)ATC>AGC		FXYD domain-containing ion transport regulator							229.0	185.0	200.0					19																	35642229		2203	4300	6503	SO:0001583	missense	53822					integral to membrane	ion channel activity	g.chr19:35642229T>G	AI929519	CCDS12446.1	19q13.1	2008-02-05	2002-01-14			ENSG00000221946			4034	protein-coding gene	gene with protein product		606684	"""FXYD domain-containing ion transport regulator 7"""				Standard	NM_022006		Approved		uc002nye.1	P58549		ENST00000270310.2:c.134T>G	19.37:g.35642229T>G	ENSP00000270310:p.Ile45Ser					FXYD7_uc002nyf.1_Missense_Mutation_p.I45S	p.I45S	NM_022006	NP_071289	P58549	FXYD7_HUMAN	Epithelial(14;2.32e-21)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;2.43e-18)|LUSC - Lung squamous cell carcinoma(66;0.0849)		3	218	+	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		45			Helical; (Potential).			Missense_Mutation	SNP	ENST00000270310.2	37	c.134T>G	CCDS12446.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.423241	0.43020	.	.	ENSG00000221946	ENST00000270310	T	0.63580	-0.05	3.68	3.68	0.42216	.	.	.	.	.	T	0.50769	0.1635	.	.	.	0.28168	N	0.928687	P	0.35208	0.49	B	0.32762	0.152	T	0.52616	-0.8552	8	0.87932	D	0	.	8.9052	0.35519	0.0:0.0:0.0:1.0	.	45	P58549	FXYD7_HUMAN	S	45	ENSP00000270310:I45S	ENSP00000270310:I45S	I	+	2	0	FXYD7	40334069	0.986000	0.35501	0.993000	0.49108	0.719000	0.41307	3.420000	0.52735	1.673000	0.50895	0.434000	0.28630	ATC		0.542	FXYD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460657.1	NM_022006		10	105	0	0	0	0.013537	0	10	105				
PLEKHG2	64857	broad.mit.edu	37	19	39915029	39915029	+	Missense_Mutation	SNP	G	G	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:39915029G>C	ENST00000409794.3	+	19	4106	c.3256G>C	c.(3256-3258)Gat>Cat	p.D1086H	CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.D1057H|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.D1027H	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1086	Pro-rich.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D1044H(1)|p.D1027H(1)|p.D1086H(1)		breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AAGCAGCCTGGATCCCCAGGG	0.582																																							uc010xuz.1		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)|pancreas(1)|breast(1)	4						c.(3256-3258)GAT>CAT		common-site lymphoma/leukemia guanine nucleotide							96.0	100.0	98.0					19																	39915029		2203	4300	6503	SO:0001583	missense	64857				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr19:39915029G>C	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3256G>C	19.37:g.39915029G>C	ENSP00000386733:p.Asp1086His					PLEKHG2_uc010xuy.1_Missense_Mutation_p.D1027H|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.D864H	p.D1086H	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)		19	3581	+	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		1086			Pro-rich.		B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	37	c.3256G>C	CCDS33022.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.56|13.56	2.273820|2.273820	0.40194|0.40194	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508|ENST00000205135	T;T;T|.	0.79247|.	-1.08;-1.15;-1.25|.	3.68|3.68	1.55|1.55	0.23275|0.23275	.|.	0.662303|.	0.13273|.	N|.	0.400398|.	T|T	0.43211|0.43211	0.1237|0.1237	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	0.999994|0.999994	D;D;D|.	0.89917|.	1.0;0.995;0.999|.	D;P;D|.	0.85130|.	0.997;0.599;0.993|.	T|T	0.32745|0.32745	-0.9895|-0.9895	10|5	0.87932|.	D|.	0|.	.|.	5.8466|5.8466	0.18669|0.18669	0.2429:0.0:0.7571:0.0|0.2429:0.0:0.7571:0.0	.|.	1057;1086;1027|.	Q9H7P9-3;Q9H7P9;E7ESZ3|.	.;PKHG2_HUMAN;.|.	H|C	1086;1057;1027|953	ENSP00000386733:D1086H;ENSP00000392906:D1057H;ENSP00000408857:D1027H|.	ENSP00000386733:D1086H|.	D|W	+|+	1|3	0|0	PLEKHG2|PLEKHG2	44606869|44606869	0.038000|0.038000	0.19896|0.19896	0.008000|0.008000	0.14137|0.14137	0.005000|0.005000	0.04900|0.04900	0.639000|0.639000	0.24690|0.24690	0.555000|0.555000	0.29079|0.29079	0.491000|0.491000	0.48974|0.48974	GAT|TGG		0.582	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835		19	45	0	0	0	0.006122	0	19	45				
FCGBP	8857	broad.mit.edu	37	19	40434113	40434113	+	Nonsense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:40434113G>T	ENST00000221347.6	-	2	163	c.156C>A	c.(154-156)taC>taA	p.Y52*		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	52	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)		p.Y52*(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGAGGCGGGGGTAGGCCTTGC	0.577																																							uc002omp.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(154-156)TAC>TAA		Fc fragment of IgG binding protein precursor							84.0	77.0	79.0					19																	40434113		2203	4300	6503	SO:0001587	stop_gained	8857					extracellular region	protein binding	g.chr19:40434113G>T	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.156C>A	19.37:g.40434113G>T	ENSP00000221347:p.Tyr52*						p.Y52*	NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		2	164	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		52			IgGFc-binding.		O95784	Nonsense_Mutation	SNP	ENST00000221347.6	37	c.156C>A	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	6.993	0.553328	0.13374	.	.	ENSG00000090920	ENST00000221347	.	.	.	4.13	-8.26	0.01021	.	2.523000	0.01775	N	0.031432	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	10.3359	0.43850	0.627:0.2324:0.1406:0.0	.	.	.	.	X	52	.	ENSP00000221347:Y52X	Y	-	3	2	FCGBP	45125953	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.836000	0.04382	-2.082000	0.00868	-0.140000	0.14226	TAC		0.577	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		19	65	1	0	1.28384e-07	0.012319	1.56641e-07	19	65				
ZNF225	7768	broad.mit.edu	37	19	44635941	44635941	+	Nonsense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:44635941C>T	ENST00000262894.6	+	5	1454	c.1174C>T	c.(1174-1176)Cga>Tga	p.R392*	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Nonsense_Mutation_p.R392*	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R392*(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				AAGACATGTGCGAGTCCACAG	0.428																																							uc002oyj.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1174-1176)CGA>TGA		zinc finger protein 225							83.0	88.0	87.0					19																	44635941		2175	4289	6464	SO:0001587	stop_gained	7768				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44635941C>T	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1174C>T	19.37:g.44635941C>T	ENSP00000262894:p.Arg392*					ZNF225_uc010eje.1_Nonsense_Mutation_p.R309*|ZNF225_uc010ejf.1_Nonsense_Mutation_p.R392*	p.R392*	NM_013362	NP_037494	Q9UK10	ZN225_HUMAN			5	1417	+		Prostate(69;0.0352)|all_neural(266;0.202)	392			C2H2-type 8.		A8K8S2|Q53F12|Q9NS46|Q9UID8	Nonsense_Mutation	SNP	ENST00000262894.6	37	c.1174C>T	CCDS46100.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853948	0.91355	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	.	.	.	2.21	-4.19	0.03835	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.241	0.20791	0.2223:0.533:0.2447:0.0	.	.	.	.	X	392;356	.	ENSP00000262894:R392X	R	+	1	2	ZNF225	49327781	0.000000	0.05858	0.012000	0.15200	0.412000	0.31113	-5.663000	0.00106	-1.165000	0.02786	0.462000	0.41574	CGA		0.428	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1			9	93	0	0	0	0.008291	0	9	93				
RSPH6A	81492	broad.mit.edu	37	19	46307742	46307742	+	Missense_Mutation	SNP	G	G	A	rs76423334	byFrequency	TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:46307742G>A	ENST00000221538.3	-	3	1563	c.1421C>T	c.(1420-1422)cCg>cTg	p.P474L	RSPH6A_ENST00000600188.1_Missense_Mutation_p.P210L|RSPH6A_ENST00000597055.1_Missense_Mutation_p.P474L	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	474						intracellular (GO:0005622)		p.P474L(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CTCGTTGCCCGGGAAGGGTGG	0.632													G|||	12	0.00239617	0.0008	0.0	5008	,	,		18086	0.0099		0.0	False		,,,				2504	0.001						uc002pdm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1420-1422)CCG>CTG		radial spokehead-like 1		G	LEU/PRO	0,4406		0,0,2203	75.0	61.0	66.0		1421	3.8	1.0	19	dbSNP_131	66	1,8599	1.2+/-3.3	0,1,4299	yes	missense	RSPH6A	NM_030785.3	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	474/718	46307742	1,13005	2203	4300	6503	SO:0001583	missense	81492					intracellular		g.chr19:46307742G>A	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1421C>T	19.37:g.46307742G>A	ENSP00000221538:p.Pro474Leu					RSPH6A_uc002pdl.2_Missense_Mutation_p.P210L	p.P474L	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN			3	1564	-			474					Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	37	c.1421C>T	CCDS12675.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	G	22.7	4.321897	0.81580	0.0	1.16E-4	ENSG00000104941	ENST00000221538	T	0.19669	2.13	3.8	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.44498	0.1296	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61073	-0.7136	10	0.87932	D	0	-10.9745	14.008	0.64478	0.0:0.0:1.0:0.0	.	474	Q9H0K4	RSH6A_HUMAN	L	474	ENSP00000221538:P474L	ENSP00000221538:P474L	P	-	2	0	RSPH6A	50999582	1.000000	0.71417	0.970000	0.41538	0.845000	0.48019	9.204000	0.95041	2.428000	0.82296	0.456000	0.33151	CCG		0.632	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1			4	53	0	0	0	0.000602	0	4	53				
ZNF813	126017	broad.mit.edu	37	19	53995018	53995018	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:53995018C>T	ENST00000396403.4	+	4	1660	c.1532C>T	c.(1531-1533)gCa>gTa	p.A511V	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A511V(1)		large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		ACACACCTTGCATGTCATCAT	0.388																																							uc002qbu.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1531-1533)GCA>GTA		zinc finger protein 813							53.0	56.0	55.0					19																	53995018		2198	4297	6495	SO:0001583	missense	126017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53995018C>T	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1532C>T	19.37:g.53995018C>T	ENSP00000379684:p.Ala511Val					ZNF813_uc010eqq.1_Intron	p.A511V	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN		GBM - Glioblastoma multiforme(134;0.00619)	4	1660	+			511			C2H2-type 11.			Missense_Mutation	SNP	ENST00000396403.4	37	c.1532C>T	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	c	0.923	-0.715234	0.03206	.	.	ENSG00000198346	ENST00000396403	T	0.16897	2.31	1.32	-2.63	0.06133	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08358	0.0208	N	0.16903	0.455	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.30357	-0.9981	9	0.31617	T	0.26	.	4.5196	0.11952	0.0:0.531:0.1787:0.2903	.	511	Q6ZN06	ZN813_HUMAN	V	511	ENSP00000379684:A511V	ENSP00000379684:A511V	A	+	2	0	ZNF813	58686830	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.034000	0.01424	-1.813000	0.01226	-1.073000	0.02249	GCA		0.388	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301		3	37	0	0	0	0.004672	0	3	37				
ZNF551	90233	broad.mit.edu	37	19	58196753	58196753	+	Splice_Site	SNP	G	G	T	rs142211450		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:58196753G>T	ENST00000282296.5	+	2	390	c.205G>T	c.(205-207)Ggt>Tgt	p.G69C	AC003006.7_ENST00000599221.1_Intron|ZNF551_ENST00000356715.4_Splice_Site_p.G53C|ZNF551_ENST00000599402.1_Intron|ZNF551_ENST00000596085.1_Splice_Site_p.D53Y|AC003006.7_ENST00000594684.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G53C(1)		endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AACATCCCTGGGTAAGGCCCT	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		21033	0.0		0.001	False		,,,				2504	0.0						uc002qpw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(157-159)GGT>TGT		zinc finger protein 551							238.0	214.0	222.0					19																	58196753		2203	4300	6503	SO:0001630	splice_region_variant	90233				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58196753G>T	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.205+1G>T	19.37:g.58196753G>T						ZNF551_uc002qpv.3_Intron|ZNF776_uc002qpx.2_Intron	p.G53C	NM_138347	NP_612356	Q7Z340	ZN551_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	2	380	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	69			KRAB.		B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	37	c.157G>T	CCDS12959.2	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	13.62|13.62	2.291146|2.291146	0.40494|0.40494	.|.	.|.	ENSG00000204519|ENSG00000204519	ENST00000356715;ENST00000282296|ENST00000359821	.|.	.|.	.|.	2.17|2.17	1.12|1.12	0.20585|0.20585	Krueppel-associated box (4);|.	.|.	.|.	.|.	.|.	T|T	0.69717|0.69717	0.3142|0.3142	M|M	0.92970|0.92970	3.365|3.365	0.47476|0.47476	D|D	0.999437|0.999437	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.65561|0.65561	-0.6138|-0.6138	8|6	0.72032|0.09590	D|T	0.01|0.72	.|.	4.605|4.605	0.12372|0.12372	0.1899:0.0:0.8101:0.0|0.1899:0.0:0.8101:0.0	.|.	69|.	Q7Z340|.	ZN551_HUMAN|.	C|F	69;53|41	.|.	ENSP00000282296:G53C|ENSP00000352875:V41F	G|V	+|+	1|1	0|0	ZNF551|ZNF551	62888565|62888565	1.000000|1.000000	0.71417|0.71417	0.606000|0.606000	0.28943|0.28943	0.045000|0.045000	0.14185|0.14185	2.853000|2.853000	0.48317|0.48317	0.470000|0.470000	0.27294|0.27294	0.462000|0.462000	0.41574|0.41574	GGT|GTT		0.478	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	Missense_Mutation	22	175	1	0	6.32553e-13	0.004656	8.91166e-13	22	175				
C19orf18	147685	broad.mit.edu	37	19	58472789	58472789	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:58472789C>T	ENST00000314391.3	-	5	603	c.502G>A	c.(502-504)Gaa>Aaa	p.E168K		NM_152474.4	NP_689687.1	Q8NEA5	CS018_HUMAN	chromosome 19 open reading frame 18	168						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E168K(1)		large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		AGCTCATTTTCGTTCTCTGGA	0.488																																							uc002qqv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(502-504)GAA>AAA		hypothetical protein LOC147685 precursor							158.0	122.0	135.0					19																	58472789		2203	4300	6503	SO:0001583	missense	147685					integral to membrane		g.chr19:58472789C>T	BC033933	CCDS12967.1	19q13.43	2013-03-11			ENSG00000177025	ENSG00000177025			28642	protein-coding gene	gene with protein product						12477932	Standard	NM_152474		Approved	MGC41906	uc002qqv.3	Q8NEA5	OTTHUMG00000183450	ENST00000314391.3:c.502G>A	19.37:g.58472789C>T	ENSP00000321519:p.Glu168Lys						p.E168K	NM_152474	NP_689687	Q8NEA5	CS018_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)	5	606	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	168			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000314391.3	37	c.502G>A	CCDS12967.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763139	0.49574	.	.	ENSG00000177025	ENST00000314391	T	0.61274	0.12	4.07	4.07	0.47477	.	0.000000	0.43919	D	0.000507	T	0.63546	0.2520	L	0.34521	1.04	0.31843	N	0.623215	D	0.89917	1.0	D	0.70227	0.968	T	0.68462	-0.5402	10	0.87932	D	0	-4.5528	12.056	0.53536	0.0:1.0:0.0:0.0	.	168	Q8NEA5	CS018_HUMAN	K	168	ENSP00000321519:E168K	ENSP00000321519:E168K	E	-	1	0	C19orf18	63164601	0.992000	0.36948	0.990000	0.47175	0.091000	0.18340	2.701000	0.47094	2.558000	0.86282	0.561000	0.74099	GAA		0.488	C19orf18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466704.1	NM_152474		4	69	0	0	0	0.000602	0	4	69				
ZNF638	27332	broad.mit.edu	37	2	71629097	71629097	+	Missense_Mutation	SNP	A	A	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:71629097A>C	ENST00000409544.1	+	16	3339	c.2709A>C	c.(2707-2709)gaA>gaC	p.E903D	ZNF638_ENST00000264447.4_Missense_Mutation_p.E903D|ZNF638_ENST00000355812.3_Missense_Mutation_p.E903D	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	903					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E903D(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AAACAGAAGAAATGTGTGTGA	0.269																																							uc002shx.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(2707-2709)GAA>GAC		zinc finger protein 638							72.0	77.0	75.0					2																	71629097		2203	4297	6500	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71629097A>C	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2709A>C	2.37:g.71629097A>C	ENSP00000386433:p.Glu903Asp					ZNF638_uc010yqw.1_Missense_Mutation_p.E482D|ZNF638_uc002shy.2_Missense_Mutation_p.E903D|ZNF638_uc002shz.2_Missense_Mutation_p.E903D|ZNF638_uc002sia.2_Missense_Mutation_p.E903D|ZNF638_uc002sib.1_Missense_Mutation_p.E903D|ZNF638_uc010fed.2_RNA|ZNF638_uc002sic.2_5'UTR	p.E903D	NM_014497	NP_055312	Q14966	ZN638_HUMAN			16	3028	+			903					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.2709A>C	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	A	12.50	1.955913	0.34471	.	.	ENSG00000075292	ENST00000394137;ENST00000355812;ENST00000264447;ENST00000409544	T;T;T	0.57595	0.39;1.4;1.4	5.69	1.77	0.24775	.	0.445384	0.24291	N	0.039804	T	0.32852	0.0843	L	0.28740	0.885	0.80722	D	1	P;B;P;P	0.42692	0.682;0.417;0.787;0.682	B;B;B;B	0.38500	0.142;0.153;0.275;0.142	T	0.03945	-1.0990	10	0.27785	T	0.31	-20.9936	5.6827	0.17784	0.6958:0.1444:0.1598:0.0	.	903;903;903;903	A8K583;Q14966-4;Q14966-3;Q14966	.;.;.;ZN638_HUMAN	D	482;903;903;903	ENSP00000348066:E903D;ENSP00000264447:E903D;ENSP00000386433:E903D	ENSP00000264447:E903D	E	+	3	2	ZNF638	71482605	0.999000	0.42202	1.000000	0.80357	0.969000	0.65631	0.402000	0.20965	0.990000	0.38787	0.477000	0.44152	GAA		0.269	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		5	58	0	0	0	0.000602	0	5	58				
TEX37	200523	broad.mit.edu	37	2	88828809	88828809	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:88828809G>T	ENST00000303254.3	+	4	502	c.360G>T	c.(358-360)caG>caT	p.Q120H		NM_152670.2	NP_689883.1	Q96LM6	TEX37_HUMAN	testis expressed 37	120						nucleus (GO:0005634)		p.Q120H(1)									ACCTGGCCCAGGGTGACCCCA	0.592																																							uc002stb.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(358-360)CAG>CAT		chromosome 2 open reading frame 51							122.0	111.0	115.0					2																	88828809		2203	4300	6503	SO:0001583	missense	200523					nucleus		g.chr2:88828809G>T	AK058098	CCDS2003.1	2p11.2	2014-01-28	2012-09-14	2012-09-14	ENSG00000172073	ENSG00000172073			26341	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 21kDa"""		"""chromosome 2 open reading frame 51"""	C2orf51		17091336	Standard	NM_152670		Approved	FLJ25369, TSC21	uc002stb.2	Q96LM6	OTTHUMG00000130332	ENST00000303254.3:c.360G>T	2.37:g.88828809G>T	ENSP00000307142:p.Gln120His						p.Q120H	NM_152670	NP_689883	Q96LM6	TSC21_HUMAN			4	502	+			120						Missense_Mutation	SNP	ENST00000303254.3	37	c.360G>T	CCDS2003.1	.	.	.	.	.	.	.	.	.	.	G	6.312	0.425629	0.11987	.	.	ENSG00000172073	ENST00000303254	T	0.45668	0.89	4.19	-2.39	0.06602	.	0.969053	0.08471	N	0.940947	T	0.18130	0.0435	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.19063	-1.0317	10	0.23302	T	0.38	-3.3584	2.8924	0.05680	0.177:0.4426:0.2453:0.1351	.	120	Q96LM6	TSC21_HUMAN	H	120	ENSP00000307142:Q120H	ENSP00000307142:Q120H	Q	+	3	2	C2orf51	88609924	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	-0.169000	0.09911	-0.503000	0.06586	-0.502000	0.04539	CAG		0.592	TEX37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252682.1	NM_152670		23	64	1	0	6.44725e-10	0.014323	8.47448e-10	23	64				
TEX37	200523	broad.mit.edu	37	2	88828903	88828903	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:88828903C>A	ENST00000303254.3	+	4	596	c.454C>A	c.(454-456)Cta>Ata	p.L152I		NM_152670.2	NP_689883.1	Q96LM6	TEX37_HUMAN	testis expressed 37	152						nucleus (GO:0005634)		p.L152I(1)									AGGCTACCTGCTACTGCCAGG	0.562																																							uc002stb.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(454-456)CTA>ATA		chromosome 2 open reading frame 51							91.0	84.0	87.0					2																	88828903		2203	4300	6503	SO:0001583	missense	200523					nucleus		g.chr2:88828903C>A	AK058098	CCDS2003.1	2p11.2	2014-01-28	2012-09-14	2012-09-14	ENSG00000172073	ENSG00000172073			26341	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 21kDa"""		"""chromosome 2 open reading frame 51"""	C2orf51		17091336	Standard	NM_152670		Approved	FLJ25369, TSC21	uc002stb.2	Q96LM6	OTTHUMG00000130332	ENST00000303254.3:c.454C>A	2.37:g.88828903C>A	ENSP00000307142:p.Leu152Ile						p.L152I	NM_152670	NP_689883	Q96LM6	TSC21_HUMAN			4	596	+			152						Missense_Mutation	SNP	ENST00000303254.3	37	c.454C>A	CCDS2003.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068591	0.36470	.	.	ENSG00000172073	ENST00000303254	T	0.57595	0.39	4.32	4.32	0.51571	.	0.000000	0.38663	N	0.001613	T	0.61565	0.2357	L	0.36672	1.1	0.23070	N	0.998344	D	0.76494	0.999	D	0.83275	0.996	T	0.53337	-0.8453	10	0.87932	D	0	-21.1687	12.622	0.56607	0.0:1.0:0.0:0.0	.	152	Q96LM6	TSC21_HUMAN	I	152	ENSP00000307142:L152I	ENSP00000307142:L152I	L	+	1	2	C2orf51	88610018	0.347000	0.24853	0.363000	0.25875	0.012000	0.07955	2.901000	0.48695	2.689000	0.91719	0.561000	0.74099	CTA		0.562	TEX37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252682.1	NM_152670		23	49	1	0	1.10923e-09	0.00278	1.44313e-09	23	49				
CNTNAP5	129684	broad.mit.edu	37	2	125530567	125530567	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:125530567C>A	ENST00000431078.1	+	17	3086	c.2722C>A	c.(2722-2724)Ctg>Atg	p.L908M		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	908	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.L908M(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CCATTTTCGACTGCAGCTGAA	0.532																																							uc002tno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)	10						c.(2722-2724)CTG>ATG		contactin associated protein-like 5 precursor							113.0	107.0	109.0					2																	125530567		1915	4131	6046	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125530567C>A	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2722C>A	2.37:g.125530567C>A	ENSP00000399013:p.Leu908Met					CNTNAP5_uc010flu.2_Missense_Mutation_p.L909M	p.L908M	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	17	3086	+			908			Laminin G-like 3.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.2722C>A	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	c	16.69	3.194505	0.58017	.	.	ENSG00000155052	ENST00000431078	T	0.41758	0.99	5.63	-5.2	0.02823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.224038	0.21918	N	0.067210	T	0.61035	0.2315	M	0.84773	2.715	0.31348	N	0.682866	D	0.64830	0.994	D	0.65573	0.936	T	0.67875	-0.5557	10	0.52906	T	0.07	.	16.1657	0.81754	0.0:0.2981:0.0:0.7019	.	908	Q8WYK1	CNTP5_HUMAN	M	908	ENSP00000399013:L908M	ENSP00000399013:L908M	L	+	1	2	CNTNAP5	125247037	0.005000	0.15991	0.021000	0.16686	0.976000	0.68499	-0.044000	0.12023	-0.927000	0.03766	-0.150000	0.13652	CTG		0.532	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			38	81	1	0	3.09479e-21	0.006999	4.78285e-21	38	81				
NCKAP5	344148	broad.mit.edu	37	2	133543111	133543111	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:133543111C>T	ENST00000409261.1	-	14	1646	c.1273G>A	c.(1273-1275)Ggt>Agt	p.G425S	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.G425S|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	425								p.G425S(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TCTTTATAACCCCATTTGGTT	0.438																																							uc002ttp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1273-1275)GGT>AGT		Nck-associated protein 5 isoform 1							94.0	88.0	90.0					2																	133543111		1834	4092	5926	SO:0001583	missense	344148						protein binding	g.chr2:133543111C>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1273G>A	2.37:g.133543111C>T	ENSP00000387128:p.Gly425Ser					NCKAP5_uc002ttq.2_Intron	p.G425S	NM_207363	NP_997246	O14513	NCKP5_HUMAN			14	1647	-			425					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.1273G>A	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	c	24.7	4.562611	0.86335	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.20463	2.07;2.07	5.23	5.23	0.72850	.	0.000000	0.35067	U	0.003467	T	0.34832	0.0911	L	0.32530	0.975	0.80722	D	1	D	0.56521	0.976	D	0.62955	0.909	T	0.04796	-1.0926	10	0.87932	D	0	.	17.1771	0.86844	0.0:1.0:0.0:0.0	.	425	O14513	NCKP5_HUMAN	S	425	ENSP00000387128:G425S;ENSP00000380603:G425S	ENSP00000380603:G425S	G	-	1	0	NCKAP5	133259581	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.816000	0.62642	2.714000	0.92807	0.645000	0.84053	GGT		0.438	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		5	81	0	0	0	0.001168	0	5	81				
PDK1	5163	broad.mit.edu	37	2	173435514	173435514	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:173435514G>A	ENST00000282077.3	+	8	1089	c.907G>A	c.(907-909)Gtt>Att	p.V303I	PDK1_ENST00000392571.2_Missense_Mutation_p.V323I|PDK1_ENST00000544863.1_Missense_Mutation_p.V148I|PDK1_ENST00000543905.1_Missense_Mutation_p.V227I|PDK1_ENST00000410055.1_Missense_Mutation_p.V303I			Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase, isozyme 1	303	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell proliferation (GO:0008283)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.V303I(1)		central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.12)			CCCTATTCAAGTTCATGTCAC	0.353									Autosomal Dominant Polycystic Kidney Disease																														uc002uhr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|central_nervous_system(1)	4						c.(907-909)GTT>ATT		pyruvate dehydrogenase kinase 1 precursor							131.0	120.0	124.0					2																	173435514		2203	4300	6503	SO:0001583	missense	5163	Autosomal_Dominant_Polycystic_Kidney_Disease	Familial Cancer Database	ADPKD	glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity	g.chr2:173435514G>A	L42450	CCDS2250.1, CCDS63059.1	2q31.1	2008-05-23	2005-11-16		ENSG00000152256	ENSG00000152256			8809	protein-coding gene	gene with protein product		602524	"""pyruvate dehydrogenase kinase, isoenzyme 1"""			7499431	Standard	NR_103731		Approved		uc002uhs.3	Q15118	OTTHUMG00000132285	ENST00000282077.3:c.907G>A	2.37:g.173435514G>A	ENSP00000282077:p.Val303Ile					PDK1_uc010zdz.1_Missense_Mutation_p.V148I|PDK1_uc010zea.1_RNA|PDK1_uc002uhq.1_Missense_Mutation_p.V323I|PDK1_uc002uhs.2_Missense_Mutation_p.V303I|PDK1_uc010zeb.1_Missense_Mutation_p.V323I	p.V303I	NM_002610	NP_002601	Q15118	PDK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.12)		8	1007	+			303			Histidine kinase.		B2R6T1|B7Z937|D3DPD8|E9PD65|Q308M4	Missense_Mutation	SNP	ENST00000282077.3	37	c.907G>A	CCDS2250.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.729241	0.69074	.	.	ENSG00000152256	ENST00000543905;ENST00000544863;ENST00000282077;ENST00000392571;ENST00000410055;ENST00000416991	T;T;T;T;T;T	0.69175	0.48;0.48;0.48;0.48;0.48;-0.38	5.78	5.78	0.91487	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.052879	0.85682	D	0.000000	T	0.69566	0.3125	L	0.42245	1.32	0.80722	D	1	B;P	0.35456	0.095;0.502	B;P	0.44696	0.444;0.458	T	0.64740	-0.6336	10	0.33940	T	0.23	-20.5084	19.9987	0.97401	0.0:0.0:1.0:0.0	.	303;323	Q15118;E9PD65	PDK1_HUMAN;.	I	227;148;303;323;303;221	ENSP00000438567:V227I;ENSP00000437502:V148I;ENSP00000282077:V303I;ENSP00000376352:V323I;ENSP00000386985:V303I;ENSP00000399160:V221I	ENSP00000282077:V303I	V	+	1	0	PDK1	173143760	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	8.013000	0.88655	2.738000	0.93877	0.591000	0.81541	GTT		0.353	PDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255380.3	NM_002610		20	48	0	0	0	0.00333	0	20	48				
DNAH7	56171	broad.mit.edu	37	2	196825586	196825586	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:196825586C>A	ENST00000312428.6	-	18	2389	c.2289G>T	c.(2287-2289)ttG>ttT	p.L763F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	763	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.L763F(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GATAAGGGTTCAAGCCATCTT	0.393																																							uc002utj.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(10)|ovary(2)	12						c.(2287-2289)TTG>TTT		dynein, axonemal, heavy chain 7							104.0	96.0	99.0					2																	196825586		1849	4094	5943	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196825586C>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2289G>T	2.37:g.196825586C>A	ENSP00000311273:p.Leu763Phe						p.L763F	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN			18	2390	-			763			Stem (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.2289G>T	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326526	0.41197	.	.	ENSG00000118997	ENST00000312428	T	0.62232	0.04	5.74	4.86	0.63082	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	D	0.000007	T	0.67692	0.2920	L	0.46614	1.455	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.64833	-0.6314	10	0.24483	T	0.36	.	6.8923	0.24236	0.1512:0.7016:0.0:0.1472	.	763	Q8WXX0	DYH7_HUMAN	F	763	ENSP00000311273:L763F	ENSP00000311273:L763F	L	-	3	2	DNAH7	196533831	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	0.817000	0.27281	1.436000	0.47453	-0.142000	0.14014	TTG		0.393	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		7	133	1	0	2.7689e-08	0.001984	3.44424e-08	7	133				
MDH1B	130752	broad.mit.edu	37	2	207615733	207615733	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:207615733C>A	ENST00000374412.3	-	6	1252	c.977G>T	c.(976-978)aGg>aTg	p.R326M	MDH1B_ENST00000449792.1_Missense_Mutation_p.R228M|MDH1B_ENST00000454776.2_Missense_Mutation_p.R326M|MDH1B_ENST00000392214.2_Intron	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	326					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.R326M(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		TCTGTACACCCTTGTTTTTCT	0.338																																					Pancreas(76;29 1355 28675 37177 51207)	Pancreas(76;29 1355 28675 37177 51207)	uc002vbs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)	4						c.(976-978)AGG>ATG		malate dehydrogenase 1B, NAD (soluble)							126.0	127.0	127.0					2																	207615733		2203	4299	6502	SO:0001583	missense	130752				carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity	g.chr2:207615733C>A		CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.977G>T	2.37:g.207615733C>A	ENSP00000363533:p.Arg326Met					MDH1B_uc010ziw.1_Intron|MDH1B_uc010fui.2_Missense_Mutation_p.R326M|MDH1B_uc010fuj.2_Missense_Mutation_p.R228M|MDH1B_uc002vbt.2_Intron	p.R326M	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)	6	1032	-			326					A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	ENST00000374412.3	37	c.977G>T	CCDS33365.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223146	0.58668	.	.	ENSG00000138400	ENST00000374412;ENST00000449792;ENST00000454776	T;T;T	0.09163	3.01;3.01;3.01	5.97	-3.26	0.05064	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.259999	0.43747	D	0.000533	T	0.10895	0.0266	L	0.38175	1.15	0.37452	D	0.914878	P;P	0.40000	0.648;0.698	B;P	0.45558	0.353;0.485	T	0.02574	-1.1139	10	0.72032	D	0.01	-10.511	11.8163	0.52214	0.0:0.3699:0.0:0.6301	.	326;326	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	M	326;228;326	ENSP00000363533:R326M;ENSP00000416577:R228M;ENSP00000389916:R326M	ENSP00000363533:R326M	R	-	2	0	MDH1B	207323978	0.217000	0.23597	0.001000	0.08648	0.992000	0.81027	0.539000	0.23175	-0.736000	0.04831	-0.290000	0.09829	AGG		0.338	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256429.2	NM_001039845		11	97	1	0	5.50884e-06	0.013537	6.47352e-06	11	97				
C2orf80	389073	broad.mit.edu	37	2	209049756	209049757	+	Splice_Site	DNP	CC	CC	AA			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:209049756_209049757CC>AA	ENST00000341287.4	-	3	237	c.42_42GG>TT	c.(40-42)ttGG>ttTTg	p.L14F	C2orf80_ENST00000451346.1_Intron|C2orf80_ENST00000453017.1_Splice_Site_p.L14F	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80	14								p.?(1)		endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						TATAATCTCCCCTTAAAAGCAA	0.446																																							uc002vcr.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e3-1		hypothetical protein LOC389073																																				SO:0001630	splice_region_variant	389073							g.chr2:209049756_209049757CC>AA	AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.42_42delinsAA	2.37:g.209049756_209049757delinsAA							p.L14_splice	NM_001099334	NP_001092804	Q0P641	CB080_HUMAN			3	214	-								A6NKZ3	Splice_Site	DNP	ENST00000341287.4	37	c.42_splice	CCDS42809.1																																																																																				0.446	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336931.1	NM_001099334	Missense_Mutation	9	61	0	0	0	0.004672	0	9	61				
IKZF2	22807	broad.mit.edu	37	2	213872367	213872367	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:213872367C>A	ENST00000434687.1	-	9	1607	c.1298G>T	c.(1297-1299)aGc>aTc	p.S433I	IKZF2_ENST00000374327.4_Missense_Mutation_p.S288I|IKZF2_ENST00000342002.2_Missense_Mutation_p.S439I|IKZF2_ENST00000451136.2_Missense_Mutation_p.S361I|IKZF2_ENST00000374319.4_Missense_Mutation_p.S407I|IKZF2_ENST00000457361.1_Missense_Mutation_p.S433I|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000413091.3_3'UTR|IKZF2_ENST00000421754.2_Missense_Mutation_p.S359I			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	433					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S433I(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GTAAGCTGGGCTTTGTTTCCT	0.493																																							uc002vem.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1297-1299)AGC>ATC		helios isoform 1							212.0	207.0	209.0					2																	213872367		2203	4300	6503	SO:0001583	missense	22807				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:213872367C>A	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1298G>T	2.37:g.213872367C>A	ENSP00000412869:p.Ser433Ile					IKZF2_uc010fuu.2_Missense_Mutation_p.S288I|IKZF2_uc002vej.2_Missense_Mutation_p.S380I|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Missense_Mutation_p.S359I|IKZF2_uc002vel.2_Missense_Mutation_p.S354I|IKZF2_uc010fuw.2_Missense_Mutation_p.S207I|IKZF2_uc010fux.2_Missense_Mutation_p.S207I|IKZF2_uc010fuy.2_Missense_Mutation_p.S361I|IKZF2_uc002ven.2_Missense_Mutation_p.S407I|IKZF2_uc002vei.2_Missense_Mutation_p.S211I	p.S433I	NM_016260	NP_057344	Q9UKS7	IKZF2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)	8	1467	-		Esophageal squamous(248;0.0559)|Renal(323;0.218)	433					Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	c.1298G>T	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121744	0.56613	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	T;T;T;T;T;T;T	0.17854	3.01;2.98;3.01;3.04;2.98;3.07;2.25	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	M	0.67397	2.05	0.80722	D	1	P;P;D;P;D;P	0.62365	0.95;0.937;0.991;0.728;0.96;0.729	P;P;P;B;P;P	0.60789	0.609;0.679;0.879;0.361;0.665;0.474	T	0.02625	-1.1132	10	0.72032	D	0.01	-8.9521	11.8725	0.52529	0.0:0.8662:0.0:0.1338	.	361;359;288;407;433;211	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	I	433;439;433;407;361;359;288;137	ENSP00000410447:S433I;ENSP00000342876:S439I;ENSP00000412869:S433I;ENSP00000363439:S407I;ENSP00000395203:S361I;ENSP00000399574:S359I;ENSP00000363447:S288I	ENSP00000342876:S439I	S	-	2	0	IKZF2	213580612	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.034000	0.49751	2.906000	0.99361	0.655000	0.94253	AGC		0.493	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260		25	273	1	0	3.28513e-13	0.003954	4.65393e-13	25	273				
ANO7	50636	broad.mit.edu	37	2	242149890	242149890	+	Missense_Mutation	SNP	G	G	A	rs570289436		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr2:242149890G>A	ENST00000274979.8	+	15	1731	c.1628G>A	c.(1627-1629)cGc>cAc	p.R543H	ANO7_ENST00000402430.3_Missense_Mutation_p.R542H	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	543					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.R543H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						TAGGCCTCTCGCATCGCCAGC	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16761	0.0		0.0	False		,,,				2504	0.0						uc002wax.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|central_nervous_system(1)	3						c.(1627-1629)CGC>CAC		transmembrane protein 16G isoform NGEP long							99.0	85.0	90.0					2																	242149890		2203	4300	6503	SO:0001583	missense	50636					cell junction|chloride channel complex|cytosol	chloride channel activity	g.chr2:242149890G>A	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1628G>A	2.37:g.242149890G>A	ENSP00000274979:p.Arg543His						p.R543H	NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN			15	1731	+			543			Extracellular (Potential).		Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	c.1628G>A	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.535756	0.27475	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.64085	-0.08;-0.08	3.27	-1.04	0.10068	.	1.252990	0.05724	N	0.598293	T	0.69070	0.3070	L	0.58669	1.825	0.09310	N	1	D	0.76494	0.999	D	0.63113	0.911	T	0.58891	-0.7556	10	0.15066	T	0.55	.	8.2978	0.31995	0.5299:0.0:0.4701:0.0	.	543	Q6IWH7	ANO7_HUMAN	H	543;542	ENSP00000274979:R543H;ENSP00000385418:R542H	ENSP00000274979:R543H	R	+	2	0	ANO7	241798563	0.120000	0.22244	0.000000	0.03702	0.154000	0.21943	0.216000	0.17585	-0.213000	0.10094	0.313000	0.20887	CGC		0.642	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891		5	45	0	0	0	0.001168	0	5	45				
PROKR2	128674	broad.mit.edu	37	20	5294904	5294904	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr20:5294904C>T	ENST00000217270.3	-	1	111	c.112G>A	c.(112-114)Gat>Aat	p.D38N	PROKR2_ENST00000546004.1_Missense_Mutation_p.D38N	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	38					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.D38N(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						TCATCCTCATCCATAGGGAGG	0.507										HNSCC(71;0.22)																													uc010zqw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(112-114)GAT>AAT		prokineticin receptor 2							136.0	119.0	125.0					20																	5294904		2203	4300	6503	SO:0001583	missense	128674					integral to membrane|plasma membrane	neuropeptide Y receptor activity	g.chr20:5294904C>T	AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.112G>A	20.37:g.5294904C>T	ENSP00000217270:p.Asp38Asn	HNSCC(71;0.22)				PROKR2_uc010zqx.1_Missense_Mutation_p.D38N|PROKR2_uc010zqy.1_Missense_Mutation_p.D38N|uc002wly.1_5'Flank	p.D38N	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN			1	112	-			38			Extracellular (Potential).		A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	ENST00000217270.3	37	c.112G>A	CCDS13089.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496904	0.64186	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.71579	-0.58;-0.58	4.6	4.6	0.57074	.	0.176633	0.48767	D	0.000168	T	0.67297	0.2878	M	0.66939	2.045	0.44798	D	0.997808	B	0.19817	0.039	B	0.16289	0.015	T	0.64931	-0.6291	10	0.33940	T	0.23	.	13.2911	0.60272	0.0:1.0:0.0:0.0	.	38	Q8NFJ6	PKR2_HUMAN	N	38	ENSP00000440790:D38N;ENSP00000217270:D38N	ENSP00000217270:D38N	D	-	1	0	PROKR2	5242904	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.510000	0.67018	2.269000	0.75478	0.655000	0.94253	GAT		0.507	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773		15	82	0	0	0	0.004007	0	15	82				
ARFGEF2	10564	broad.mit.edu	37	20	47630484	47630484	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr20:47630484A>T	ENST00000371917.4	+	30	4166	c.4166A>T	c.(4165-4167)gAg>gTg	p.E1389V		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1389					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)	p.E1389V(1)		breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AAACTCCCTGAGCAACTGTCA	0.483																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	Esophageal Squamous(176;1738 1974 26285 33069 35354)	uc002xtx.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|upper_aerodigestive_tract(1)	4						c.(4165-4167)GAG>GTG		ADP-ribosylation factor guanine							142.0	123.0	129.0					20																	47630484		2203	4300	6503	SO:0001583	missense	10564				exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity	g.chr20:47630484A>T	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.4166A>T	20.37:g.47630484A>T	ENSP00000360985:p.Glu1389Val					ARFGEF2_uc010zyf.1_Missense_Mutation_p.E682V	p.E1389V	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)		30	4318	+			1389					Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	c.4166A>T	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487254	0.84854	.	.	ENSG00000124198	ENST00000371917	T	0.56103	0.48	5.69	5.69	0.88448	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70745	0.3259	M	0.83852	2.665	0.80722	D	1	D	0.58620	0.983	P	0.56788	0.806	T	0.75536	-0.3283	10	0.59425	D	0.04	.	15.9466	0.79799	1.0:0.0:0.0:0.0	.	1389	Q9Y6D5	BIG2_HUMAN	V	1389	ENSP00000360985:E1389V	ENSP00000360985:E1389V	E	+	2	0	ARFGEF2	47063891	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	9.339000	0.96797	2.164000	0.68074	0.459000	0.35465	GAG		0.483	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420		19	106	0	0	0	0.008871	0	19	106				
TSHZ2	128553	broad.mit.edu	37	20	51871354	51871354	+	Missense_Mutation	SNP	T	T	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr20:51871354T>A	ENST00000371497.5	+	2	2244	c.1357T>A	c.(1357-1359)Tgt>Agt	p.C453S	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.C450S|TSHZ2_ENST00000603338.2_Missense_Mutation_p.C450S	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	453					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C453S(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AGCATCAGATTGTACAGCCTC	0.458																																							uc002xwo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(1357-1359)TGT>AGT		teashirt zinc finger homeobox 2							95.0	101.0	99.0					20																	51871354		2203	4300	6503	SO:0001583	missense	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51871354T>A	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1357T>A	20.37:g.51871354T>A	ENSP00000360552:p.Cys453Ser						p.C453S	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	2313	+			453					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	c.1357T>A	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.804761	0.00075	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.21191	2.02;2.02	5.95	-2.58	0.06228	.	0.533827	0.23375	N	0.048867	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35025	-0.9805	10	0.02654	T	1	-11.652	3.9954	0.09556	0.107:0.123:0.4421:0.328	.	453	Q9NRE2	TSH2_HUMAN	S	453;450	ENSP00000360552:C453S;ENSP00000333114:C450S	ENSP00000333114:C450S	C	+	1	0	TSHZ2	51304761	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.585000	0.05794	-0.376000	0.07943	0.523000	0.50628	TGT		0.458	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		31	94	0	0	0	0.008361	0	31	94				
ZNF217	7764	broad.mit.edu	37	20	52193560	52193560	+	Silent	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr20:52193560A>G	ENST00000371471.2	-	4	2168	c.1743T>C	c.(1741-1743)tcT>tcC	p.S581S	ZNF217_ENST00000302342.3_Silent_p.S581S|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	581					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S581S(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			TCTGAAAAACAGAAGGCATCT	0.443																																							uc002xwq.3		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6						c.(1741-1743)TCT>TCC		zinc finger protein 217							124.0	117.0	119.0					20																	52193560		2203	4300	6503	SO:0001819	synonymous_variant	7764				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:52193560A>G	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1743T>C	20.37:g.52193560A>G						ZNF217_uc010gij.1_Silent_p.S573S	p.S581S	NM_006526	NP_006517	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)		3	2014	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		581					E1P5Y6|Q14DB8	Silent	SNP	ENST00000371471.2	37	c.1743T>C	CCDS13443.1																																																																																				0.443	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526		41	76	0	0	0	0.00623	0	41	76				
CASS4	57091	broad.mit.edu	37	20	55012553	55012553	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr20:55012553C>A	ENST00000360314.3	+	3	595	c.370C>A	c.(370-372)Cag>Aag	p.Q124K	CASS4_ENST00000371336.3_Missense_Mutation_p.Q124K|CASS4_ENST00000434344.1_Missense_Mutation_p.Q124K	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	124					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.Q124K(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						GGAGGGGCCCCAGCCCCCTAC	0.582																																							uc002xxp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(370-372)CAG>AAG		HEF-like protein isoform a							61.0	69.0	66.0					20																	55012553		2200	4294	6494	SO:0001583	missense	57091				cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity	g.chr20:55012553C>A	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.370C>A	20.37:g.55012553C>A	ENSP00000353462:p.Gln124Lys					CASS4_uc002xxq.3_Missense_Mutation_p.Q124K|CASS4_uc002xxr.2_Missense_Mutation_p.Q124K|CASS4_uc010zze.1_Intron|CASS4_uc010gio.2_Missense_Mutation_p.Q124K	p.Q124K	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN			3	595	+			124					E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	c.370C>A	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.402057	0.01165	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.19806	2.62;2.62;2.12	5.35	0.59	0.17458	.	1.593630	0.03753	N	0.256870	T	0.10508	0.0257	N	0.08118	0	0.09310	N	1	B;B;B	0.18741	0.016;0.03;0.009	B;B;B	0.18561	0.009;0.022;0.01	T	0.27468	-1.0073	10	0.10636	T	0.68	-1.0106	6.6379	0.22893	0.1304:0.61:0.0:0.2596	.	124;124;124	Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;CASS4_HUMAN	K	124	ENSP00000353462:Q124K;ENSP00000360387:Q124K;ENSP00000410027:Q124K	ENSP00000353462:Q124K	Q	+	1	0	CASS4	54445960	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	0.213000	0.17521	0.217000	0.20800	-0.182000	0.12963	CAG		0.582	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		23	90	1	0	5.35356e-11	0.00278	7.33956e-11	23	90				
SLMO2	51012	broad.mit.edu	37	20	57613683	57613683	+	Silent	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr20:57613683C>A	ENST00000355937.4	-	2	217	c.39G>T	c.(37-39)ccG>ccT	p.P13P	SLMO2_ENST00000371033.5_Silent_p.P13P	NM_016045.2	NP_057129.2	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2 (Drosophila)	13	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)	p.P13P(1)		endometrium(1)|lung(2)|skin(2)	5	all_lung(29;0.00711)		Colorectal(105;0.109)			CAGTTTCCCACGGGTGGCTGC	0.358																																							uc002yam.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(37-39)CCG>CCT		slowmo homolog 2							81.0	75.0	77.0					20																	57613683		1861	4091	5952	SO:0001819	synonymous_variant	51012							g.chr20:57613683C>A	AF151865	CCDS42893.1, CCDS58783.1	20q13.32	2008-10-22	2007-02-06	2007-02-06	ENSG00000101166	ENSG00000101166			15892	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 45"""	C20orf45			Standard	NM_016045		Approved	dJ543J19.5, PRELID3B	uc002yam.3	Q9Y3B1	OTTHUMG00000032856	ENST00000355937.4:c.39G>T	20.37:g.57613683C>A						SLMO2_uc010zzv.1_Silent_p.P13P	p.P13P	NM_016045	NP_057129	Q9Y3B1	SLMO2_HUMAN	Colorectal(105;0.109)		2	155	-	all_lung(29;0.00711)		13			PRELI/MSF1.		E1P5I8|Q5JX17|Q9NUL0	Silent	SNP	ENST00000355937.4	37	c.39G>T	CCDS42893.1																																																																																				0.358	SLMO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079897.2	NM_016045		22	90	1	0	8.10497e-08	0.010504	9.98439e-08	22	90				
TPTE	7179	broad.mit.edu	37	21	10941911	10941911	+	Silent	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr21:10941911G>T	ENST00000361285.4	-	14	1121	c.792C>A	c.(790-792)atC>atA	p.I264I	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Silent_p.I246I|TPTE_ENST00000342420.5_Silent_p.I226I	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	264	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCCTTACCTTGATTGGATTTC	0.313																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(790-792)ATC>ATA		transmembrane phosphatase with tensin homology							215.0	204.0	208.0					21																	10941911		2203	4299	6502	SO:0001819	synonymous_variant	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10941911G>T	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.792C>A	21.37:g.10941911G>T						TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.I246I|TPTE_uc002yir.1_Silent_p.I226I|TPTE_uc010gkv.1_Silent_p.I126I	p.I264I	NM_199261	NP_954870	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	14	1160	-			264			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	37	c.792C>A	CCDS13560.2																																																																																				0.313	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			37	184	1	0	1.90571e-15	0.004289	2.77689e-15	37	184				
BAGE2	85319	broad.mit.edu	37	21	11097584	11097584	+	RNA	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr21:11097584C>A	ENST00000470054.1	-	0	285							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tccagctcaccacaggggact	0.537																																							uc002yit.1		NA																	0					0						c.(76-78)GTG>GTT		B melanoma antigen family, member 2 precursor							62.0	81.0	74.0					21																	11097584		1422	2571	3993			85319							g.chr21:11097584C>A	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11097584C>A						BAGE_uc002yix.2_RNA	p.V26V	NM_182482	NP_872288			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	2	286	-								A8K925|Q08ER0	Silent	SNP	ENST00000470054.1	37	c.78G>T																																																																																					0.537	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482		4	61	1	0	0.00909568	0.009096	0.00954485	4	61				
ADAMTS5	11096	broad.mit.edu	37	21	28327084	28327084	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr21:28327084G>T	ENST00000284987.5	-	2	1332	c.1211C>A	c.(1210-1212)gCa>gAa	p.A404E	MIR4759_ENST00000584048.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	404	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A404E(1)|p.A404V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						AGTGAAGGCTGCGTGGAGGCC	0.502																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(1210-1212)GCA>GAA		ADAM metallopeptidase with thrombospondin type 1							121.0	112.0	115.0					21																	28327084		2203	4300	6503	SO:0001583	missense	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28327084G>T	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1211C>A	21.37:g.28327084G>T	ENSP00000284987:p.Ala404Glu						p.A404E	NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN			2	1940	-			404			Peptidase M12B.		Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	c.1211C>A	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	G	32	5.131939	0.94473	.	.	ENSG00000154736	ENST00000284987	T	0.64260	-0.09	5.18	5.18	0.71444	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.83700	0.5311	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.86877	0.2039	10	0.66056	D	0.02	.	18.8824	0.92362	0.0:0.0:1.0:0.0	.	404	Q9UNA0	ATS5_HUMAN	E	404	ENSP00000284987:A404E	ENSP00000284987:A404E	A	-	2	0	ADAMTS5	27248955	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	2.710000	0.92621	0.650000	0.86243	GCA		0.502	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			12	59	1	0	6.72482e-11	0.003163	9.12144e-11	12	59				
KRTAP24-1	643803	broad.mit.edu	37	21	31654799	31654799	+	Missense_Mutation	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr21:31654799C>G	ENST00000340345.4	-	1	477	c.452G>C	c.(451-453)tGc>tCc	p.C151S		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	151						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.C151S(1)		breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						TTGTCCAAAGCAGTTGGAACC	0.458																																							uc002ynv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(451-453)TGC>TCC		keratin associated protein 24-1							132.0	131.0	131.0					21																	31654799		1942	4155	6097	SO:0001583	missense	643803					keratin filament	structural molecule activity	g.chr21:31654799C>G	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.452G>C	21.37:g.31654799C>G	ENSP00000339238:p.Cys151Ser						p.C151S	NM_001085455	NP_001078924	Q3LI83	KR241_HUMAN			1	478	-			151					Q1XDX0	Missense_Mutation	SNP	ENST00000340345.4	37	c.452G>C	CCDS42915.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.726197	0.30593	.	.	ENSG00000188694	ENST00000340345	T	0.03124	4.04	4.9	-5.23	0.02798	.	1.093370	0.07125	N	0.844639	T	0.02929	0.0087	L	0.51422	1.61	0.09310	N	1	B	0.18166	0.026	B	0.25884	0.064	T	0.49716	-0.8910	10	0.05959	T	0.93	0.4228	2.7327	0.05231	0.1156:0.3201:0.1137:0.4506	.	151	Q3LI83	KR241_HUMAN	S	151	ENSP00000339238:C151S	ENSP00000339238:C151S	C	-	2	0	KRTAP24-1	30576670	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.957000	0.03861	-1.244000	0.02516	-0.140000	0.14226	TGC		0.458	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	NM_001085455		49	98	0	0	0	0.01441	0	49	98				
KRTAP10-6	386674	broad.mit.edu	37	21	46012274	46012274	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr21:46012274G>T	ENST00000400368.1	-	1	112	c.92C>A	c.(91-93)tCc>tAc	p.S31Y	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	31						keratin filament (GO:0045095)		p.S31Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						CACCTGCCAGGAGTCGGAGCA	0.682																																							uc002zfm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(91-93)TCC>TAC		keratin associated protein 10-6							58.0	58.0	58.0					21																	46012274		2059	4158	6217	SO:0001583	missense	386674					keratin filament		g.chr21:46012274G>T	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.92C>A	21.37:g.46012274G>T	ENSP00000383219:p.Ser31Tyr					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.S31Y	NM_198688	NP_941961	P60371	KR106_HUMAN			1	113	-			31						Missense_Mutation	SNP	ENST00000400368.1	37	c.92C>A	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	g	8.685	0.905993	0.17760	.	.	ENSG00000188155	ENST00000400368	T	0.16743	2.32	2.86	1.92	0.25849	.	.	.	.	.	T	0.33235	0.0856	M	0.86343	2.81	0.27205	N	0.960079	D	0.61080	0.989	P	0.50708	0.648	T	0.21314	-1.0249	9	0.87932	D	0	.	9.3931	0.38386	0.0:0.2217:0.7783:0.0	.	31	P60371	KR106_HUMAN	Y	31	ENSP00000383219:S31Y	ENSP00000383219:S31Y	S	-	2	0	KRTAP10-6	44836702	1.000000	0.71417	0.576000	0.28549	0.282000	0.26991	3.486000	0.53215	0.498000	0.27948	0.407000	0.27541	TCC		0.682	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688		5	27	1	0	8.12818e-05	0.001984	9.21194e-05	5	27				
ADARB1	104	broad.mit.edu	37	21	46604837	46604837	+	Splice_Site	SNP	G	G	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr21:46604837G>C	ENST00000360697.3	+	7	1531		c.e7-1		ADARB1_ENST00000348831.4_Splice_Site|ADARB1_ENST00000539173.1_Splice_Site|ADARB1_ENST00000389863.4_Splice_Site|ADARB1_ENST00000437626.1_Splice_Site			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1						adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.?(2)		endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		TTCTCTCTTAGAACCAGCAGA	0.398																																							uc002zgy.2		NA																	2	Unknown(2)		lung(2)	skin(1)	1						c.e9-1		RNA-specific adenosine deaminase B1 isoform 2							111.0	116.0	115.0					21																	46604837		2203	4300	6503	SO:0001630	splice_region_variant	104				adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding	g.chr21:46604837G>C	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.1517-1G>C	21.37:g.46604837G>C						ADARB1_uc002zgr.2_Splice_Site_p.E506_splice|ADARB1_uc002zgs.2_Splice_Site|ADARB1_uc002zgw.2_Splice_Site_p.E466_splice|ADARB1_uc002zgv.2_Splice_Site|ADARB1_uc002zgt.2_Splice_Site_p.E466_splice|ADARB1_uc010gpx.2_Splice_Site|ADARB1_uc002zgq.2_Splice_Site|ADARB1_uc002zgu.2_Splice_Site	p.E506_splice	NM_015833	NP_056648	P78563	RED1_HUMAN		Colorectal(79;0.115)	9	1952	+								A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Splice_Site	SNP	ENST00000360697.3	37	c.1517_splice	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729148	0.48833	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0803	0.86597	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADARB1	45429265	1.000000	0.71417	0.962000	0.40283	0.520000	0.34377	7.618000	0.83043	2.712000	0.92718	0.563000	0.77884	.		0.398	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833	Intron	10	116	0	0	0	0.008291	0	10	116				
SCN10A	6336	broad.mit.edu	37	3	38770309	38770309	+	Silent	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:38770309C>G	ENST00000449082.2	-	15	2363	c.2364G>C	c.(2362-2364)ggG>ggC	p.G788G		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	788					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.G788G(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TGGTGAGGTTCCCCAGTGCCC	0.502																																							uc003ciq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(2362-2364)GGG>GGC		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						133.0	133.0	133.0					3																	38770309		2203	4300	6503	SO:0001819	synonymous_variant	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38770309C>G	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.2364G>C	3.37:g.38770309C>G							p.G788G	NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	15	2364	-			788			II.		A6NDQ1	Silent	SNP	ENST00000449082.2	37	c.2364G>C	CCDS33736.1																																																																																				0.502	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		5	50	0	0	0	0.000602	0	5	50				
COL7A1	1294	broad.mit.edu	37	3	48630019	48630019	+	Missense_Mutation	SNP	G	G	T	rs141801873		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:48630019G>T	ENST00000328333.8	-	7	1067	c.960C>A	c.(958-960)agC>agA	p.S320R	COL7A1_ENST00000454817.1_Missense_Mutation_p.S320R	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	320	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S320R(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGCTGTCCCGCTCACAGCCT	0.617																																							uc003ctz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(958-960)AGC>AGA		alpha 1 type VII collagen precursor							53.0	55.0	55.0					3																	48630019		2203	4300	6503	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48630019G>T	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.960C>A	3.37:g.48630019G>T	ENSP00000332371:p.Ser320Arg						p.S320R	NM_000094	NP_000085	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	7	961	-			320			Nonhelical region (NC1).|Fibronectin type-III 1.		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.960C>A	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	8.378	0.836915	0.16891	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.54479	0.57;0.57	4.5	-0.12	0.13539	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.144225	0.31784	N	0.007076	T	0.56187	0.1968	L	0.45285	1.41	0.30902	N	0.729111	D	0.76494	0.999	D	0.67725	0.953	T	0.57562	-0.7790	10	0.62326	D	0.03	.	7.1653	0.25687	0.5619:0.1199:0.3182:0.0	.	320	Q02388	CO7A1_HUMAN	R	320	ENSP00000332371:S320R;ENSP00000412569:S320R	ENSP00000332371:S320R	S	-	3	2	COL7A1	48605023	0.022000	0.18835	0.998000	0.56505	0.877000	0.50540	-0.210000	0.09345	0.005000	0.14708	0.462000	0.41574	AGC		0.617	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		9	30	1	0	0.000274275	0.004482	0.000306755	9	30				
RNF123	63891	broad.mit.edu	37	3	49744330	49744330	+	Splice_Site	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:49744330A>T	ENST00000327697.6	+	26	2639	c.2495A>T	c.(2494-2496)cAg>cTg	p.Q832L	RNF123_ENST00000432042.1_Splice_Site_p.Q686L	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	832					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Q832L(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GTCTACTCCCAGGTGTGCTGG	0.597																																							uc003cxh.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7						c.(2494-2496)CAG>CTG		ring finger protein 123							126.0	103.0	111.0					3																	49744330		2203	4300	6503	SO:0001630	splice_region_variant	63891					cytoplasm	ligase activity|protein binding|zinc ion binding	g.chr3:49744330A>T	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2496+1A>T	3.37:g.49744330A>T						RNF123_uc010hky.1_Missense_Mutation_p.Q494L|RNF123_uc003cxi.2_RNA	p.Q832L	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)	26	2581	+			832					A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	c.2495A>T	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172816	0.38413	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.75589	-0.67;-0.95	5.3	5.3	0.74995	.	0.271369	0.40222	N	0.001154	T	0.61438	0.2347	N	0.22421	0.69	0.80722	D	1	B;B	0.26002	0.139;0.0	B;B	0.21917	0.037;0.0	T	0.60865	-0.7178	10	0.48119	T	0.1	-17.5308	12.967	0.58490	1.0:0.0:0.0:0.0	.	686;832	C9J266;Q5XPI4	.;RN123_HUMAN	L	832;832;686	ENSP00000328287:Q832L;ENSP00000392443:Q686L	ENSP00000328287:Q832L	Q	+	2	0	RNF123	49719334	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	6.434000	0.73408	1.990000	0.58119	0.402000	0.26972	CAG		0.597	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	Missense_Mutation	13	29	0	0	0	0.013537	0	13	29				
PROS1	5627	broad.mit.edu	37	3	93593234	93593234	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:93593234G>A	ENST00000394236.3	-	15	2202	c.1886C>T	c.(1885-1887)gCc>gTc	p.A629V	PROS1_ENST00000407433.1_Missense_Mutation_p.A498V	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	629	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.A629V(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	CACTGGTGTGGCACTGAATGG	0.353																																							uc003drb.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1885-1887)GCC>GTC		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						55.0	51.0	53.0					3																	93593234		2203	4298	6501	SO:0001583	missense	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93593234G>A		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1886C>T	3.37:g.93593234G>A	ENSP00000377783:p.Ala629Val					PROS1_uc010hoo.2_Missense_Mutation_p.A498V|PROS1_uc003dqz.3_Missense_Mutation_p.A498V	p.A629V	NM_000313	NP_000304	P07225	PROS_HUMAN			15	2227	-			629			Laminin G-like 2.		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	c.1886C>T	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162216	0.57368	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	T;T	0.77877	-1.13;-1.13	4.31	4.31	0.51392	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.107842	0.64402	D	0.000006	T	0.79969	0.4538	M	0.82517	2.595	0.47819	D	0.999527	B	0.24618	0.107	B	0.24006	0.05	T	0.81484	-0.0912	10	0.72032	D	0.01	.	16.0441	0.80707	0.0:0.0:1.0:0.0	.	629	P07225	PROS_HUMAN	V	629;498	ENSP00000377783:A629V;ENSP00000385794:A498V	ENSP00000377783:A629V	A	-	2	0	PROS1	95075924	0.994000	0.37717	0.995000	0.50966	0.994000	0.84299	3.350000	0.52224	2.384000	0.81235	0.555000	0.69702	GCC		0.353	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		5	49	0	0	0	0.000602	0	5	49				
HCLS1	3059	broad.mit.edu	37	3	121356023	121356023	+	Missense_Mutation	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:121356023C>G	ENST00000314583.3	-	7	626	c.535G>C	c.(535-537)Gga>Cga	p.G179R	HCLS1_ENST00000428394.2_Intron|HCLS1_ENST00000473883.1_5'UTR	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	179					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)	p.G179R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		TCCGTCTCTCCCTTGTAGTCA	0.542																																							uc003eeh.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)GGA>CGA		hematopoietic cell-specific Lyn substrate 1							179.0	153.0	162.0					3																	121356023		2203	4300	6503	SO:0001583	missense	3059				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:121356023C>G		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.535G>C	3.37:g.121356023C>G	ENSP00000320176:p.Gly179Arg					HCLS1_uc011bjj.1_Intron|HCLS1_uc011bjk.1_RNA	p.G179R	NM_005335	NP_005326	P14317	HCLS1_HUMAN		GBM - Glioblastoma multiforme(114;0.0912)	7	660	-			179			Cortactin 3.		B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	37	c.535G>C	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146167	0.57044	.	.	ENSG00000180353	ENST00000314583	T	0.21361	2.01	5.15	5.15	0.70609	.	0.115902	0.64402	D	0.000006	T	0.47619	0.1455	M	0.76838	2.35	0.80722	D	1	D	0.67145	0.996	D	0.68765	0.96	T	0.50742	-0.8792	10	0.66056	D	0.02	-14.1073	16.1241	0.81380	0.0:1.0:0.0:0.0	.	179	P14317	HCLS1_HUMAN	R	179	ENSP00000320176:G179R	ENSP00000320176:G179R	G	-	1	0	HCLS1	122838713	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.676000	0.54612	2.398000	0.81561	0.655000	0.94253	GGA		0.542	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335		18	33	0	0	0	0.008871	0	18	33				
GOLGB1	2804	broad.mit.edu	37	3	121413585	121413585	+	Nonsense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:121413585C>A	ENST00000340645.5	-	13	5895	c.5770G>T	c.(5770-5772)Gag>Tag	p.E1924*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.E1929*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1924					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.E1924*(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		ATAAGCCTCTCTTCCAAATCA	0.368																																							uc003eei.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|breast(2)|skin(2)	10						c.(5770-5772)GAG>TAG		golgi autoantigen, golgin subfamily b,							225.0	218.0	220.0					3																	121413585		2203	4300	6503	SO:0001587	stop_gained	2804				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding	g.chr3:121413585C>A	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5770G>T	3.37:g.121413585C>A	ENSP00000341848:p.Glu1924*					GOLGB1_uc010hrc.2_Nonsense_Mutation_p.E1929*|GOLGB1_uc003eej.3_Nonsense_Mutation_p.E1890*|GOLGB1_uc011bjm.1_Nonsense_Mutation_p.E1810*|GOLGB1_uc010hrd.1_Nonsense_Mutation_p.E1888*	p.E1924*	NM_004487	NP_004478	Q14789	GOGB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0989)	13	5896	-			1924			Cytoplasmic (Potential).|Potential.		B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	ENST00000340645.5	37	c.5770G>T	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	C	45	11.410673	0.99558	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	.	.	.	5.73	5.73	0.89815	.	0.000000	0.51477	D	0.000091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	17.3802	0.87402	0.0:1.0:0.0:0.0	.	.	.	.	X	1924;1929	.	ENSP00000341848:E1924X	E	-	1	0	GOLGB1	122896275	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.005000	0.70716	2.688000	0.91661	0.650000	0.86243	GAG		0.368	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		56	126	1	0	1.54886e-18	0.01441	2.33704e-18	56	126				
KALRN	8997	broad.mit.edu	37	3	124377365	124377365	+	Splice_Site	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:124377365G>A	ENST00000291478.5	+	9	1192		c.e9+1		KALRN_ENST00000459915.1_Splice_Site|KALRN_ENST00000360013.3_Splice_Site|KALRN_ENST00000428018.2_Splice_Site|KALRN_ENST00000393496.1_Splice_Site	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase						apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.?(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CTACTTTGAGGTAAGCTGTGC	0.507																																							uc003ehg.2		NA																	2	Unknown(2)		lung(2)	large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						c.e42+1		kalirin, RhoGEF kinase isoform 1							143.0	106.0	119.0					3																	124377365		2203	4300	6503	SO:0001630	splice_region_variant	8997				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr3:124377365G>A	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.1029+1G>A	3.37:g.124377365G>A						KALRN_uc003ehi.2_Splice_Site_p.E381_splice|KALRN_uc003ehk.2_Splice_Site_p.E343_splice|KALRN_uc011bjz.1_Splice_Site_p.E132_splice	p.E2040_splice	NM_001024660	NP_001019831	O60229	KALRN_HUMAN			42	6247	+								A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Splice_Site	SNP	ENST00000291478.5	37	c.6120_splice	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026347	0.54683	.	.	ENSG00000160145	ENST00000360013;ENST00000354186;ENST00000393496;ENST00000291478;ENST00000428018;ENST00000459915	.	.	.	4.6	4.6	0.57074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9732	0.89119	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KALRN	125860055	1.000000	0.71417	0.990000	0.47175	0.330000	0.28571	9.601000	0.98297	2.549000	0.85964	0.650000	0.86243	.		0.507	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	Intron	12	50	0	0	0	0.010729	0	12	50				
SRPRB	58477	broad.mit.edu	37	3	133525539	133525539	+	Missense_Mutation	SNP	T	T	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:133525539T>G	ENST00000466490.2	+	3	526	c.241T>G	c.(241-243)Ttt>Gtt	p.F81V		NM_021203.3	NP_067026.3	Q9Y5M8	SRPRB_HUMAN	signal recognition particle receptor, B subunit	81					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|small GTPase mediated signal transduction (GO:0007264)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)	p.F81V(1)		breast(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(2)	12						AACGTTGCTCTTTGTCAGGGT	0.403																																							uc003epx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(241-243)TTT>GTT		signal recognition particle receptor, beta							173.0	161.0	165.0					3																	133525539		2203	4300	6503	SO:0001583	missense	58477					endoplasmic reticulum membrane|integral to membrane	GTP binding|protein binding|receptor activity	g.chr3:133525539T>G	AK075531	CCDS3081.1	3q22.1	2004-01-29			ENSG00000144867	ENSG00000144867			24085	protein-coding gene	gene with protein product						7844142, 10859309	Standard	NM_021203		Approved	APMCF1	uc003epx.2	Q9Y5M8	OTTHUMG00000159753	ENST00000466490.2:c.241T>G	3.37:g.133525539T>G	ENSP00000418401:p.Phe81Val						p.F81V	NM_021203	NP_067026	Q9Y5M8	SRPRB_HUMAN			2	257	+			81					Q6P595|Q8N2D8	Missense_Mutation	SNP	ENST00000466490.2	37	c.241T>G	CCDS3081.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.804120	0.90623	.	.	ENSG00000144867	ENST00000466490;ENST00000484684	T;T	0.70164	2.14;-0.46	5.33	5.33	0.75918	.	0.071085	0.53938	D	0.000052	T	0.80884	0.4709	M	0.75615	2.305	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.82884	-0.0236	10	0.59425	D	0.04	-12.8606	14.9554	0.71110	0.0:0.0:0.0:1.0	.	81	Q9Y5M8	SRPRB_HUMAN	V	81	ENSP00000418401:F81V;ENSP00000417096:F81V	ENSP00000418401:F81V	F	+	1	0	SRPRB	135008229	1.000000	0.71417	0.993000	0.49108	0.966000	0.64601	6.561000	0.73955	2.016000	0.59253	0.533000	0.62120	TTT		0.403	SRPRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357170.2			5	75	0	0	0	0.001168	0	5	75				
CLDN18	51208	broad.mit.edu	37	3	137742593	137742593	+	Missense_Mutation	SNP	G	G	A	rs200466463		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:137742593G>A	ENST00000183605.5	+	2	540	c.314G>A	c.(313-315)cGc>cAc	p.R105H	CLDN18_ENST00000343735.4_Missense_Mutation_p.R105H	NM_016369.3	NP_057453.1	P56856	CLD18_HUMAN	claudin 18	105					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.R105H(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						AAATGCATCCGCATTGGCAGC	0.557																																							uc003ero.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(313-315)CGC>CAC		claudin 18 isoform 2		G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	122.0	96.0	105.0		314,314	4.5	1.0	3		105	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	CLDN18	NM_001002026.2,NM_016369.3	29,29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging	105/262,105/262	137742593	3,13003	2203	4300	6503	SO:0001583	missense	51208				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr3:137742593G>A	AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000183605.5:c.314G>A	3.37:g.137742593G>A	ENSP00000183605:p.Arg105His					CLDN18_uc003erp.1_Missense_Mutation_p.R105H|CLDN18_uc010hue.1_Silent_p.P100P	p.R105H	NM_001002026	NP_001002026	P56856	CLD18_HUMAN			2	367	+			105			Cytoplasmic (Potential).		A5PL21|Q96PH4	Missense_Mutation	SNP	ENST00000183605.5	37	c.314G>A	CCDS3095.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095797	0.76870	0.0	3.49E-4	ENSG00000066405	ENST00000343735;ENST00000183605;ENST00000536138	D;D	0.89485	-2.52;-2.52	5.43	4.54	0.55810	.	0.263124	0.36200	N	0.002739	D	0.93716	0.7992	M	0.79258	2.445	0.44834	D	0.997842	D;D	0.89917	0.999;1.0	D;D	0.70716	0.934;0.97	D	0.94172	0.7424	10	0.72032	D	0.01	.	14.5598	0.68128	0.0719:0.0:0.9281:0.0	.	105;105	P56856;P56856-2	CLD18_HUMAN;.	H	105;105;94	ENSP00000340939:R105H;ENSP00000183605:R105H	ENSP00000183605:R105H	R	+	2	0	CLDN18	139225283	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	3.715000	0.54897	2.558000	0.86282	0.650000	0.86243	CGC		0.557	CLDN18-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357199.2	NM_001002026		17	41	0	0	0	0.00499	0	17	41				
RSRC1	51319	broad.mit.edu	37	3	158261251	158261251	+	Missense_Mutation	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:158261251A>G	ENST00000295930.3	+	9	1049	c.887A>G	c.(886-888)gAt>gGt	p.D296G	RSRC1_ENST00000312179.6_Missense_Mutation_p.D238G|RP11-538P18.2_ENST00000475981.1_RNA|RSRC1_ENST00000464171.1_Missense_Mutation_p.D238G|RSRC1_ENST00000480820.1_Missense_Mutation_p.D296G|RSRC1_ENST00000475278.2_Intron	NM_001271838.1|NM_016625.2	NP_001258767.1|NP_057709.2	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	296					mRNA splicing, via spliceosome (GO:0000398)|nucleocytoplasmic transport (GO:0006913)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)		p.D296G(1)		cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	18			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			AAGTACCAAGATGACAATTCC	0.388																																							uc003fbt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(886-888)GAT>GGT		arginine/serine-rich coiled-coil 1							163.0	146.0	152.0					3																	158261251		2203	4300	6503	SO:0001583	missense	51319				nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding	g.chr3:158261251A>G	AF208853	CCDS3181.1, CCDS63822.1	3q25.32	2009-09-09			ENSG00000174891	ENSG00000174891			24152	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 21"""	613352				15798186, 19065146	Standard	NM_001271838		Approved	MGC12197, BM-011, SRrp53, SFRS21	uc003fbu.2	Q96IZ7	OTTHUMG00000158758	ENST00000295930.3:c.887A>G	3.37:g.158261251A>G	ENSP00000295930:p.Asp296Gly					RSRC1_uc003fbv.2_Missense_Mutation_p.D238G	p.D296G	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)		9	998	+			296					A8K2R9|Q96QK2|Q9NZE5	Missense_Mutation	SNP	ENST00000295930.3	37	c.887A>G	CCDS3181.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.265591	0.80358	.	.	ENSG00000174891	ENST00000480820;ENST00000295930;ENST00000464171;ENST00000312179	.	.	.	5.0	5.0	0.66597	.	0.054037	0.64402	D	0.000001	T	0.76976	0.4063	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.986;0.999	P;D	0.68765	0.84;0.96	T	0.80322	-0.1431	9	0.87932	D	0	.	14.7152	0.69262	1.0:0.0:0.0:0.0	.	238;296	Q96IZ7-2;Q96IZ7	.;RSRC1_HUMAN	G	296;296;238;238	.	ENSP00000295930:D296G	D	+	2	0	RSRC1	159743945	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.533000	0.73829	2.020000	0.59435	0.533000	0.62120	GAT		0.388	RSRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352063.2	NM_016625		28	117	0	0	0	0.010818	0	28	117				
MECOM	2122	broad.mit.edu	37	3	168840508	168840508	+	Missense_Mutation	SNP	T	T	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:168840508T>C	ENST00000464456.1	-	5	1474	c.274A>G	c.(274-276)Aaa>Gaa	p.K92E	MECOM_ENST00000460814.1_Missense_Mutation_p.K92E|MECOM_ENST00000472280.1_Missense_Mutation_p.K92E|MECOM_ENST00000433243.2_Missense_Mutation_p.K92E|MECOM_ENST00000392736.3_Missense_Mutation_p.K92E|MECOM_ENST00000494292.1_Missense_Mutation_p.K280E|MECOM_ENST00000468789.1_Missense_Mutation_p.K92E|MECOM_ENST00000264674.3_Missense_Mutation_p.K156E	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K92E(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						AGCATGTGTTTCTCCAGGCTG	0.368																																							uc003ffi.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						c.(274-276)AAA>GAA		MDS1 and EVI1 complex locus isoform b							146.0	127.0	134.0					3																	168840508		2203	4300	6503	SO:0001583	missense	2122				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:168840508T>C	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.274A>G	3.37:g.168840508T>C	ENSP00000419770:p.Lys92Glu					MECOM_uc010hwk.1_Missense_Mutation_p.K115E|MECOM_uc003ffj.3_Missense_Mutation_p.K156E|MECOM_uc011bpi.1_Missense_Mutation_p.K92E|MECOM_uc003ffn.3_Missense_Mutation_p.K92E|MECOM_uc003ffk.2_Missense_Mutation_p.K92E|MECOM_uc003ffl.2_Missense_Mutation_p.K252E|MECOM_uc011bpj.1_Missense_Mutation_p.K280E|MECOM_uc011bpk.1_Missense_Mutation_p.K82E|MECOM_uc010hwn.2_Missense_Mutation_p.K280E|MECOM_uc003ffm.1_Missense_Mutation_p.K156E	p.K92E	NM_005241	NP_005232	Q03112	EVI1_HUMAN			5	543	-			92			Interaction with MAPK9, SMAD3 and probably SUV39H1.|C2H2-type 2.		Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	37	c.274A>G	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.625264	0.46840	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243;ENST00000492586;ENST00000484519;ENST00000460890;ENST00000487503;ENST00000494597	T;T;T;T;T;T;T;T;T;T;T;T;T	0.26660	2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;1.72;1.72;1.72	5.57	5.57	0.84162	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.951861	0.08680	N	0.909581	T	0.21590	0.0520	N	0.16833	0.445	0.40329	D	0.978908	P;P;P;P;P	0.48162	0.885;0.885;0.906;0.774;0.906	B;B;B;B;B	0.44315	0.318;0.318;0.446;0.318;0.446	T	0.01858	-1.1259	10	0.36615	T	0.2	-15.984	11.6947	0.51536	0.0:0.0:0.1477:0.8523	.	280;92;280;156;92	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	E	156;92;92;92;280;92;92;92;67;92;92;92;92	ENSP00000264674:K156E;ENSP00000376493:K92E;ENSP00000419770:K92E;ENSP00000420048:K92E;ENSP00000417899:K280E;ENSP00000419995:K92E;ENSP00000420466:K92E;ENSP00000394302:K92E;ENSP00000417506:K67E;ENSP00000417299:K92E;ENSP00000417922:K92E;ENSP00000419757:K92E;ENSP00000420072:K92E	ENSP00000264674:K156E	K	-	1	0	MECOM	170323202	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.978000	0.40598	2.119000	0.64992	0.533000	0.62120	AAA		0.368	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991		6	71	0	0	0	0.001984	0	6	71				
KLHL24	54800	broad.mit.edu	37	3	183397003	183397003	+	Missense_Mutation	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:183397003A>G	ENST00000454652.2	+	9	2118	c.1732A>G	c.(1732-1734)Atg>Gtg	p.M578V	KLHL24_ENST00000242810.6_Missense_Mutation_p.M578V	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	578						cell projection (GO:0042995)|cytoplasm (GO:0005737)		p.M578V(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			GGTAGCTGCAATGCCCAGGCC	0.443																																							uc003flv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1732-1734)ATG>GTG		DRE1 protein							124.0	118.0	120.0					3																	183397003		2203	4300	6503	SO:0001583	missense	54800					axon|cytoplasm|perikaryon		g.chr3:183397003A>G		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1732A>G	3.37:g.183397003A>G	ENSP00000395012:p.Met578Val					KLHL24_uc003flw.2_Missense_Mutation_p.M578V	p.M578V	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)		8	2027	+	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		578			Kelch 6.		A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	37	c.1732A>G	CCDS3246.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.509997	0.85282	.	.	ENSG00000114796	ENST00000242810;ENST00000454652	D;D	0.84146	-1.81;-1.81	6.07	6.07	0.98685	Galactose oxidase, beta-propeller (1);	0.077398	0.85682	D	0.000000	D	0.92655	0.7666	M	0.87456	2.885	0.80722	D	1	D	0.54601	0.967	P	0.62014	0.897	D	0.93004	0.6426	10	0.51188	T	0.08	.	16.635	0.85050	1.0:0.0:0.0:0.0	.	578	Q6TFL4	KLH24_HUMAN	V	578	ENSP00000242810:M578V;ENSP00000395012:M578V	ENSP00000242810:M578V	M	+	1	0	KLHL24	184879697	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.339000	0.96797	2.330000	0.79161	0.477000	0.44152	ATG		0.443	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644		28	62	0	0	0	0.008361	0	28	62				
NCBP2	22916	broad.mit.edu	37	3	196664485	196664485	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:196664485G>A	ENST00000321256.5	-	3	388	c.295C>T	c.(295-297)Cgg>Tgg	p.R99W	NCBP2_ENST00000452404.2_Missense_Mutation_p.R81W|NCBP2-AS1_ENST00000447775.1_RNA|NCBP2_ENST00000427641.2_Missense_Mutation_p.R46W|NCBP2_ENST00000422610.1_Missense_Mutation_p.R29W|NCBP2_ENST00000447325.1_Missense_Mutation_p.R29W|NCBP2_ENST00000467803.1_5'UTR	NM_007362.3	NP_031388.2	P52298	NCBP2_HUMAN	nuclear cap binding protein subunit 2, 20kDa	99	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of RNA export from nucleus (GO:0046833)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|RNA cap binding (GO:0000339)	p.R99W(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)		TTTATGTACCGCATGGCGTTT	0.488																																							uc003fxd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(295-297)CGG>TGG		nuclear cap binding protein subunit 2, 20kDa							115.0	105.0	108.0					3																	196664485		2203	4300	6503	SO:0001583	missense	22916				gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of RNA export from nucleus|positive regulation of viral transcription|regulation of translational initiation|snRNA export from nucleus|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm	nucleotide binding|protein binding|RNA 7-methylguanosine cap binding	g.chr3:196664485G>A	D59253	CCDS3323.1, CCDS46986.1	3q29	2013-02-12	2002-08-29		ENSG00000114503	ENSG00000114503		"""RNA binding motif (RRM) containing"""	7659	protein-coding gene	gene with protein product		605133	"""nuclear cap binding protein subunit 2, 20kD"""			7478990, 7651522, 8682299	Standard	NM_001042540		Approved	NIP1, CBP20, Cbc2	uc003fxd.1	P52298	OTTHUMG00000155520	ENST00000321256.5:c.295C>T	3.37:g.196664485G>A	ENSP00000326806:p.Arg99Trp					NCBP2_uc003fxb.1_Missense_Mutation_p.R29W|NCBP2_uc011btz.1_Missense_Mutation_p.R81W|NCBP2_uc003fxc.1_RNA|NCBP2_uc003fxe.1_Missense_Mutation_p.R46W|NCBP2_uc003fxf.2_3'UTR	p.R99W	NM_007362	NP_031388	P52298	NCBP2_HUMAN	Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)	3	385	-	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		99			RRM.		B2RE91|B4DMK7|E9PAR5|Q14924|Q2TS50	Missense_Mutation	SNP	ENST00000321256.5	37	c.295C>T	CCDS3323.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.462954	0.63513	.	.	ENSG00000114503	ENST00000447325;ENST00000321256;ENST00000427641;ENST00000452404;ENST00000422610;ENST00000411704	T;T;T;T;T;T	0.75260	-0.92;2.27;-0.92;2.27;-0.92;-0.92	4.96	2.05	0.26809	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.057701	0.64402	D	0.000003	D	0.85248	0.5653	M	0.82823	2.61	0.80722	D	1	P;D;P	0.89917	0.716;1.0;0.844	B;D;B	0.80764	0.138;0.994;0.217	D	0.84961	0.0877	10	0.48119	T	0.1	.	13.3628	0.60665	0.0:0.0:0.4238:0.5762	.	81;46;99	P52298-2;E9PAR5;P52298	.;.;NCBP2_HUMAN	W	29;99;46;81;29;29	ENSP00000413518:R29W;ENSP00000326806:R99W;ENSP00000397619:R46W;ENSP00000412785:R81W;ENSP00000394105:R29W;ENSP00000389315:R29W	ENSP00000326806:R99W	R	-	1	2	NCBP2	198148882	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.449000	0.21744	0.323000	0.23307	-0.182000	0.12963	CGG		0.488	NCBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340470.2	NM_007362		4	94	0	0	0	0.000602	0	4	94				
UGT2B7	7364	broad.mit.edu	37	4	69978338	69978338	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr4:69978338G>A	ENST00000305231.7	+	6	1520	c.1474G>A	c.(1474-1476)Gat>Aat	p.D492N	UGT2B7_ENST00000508661.1_3'UTR	NM_001074.2	NP_001065.2	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	492					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)	p.D492N(1)		autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCACTCTTTGGATGTGATTGG	0.458																																							uc003heg.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1474-1476)GAT>AAT		UDP glucuronosyltransferase 2B7 precursor							177.0	167.0	170.0					4																	69978338		2203	4300	6503	SO:0001583	missense	7364				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69978338G>A	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000305231.7:c.1474G>A	4.37:g.69978338G>A	ENSP00000304811:p.Asp492Asn					UGT2B7_uc010ihq.2_3'UTR	p.D492N	NM_001074	NP_001065	P16662	UD2B7_HUMAN			6	1520	+			492					B2R810|Q6GTW0	Missense_Mutation	SNP	ENST00000305231.7	37	c.1474G>A	CCDS3526.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656614	0.47467	.	.	ENSG00000171234	ENST00000305231	T	0.72942	-0.7	2.13	2.13	0.27403	.	0.000000	0.64402	U	0.000002	D	0.87398	0.6167	H	0.96748	3.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88960	0.3393	9	.	.	.	.	9.956	0.41666	0.0:0.0:1.0:0.0	.	492	P16662	UD2B7_HUMAN	N	492	ENSP00000304811:D492N	.	D	+	1	0	UGT2B7	70012927	1.000000	0.71417	0.994000	0.49952	0.084000	0.17831	8.547000	0.90665	1.192000	0.43071	0.306000	0.20318	GAT		0.458	UGT2B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251560.1	NM_001074		17	138	0	0	0	0.00499	0	17	138				
BANK1	55024	broad.mit.edu	37	4	102839313	102839313	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr4:102839313C>T	ENST00000322953.4	+	7	1447	c.1173C>T	c.(1171-1173)caC>caT	p.H391H	BANK1_ENST00000504592.1_Silent_p.H376H|BANK1_ENST00000444316.2_Silent_p.H361H|BANK1_ENST00000508653.1_Silent_p.H258H|BANK1_ENST00000428908.1_Silent_p.H258H	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	391					B cell activation (GO:0042113)			p.H391H(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GGCATGGTCACAAAGAACTCA	0.358																																							uc003hvy.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1171-1173)CAC>CAT		B-cell scaffold protein with ankyrin repeats 1							54.0	56.0	56.0					4																	102839313		2202	4298	6500	SO:0001819	synonymous_variant	55024				B cell activation			g.chr4:102839313C>T	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1173C>T	4.37:g.102839313C>T						BANK1_uc003hvx.3_Silent_p.H376H|BANK1_uc010ill.2_Silent_p.H258H|BANK1_uc003hvz.3_Silent_p.H361H	p.H391H	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)	7	1447	+		Hepatocellular(203;0.217)	391			ANK 2.		A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Silent	SNP	ENST00000322953.4	37	c.1173C>T	CCDS34038.1																																																																																				0.358	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935		7	74	0	0	0	0.001984	0	7	74				
TACR3	6870	broad.mit.edu	37	4	104512654	104512654	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr4:104512654G>T	ENST00000304883.2	-	4	1215	c.1075C>A	c.(1075-1077)Ctg>Atg	p.L359M	RP11-297P16.3_ENST00000512401.1_RNA|RP11-297P16.3_ENST00000502936.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	359					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)	p.L359M(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CTTTTATTCAGACAGCAGTAG	0.398																																							uc003hxe.1		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(3)|lung(2)|breast(1)|skin(1)	7						c.(1075-1077)CTG>ATG		tachykinin receptor 3							159.0	165.0	163.0					4																	104512654		2203	4300	6503	SO:0001583	missense	6870					integral to plasma membrane	tachykinin receptor activity	g.chr4:104512654G>T	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1075C>A	4.37:g.104512654G>T	ENSP00000303325:p.Leu359Met						p.L359M	NM_001059	NP_001050	P29371	NK3R_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)	4	1218	-		Hepatocellular(203;0.217)	359			Helical; Name=7; (Potential).		Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	c.1075C>A	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311583	0.40895	.	.	ENSG00000169836	ENST00000304883	T	0.38401	1.14	5.21	2.52	0.30459	.	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	M	0.65320	2	0.46061	D	0.998844	D	0.89917	1.0	D	0.79108	0.992	T	0.37454	-0.9705	10	0.22706	T	0.39	.	9.4264	0.38583	0.2345:0.0:0.7655:0.0	.	359	P29371	NK3R_HUMAN	M	359	ENSP00000303325:L359M	ENSP00000303325:L359M	L	-	1	2	TACR3	104732103	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.191000	0.65110	0.287000	0.22375	-0.140000	0.14226	CTG		0.398	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059		22	71	1	0	2.89027e-11	0.014323	4.00553e-11	22	71				
CYP2U1	113612	broad.mit.edu	37	4	108868619	108868619	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr4:108868619C>A	ENST00000332884.6	+	3	1489	c.1214C>A	c.(1213-1215)gCc>gAc	p.A405D	CYP2U1_ENST00000508453.1_Missense_Mutation_p.A196D|RP11-286E11.1_ENST00000513071.1_RNA	NM_183075.2	NP_898898.1	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U, polypeptide 1	405					arachidonic acid metabolic process (GO:0019369)|cell death (GO:0008219)|omega-hydroxylase P450 pathway (GO:0097267)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.A405D(1)		breast(1)|large_intestine(2)|lung(4)|skin(2)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		TACACAGAAGCCACCATCATG	0.498																																							uc003hyp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1213-1215)GCC>GAC		cytochrome P450, family 2, subfamily U,							105.0	94.0	97.0					4																	108868619		2203	4300	6503	SO:0001583	missense	113612				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr4:108868619C>A	BC012027	CCDS34047.1	4q25	2012-11-23			ENSG00000155016	ENSG00000155016		"""Cytochrome P450s"""	20582	protein-coding gene	gene with protein product	"""spastic paraplegia 49"""	610670				14975754, 14660610	Standard	XM_005262717		Approved	SPG49	uc003hyp.3	Q7Z449	OTTHUMG00000161084	ENST00000332884.6:c.1214C>A	4.37:g.108868619C>A	ENSP00000333212:p.Ala405Asp					CYP2U1_uc011cfi.1_Missense_Mutation_p.A196D	p.A405D	NM_183075	NP_898898	Q7Z449	CP2U1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000128)	3	1297	+		Hepatocellular(203;0.217)	405					B2RMV7|Q96EQ6	Missense_Mutation	SNP	ENST00000332884.6	37	c.1214C>A	CCDS34047.1	.	.	.	.	.	.	.	.	.	.	C	35	5.510990	0.96386	.	.	ENSG00000155016	ENST00000332884;ENST00000424249;ENST00000508453	D;D	0.83914	-1.78;-1.78	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.95421	0.8513	H	0.98646	4.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96228	0.9166	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	405	Q7Z449	CP2U1_HUMAN	D	405;362;196	ENSP00000333212:A405D;ENSP00000423667:A196D	ENSP00000333212:A405D	A	+	2	0	CYP2U1	109088068	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GCC		0.498	CYP2U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363691.2	NM_183075		19	41	1	0	8.00594e-06	0.007413	9.36475e-06	19	41				
TENM3	55714	broad.mit.edu	37	4	183675836	183675836	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr4:183675836C>T	ENST00000511685.1	+	22	4439	c.4316C>T	c.(4315-4317)tCc>tTc	p.S1439F	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.S1439F			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1439					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S1439F(1)									GGAGAAATCTCCTTAGTGGCC	0.468																																							uc003ivd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4315-4317)TCC>TTC		odz, odd Oz/ten-m homolog 3							61.0	62.0	62.0					4																	183675836		1979	4168	6147	SO:0001583	missense	55714				signal transduction	integral to membrane		g.chr4:183675836C>T	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.4316C>T	4.37:g.183675836C>T	ENSP00000424226:p.Ser1439Phe					ODZ3_uc003ive.1_Missense_Mutation_p.S852F	p.S1439F	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)	21	4353	+		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)	1439			Extracellular (Potential).		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	c.4316C>T	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839444	0.71488	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.90197	-2.63;-2.63	5.29	5.29	0.74685	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	D	0.90679	0.7076	M	0.86097	2.795	0.52099	D	0.999941	P	0.40476	0.718	B	0.30646	0.118	D	0.92229	0.5791	9	0.66056	D	0.02	.	19.1301	0.93402	0.0:1.0:0.0:0.0	.	1439	Q9P273	TEN3_HUMAN	F	1439	ENSP00000424226:S1439F;ENSP00000385276:S1439F	ENSP00000385276:S1439F	S	+	2	0	ODZ3	183912830	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	5.892000	0.69790	2.767000	0.95098	0.655000	0.94253	TCC		0.468	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1			8	34	0	0	0	0.00308	0	8	34				
CDH12	1010	broad.mit.edu	37	5	21975427	21975427	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:21975427G>A	ENST00000382254.1	-	6	1385	c.299C>T	c.(298-300)aCc>aTc	p.T100I	CDH12_ENST00000504376.2_Missense_Mutation_p.T100I|CDH12_ENST00000522262.1_Missense_Mutation_p.T100I	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T100I(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GGTAAAAACGGTGCCAGCGCC	0.493										HNSCC(59;0.17)																													uc010iuc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(298-300)ACC>ATC		cadherin 12, type 2 preproprotein							62.0	63.0	62.0					5																	21975427		2037	3862	5899	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21975427G>A	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.299C>T	5.37:g.21975427G>A	ENSP00000371689:p.Thr100Ile	HNSCC(59;0.17)				CDH12_uc011cno.1_Missense_Mutation_p.T100I|CDH12_uc003jgk.2_Missense_Mutation_p.T100I	p.T100I	NM_004061	NP_004052	P55289	CAD12_HUMAN			3	757	-			100			Cadherin 1.|Extracellular (Potential).		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.299C>T	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863875	0.71949	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.61392	0.11;0.11;0.11	5.16	5.16	0.70880	Cadherin (5);Cadherin-like (1);	0.047915	0.85682	D	0.000000	T	0.79592	0.4472	M	0.89095	3.005	0.53005	D	0.999962	P;D	0.59357	0.956;0.985	D;P	0.65573	0.936;0.763	T	0.82257	-0.0547	10	0.48119	T	0.1	.	18.6264	0.91340	0.0:0.0:1.0:0.0	.	100;100	B7Z2U6;P55289	.;CAD12_HUMAN	I	100	ENSP00000423577:T100I;ENSP00000371689:T100I;ENSP00000428786:T100I	ENSP00000371689:T100I	T	-	2	0	CDH12	22011184	1.000000	0.71417	0.997000	0.53966	0.719000	0.41307	9.357000	0.97099	2.414000	0.81942	0.484000	0.47621	ACC		0.493	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		44	112	0	0	0	0.01441	0	44	112				
CCNB1	891	broad.mit.edu	37	5	68467140	68467140	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:68467140C>A	ENST00000256442.5	+	4	660	c.407C>A	c.(406-408)gCc>gAc	p.A136D		NM_031966.3	NP_114172.1	P14635	CCNB1_HUMAN	cyclin B1	136					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to iron(III) ion (GO:0071283)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle checkpoint (GO:0071174)|mitotic spindle stabilization (GO:0043148)|negative regulation of gene expression (GO:0010629)|negative regulation of protein phosphorylation (GO:0001933)|oocyte maturation (GO:0001556)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of chromosome condensation (GO:0060623)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to DDT (GO:0046680)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|spermatogenesis (GO:0007283)|tissue regeneration (GO:0042246)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase activity (GO:0016301)|patched binding (GO:0005113)|protein kinase binding (GO:0019901)	p.A136V(1)|p.A136D(1)		large_intestine(2)|lung(5)|skin(1)	8		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TCTGGATGTGCCCCTGCAGAA	0.423																																							uc003jvm.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)		0						c.(406-408)GCC>GAC		cyclin B1							129.0	126.0	127.0					5																	68467140		2203	4300	6503	SO:0001583	missense	891				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitotic cell cycle spindle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|mitotic spindle stabilization|positive regulation of attachment of spindle microtubules to kinetochore|positive regulation of mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	condensed nuclear chromosome outer kinetochore|cytosol|microtubule organizing center|nucleoplasm|spindle pole		g.chr5:68467140C>A	U22364	CCDS3997.1	5q12	2008-07-18			ENSG00000134057	ENSG00000134057			1579	protein-coding gene	gene with protein product	"""G2/mitotic-specific cyclin B1"""	123836		CCNB		1386342	Standard	NM_031966		Approved		uc003jvm.3	P14635	OTTHUMG00000097817	ENST00000256442.5:c.407C>A	5.37:g.68467140C>A	ENSP00000256442:p.Ala136Asp					CCNB1_uc011crd.1_Missense_Mutation_p.A136D|CCNB1_uc010ixb.2_Missense_Mutation_p.A136D	p.A136D	NM_031966	NP_114172	P14635	CCNB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)	4	584	+		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)	136					A8K066|Q5TZP9	Missense_Mutation	SNP	ENST00000256442.5	37	c.407C>A	CCDS3997.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320699	0.41096	.	.	ENSG00000134057	ENST00000256442;ENST00000506572;ENST00000508407;ENST00000505500	T;T;T;T	0.14266	2.64;2.52;2.52;2.52	5.88	5.88	0.94601	.	0.461328	0.25369	N	0.031164	T	0.12178	0.0296	L	0.42245	1.32	0.45118	D	0.99813	B;B;B	0.21309	0.047;0.04;0.054	B;B;B	0.28139	0.086;0.039;0.027	T	0.17440	-1.0369	10	0.16896	T	0.51	.	7.9468	0.29991	0.1608:0.7598:0.0:0.0794	.	136;136;136	E9PC90;Q5TZP9;P14635	.;.;CCNB1_HUMAN	D	136	ENSP00000256442:A136D;ENSP00000423387:A136D;ENSP00000426092:A136D;ENSP00000424588:A136D	ENSP00000256442:A136D	A	+	2	0	CCNB1	68502896	0.029000	0.19370	0.971000	0.41717	0.984000	0.73092	1.110000	0.31147	2.789000	0.95967	0.591000	0.81541	GCC		0.423	CCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215084.1	NM_031966		7	88	1	0	8.12818e-05	0.001984	9.21194e-05	7	88				
CMYA5	202333	broad.mit.edu	37	5	79030937	79030937	+	Missense_Mutation	SNP	G	G	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:79030937G>C	ENST00000446378.2	+	2	6380	c.6349G>C	c.(6349-6351)Gat>Cat	p.D2117H		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2117					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.D2117H(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGATGATGCTGATGAGGGAAA	0.438																																							uc003kgc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|pancreas(2)|lung(1)	9						c.(6349-6351)GAT>CAT		cardiomyopathy associated 5							66.0	64.0	64.0					5																	79030937		1900	4119	6019	SO:0001583	missense	202333					perinuclear region of cytoplasm		g.chr5:79030937G>C	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6349G>C	5.37:g.79030937G>C	ENSP00000394770:p.Asp2117His						p.D2117H	NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	2	6421	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	2117					A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	c.6349G>C	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533883	0.27387	.	.	ENSG00000164309	ENST00000446378	T	0.04083	3.71	5.87	-7.68	0.01268	.	2.273040	0.01664	N	0.025270	T	0.03220	0.0094	N	0.19112	0.55	0.09310	N	1	P	0.35982	0.531	B	0.32393	0.145	T	0.39482	-0.9612	10	0.66056	D	0.02	.	7.5944	0.28039	0.177:0.1186:0.588:0.1164	.	2117	Q8N3K9	CMYA5_HUMAN	H	2117	ENSP00000394770:D2117H	ENSP00000394770:D2117H	D	+	1	0	CMYA5	79066693	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.229000	0.09098	-1.040000	0.03271	-1.107000	0.02091	GAT		0.438	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		20	49	0	0	0	0.008871	0	20	49				
ATG10	83734	broad.mit.edu	37	5	81460256	81460256	+	Missense_Mutation	SNP	T	T	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:81460256T>G	ENST00000282185.3	+	4	549	c.255T>G	c.(253-255)atT>atG	p.I85M	ATG10_ENST00000458350.3_Missense_Mutation_p.I85M|ATG10_ENST00000513634.1_Missense_Mutation_p.I85M	NM_031482.4	NP_113670.1	Q9H0Y0	ATG10_HUMAN	autophagy related 10	85					autophagy (GO:0006914)|autophagy in response to ER overload (GO:0034263)|positive regulation of protein modification process (GO:0031401)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	Atg12 ligase activity (GO:0019777)	p.I85M(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(2)	9		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		GTGAAGTGATTGAAACTGCAG	0.378																																							uc003khs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(253-255)ATT>ATG		APG10 autophagy 10-like							134.0	137.0	136.0					5																	81460256		2203	4300	6503	SO:0001583	missense	83734				autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding	g.chr5:81460256T>G	AK024016	CCDS4057.1	5q14.1	2014-02-12	2012-06-06	2005-09-11	ENSG00000152348	ENSG00000152348			20315	protein-coding gene	gene with protein product		610800	"""APG10 autophagy 10-like (S. cerevisiae)"", ""ATG10 autophagy related 10 homolog (S. cerevisiae)"""	APG10L			Standard	NM_031482		Approved	DKFZP586I0418, FLJ13954	uc003khr.3	Q9H0Y0	OTTHUMG00000119041	ENST00000282185.3:c.255T>G	5.37:g.81460256T>G	ENSP00000282185:p.Ile85Met					ATG10_uc003khr.2_Missense_Mutation_p.I85M|ATG10_uc010jas.2_Missense_Mutation_p.I49M	p.I85M	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)	5	684	+		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)	85					B2RE09|Q6PIX1|Q9H842	Missense_Mutation	SNP	ENST00000282185.3	37	c.255T>G	CCDS4057.1	.	.	.	.	.	.	.	.	.	.	T	2.829	-0.243038	0.05906	.	.	ENSG00000152348	ENST00000282185;ENST00000458350;ENST00000513634	T;T;T	0.45668	1.9;1.9;0.89	5.58	-9.76	0.00503	.	1.153300	0.06154	N	0.674794	T	0.18173	0.0436	N	0.08118	0	0.09310	N	1	B;B	0.13145	0.005;0.007	B;B	0.15484	0.001;0.013	T	0.29882	-0.9997	10	0.41790	T	0.15	-0.0295	7.8491	0.29444	0.0:0.3547:0.2986:0.3467	.	85;85	D6RDX3;Q9H0Y0	.;ATG10_HUMAN	M	85	ENSP00000282185:I85M;ENSP00000404938:I85M;ENSP00000425225:I85M	ENSP00000282185:I85M	I	+	3	3	ATG10	81496012	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.535000	0.02210	-2.195000	0.00752	0.383000	0.25322	ATT		0.378	ATG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239252.2	NM_001131028		49	85	0	0	0	0.01441	0	49	85				
FBN2	2201	broad.mit.edu	37	5	127599195	127599195	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:127599195G>T	ENST00000508053.1	-	69	9088	c.8114C>A	c.(8113-8115)cCc>cAc	p.P2705H	FBN2_ENST00000262464.4_Missense_Mutation_p.P2705H			P35556	FBN2_HUMAN	fibrillin 2	2705	EGF-like 47; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.P2705H(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTAATTGCAGGGGTTCTTGGA	0.612																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(8113-8115)CCC>CAC		fibrillin 2 precursor							113.0	110.0	111.0					5																	127599195		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127599195G>T	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8114C>A	5.37:g.127599195G>T	ENSP00000424571:p.Pro2705His						p.P2705H	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	63	8553	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	2705			EGF-like 47; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.8114C>A	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026904	0.93518	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.87571	-2.27;-2.27	5.24	5.24	0.73138	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000017	D	0.92724	0.7687	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90297	0.4327	10	0.25751	T	0.34	.	19.0205	0.92912	0.0:0.0:1.0:0.0	.	2705	P35556	FBN2_HUMAN	H	2705	ENSP00000262464:P2705H;ENSP00000424571:P2705H	ENSP00000262464:P2705H	P	-	2	0	FBN2	127627094	1.000000	0.71417	0.964000	0.40570	0.979000	0.70002	9.601000	0.98297	2.706000	0.92434	0.655000	0.94253	CCC		0.612	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		19	132	1	0	1.00905e-13	0.008871	1.43747e-13	19	132				
PCDHA8	56140	broad.mit.edu	37	5	140222229	140222229	+	Silent	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:140222229G>A	ENST00000531613.1	+	1	1323	c.1323G>A	c.(1321-1323)ttG>ttA	p.L441L	PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000378123.3_Silent_p.L441L|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	441	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L441F(2)|p.L441L(2)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCCAGCTTGTCTGTGGAGG	0.662																																							uc003lhs.2		NA																	4	Substitution - Missense(2)|Substitution - coding silent(2)		lung(4)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1321-1323)TTG>TTA		protocadherin alpha 8 isoform 1 precursor							57.0	61.0	59.0					5																	140222229		2194	4265	6459	SO:0001819	synonymous_variant	56140				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140222229G>A	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1323G>A	5.37:g.140222229G>A						PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.L441L	p.L441L	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1323	+			441			Cadherin 4.|Extracellular (Potential).		B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	c.1323G>A	CCDS54919.1																																																																																				0.662	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911		6	89	0	0	0	0.001984	0	6	89				
PCDHB6	56130	broad.mit.edu	37	5	140529991	140529991	+	Silent	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:140529991G>A	ENST00000231136.1	+	1	153	c.153G>A	c.(151-153)ctG>ctA	p.L51L	PCDHB6_ENST00000543635.1_Intron	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	51	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L51L(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAAAGGACCTGGGACTGAGGG	0.512																																							uc003lir.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(151-153)CTG>CTA		protocadherin beta 6 precursor							101.0	109.0	106.0					5																	140529991		2203	4300	6503	SO:0001819	synonymous_variant	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140529991G>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.153G>A	5.37:g.140529991G>A						PCDHB6_uc011dah.1_Intron	p.L51L	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	153	+			51			Extracellular (Potential).|Cadherin 1.		B2R8R9	Silent	SNP	ENST00000231136.1	37	c.153G>A	CCDS4248.1																																																																																				0.512	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		32	120	0	0	0	0.008361	0	32	120				
PCDHB17	54661	broad.mit.edu	37	5	140536921	140536921	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:140536921G>A	ENST00000539533.1	+	1	1345	c.1345G>A	c.(1345-1347)Gcc>Acc	p.A449T						protocadherin beta 17 pseudogene									p.A449T(2)									CAATGACAACGCCCCCGCCTT	0.587																																							uc003lis.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1342-1344)GCC>ACC		SubName: Full=Protocadherin-psi1;																																				SO:0001583	missense	54661							g.chr5:140536921G>A	AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.1345G>A	5.37:g.140536921G>A	ENSP00000438685:p.Ala449Thr						p.A448T	NR_001280						1	1342	+									Missense_Mutation	SNP	ENST00000539533.1	37	c.1342G>A		.	.	.	.	.	.	.	.	.	.	G	14.37	2.516403	0.44763	.	.	ENSG00000255622	ENST00000539533	T	0.03181	4.02	5.29	4.36	0.52297	.	.	.	.	.	T	0.02848	0.0085	.	.	.	.	.	.	P	0.45348	0.856	B	0.16722	0.016	T	0.39014	-0.9634	7	0.66056	D	0.02	.	14.5966	0.68413	0.0:0.2762:0.7238:0.0	.	449	Q96T98	.	T	449	ENSP00000438685:A449T	ENSP00000438685:A449T	A	+	1	0	AC005754.1	140517105	0.005000	0.15991	1.000000	0.80357	0.959000	0.62525	0.109000	0.15417	2.654000	0.90174	0.485000	0.47835	GCC		0.587	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				5	91	0	0	0	0.001984	0	5	91				
PCDHB10	56126	broad.mit.edu	37	5	140573077	140573077	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:140573077A>T	ENST00000239446.4	+	1	1136	c.952A>T	c.(952-954)Aat>Tat	p.N318Y		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	318	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N318Y(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTACAAAATAAATATACAGGC	0.378																																							uc003lix.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(952-954)AAT>TAT		protocadherin beta 10 precursor							61.0	66.0	65.0					5																	140573077		2203	4300	6503	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140573077A>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.952A>T	5.37:g.140573077A>T	ENSP00000239446:p.Asn318Tyr						p.N318Y	NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1126	+			318			Extracellular (Potential).|Cadherin 3.		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.952A>T	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	A	2.104	-0.405451	0.04832	.	.	ENSG00000120324	ENST00000239446	T	0.01787	4.64	3.41	0.742	0.18341	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01695	0.0054	L	0.28192	0.835	0.09310	N	1	B	0.24092	0.097	B	0.33254	0.16	T	0.48246	-0.9052	9	0.49607	T	0.09	.	3.0679	0.06220	0.5136:0.0:0.2048:0.2815	.	318	Q9UN67	PCDBA_HUMAN	Y	318	ENSP00000239446:N318Y	ENSP00000239446:N318Y	N	+	1	0	PCDHB10	140553261	0.000000	0.05858	0.980000	0.43619	0.785000	0.44390	-2.174000	0.01264	0.525000	0.28522	0.454000	0.30748	AAT		0.378	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		7	156	0	0	0	0.00308	0	7	156				
PCDHB12	56124	broad.mit.edu	37	5	140590351	140590351	+	Silent	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:140590351G>A	ENST00000239450.2	+	1	2061	c.1872G>A	c.(1870-1872)gtG>gtA	p.V624V	PCDHB12_ENST00000541609.1_Silent_p.V287V	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V624V(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGGCGAGGTGCGCACCGCCA	0.706																																							uc003liz.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(1870-1872)GTG>GTA		protocadherin beta 12 precursor							7.0	9.0	8.0					5																	140590351		1582	3263	4845	SO:0001819	synonymous_variant	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140590351G>A	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1872G>A	5.37:g.140590351G>A						PCDHB12_uc011dak.1_Silent_p.V287V	p.V624V	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2061	+			624			Extracellular (Potential).|Cadherin 6.		B4DDU1	Silent	SNP	ENST00000239450.2	37	c.1872G>A	CCDS4254.1																																																																																				0.706	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		5	91	0	0	0	0.00308	0	5	91				
FAT2	2196	broad.mit.edu	37	5	150943179	150943179	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:150943179G>T	ENST00000261800.5	-	2	3293	c.3281C>A	c.(3280-3282)cCc>cAc	p.P1094H		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1094	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1094H(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCGGTCCAGGGGTGCCAGAGT	0.473																																							uc003lue.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(3280-3282)CCC>CAC		FAT tumor suppressor 2 precursor							69.0	67.0	67.0					5																	150943179		2203	4300	6503	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150943179G>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.3281C>A	5.37:g.150943179G>T	ENSP00000261800:p.Pro1094His					GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.P1094H	p.P1094H	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	3294	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	1094			Cadherin 9.|Extracellular (Potential).		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.3281C>A	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.727744	0.30593	.	.	ENSG00000086570	ENST00000261800	T	0.01745	4.66	4.93	4.03	0.46877	Cadherin (5);Cadherin-like (1);	0.000000	0.64402	D	0.000013	T	0.04272	0.0118	L	0.44542	1.39	0.20703	N	0.999869	P	0.39071	0.658	P	0.50109	0.631	T	0.38001	-0.9681	10	0.22706	T	0.39	.	15.2775	0.73753	0.0:0.141:0.859:0.0	.	1094	Q9NYQ8	FAT2_HUMAN	H	1094	ENSP00000261800:P1094H	ENSP00000261800:P1094H	P	-	2	0	FAT2	150923372	0.797000	0.28877	0.670000	0.29842	0.991000	0.79684	2.811000	0.47986	1.158000	0.42547	0.484000	0.47621	CCC		0.473	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		4	44	1	0	1.23904e-05	0.000602	1.42966e-05	4	44				
EBF1	1879	broad.mit.edu	37	5	158223455	158223455	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr5:158223455C>T	ENST00000313708.6	-	9	1089	c.807G>A	c.(805-807)ccG>ccA	p.P269P	EBF1_ENST00000517373.1_Silent_p.P261P|EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Silent_p.P238P	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	269	IPT/TIG.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P269P(1)	HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCCTTCACTCGGGCTGATGG	0.463			T	HMGA2	lipoma																																		uc010jip.2		NA		Dom	yes		5	5q34	1879	T	early B-cell factor 1			M	HMGA2		lipoma	HMGA2/EBF1(2)	1	Substitution - coding silent(1)		lung(1)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(805-807)CCG>CCA		early B-cell factor							109.0	90.0	96.0					5																	158223455		2203	4300	6503	SO:0001819	synonymous_variant	1879				multicellular organismal development	nucleus	DNA binding|metal ion binding	g.chr5:158223455C>T	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.807G>A	5.37:g.158223455C>T						EBF1_uc011ddw.1_Silent_p.P137P|EBF1_uc011ddx.1_Silent_p.P270P|EBF1_uc003lxl.3_Silent_p.P238P	p.P269P	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		9	1109	-	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	269			IPT/TIG.		Q8IW11	Silent	SNP	ENST00000313708.6	37	c.807G>A	CCDS4343.1																																																																																				0.463	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007		4	66	0	0	0	0.009096	0	4	66				
NQO2	4835	broad.mit.edu	37	6	3006783	3006783	+	5'UTR	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:3006783C>T	ENST00000338130.2	+	0	709				NQO2_ENST00000606474.1_5'UTR|NQO2_ENST00000380454.4_5'UTR|NQO2_ENST00000380455.4_5'UTR|NQO2_ENST00000380441.1_5'UTR|NQO2_ENST00000380430.1_5'UTR			P16083	NQO2_HUMAN	NAD(P)H dehydrogenase, quinone 2						memory (GO:0007613)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	dihydronicotinamide riboside quinone reductase activity (GO:0001512)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADPH dehydrogenase (quinone) activity (GO:0008753)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Dabigatran etexilate(DB06695)|Flavin adenine dinucleotide(DB03147)|Melatonin(DB01065)|Menadione(DB00170)|Primaquine(DB01087)	CACCTTCTTACGCTATGGCAG	0.458																																							uc003mus.2		NA																	0				ovary(1)	1						c.(-5--1)TACGC>TATGC		NAD(P)H dehydrogenase, quinone 2	Menadione(DB00170)|NADH(DB00157)						129.0	107.0	115.0					6																	3006783		2203	4298	6501	SO:0001623	5_prime_UTR_variant	4835					cytoplasm|nucleus	coenzyme binding|dihydronicotinamide riboside quinone reductase activity|electron carrier activity|metal ion binding|NADPH dehydrogenase (quinone) activity	g.chr6:3006783C>T	U07736	CCDS4481.1, CCDS75388.1	6p25.2	2012-09-20	2001-11-30	2001-12-07	ENSG00000124588	ENSG00000124588	1.6.5.2		7856	protein-coding gene	gene with protein product		160998	"""NAD(P)H menadione oxidoreductase 2, dioxin-inducible"""	NMOR2		1691923	Standard	XM_005249152		Approved	QR2, DHQV, DIA6	uc003mus.2	P16083	OTTHUMG00000014130	ENST00000338130.2:c.-4C>T	6.37:g.3006783C>T						NQO2_uc003mup.1_Translation_Start_Site|NQO2_uc003mut.2_Translation_Start_Site		NM_000904	NP_000895	P16083	NQO2_HUMAN			2	335	+	Ovarian(93;0.0412)	all_hematologic(90;0.0895)						B2R492|Q5TD04	Translation_Start_Site	SNP	ENST00000338130.2	37	c.-3C>T	CCDS4481.1																																																																																				0.458	NQO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039651.1			3	15	0	0	0	0.009096	0	3	15				
RPP40	10799	broad.mit.edu	37	6	5000118	5000118	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:5000118C>A	ENST00000380051.2	-	4	402	c.358G>T	c.(358-360)Gat>Tat	p.D120Y	RPP40_ENST00000464646.1_Missense_Mutation_p.D60Y|RPP40_ENST00000319533.5_Missense_Mutation_p.D97Y	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	120					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)	p.D120Y(1)		NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				GTGTCTTTATCCAGTGACAAA	0.333																																							uc003mwl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(358-360)GAT>TAT		ribonuclease P 40kDa subunit							88.0	99.0	95.0					6																	5000118		2203	4299	6502	SO:0001583	missense	10799				tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity	g.chr6:5000118C>A	U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.358G>T	6.37:g.5000118C>A	ENSP00000369391:p.Asp120Tyr					RPP40_uc003mwm.2_Missense_Mutation_p.D97Y	p.D120Y	NM_006638	NP_006629	O75818	RPP40_HUMAN			4	393	-	Ovarian(93;0.11)	all_hematologic(90;0.0895)	120					Q5VX97|Q8WVK8	Missense_Mutation	SNP	ENST00000380051.2	37	c.358G>T	CCDS34333.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863282	0.71949	.	.	ENSG00000124787	ENST00000380051;ENST00000319533;ENST00000464646	T;T;T	0.52983	0.64;0.64;0.64	5.54	5.54	0.83059	.	0.046090	0.85682	D	0.000000	T	0.66713	0.2817	M	0.83483	2.645	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.69479	0.958;0.964	T	0.70267	-0.4919	10	0.59425	D	0.04	-5.1666	18.4831	0.90819	0.0:1.0:0.0:0.0	.	97;120	O75818-2;O75818	.;RPP40_HUMAN	Y	120;97;60	ENSP00000369391:D120Y;ENSP00000317998:D97Y;ENSP00000419431:D60Y	ENSP00000317998:D97Y	D	-	1	0	RPP40	4945117	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.760000	0.55235	2.613000	0.88420	0.650000	0.86243	GAT		0.333	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039733.2	NM_006638		55	67	1	0	1.13205e-32	0.01441	1.82704e-32	55	67				
ZBED9	114821	broad.mit.edu	37	6	28542849	28542849	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:28542849G>T	ENST00000452236.2	-	3	2250	c.1633C>A	c.(1633-1635)Cat>Aat	p.H545N	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.H545N(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						TTTTCTGTATGCAAGCTGGCA	0.403																																							uc003nlo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1633-1635)CAT>AAT		SCAN domain containing 3							102.0	101.0	101.0					6																	28542849		2203	4300	6503	SO:0001583	missense	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28542849G>T																												ENST00000452236.2:c.1633C>A	6.37:g.28542849G>T	ENSP00000395259:p.His545Asn						p.H545N	NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN			3	2251	-			545			Potential.			Missense_Mutation	SNP	ENST00000452236.2	37	c.1633C>A	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	G	0.232	-1.020631	0.02061	.	.	ENSG00000232040	ENST00000452236	T	0.01397	4.94	3.41	2.36	0.29203	.	.	.	.	.	T	0.00144	0.0004	N	0.00347	-1.61	0.20307	N	0.999912	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	6.5189	0.22264	0.0:0.0:0.4038:0.5962	.	545	Q6R2W3	SCND3_HUMAN	N	545	ENSP00000395259:H545N	ENSP00000395259:H545N	H	-	1	0	SCAND3	28650828	0.034000	0.19679	0.283000	0.24790	0.926000	0.56050	0.323000	0.19593	0.615000	0.30124	0.563000	0.77884	CAT		0.403	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			10	99	1	0	0.00621372	0.006214	0.0066297	10	99				
HSPA1L	3305	broad.mit.edu	37	6	31779552	31779552	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:31779552C>T	ENST00000375654.4	-	2	387	c.198G>A	c.(196-198)caG>caA	p.Q66Q	HSPA1L_ENST00000417199.3_Silent_p.Q66Q	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	66					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.Q66Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						AAACAGTGTTCTGGGGATTCA	0.493																																							uc003nxh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pleura(1)|kidney(1)|skin(1)	6						c.(196-198)CAG>CAA		heat shock 70kDa protein 1-like							139.0	130.0	133.0					6																	31779552		2203	4300	6503	SO:0001819	synonymous_variant	3305				response to unfolded protein		ATP binding	g.chr6:31779552C>T	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.198G>A	6.37:g.31779552C>T						HSPA1L_uc010jte.2_Silent_p.Q66Q	p.Q66Q	NM_005527	NP_005518	P34931	HS71L_HUMAN			2	381	-			66					A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	37	c.198G>A	CCDS34413.1																																																																																				0.493	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			84	63	0	0	0	0.01441	0	84	63				
TNXB	7148	broad.mit.edu	37	6	32011892	32011893	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:32011892_32011893GG>TT	ENST00000375244.3	-	34	11478_11479	c.11277_11278CC>AA	c.(11275-11280)ccCCgt>ccAAgt	p.R3760S	TNXB_ENST00000451343.1_Missense_Mutation_p.R189S|TNXB_ENST00000375247.2_Missense_Mutation_p.R3758S			P22105	TENX_HUMAN	tenascin XB	3805	Fibronectin type-III 29. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.R3825S(1)|p.R189S(1)|p.R3760S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGGAGGTCACGGGGGCTCTCCA	0.619																																							uc003nzl.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(11269-11274)CCCCGT>CCAAGT		tenascin XB isoform 1 precursor																																				SO:0001583	missense	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32011892_32011893GG>TT	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.11277_11278delinsTT	6.37:g.32011892_32011893delinsTT	ENSP00000364393:p.Arg3760Ser					TNXB_uc003nzg.1_Missense_Mutation_p.R189S|TNXB_uc003nzh.1_Missense_Mutation_p.R227S	p.R3758S	NM_019105	NP_061978	P22105	TENX_HUMAN			34	11473_11474	-			3805			Fibronectin type-III 30.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	DNP	ENST00000375244.3	37	c.11271_11272CC>AA																																																																																					0.619	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		6	4	0	0	0	0.004672	0	6	4				
NOTCH4	4855	broad.mit.edu	37	6	32184793	32184794	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:32184793_32184794GG>TT	ENST00000375023.3	-	11	1927_1928	c.1789_1790CC>AA	c.(1789-1791)CCa>AAa	p.P597K	NOTCH4_ENST00000465528.1_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	597	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.P597K(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						AACGGGACATGGGTCACTCAGG	0.584																																							uc003obb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(1789-1791)CCA>AAA		notch4 preproprotein																																				SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32184793_32184794GG>TT		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1789_1790delinsTT	6.37:g.32184793_32184794delinsTT	ENSP00000364163:p.Pro597Lys					NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA|NOTCH4_uc003obc.2_Missense_Mutation_p.P597K	p.P597K	NM_004557	NP_004548	Q99466	NOTC4_HUMAN			11	1928_1929	-			597			EGF-like 15; calcium-binding (Potential).|Extracellular (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	DNP	ENST00000375023.3	37	c.1789_1790CC>AA	CCDS34420.1																																																																																				0.584	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			29	29	0	0	0	0.004672	0	29	29				
CLPSL1	340204	broad.mit.edu	37	6	35755685	35755685	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:35755685C>A	ENST00000373861.5	+	3	358	c.264C>A	c.(262-264)aaC>aaA	p.N88K	CLPSL1_ENST00000542261.1_Missense_Mutation_p.N87K			A2RUU4	COLL1_HUMAN	colipase-like 1	88					digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)	p.N88K(1)									GCCTGCGGAACCTGACTTGTA	0.483																																							uc003old.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(262-264)AAC>AAA		hypothetical protein LOC340204 precursor							170.0	167.0	168.0					6																	35755685		2032	4194	6226	SO:0001583	missense	340204				digestion|lipid catabolic process	extracellular region	enzyme activator activity	g.chr6:35755685C>A		CCDS43456.1	6p21.31	2014-01-28	2012-02-06	2012-02-06	ENSG00000204140	ENSG00000204140			21251	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 127"""	C6orf127			Standard	NM_001010886		Approved	dJ510O8.6	uc003old.4	A2RUU4	OTTHUMG00000014582	ENST00000373861.5:c.264C>A	6.37:g.35755685C>A	ENSP00000362968:p.Asn88Lys						p.N88K	NM_001010886	NP_001010886	A2RUU4	CF127_HUMAN			3	321	+			88					A7E2T6|B2RPE2|B5G4V2|B6ZDM9|Q5T9G1	Missense_Mutation	SNP	ENST00000373861.5	37	c.264C>A	CCDS43456.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741830	0.30865	.	.	ENSG00000204140	ENST00000373861;ENST00000373860;ENST00000542261	T;T	0.32023	1.47;1.47	2.65	1.78	0.24846	.	1.029100	0.07794	U	0.955367	T	0.12518	0.0304	L	0.36672	1.1	0.09310	N	0.999999	P	0.51791	0.948	P	0.46208	0.507	T	0.12578	-1.0542	10	0.42905	T	0.14	.	5.4486	0.16550	0.0:0.8412:0.0:0.1588	.	88	A2RUU4	CF127_HUMAN	K	88;88;87	ENSP00000362968:N88K;ENSP00000438478:N87K	ENSP00000362967:N88K	N	+	3	2	C6orf127	35863663	0.589000	0.26807	0.256000	0.24389	0.003000	0.03518	0.775000	0.26689	0.720000	0.32209	-0.225000	0.12378	AAC		0.483	CLPSL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040317.2	NM_001010886		33	58	1	0	4.31634e-10	0.012213	5.73263e-10	33	58				
TBC1D22B	55633	broad.mit.edu	37	6	37250728	37250728	+	Splice_Site	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:37250728G>A	ENST00000373491.3	+	5	818	c.672G>A	c.(670-672)tcG>tcA	p.S224S		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	224	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.S224S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			GACTCCTGTCGGTGAGTTCTA	0.483																																							uc003onn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(670-672)TCG>TCA		TBC1 domain family, member 22B							87.0	79.0	82.0					6																	37250728		2203	4300	6503	SO:0001630	splice_region_variant	55633					intracellular	Rab GTPase activator activity	g.chr6:37250728G>A	AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.672+1G>A	6.37:g.37250728G>A						TBC1D22B_uc010jwt.2_RNA	p.S224S	NM_017772	NP_060242	Q9NU19	TB22B_HUMAN	OV - Ovarian serous cystadenocarcinoma(102;0.241)		5	818	+			224			Rab-GAP TBC.		A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Silent	SNP	ENST00000373491.3	37	c.672G>A	CCDS4832.1																																																																																				0.483	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040402.1	NM_017772	Silent	9	21	0	0	0	0.004482	0	9	21				
HTR1E	3354	broad.mit.edu	37	6	87726029	87726029	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:87726029C>A	ENST00000305344.5	+	2	1680	c.977C>A	c.(976-978)gCc>gAc	p.A326D		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	326					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.A326D(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TCGGAAGTGGCCGACTTTCTG	0.448																																							uc003pli.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(976-978)GCC>GAC		5-hydroxytryptamine (serotonin) receptor 1E	Eletriptan(DB00216)						151.0	159.0	156.0					6																	87726029		2203	4300	6503	SO:0001583	missense	3354				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity	g.chr6:87726029C>A		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.977C>A	6.37:g.87726029C>A	ENSP00000307766:p.Ala326Asp						p.A326D	NM_000865	NP_000856	P28566	5HT1E_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.055)	2	1680	+		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)	326			Helical; Name=7; (By similarity).		E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	c.977C>A	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.447513	0.43429	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.72282	-0.64;-0.64	4.61	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	0.100891	0.41500	U	0.000879	T	0.52403	0.1732	L	0.31065	0.9	0.41343	D	0.987312	B	0.23490	0.086	B	0.40565	0.333	T	0.51395	-0.8711	10	0.27082	T	0.32	.	14.4017	0.67050	0.0:0.851:0.149:0.0	.	326	P28566	5HT1E_HUMAN	D	326	ENSP00000307766:A326D;ENSP00000358597:A326D	ENSP00000307766:A326D	A	+	2	0	HTR1E	87782748	1.000000	0.71417	0.990000	0.47175	0.921000	0.55340	4.526000	0.60566	0.893000	0.36288	0.407000	0.27541	GCC		0.448	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		59	83	1	0	6.26901e-30	0.01441	1.00541e-29	59	83				
CASP8AP2	9994	broad.mit.edu	37	6	90556331	90556331	+	RNA	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:90556331G>T	ENST00000551025.1	+	0	1460									caspase 8 associated protein 2									p.G8V(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		GATGACAATGGTGATGGAACA	0.338																																					Colon(187;1656 2025 17045 31481 39901)	Colon(187;1656 2025 17045 31481 39901)	uc003pnr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(22-24)GGT>GTT		caspase 8 associated protein 2							134.0	139.0	138.0					6																	90556331		1936	4143	6079			9994				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity	g.chr6:90556331G>T	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90556331G>T						CASP8AP2_uc003pns.2_Missense_Mutation_p.G8V|CASP8AP2_uc003pnt.2_Missense_Mutation_p.G8V|CASP8AP2_uc011dzz.1_Missense_Mutation_p.G8V	p.G8V	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0953)	2	219	+		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)	8						Missense_Mutation	SNP	ENST00000551025.1	37	c.23G>T																																																																																					0.338	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		7	10	1	0	1.76689e-08	0.006214	2.20862e-08	7	10				
BACH2	60468	broad.mit.edu	37	6	90660894	90660894	+	Missense_Mutation	SNP	G	G	A	rs148083597	byFrequency	TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:90660894G>A	ENST00000257749.4	-	7	1638	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	RP3-512E2.2_ENST00000445838.1_RNA|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000537989.1_Missense_Mutation_p.R311W|BACH2_ENST00000343122.3_Missense_Mutation_p.R311W	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	311						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.R311W(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GGCTGTTTCCGGTCCATCTCG	0.647																																							uc011eab.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(1)|lung(1)|skin(1)	6						c.(931-933)CGG>TGG		BTB and CNC homology 1, basic leucine zipper		G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	44.0	42.0	43.0		931,931	3.1	0.9	6	dbSNP_134	43	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	BACH2	NM_001170794.1,NM_021813.2	101,101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	311/842,311/842	90660894	2,13004	2203	4300	6503	SO:0001583	missense	60468					nucleus	protein dimerization activity|sequence-specific DNA binding	g.chr6:90660894G>A	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.931C>T	6.37:g.90660894G>A	ENSP00000257749:p.Arg311Trp					BACH2_uc003pnw.2_Missense_Mutation_p.R311W|BACH2_uc010kch.2_Missense_Mutation_p.R311W	p.R311W	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0799)	7	1740	-		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)	311					E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	c.931C>T	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963074	0.53507	2.27E-4	1.16E-4	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.38887	1.11;1.11;1.11	5.03	3.11	0.35812	.	0.498207	0.22512	N	0.059099	T	0.23492	0.0568	N	0.19112	0.55	0.31433	N	0.672948	D	0.76494	0.999	P	0.54706	0.759	T	0.07347	-1.0777	10	0.72032	D	0.01	-2.216	8.1526	0.31150	0.0882:0.0:0.6679:0.2439	.	311	Q9BYV9	BACH2_HUMAN	W	311	ENSP00000257749:R311W;ENSP00000437473:R311W;ENSP00000345642:R311W	ENSP00000257749:R311W	R	-	1	2	BACH2	90717615	0.944000	0.32072	0.922000	0.36590	0.952000	0.60782	1.514000	0.35834	1.358000	0.45922	0.655000	0.94253	CGG		0.647	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813		6	36	0	0	0	0.001168	0	6	36				
EPHA7	2045	broad.mit.edu	37	6	94066483	94066483	+	Silent	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:94066483G>T	ENST00000369303.4	-	5	1460	c.1276C>A	c.(1276-1278)Cga>Aga	p.R426R		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	426	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.R426*(1)|p.R426R(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CTCTGGGATCGGCTTAAGTCA	0.418																																							uc003poe.2		NA																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	p.R426*(1)	lung(2)	lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28						c.(1276-1278)CGA>AGA		ephrin receptor EphA7 precursor							112.0	112.0	112.0					6																	94066483		2203	4300	6503	SO:0001819	synonymous_variant	2045					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr6:94066483G>T	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1276C>A	6.37:g.94066483G>T						EPHA7_uc003pof.2_Silent_p.R426R|EPHA7_uc011eac.1_Silent_p.R426R	p.R426R	NM_004440	NP_004431	Q15375	EPHA7_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0847)	5	1517	-		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)	426			Extracellular (Potential).|Fibronectin type-III 1.		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	ENST00000369303.4	37	c.1276C>A	CCDS5031.1																																																																																				0.418	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			27	29	1	0	3.80469e-20	0.009535	5.77498e-20	27	29				
SYNE1	23345	broad.mit.edu	37	6	152804280	152804280	+	Silent	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr6:152804280G>T	ENST00000367255.5	-	14	1891	c.1290C>A	c.(1288-1290)acC>acA	p.T430T	SYNE1_ENST00000367248.3_Silent_p.T420T|SYNE1_ENST00000265368.4_Silent_p.T430T|SYNE1_ENST00000423061.1_Silent_p.T437T|SYNE1_ENST00000413186.2_Silent_p.T430T|SYNE1_ENST00000367253.4_Silent_p.T430T|SYNE1_ENST00000466159.2_Silent_p.T430T|SYNE1_ENST00000448038.1_Silent_p.T437T|SYNE1_ENST00000341594.5_Silent_p.T430T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	430					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.T430T(2)|p.T437T(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGTTGAACGGTTATTTCCT	0.483										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - coding silent(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(1288-1290)ACC>ACA		spectrin repeat containing, nuclear envelope 1							279.0	263.0	268.0					6																	152804280		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152804280G>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1290C>A	6.37:g.152804280G>T		HNSCC(10;0.0054)				SYNE1_uc003qot.3_Silent_p.T437T|SYNE1_uc003qou.3_Silent_p.T430T|SYNE1_uc010kjb.1_Silent_p.T413T|SYNE1_uc003qpa.1_Silent_p.T430T|SYNE1_uc003qox.1_5'UTR	p.T430T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	14	1892	-		Ovarian(120;0.0955)	430			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.1290C>A	CCDS5236.2																																																																																				0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		78	97	1	0	1.1397e-45	0.01441	1.875e-45	78	97				
SDK1	221935	broad.mit.edu	37	7	3991446	3991446	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:3991446C>T	ENST00000404826.2	+	7	1183	c.1044C>T	c.(1042-1044)acC>acT	p.T348T	SDK1_ENST00000389531.3_Silent_p.T348T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	348	Ig-like C2-type 3.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T348T(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GACGCCTCACCATCAGCAACC	0.617																																							uc003smx.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(3)|ovary(2)|skin(1)	6						c.(1042-1044)ACC>ACT		sidekick 1 precursor							79.0	70.0	73.0					7																	3991446		2203	4300	6503	SO:0001819	synonymous_variant	221935				cell adhesion	integral to membrane		g.chr7:3991446C>T	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1044C>T	7.37:g.3991446C>T							p.T348T	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	7	1183	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	348			Ig-like C2-type 3.		Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	c.1044C>T	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	7.929	0.740302	0.15642	.	.	ENSG00000146555	ENST00000426596	.	.	.	4.87	-0.345	0.12624	.	.	.	.	.	T	0.40398	0.1115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26643	-1.0097	4	.	.	.	.	1.387	0.02242	0.1518:0.2425:0.1487:0.457	.	.	.	.	L	67	.	.	P	+	2	0	SDK1	3957972	0.992000	0.36948	0.997000	0.53966	0.653000	0.38743	0.133000	0.15912	0.216000	0.20781	-0.768000	0.03414	CCA		0.617	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		8	97	0	0	0	0.00308	0	8	97				
AOAH	313	broad.mit.edu	37	7	36763656	36763656	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:36763656G>T	ENST00000258749.5	-	1	497	c.98C>A	c.(97-99)cCc>cAc	p.P33H	AOAH_ENST00000535891.1_Missense_Mutation_p.P33H|AOAH_ENST00000431169.1_Missense_Mutation_p.P33H	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	33					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)	p.P33H(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						CGAGAGGCTGGGCCTGGACTG	0.483																																							uc003tfh.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(97-99)CCC>CAC		acyloxyacyl hydrolase precursor							54.0	57.0	56.0					7																	36763656		2203	4300	6503	SO:0001583	missense	313				inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity	g.chr7:36763656G>T	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.98C>A	7.37:g.36763656G>T	ENSP00000258749:p.Pro33His					AOAH_uc010kxf.2_Missense_Mutation_p.P33H|AOAH_uc011kba.1_Missense_Mutation_p.P33H	p.P33H	NM_001637	NP_001628	P28039	AOAH_HUMAN			1	499	-			33					A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	37	c.98C>A	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	G	4.140	0.024366	0.08054	.	.	ENSG00000136250	ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647;ENST00000435386	T;T;T;T	0.78126	1.97;-1.11;-1.15;1.02	4.08	-0.0611	0.13786	.	1.543390	0.04148	N	0.320805	T	0.63177	0.2489	.	.	.	0.09310	N	1	B;P;B	0.48640	0.012;0.913;0.185	B;B;B	0.37601	0.001;0.254;0.059	T	0.55642	-0.8109	9	0.45353	T	0.12	-11.4612	3.2068	0.06669	0.3364:0.0:0.4802:0.1834	.	33;33;33	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	H	33	ENSP00000441101:P33H;ENSP00000258749:P33H;ENSP00000405683:P33H;ENSP00000416051:P33H	ENSP00000258749:P33H	P	-	2	0	AOAH	36730181	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.256000	0.08757	-0.130000	0.11599	-0.137000	0.14449	CCC		0.483	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637		20	33	1	0	1.2644e-06	0.010504	1.50665e-06	20	33				
ABCA13	154664	broad.mit.edu	37	7	48413973	48413973	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:48413973A>T	ENST00000435803.1	+	34	11187	c.11163A>T	c.(11161-11163)caA>caT	p.Q3721H		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3721					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.Q3666H(1)|p.Q3721H(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CCTTTGGACAAGGGGTATTTT	0.413																																							uc003toq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(11161-11163)CAA>CAT		ATP binding cassette, sub-family A (ABC1),							84.0	78.0	80.0					7																	48413973		1891	4113	6004	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48413973A>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11163A>T	7.37:g.48413973A>T	ENSP00000411096:p.Gln3721His					ABCA13_uc010kys.1_Missense_Mutation_p.Q795H|ABCA13_uc003tos.1_Missense_Mutation_p.Q547H|ABCA13_uc010kyt.1_5'Flank	p.Q3721H	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			34	11188	+			3721			Helical; (Potential).		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.11163A>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341993	0.41498	.	.	ENSG00000179869	ENST00000435803	D	0.83075	-1.68	5.51	3.08	0.35506	.	0.000000	0.48767	D	0.000170	D	0.86481	0.5943	M	0.68317	2.08	0.80722	D	1	D;P	0.76494	0.999;0.946	D;P	0.72075	0.976;0.614	T	0.81688	-0.0819	10	0.20046	T	0.44	.	6.9697	0.24642	0.7747:0.1491:0.0762:0.0	.	1423;3721	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	H	3721	ENSP00000411096:Q3721H	ENSP00000411096:Q3721H	Q	+	3	2	ABCA13	48384519	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	2.439000	0.44846	0.436000	0.26393	-0.290000	0.09829	CAA		0.413	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		6	29	0	0	0	0.001984	0	6	29				
IKZF1	10320	broad.mit.edu	37	7	50468246	50468246	+	Missense_Mutation	SNP	T	T	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:50468246T>A	ENST00000331340.3	+	8	1636	c.1481T>A	c.(1480-1482)aTg>aAg	p.M494K	IKZF1_ENST00000359197.5_Missense_Mutation_p.M452K|IKZF1_ENST00000438033.1_Missense_Mutation_p.M407K|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000346667.4_Missense_Mutation_p.M264K|IKZF1_ENST00000349824.4_Missense_Mutation_p.M351K|IKZF1_ENST00000439701.1_Missense_Mutation_p.M452K|IKZF1_ENST00000357364.4_Missense_Mutation_p.M407K|IKZF1_ENST00000343574.5_Missense_Mutation_p.M407K	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	494					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)|p.M494K(1)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GAGTGCAACATGTGCGGCTAC	0.602			"""D,T"""	BCL6	"""ALL, DLBCL"""																																		uc003tow.3		NA		"""Rec,Dom"""	yes		7	7p12.2	10320	D	IKAROS family zinc finger 1			L			ALL		29	Unknown(28)|Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(28)|lung(1)	haematopoietic_and_lymphoid_tissue(147)|lung(1)	148						c.(1480-1482)ATG>AAG		zinc finger protein, subfamily 1A, 1 (Ikaros)							47.0	53.0	51.0					7																	50468246		2191	4295	6486	SO:0001583	missense	10320				cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	g.chr7:50468246T>A	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1481T>A	7.37:g.50468246T>A	ENSP00000331614:p.Met494Lys					IKZF1_uc003tox.3_Missense_Mutation_p.M452K|IKZF1_uc003toy.3_Missense_Mutation_p.M452K|IKZF1_uc011kck.1_Missense_Mutation_p.M407K|IKZF1_uc003toz.3_Missense_Mutation_p.M464K|IKZF1_uc010kyx.2_Missense_Mutation_p.M234K|IKZF1_uc003tpa.3_Missense_Mutation_p.M236K	p.M494K	NM_006060	NP_006051	Q13422	IKZF1_HUMAN			9	1649	+	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)	494			C2H2-type 6.		A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	37	c.1481T>A		.	.	.	.	.	.	.	.	.	.	T	27.0	4.795471	0.90453	.	.	ENSG00000185811	ENST00000346667;ENST00000343574;ENST00000359197;ENST00000349824;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);	0.041426	0.85682	D	0.000000	T	0.62146	0.2404	.	.	.	0.80722	D	1	D;D;D;P;D	0.58620	0.981;0.983;0.968;0.823;0.968	D;P;P;P;D	0.76071	0.987;0.756;0.614;0.513;0.971	T	0.58375	-0.7647	9	0.27082	T	0.32	-16.3067	16.0487	0.80740	0.0:0.0:0.0:1.0	.	407;264;407;452;494	Q13422-2;Q13422-6;Q13422-3;Q13422-7;Q13422	.;.;.;.;IKZF1_HUMAN	K	264;407;452;351;407;494;407;452	ENSP00000340080:M264K;ENSP00000342750:M407K;ENSP00000352123:M452K;ENSP00000342485:M351K;ENSP00000349928:M407K;ENSP00000331614:M494K;ENSP00000396554:M407K;ENSP00000413025:M452K	ENSP00000331614:M494K	M	+	2	0	IKZF1	50435740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.953000	0.87836	2.189000	0.69895	0.533000	0.62120	ATG		0.602	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060		3	30	0	0	0	0.004672	0	3	30				
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	T	G	rs121434568		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:55259515T>G	ENST00000275493.2	+	21	2750	c.2573T>G	c.(2572-2574)cTg>cGg	p.L858R	EGFR_ENST00000454757.2_Missense_Mutation_p.L805R|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Missense_Mutation_p.L813R|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	858	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> M (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.|L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity; more sensitive to gefitinib than wild-type; dbSNP:rs121434568). {ECO:0000269|PubMed:15118125, ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L858R(1489)|p.L858Q(1)|p.L858K(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GATTTTGGGCTGGCCAAACTG	0.537	L858R(NCIH1975_LUNG)	8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2	L858R(NCIH1975_LUNG)	8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		1491	Substitution - Missense(1491)	p.L858R(3429)|p.L858L(4)|p.L858M(4)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858K(1)|p.L858G(1)	lung(1475)|upper_aerodigestive_tract(5)|thyroid(4)|large_intestine(2)|peritoneum(1)|stomach(1)|thymus(1)|breast(1)|ovary(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2572-2574)CTG>CGG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						105.0	98.0	101.0					7																	55259515		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259515T>G		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2573T>G	7.37:g.55259515T>G	ENSP00000275493:p.Leu858Arg	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R|uc003tqo.2_5'Flank	p.L858R	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2819	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		858		L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity).|L -> M (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2573T>G	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601026	0.87055	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.91351	-2.83;-2.83;-2.83	5.71	5.71	0.89125	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.137592	0.50627	D	0.000117	D	0.96340	0.8806	M	0.92555	3.32	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.956;0.999	D	0.97213	0.9872	10	0.87932	D	0	.	14.8112	0.69996	0.0:0.0:0.0:1.0	.	813;858	Q504U8;P00533	.;EGFR_HUMAN	R	813;728;858;805	ENSP00000415559:L813R;ENSP00000275493:L858R;ENSP00000395243:L805R	ENSP00000275493:L858R	L	+	2	0	EGFR	55227009	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.890000	0.87313	2.176000	0.68965	0.528000	0.53228	CTG		0.537	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		15	75	0	0	0	0.00245	0	15	75				
PEX1	5189	broad.mit.edu	37	7	92130962	92130962	+	Missense_Mutation	SNP	G	G	T	rs145430946	byFrequency	TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:92130962G>T	ENST00000248633.4	-	15	2537	c.2442C>A	c.(2440-2442)ttC>ttA	p.F814L	PEX1_ENST00000541751.1_3'UTR|PEX1_ENST00000438045.1_Missense_Mutation_p.F492L|PEX1_ENST00000428214.1_Missense_Mutation_p.F757L	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	814					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.F814L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GAGCCTTTTGGAAGTCCAATG	0.363																																							uc003uly.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2440-2442)TTC>TTA		peroxin1							55.0	57.0	56.0					7																	92130962		2203	4300	6503	SO:0001583	missense	5189				microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding	g.chr7:92130962G>T	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.2442C>A	7.37:g.92130962G>T	ENSP00000248633:p.Phe814Leu					PEX1_uc011khr.1_Missense_Mutation_p.F606L|PEX1_uc010ley.2_Missense_Mutation_p.F757L|PEX1_uc011khs.1_Missense_Mutation_p.F492L|PEX1_uc011kht.1_RNA	p.F814L	NM_000466	NP_000457	O43933	PEX1_HUMAN	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)		15	2538	-	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	814					A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	37	c.2442C>A	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.811592	0.70797	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	T;T;T	0.80824	-1.42;-1.42;2.4	5.78	2.63	0.31362	.	0.000000	0.85682	D	0.000000	D	0.85792	0.5779	M	0.77313	2.365	0.80722	D	1	P;D;P	0.63880	0.76;0.993;0.853	P;D;P	0.63192	0.603;0.912;0.504	D	0.84604	0.0674	10	0.72032	D	0.01	-9.687	6.6104	0.22749	0.249:0.1515:0.5995:0.0	.	492;606;814	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	L	492;814;757	ENSP00000410438:F492L;ENSP00000248633:F814L;ENSP00000394413:F757L	ENSP00000248633:F814L	F	-	3	2	PEX1	91968898	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	1.597000	0.36729	0.805000	0.34159	0.563000	0.77884	TTC		0.363	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466		9	72	1	0	2.74318e-10	0.006214	3.66236e-10	9	72				
MUC17	140453	broad.mit.edu	37	7	100682069	100682069	+	Missense_Mutation	SNP	T	T	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:100682069T>A	ENST00000306151.4	+	3	7436	c.7372T>A	c.(7372-7374)Tta>Ata	p.L2458I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2458	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.L2458I(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACCACTCCGTTAGCAAGTAT	0.532																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(7372-7374)TTA>ATA		mucin 17 precursor							341.0	336.0	338.0					7																	100682069		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100682069T>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7372T>A	7.37:g.100682069T>A	ENSP00000302716:p.Leu2458Ile					MUC17_uc010lho.1_RNA	p.L2458I	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	7425	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2458			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|39.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.7372T>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	t	7.910	0.736337	0.15574	.	.	ENSG00000169876	ENST00000306151	T	0.02837	4.14	1.25	-0.987	0.10249	.	.	.	.	.	T	0.01489	0.0048	N	0.24115	0.695	0.09310	N	1	P	0.38110	0.618	B	0.22601	0.04	T	0.49916	-0.8888	9	0.21540	T	0.41	.	5.5684	0.17182	0.0:0.0:0.5851:0.4148	.	2458	Q685J3	MUC17_HUMAN	I	2458	ENSP00000302716:L2458I	ENSP00000302716:L2458I	L	+	1	2	MUC17	100468789	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.489000	0.02306	-0.467000	0.06932	0.113000	0.15668	TTA		0.532	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		32	207	0	0	0	0.009535	0	32	207				
LAMB4	22798	broad.mit.edu	37	7	107708591	107708591	+	Missense_Mutation	SNP	G	G	C	rs140790836		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:107708591G>C	ENST00000388781.3	-	19	2399	c.2316C>G	c.(2314-2316)caC>caG	p.H772Q	LAMB4_ENST00000205386.4_Missense_Mutation_p.H772Q|LAMB4_ENST00000388780.3_Missense_Mutation_p.H772Q	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	772	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.H772Q(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AGCCCTGGGGGTGACACTTGC	0.547																																							uc010ljo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(2314-2316)CAC>CAG		laminin, beta 4 precursor							66.0	67.0	66.0					7																	107708591		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107708591G>C	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2316C>G	7.37:g.107708591G>C	ENSP00000373433:p.His772Gln					LAMB4_uc003vey.2_Missense_Mutation_p.H772Q	p.H772Q	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN			19	2400	-			772			Laminin EGF-like 6.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.2316C>G	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554284	0.65425	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780	T;T;T	0.61392	0.11;0.11;0.11	5.15	1.02	0.19986	EGF-like, laminin (3);	0.107851	0.41097	D	0.000949	T	0.65302	0.2678	M	0.67700	2.07	0.80722	D	1	D	0.60575	0.988	P	0.59357	0.856	T	0.63093	-0.6714	10	0.54805	T	0.06	.	8.6274	0.33897	0.5735:0.0:0.4265:0.0	.	772	A4D0S4	LAMB4_HUMAN	Q	772	ENSP00000205386:H772Q;ENSP00000373433:H772Q;ENSP00000373432:H772Q	ENSP00000205386:H772Q	H	-	3	2	LAMB4	107495827	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	1.323000	0.33701	0.078000	0.16900	-0.136000	0.14681	CAC		0.547	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		24	29	0	0	0	0.00333	0	24	29				
TMEM168	64418	broad.mit.edu	37	7	112423771	112423771	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:112423771C>A	ENST00000312814.6	-	2	1670	c.1110G>T	c.(1108-1110)ttG>ttT	p.L370F	TMEM168_ENST00000454074.1_Missense_Mutation_p.L370F	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	370						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)		p.L370F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						AAACTGCTCCCAAAATCGCTG	0.398																																							uc003vgn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1108-1110)TTG>TTT		transmembrane protein 168							114.0	114.0	114.0					7																	112423771		2203	4300	6503	SO:0001583	missense	64418					integral to membrane|transport vesicle		g.chr7:112423771C>A		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1110G>T	7.37:g.112423771C>A	ENSP00000323068:p.Leu370Phe					TMEM168_uc010lju.2_Missense_Mutation_p.L370F|TMEM168_uc011kmr.1_Intron	p.L370F	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN			2	1502	-			370			Helical; (Potential).		A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	ENST00000312814.6	37	c.1110G>T	CCDS5757.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740067	0.30865	.	.	ENSG00000146802	ENST00000312814;ENST00000454074;ENST00000418785;ENST00000441474	.	.	.	6.07	3.28	0.37604	.	0.130586	0.53938	N	0.000059	T	0.55986	0.1955	L	0.47716	1.5	0.80722	D	1	D	0.61697	0.99	P	0.60068	0.868	T	0.51537	-0.8693	9	0.41790	T	0.15	-10.2988	6.0487	0.19773	0.1336:0.6654:0.0:0.201	.	370	Q9H0V1	TM168_HUMAN	F	370;370;10;22	.	ENSP00000323068:L370F	L	-	3	2	TMEM168	112211007	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.589000	0.36644	0.436000	0.26393	0.655000	0.94253	TTG		0.398	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484		50	91	1	0	1.56793e-16	0.01441	2.3111e-16	50	91				
SMO	6608	broad.mit.edu	37	7	128851599	128851599	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:128851599G>T	ENST00000249373.3	+	11	2204	c.1924G>T	c.(1924-1926)Gtg>Ttg	p.V642L	RP11-286H14.8_ENST00000466717.1_RNA	NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	642					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.V642L(1)		biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	TGTCACCCCTGTGGCAACTCC	0.602			Mis		skin basal cell																																		uc003vor.2		NA		Dom	yes		7	7q31-q32	6608	Mis	smoothened homolog (Drosophila)			E			skin basal cell 		1	Substitution - Missense(1)		lung(1)	skin(19)|large_intestine(10)|central_nervous_system(3)|upper_aerodigestive_tract(2)|biliary_tract(1)|lung(1)|liver(1)	37						c.(1924-1926)GTG>TTG		smoothened precursor							61.0	62.0	62.0					7																	128851599		2203	4300	6503	SO:0001583	missense	6608				adenohypophysis development|axon extension involved in axon guidance|canonical Wnt receptor signaling pathway|cardioblast differentiation|central nervous system neuron differentiation|cerebellar cortex morphogenesis|ciliary receptor clustering involved in smoothened signaling pathway|determination of left/right symmetry|dorsal/ventral neural tube patterning|embryonic camera-type eye development|embryonic digestive tract morphogenesis|embryonic neurocranium morphogenesis|embryonic viscerocranium morphogenesis|exocrine pancreas development|facial nerve development|floor plate formation|gonad development|heart morphogenesis|muscle cell fate commitment|negative regulation of apoptosis|neural crest cell migration|neuron fate commitment|neuron projection regeneration|odontogenesis of dentine-containing tooth|osteoblast differentiation|otolith morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of neuroblast proliferation|positive regulation of smoothened signaling pathway|semicircular canal morphogenesis|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation|smoothened signaling pathway involved in ventral spinal cord patterning|spermatogenesis|vasculogenesis	cilium|cytoplasm|integral to membrane|neuronal cell body|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr7:128851599G>T	U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.1924G>T	7.37:g.128851599G>T	ENSP00000249373:p.Val642Leu					SMO_uc003vos.2_Missense_Mutation_p.V317L	p.V642L	NM_005631	NP_005622	Q99835	SMO_HUMAN			11	2204	+			642			Cytoplasmic (Potential).		A4D1K5	Missense_Mutation	SNP	ENST00000249373.3	37	c.1924G>T	CCDS5811.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646544	0.67358	.	.	ENSG00000128602	ENST00000249373	T	0.79749	-1.3	5.75	5.75	0.90469	.	0.109248	0.64402	D	0.000006	T	0.75774	0.3895	L	0.40543	1.245	0.45239	D	0.998247	B;B	0.25667	0.104;0.131	B;B	0.22386	0.024;0.039	T	0.71192	-0.4665	10	0.44086	T	0.13	.	18.5128	0.90923	0.0:0.0:1.0:0.0	.	642;642	A4D1K5;Q99835	.;SMO_HUMAN	L	642	ENSP00000249373:V642L	ENSP00000249373:V642L	V	+	1	0	SMO	128638835	1.000000	0.71417	0.988000	0.46212	0.962000	0.63368	6.032000	0.70918	2.706000	0.92434	0.655000	0.94253	GTG		0.602	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350986.1	NM_005631		19	48	1	0	7.45023e-12	0.010504	1.03815e-11	19	48				
AKR1B15	441282	broad.mit.edu	37	7	134254279	134254279	+	Missense_Mutation	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:134254279A>G	ENST00000457545.2	+	5	693	c.433A>G	c.(433-435)Aag>Gag	p.K145E	AKR1B15_ENST00000423958.1_Missense_Mutation_p.K117E	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	145							oxidoreductase activity (GO:0016491)	p.K145E(1)|p.K117E(1)|p.K123E(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						ACAGGGATTCAAGGTTTGAGT	0.507																																							uc011kpr.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(433-435)AAG>GAG		aldo-keto reductase family 1, member B15							121.0	117.0	118.0					7																	134254279		2203	4300	6503	SO:0001583	missense	441282						oxidoreductase activity	g.chr7:134254279A>G		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.433A>G	7.37:g.134254279A>G	ENSP00000389289:p.Lys145Glu					AKR1B15_uc003vrt.2_Missense_Mutation_p.K117E|AKR1B15_uc011kps.1_Missense_Mutation_p.K117E	p.K145E	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN			5	732	+			145					C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	c.433A>G	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	-	10.27	1.302758	0.23736	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.23147	1.92;1.92	2.72	0.468	0.16732	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.27419	0.0673	L	0.37561	1.115	0.58432	D	0.999999	B;P;P	0.50272	0.209;0.789;0.933	B;B;P	0.53102	0.271;0.409;0.718	T	0.04811	-1.0925	9	0.49607	T	0.09	.	8.3603	0.32355	0.414:0.586:0.0:0.0	.	117;145;123	C9JRZ8-2;C9JRZ8;A4D1P0	.;AK1BF_HUMAN;.	E	145;117	ENSP00000389289:K145E;ENSP00000397009:K117E	ENSP00000397009:K117E	K	+	1	0	AKR1B15	133904819	1.000000	0.71417	0.120000	0.21714	0.034000	0.12701	6.200000	0.72118	0.438000	0.26450	-0.842000	0.03052	AAG		0.507	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2			20	57	0	0	0	0.012319	0	20	57				
TRPV6	55503	broad.mit.edu	37	7	142583208	142583208	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:142583208C>T	ENST00000359396.3	-	1	299	c.54G>A	c.(52-54)aaG>aaA	p.K18K	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	18					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)	p.K18K(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					ATCTGCAGAACTTGCTCCATA	0.612																																							uc003wbx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(52-54)AAG>AAA		transient receptor potential cation channel,							115.0	117.0	116.0					7																	142583208		2203	4300	6503	SO:0001819	synonymous_variant	55503				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding	g.chr7:142583208C>T	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.54G>A	7.37:g.142583208C>T							p.K18K	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN			1	270	-	Melanoma(164;0.059)		18			Cytoplasmic (Potential).		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Silent	SNP	ENST00000359396.3	37	c.54G>A	CCDS5874.1																																																																																				0.612	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274		16	139	0	0	0	0.004007	0	16	139				
KMT2C	58508	broad.mit.edu	37	7	151873473	151873473	+	Missense_Mutation	SNP	G	G	A	rs141345566		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr7:151873473G>A	ENST00000262189.6	-	38	9283	c.9065C>T	c.(9064-9066)aCc>aTc	p.T3022I	KMT2C_ENST00000355193.2_Missense_Mutation_p.T3022I	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3022	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T3022I(2)									CATGCTACTGGTACCAGACTG	0.478																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(9064-9066)ACC>ATC		myeloid/lymphoid or mixed-lineage leukemia 3		G	ILE/THR	0,4406		0,0,2203	119.0	110.0	113.0		9065	5.1	0.9	7	dbSNP_134	113	1,8599	1.2+/-3.3	0,1,4299	no	missense	MLL3	NM_170606.2	89	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	3022/4912	151873473	1,13005	2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151873473G>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.9065C>T	7.37:g.151873473G>A	ENSP00000262189:p.Thr3022Ile					MLL3_uc003wkz.2_Missense_Mutation_p.T2083I|MLL3_uc003wky.2_Missense_Mutation_p.T531I	p.T3022I	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	38	9284	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	3022			Gln-rich.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.9065C>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172209	0.38315	0.0	1.16E-4	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.82893	-1.64;-1.66	5.1	5.1	0.69264	.	0.174321	0.26665	U	0.023123	T	0.81833	0.4906	L	0.44542	1.39	0.80722	D	1	P;D;P	0.53151	0.8;0.958;0.571	B;P;B	0.47981	0.216;0.563;0.238	T	0.79259	-0.1877	10	0.22109	T	0.4	.	18.5201	0.90948	0.0:0.0:1.0:0.0	.	3022;2083;3022	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	I	3022	ENSP00000262189:T3022I;ENSP00000347325:T3022I	ENSP00000262189:T3022I	T	-	2	0	MLL3	151504406	1.000000	0.71417	0.936000	0.37596	0.887000	0.51463	6.989000	0.76219	2.354000	0.79902	0.655000	0.94253	ACC		0.478	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			25	89	0	0	0	0.004656	0	25	89				
CSMD1	64478	broad.mit.edu	37	8	2823383	2823383	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr8:2823383G>T	ENST00000520002.1	-	60	9752	c.9197C>A	c.(9196-9198)cCa>cAa	p.P3066Q	CSMD1_ENST00000602557.1_Missense_Mutation_p.P3066Q|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000537824.1_Missense_Mutation_p.P3065Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3066	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.P2794Q(1)|p.P3065Q(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GACATAGCCTGGGTTACACTG	0.483																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(9196-9198)CCA>CAA		CUB and Sushi multiple domains 1 precursor							107.0	108.0	108.0					8																	2823383		2070	4215	6285	SO:0001583	missense	64478					integral to membrane		g.chr8:2823383G>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9197C>A	8.37:g.2823383G>T	ENSP00000430733:p.Pro3066Gln					CSMD1_uc011kwj.1_Missense_Mutation_p.P2395Q|CSMD1_uc010lrg.2_Intron	p.P3066Q	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	59	9587	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	3066			Extracellular (Potential).|Sushi 24.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.9197C>A		.	.	.	.	.	.	.	.	.	.	G	17.31	3.358062	0.61403	.	.	ENSG00000183117	ENST00000520002;ENST00000318252;ENST00000537824	T;T	0.65732	-0.17;-0.17	5.42	5.42	0.78866	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.80076	0.4557	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80817	-0.1213	10	0.54805	T	0.06	.	19.2323	0.93845	0.0:0.0:1.0:0.0	.	3066;3066	E5RIG2;Q96PZ7	.;CSMD1_HUMAN	Q	3066;2927;3065	ENSP00000430733:P3066Q;ENSP00000441462:P3065Q	ENSP00000320445:P2927Q	P	-	2	0	CSMD1	2810790	1.000000	0.71417	0.226000	0.23910	0.003000	0.03518	9.608000	0.98331	2.541000	0.85698	0.655000	0.94253	CCA		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		9	4	1	0	4.68919e-08	0.008291	5.80458e-08	9	4				
OPRK1	4986	broad.mit.edu	37	8	54142117	54142118	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr8:54142117_54142118GG>TT	ENST00000265572.3	-	4	1179_1180	c.882_883CC>AA	c.(880-885)atCCtg>atAAtg	p.L295M	OPRK1_ENST00000520287.1_Missense_Mutation_p.L295M|RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000524278.1_Missense_Mutation_p.L206M	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	295					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.L295M(1)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	GCCTCCACCAGGATGAATATGT	0.554																																							uc003xrh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(880-885)ATCCTG>ATAATG		opioid receptor, kappa 1	Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)																																			SO:0001583	missense	4986				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding	g.chr8:54142117_54142118GG>TT		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.882_883delinsTT	8.37:g.54142117_54142118delinsTT	ENSP00000265572:p.Leu295Met					OPRK1_uc003xri.1_Missense_Mutation_p.L295M|OPRK1_uc010lyc.1_Missense_Mutation_p.L206M	p.L295M	NM_000912	NP_000903	P41145	OPRK_HUMAN			3	1257_1258	-		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)	295			Helical; Name=6; (Potential).		E5RHC9|Q499G4	Missense_Mutation	DNP	ENST00000265572.3	37	c.882_883CC>AA	CCDS6152.1																																																																																				0.554	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1			12	11	0	0	0	0.004672	0	12	11				
TRPS1	7227	broad.mit.edu	37	8	116631634	116631634	+	Nonsense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr8:116631634C>A	ENST00000220888.5	-	2	811	c.652G>T	c.(652-654)Gag>Tag	p.E218*	TRPS1_ENST00000395715.3_Nonsense_Mutation_p.E231*|TRPS1_ENST00000519674.1_Nonsense_Mutation_p.E218*|TRPS1_ENST00000520276.1_Nonsense_Mutation_p.E222*|TRPS1_ENST00000519076.1_Nonsense_Mutation_p.E172*			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	218					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E218*(1)|p.E231*(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TCCTGAAGCTCTGGAGACAGA	0.453									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(652-654)GAG>TAG		zinc finger transcription factor TRPS1							126.0	127.0	126.0					8																	116631634		1960	4185	6145	SO:0001587	stop_gained	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116631634C>A	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.652G>T	8.37:g.116631634C>A	ENSP00000220888:p.Glu218*					TRPS1_uc011lhy.1_Nonsense_Mutation_p.E222*|TRPS1_uc003yny.2_Nonsense_Mutation_p.E231*|TRPS1_uc010mcy.2_Nonsense_Mutation_p.E218*	p.E218*	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		2	1111	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		218					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Nonsense_Mutation	SNP	ENST00000220888.5	37	c.652G>T		.	.	.	.	.	.	.	.	.	.	C	36	5.774946	0.96922	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	.	.	.	5.56	5.56	0.83823	.	0.054609	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	19.5324	0.95234	0.0:1.0:0.0:0.0	.	.	.	.	X	231;218;172;222;218	.	ENSP00000220888:E218X	E	-	1	0	TRPS1	116700809	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.667000	0.68067	2.619000	0.88677	0.460000	0.39030	GAG		0.453	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		41	76	1	0	1.5731e-28	0.011902	2.50713e-28	41	76				
ZC3H3	23144	broad.mit.edu	37	8	144557623	144557623	+	Silent	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr8:144557623G>A	ENST00000262577.5	-	5	1879	c.1848C>T	c.(1846-1848)ctC>ctT	p.L616L		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	616					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.L616L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			AGGTCTTGGAGAGCTTGTTGG	0.672																																							uc003yyd.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1846-1848)CTC>CTT		zinc finger CCCH-type containing 3							56.0	57.0	57.0					8																	144557623		2202	4300	6502	SO:0001819	synonymous_variant	23144				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding	g.chr8:144557623G>A	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1848C>T	8.37:g.144557623G>A							p.L616L	NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)		5	1877	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		616					Q14163|Q8N4E2|Q9BUS4	Silent	SNP	ENST00000262577.5	37	c.1848C>T	CCDS6402.1																																																																																				0.672	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		5	47	0	0	0	0.001984	0	5	47				
PLEC	5339	broad.mit.edu	37	8	144991017	144991017	+	Silent	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr8:144991017G>A	ENST00000322810.4	-	32	13552	c.13383C>T	c.(13381-13383)ccC>ccT	p.P4461P	PLEC_ENST00000436759.2_Silent_p.P4351P|PLEC_ENST00000354958.2_Silent_p.P4302P|PLEC_ENST00000527096.1_Silent_p.P4347P|PLEC_ENST00000398774.2_Silent_p.P4292P|PLEC_ENST00000356346.3_Silent_p.P4310P|PLEC_ENST00000345136.3_Silent_p.P4324P|PLEC_ENST00000357649.2_Silent_p.P4328P|PLEC_ENST00000354589.3_Silent_p.P4324P	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4461	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.P4324P(1)|p.P4461P(1)|p.P4351P(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CACCGGTGCTGGGGTCGATGA	0.652																																							uc003zaf.1		NA																	3	Substitution - coding silent(3)		lung(3)	large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(13381-13383)CCC>CCT		plectin isoform 1							46.0	52.0	50.0					8																	144991017		2128	4223	6351	SO:0001819	synonymous_variant	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144991017G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13383C>T	8.37:g.144991017G>A						PLEC_uc003zab.1_Silent_p.P4324P|PLEC_uc003zac.1_Silent_p.P4328P|PLEC_uc003zad.2_Silent_p.P4324P|PLEC_uc003zae.1_Silent_p.P4292P|PLEC_uc003zag.1_Silent_p.P4302P|PLEC_uc003zah.2_Silent_p.P4310P|PLEC_uc003zaj.2_Silent_p.P4351P	p.P4461P	NM_201380	NP_958782	Q15149	PLEC_HUMAN			32	13553	-			4461			Globular 2.|Plectin 30.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	c.13383C>T	CCDS43772.1																																																																																				0.652	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		8	58	0	0	0	0.00308	0	8	58				
ADAMTSL1	92949	broad.mit.edu	37	9	18622297	18622297	+	Silent	SNP	C	C	A	rs143328816		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:18622297C>A	ENST00000380548.4	+	5	870	c.531C>A	c.(529-531)gtC>gtA	p.V177V	ADAMTSL1_ENST00000276935.6_Silent_p.V177V|ADAMTSL1_ENST00000380570.4_Silent_p.V177V|ADAMTSL1_ENST00000380566.4_Silent_p.V177V|ADAMTSL1_ENST00000327883.7_Silent_p.V177V	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	177						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V177V(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		ACTGTGGGGTCTGCAACGGAG	0.527																																							uc003zne.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(529-531)GTC>GTA		ADAMTS-like 1 isoform 4 precursor							105.0	97.0	100.0					9																	18622297		2203	4300	6503	SO:0001819	synonymous_variant	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18622297C>A	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.531C>A	9.37:g.18622297C>A						ADAMTSL1_uc003znb.2_Silent_p.V177V|ADAMTSL1_uc003znc.3_Silent_p.V177V	p.V177V	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	5	658	+			177					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	37	c.531C>A	CCDS47954.1																																																																																				0.527	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			18	32	1	0	1.67942e-08	0.006122	2.11757e-08	18	32				
SPATA31D1	389763	broad.mit.edu	37	9	84608465	84608465	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:84608465G>T	ENST00000344803.2	+	4	3127	c.3080G>T	c.(3079-3081)aGa>aTa	p.R1027I		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1027					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R1027I(2)									TCCCTTAGAAGAGGTACTACA	0.448																																							uc004amn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3079-3081)AGA>ATA		hypothetical protein LOC389763							156.0	159.0	158.0					9																	84608465		1849	4097	5946	SO:0001583	missense	389763					integral to membrane		g.chr9:84608465G>T		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3080G>T	9.37:g.84608465G>T	ENSP00000341988:p.Arg1027Ile						p.R1027I	NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN			4	3127	+			1027						Missense_Mutation	SNP	ENST00000344803.2	37	c.3080G>T	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.244741	0.22796	.	.	ENSG00000214929	ENST00000344803	T	0.05382	3.45	0.796	-0.246	0.13022	.	.	.	.	.	T	0.02230	0.0069	N	0.14661	0.345	0.09310	N	1	P	0.43024	0.798	B	0.28232	0.087	T	0.44003	-0.9356	9	0.21540	T	0.41	1.7631	3.2032	0.06657	0.339:0.0:0.661:0.0	.	1027	Q6ZQQ2	F75D1_HUMAN	I	1027	ENSP00000341988:R1027I	ENSP00000341988:R1027I	R	+	2	0	FAM75D1	83798285	0.029000	0.19370	0.004000	0.12327	0.005000	0.04900	0.757000	0.26433	-0.101000	0.12219	-0.311000	0.09066	AGA		0.448	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		65	137	1	0	1.09529e-45	0.01441	1.81364e-45	65	137				
SPATA31E1	286234	broad.mit.edu	37	9	90502272	90502272	+	Missense_Mutation	SNP	G	G	T	rs181272197		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:90502272G>T	ENST00000325643.5	+	4	2936	c.2870G>T	c.(2869-2871)gGg>gTg	p.G957V		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	957					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G957V(1)									AAGGGCAGGGGGTGTTCTCAG	0.622													.|||	1	0.000199681	0.0008	0.0	5008	,	,		17978	0.0		0.0	False		,,,				2504	0.0						uc004app.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2869-2871)GGG>GTG		chromosome 9 open reading frame 79							42.0	43.0	43.0					9																	90502272		2203	4300	6503	SO:0001583	missense	286234					integral to membrane		g.chr9:90502272G>T	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2870G>T	9.37:g.90502272G>T	ENSP00000322640:p.Gly957Val						p.G957V	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN			4	2905	+			957					B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	c.2870G>T	CCDS6676.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	g	6.387	0.439564	0.12104	.	.	ENSG00000177992	ENST00000325643	T	0.03413	3.94	2.46	-4.93	0.03066	.	5.273690	0.00397	N	0.000054	T	0.02418	0.0074	N	0.22421	0.69	0.09310	N	1	B	0.15719	0.014	B	0.11329	0.006	T	0.41251	-0.9519	10	0.24483	T	0.36	.	0.2806	0.00244	0.2044:0.2159:0.1975:0.3822	.	957	Q6ZUB1	CI079_HUMAN	V	957	ENSP00000322640:G957V	ENSP00000322640:G957V	G	+	2	0	C9orf79	89692092	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.798000	0.04565	-1.322000	0.02278	0.557000	0.71058	GGG		0.622	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		12	23	1	0	1.61879e-10	0.013537	2.17259e-10	12	23				
PTPDC1	138639	broad.mit.edu	37	9	96859891	96859891	+	Missense_Mutation	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:96859891A>G	ENST00000375360.3	+	7	1221	c.881A>G	c.(880-882)aAa>aGa	p.K294R	PTPDC1_ENST00000288976.3_Missense_Mutation_p.K346R	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	294					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.K346R(1)|p.K294R(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						CTAGTTTGCAAATTGCTGCTG	0.458																																							uc004auf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(880-882)AAA>AGA		protein tyrosine phosphatase domain containing 1							88.0	87.0	88.0					9																	96859891		2203	4300	6503	SO:0001583	missense	138639						protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr9:96859891A>G	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.881A>G	9.37:g.96859891A>G	ENSP00000364509:p.Lys294Arg					PTPDC1_uc004aug.1_Missense_Mutation_p.K294R|PTPDC1_uc004auh.1_Missense_Mutation_p.K346R|PTPDC1_uc010mrj.1_Missense_Mutation_p.K348R|PTPDC1_uc010mri.1_Missense_Mutation_p.K346R	p.K294R	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN			7	1221	+			294					Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	c.881A>G	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	.	11.28	1.592338	0.28357	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.12984	2.63;2.63	5.64	4.5	0.54988	.	0.129442	0.64402	D	0.000001	T	0.12689	0.0308	L	0.50333	1.59	0.41038	D	0.985207	B;B;B;B	0.30482	0.185;0.281;0.023;0.185	B;B;B;B	0.26517	0.032;0.07;0.028;0.032	T	0.07770	-1.0755	10	0.25751	T	0.34	-19.0918	10.833	0.46671	0.9263:0.0:0.0737:0.0	.	348;346;348;294	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	R	294;346	ENSP00000364509:K294R;ENSP00000288976:K346R	ENSP00000288976:K346R	K	+	2	0	PTPDC1	95899712	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	2.036000	0.41165	0.975000	0.38392	0.533000	0.62120	AAA		0.458	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422		14	56	0	0	0	0.001855	0	14	56				
ZNF169	169841	broad.mit.edu	37	9	97054749	97054749	+	Splice_Site	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:97054749G>T	ENST00000395395.2	+	3	250	c.160G>T	c.(160-162)Gga>Tga	p.G54*	ZNF169_ENST00000375354.4_Splice_Site_p.G54*|ZNF169_ENST00000340911.4_Splice_Site_p.G54*|ZNF169_ENST00000480716.1_Splice_Site_p.G54*|ZNF169_ENST00000481550.2_Splice_Site_p.G54*	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	54	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G54*(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				GGTCTCCCTGGGTAAGGCTGG	0.483																																							uc004aum.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(160-162)GGA>TGA		zinc finger protein 169							108.0	112.0	110.0					9																	97054749		2203	4300	6503	SO:0001630	splice_region_variant	169841					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:97054749G>T	U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.160+1G>T	9.37:g.97054749G>T						ZNF169_uc004aun.2_Nonsense_Mutation_p.G54*|ZNF169_uc004auo.2_Nonsense_Mutation_p.G54*	p.G54*	NM_194320	NP_919301	Q14929	ZN169_HUMAN			3	265	+		Acute lymphoblastic leukemia(62;0.136)	54			KRAB.		A2AGP5|A8K127|Q6PI28	Nonsense_Mutation	SNP	ENST00000395395.2	37	c.160G>T	CCDS6709.2	.	.	.	.	.	.	.	.	.	.	g	10.40	1.339950	0.24339	.	.	ENSG00000175787	ENST00000395395;ENST00000375354	.	.	.	3.2	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.2451	0.54566	0.0:0.0:1.0:0.0	.	.	.	.	X	54	.	ENSP00000364503:G54X	G	+	1	0	ZNF169	96094570	1.000000	0.71417	0.965000	0.40720	0.151000	0.21798	4.837000	0.62796	1.813000	0.52934	0.603000	0.83216	GGA		0.483	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320	Nonsense_Mutation	6	32	1	0	2.0095e-06	0.001984	2.38336e-06	6	32				
ZNF462	58499	broad.mit.edu	37	9	109746587	109746587	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:109746587A>T	ENST00000277225.5	+	10	7242	c.6953A>T	c.(6952-6954)cAt>cTt	p.H2318L	RP11-508N12.2_ENST00000439901.1_RNA|ZNF462_ENST00000457913.1_Missense_Mutation_p.H2378L|ZNF462_ENST00000441147.2_Missense_Mutation_p.H1224L|ZNF462_ENST00000542028.1_Missense_Mutation_p.H275L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2318					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H2318L(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CTCCAGCAACATATAGAAAAG	0.483																																							uc004bcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(6952-6954)CAT>CTT		zinc finger protein 462							112.0	105.0	108.0					9																	109746587		2203	4300	6503	SO:0001583	missense	58499				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:109746587A>T	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.6953A>T	9.37:g.109746587A>T	ENSP00000277225:p.His2318Leu					ZNF462_uc010mto.2_Missense_Mutation_p.H2227L|ZNF462_uc004bda.2_Missense_Mutation_p.H2226L|ZNF462_uc011lvz.1_Missense_Mutation_p.H275L|uc004bdc.1_Intron	p.H2318L	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN			10	7242	+			2318			C2H2-type 25.		Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	c.6953A>T	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.906793	0.92107	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147;ENST00000542028	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	6.03	6.03	0.97812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.78783	-0.2069	10	0.87932	D	0	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	2378;2318	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	L	2318;2378;1261;1224;275	ENSP00000277225:H2318L;ENSP00000414570:H2378L;ENSP00000363818:H1261L;ENSP00000397306:H1224L;ENSP00000439771:H275L	ENSP00000277225:H2318L	H	+	2	0	ZNF462	108786408	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.923000	0.92808	2.302000	0.77476	0.533000	0.62120	CAT		0.483	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224		9	58	0	0	0	0.004482	0	9	58				
COL5A1	1289	broad.mit.edu	37	9	137704300	137704300	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:137704300G>T	ENST00000371817.3	+	47	4110	c.3696G>T	c.(3694-3696)ttG>ttT	p.L1232F		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1232	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.L1232F(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CTCAGGGTTTGCCAGGACCTC	0.542																																							uc004cfe.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(3694-3696)TTG>TTT		alpha 1 type V collagen preproprotein							102.0	80.0	87.0					9																	137704300		2203	4300	6503	SO:0001583	missense	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137704300G>T	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.3696G>T	9.37:g.137704300G>T	ENSP00000360882:p.Leu1232Phe						p.L1232F	NM_000093	NP_000084	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	47	4078	+		Myeloproliferative disorder(178;0.0341)	1232			Triple-helical region.		Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	c.3696G>T	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	9.003	0.980610	0.18812	.	.	ENSG00000130635	ENST00000371817	D	0.94330	-3.4	4.77	1.36	0.22044	.	0.000000	0.64402	U	0.000010	D	0.93022	0.7779	L	0.38953	1.18	0.51233	D	0.999914	D	0.76494	0.999	D	0.80764	0.994	D	0.90690	0.4612	10	0.59425	D	0.04	.	7.7948	0.29141	0.4699:0.0:0.5301:0.0	.	1232	P20908	CO5A1_HUMAN	F	1232	ENSP00000360882:L1232F	ENSP00000360882:L1232F	L	+	3	2	COL5A1	136844121	1.000000	0.71417	0.932000	0.37286	0.023000	0.10783	2.430000	0.44766	0.423000	0.26033	-0.149000	0.13747	TTG		0.542	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		4	30	1	0	0.00909568	0.009096	0.00954485	4	30				
SOHLH1	402381	broad.mit.edu	37	9	138590880	138590880	+	Missense_Mutation	SNP	G	G	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr9:138590880G>T	ENST00000298466.5	-	2	218	c.158C>A	c.(157-159)tCc>tAc	p.S53Y	SOHLH1_ENST00000425225.1_Missense_Mutation_p.S53Y	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	53	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S53Y(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CCGAAGGCAGGAGCTGGGACC	0.701																																							uc004cgl.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(157-159)TCC>TAC		spermatogenesis and oogenesis specific basic							32.0	32.0	32.0					9																	138590880		2201	4293	6494	SO:0001583	missense	402381				cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr9:138590880G>T	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.158C>A	9.37:g.138590880G>T	ENSP00000298466:p.Ser53Tyr					SOHLH1_uc010nbe.2_Missense_Mutation_p.S53Y	p.S53Y	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)	2	219	-		Myeloproliferative disorder(178;0.0511)	53					C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	ENST00000298466.5	37	c.158C>A	CCDS35174.1	.	.	.	.	.	.	.	.	.	.	G	9.410	1.080234	0.20309	.	.	ENSG00000165643	ENST00000298466;ENST00000425225	D;D	0.97688	-4.49;-4.49	3.24	2.26	0.28386	Helix-loop-helix DNA-binding (1);	0.842949	0.09688	N	0.768822	D	0.93919	0.8054	N	0.14661	0.345	0.09310	N	1	P;P	0.49447	0.924;0.875	P;B	0.47981	0.563;0.36	D	0.88539	0.3108	10	0.30078	T	0.28	-0.4804	5.7617	0.18203	0.1689:0.0:0.8311:0.0	.	53;53	Q5JUK2-2;Q5JUK2	.;SOLH1_HUMAN	Y	53	ENSP00000298466:S53Y;ENSP00000404438:S53Y	ENSP00000298466:S53Y	S	-	2	0	SOHLH1	137730701	0.000000	0.05858	0.001000	0.08648	0.094000	0.18550	-0.863000	0.04259	0.632000	0.30432	0.555000	0.69702	TCC		0.701	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415		14	31	1	0	4.3838e-07	0.001855	5.27297e-07	14	31				
ARSF	416	broad.mit.edu	37	X	3007540	3007540	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:3007540C>A	ENST00000381127.1	+	7	1055	c.834C>A	c.(832-834)caC>caA	p.H278Q	ARSF_ENST00000359361.2_Missense_Mutation_p.H278Q|ARSF_ENST00000537104.1_Missense_Mutation_p.H278Q	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	278					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.H278Q(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTCTCAGGCACAGTAAGGAAA	0.428																																							uc004cre.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(832-834)CAC>CAA		arylsulfatase F precursor							245.0	185.0	206.0					X																	3007540		2203	4300	6503	SO:0001583	missense	416					extracellular region	arylsulfatase activity|metal ion binding	g.chrX:3007540C>A	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.834C>A	X.37:g.3007540C>A	ENSP00000370519:p.His278Gln					ARSF_uc004crf.1_Missense_Mutation_p.H278Q	p.H278Q	NM_004042	NP_004033	P54793	ARSF_HUMAN			7	1055	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	278					Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	c.834C>A	CCDS14123.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.297031	0.40594	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.93189	-3.18;-3.18;-3.18	3.0	2.09	0.27110	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.431349	0.25698	U	0.028888	D	0.88347	0.6412	L	0.33245	0.995	0.29676	N	0.842073	B	0.26120	0.142	B	0.36030	0.216	T	0.82878	-0.0239	10	0.51188	T	0.08	.	5.4419	0.16513	0.1939:0.6903:0.0:0.1158	.	278	P54793	ARSF_HUMAN	Q	278	ENSP00000370519:H278Q;ENSP00000445594:H278Q;ENSP00000352319:H278Q	ENSP00000352319:H278Q	H	+	3	2	ARSF	3017540	0.005000	0.15991	0.006000	0.13384	0.052000	0.14988	-0.166000	0.09954	1.389000	0.46526	0.540000	0.68198	CAC		0.428	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			27	103	1	0	1.68575e-08	0.007291	2.11757e-08	27	103				
PLP2	5355	broad.mit.edu	37	X	49029519	49029519	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:49029519C>A	ENST00000376327.5	+	2	215	c.140C>A	c.(139-141)cCa>cAa	p.P47Q	PLP2_ENST00000376322.3_Missense_Mutation_p.P47Q	NM_002668.2	NP_002659.1	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic epithelium-enriched)	47	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine binding (GO:0019956)|ion transmembrane transporter activity (GO:0015075)	p.P47Q(1)		endometrium(3)|large_intestine(1)|lung(6)|urinary_tract(3)	13						GCCTCCACACCAGGCTACTCC	0.493																																							uc004dmx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(139-141)CCA>CAA		proteolipid protein 2 (colonic							190.0	124.0	146.0					X																	49029519		2203	4300	6503	SO:0001583	missense	5355				chemotaxis|cytokine-mediated signaling pathway	endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	chemokine binding|ion transmembrane transporter activity	g.chrX:49029519C>A	L09604	CCDS14319.1	Xp11.23	2008-08-01			ENSG00000102007	ENSG00000102007			9087	protein-coding gene	gene with protein product	"""A4 differentiation-dependent protein"""	300112				8470895, 7622043	Standard	NM_002668		Approved	A4, A4-LSB, MGC126187	uc004dmx.3	Q04941	OTTHUMG00000021513	ENST00000376327.5:c.140C>A	X.37:g.49029519C>A	ENSP00000365505:p.Pro47Gln						p.P47Q	NM_002668	NP_002659	Q04941	PLP2_HUMAN			2	215	+			47			MARVEL.		A6NDT7|Q32MM8	Missense_Mutation	SNP	ENST00000376327.5	37	c.140C>A	CCDS14319.1	.	.	.	.	.	.	.	.	.	.	C	7.965	0.747791	0.15710	.	.	ENSG00000102007	ENST00000376322;ENST00000376327	T;T	0.24908	1.83;1.83	5.34	3.24	0.37175	Marvel (1);MARVEL-like domain (1);	0.732668	0.12453	N	0.467570	T	0.19967	0.0480	L	0.47716	1.5	0.09310	N	1	B	0.29301	0.241	B	0.29663	0.105	T	0.20806	-1.0264	10	0.30078	T	0.28	-4.8104	4.4948	0.11831	0.2648:0.5713:0.0:0.164	.	47	Q04941	PLP2_HUMAN	Q	47	ENSP00000365500:P47Q;ENSP00000365505:P47Q	ENSP00000365500:P47Q	P	+	2	0	PLP2	48916463	0.024000	0.19004	0.025000	0.17156	0.776000	0.43924	0.681000	0.25320	0.958000	0.37956	0.594000	0.82650	CCA		0.493	PLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056540.1	NM_002668		9	33	1	0	2.17888e-05	0.006214	2.50276e-05	9	33				
MAGEH1	28986	broad.mit.edu	37	X	55479280	55479280	+	Missense_Mutation	SNP	A	A	C			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:55479280A>C	ENST00000342972.1	+	1	743	c.473A>C	c.(472-474)gAg>gCg	p.E158A	hsa-mir-4536-2_ENST00000583537.1_RNA	NM_014061.3	NP_054780.2	Q9H213	MAGH1_HUMAN	melanoma antigen family H, 1	158	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)		p.E158A(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|skin(2)	15						AGTCCGGTGGAGTATGAGTTC	0.517																																							uc004dum.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(472-474)GAG>GCG		melanoma antigen, family H, 1 protein							91.0	88.0	89.0					X																	55479280		2203	4300	6503	SO:0001583	missense	28986				apoptosis			g.chrX:55479280A>C	AF320912	CCDS14369.1	Xp11.22	2008-02-05			ENSG00000187601	ENSG00000187601			24092	protein-coding gene	gene with protein product		300548				12414813, 9485030	Standard	NM_014061		Approved	APR1	uc004dum.3	Q9H213	OTTHUMG00000021655	ENST00000342972.1:c.473A>C	X.37:g.55479280A>C	ENSP00000343706:p.Glu158Ala						p.E158A	NM_014061	NP_054780	Q9H213	MAGH1_HUMAN			1	743	+			158			MAGE.		B2R8V9|Q5JRJ3|Q9Y5M2	Missense_Mutation	SNP	ENST00000342972.1	37	c.473A>C	CCDS14369.1	.	.	.	.	.	.	.	.	.	.	.	10.89	1.477736	0.26511	.	.	ENSG00000187601	ENST00000342972	T	0.05199	3.48	3.17	3.17	0.36434	.	0.000000	0.34338	N	0.004055	T	0.06917	0.0176	L	0.52905	1.665	0.09310	N	0.999999	B	0.25486	0.127	B	0.28638	0.092	T	0.25984	-1.0116	10	0.27082	T	0.32	-5.5738	7.1277	0.25482	1.0:0.0:0.0:0.0	.	158	Q9H213	MAGH1_HUMAN	A	158	ENSP00000343706:E158A	ENSP00000343706:E158A	E	+	2	0	MAGEH1	55496005	0.974000	0.33945	0.212000	0.23672	0.005000	0.04900	3.166000	0.50785	1.489000	0.48450	0.483000	0.47432	GAG		0.517	MAGEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056868.1	NM_014061		6	59	0	0	0	0.001168	0	6	59				
MAGEH1	28986	broad.mit.edu	37	X	55479393	55479393	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:55479393G>A	ENST00000342972.1	+	1	856	c.586G>A	c.(586-588)Gac>Aac	p.D196N	hsa-mir-4536-2_ENST00000583537.1_RNA	NM_014061.3	NP_054780.2	Q9H213	MAGH1_HUMAN	melanoma antigen family H, 1	196	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)		p.D196N(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|skin(2)	15						TTGTAATTATGACTGGGATTC	0.522																																							uc004dum.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(586-588)GAC>AAC		melanoma antigen, family H, 1 protein							99.0	93.0	95.0					X																	55479393		2203	4300	6503	SO:0001583	missense	28986				apoptosis			g.chrX:55479393G>A	AF320912	CCDS14369.1	Xp11.22	2008-02-05			ENSG00000187601	ENSG00000187601			24092	protein-coding gene	gene with protein product		300548				12414813, 9485030	Standard	NM_014061		Approved	APR1	uc004dum.3	Q9H213	OTTHUMG00000021655	ENST00000342972.1:c.586G>A	X.37:g.55479393G>A	ENSP00000343706:p.Asp196Asn						p.D196N	NM_014061	NP_054780	Q9H213	MAGH1_HUMAN			1	856	+			196			MAGE.		B2R8V9|Q5JRJ3|Q9Y5M2	Missense_Mutation	SNP	ENST00000342972.1	37	c.586G>A	CCDS14369.1	.	.	.	.	.	.	.	.	.	.	.	4.420	0.077714	0.08485	.	.	ENSG00000187601	ENST00000342972	T	0.14391	2.51	3.52	2.65	0.31530	.	0.000000	0.35349	N	0.003269	T	0.05960	0.0155	N	0.03194	-0.395	0.09310	N	1	B	0.19200	0.034	B	0.27076	0.076	T	0.29671	-1.0004	10	0.51188	T	0.08	-0.5992	5.9657	0.19325	0.1446:0.0:0.8554:0.0	.	196	Q9H213	MAGH1_HUMAN	N	196	ENSP00000343706:D196N	ENSP00000343706:D196N	D	+	1	0	MAGEH1	55496118	0.992000	0.36948	0.016000	0.15963	0.007000	0.05969	1.142000	0.31540	0.872000	0.35775	0.591000	0.81541	GAC		0.522	MAGEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056868.1	NM_014061		11	77	0	0	0	0.010729	0	11	77				
POU3F4	5456	broad.mit.edu	37	X	82763714	82763714	+	Missense_Mutation	SNP	G	G	T	rs571115452		TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:82763714G>T	ENST00000373200.2	+	1	446	c.382G>T	c.(382-384)Ggc>Tgc	p.G128C	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	128					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G128C(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CACGTCAAGCGGCCAACCCCT	0.667																																							uc004eeg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(382-384)GGC>TGC		POU domain, class 3, transcription factor 4							37.0	34.0	35.0					X																	82763714		2202	4300	6502	SO:0001583	missense	5456				sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity	g.chrX:82763714G>T	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.382G>T	X.37:g.82763714G>T	ENSP00000362296:p.Gly128Cys						p.G128C	NM_000307	NP_000298	P49335	PO3F4_HUMAN			1	446	+			128					B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	c.382G>T	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055100	0.36277	.	.	ENSG00000196767	ENST00000373200	D	0.86497	-2.13	4.69	1.76	0.24704	.	0.349906	0.30036	N	0.010580	D	0.86590	0.5969	L	0.39898	1.24	0.40061	D	0.97589	D	0.63880	0.993	P	0.59288	0.855	D	0.84042	0.0365	10	0.62326	D	0.03	.	7.8032	0.29187	0.3962:0.0:0.6038:0.0	.	128	P49335	PO3F4_HUMAN	C	128	ENSP00000362296:G128C	ENSP00000362296:G128C	G	+	1	0	POU3F4	82650370	0.999000	0.42202	0.934000	0.37439	0.631000	0.37964	2.267000	0.43329	0.112000	0.17975	0.525000	0.51046	GGC		0.667	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307		10	10	1	0	9.70103e-10	0.008291	1.2686e-09	10	10				
PAK3	5063	broad.mit.edu	37	X	110366401	110366401	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:110366401G>A	ENST00000372010.1	+	5	512	c.70G>A	c.(70-72)Gat>Aat	p.D24N	PAK3_ENST00000446737.1_Missense_Mutation_p.D24N|PAK3_ENST00000518291.1_Missense_Mutation_p.D24N|PAK3_ENST00000417227.1_Missense_Mutation_p.D24N|PAK3_ENST00000372007.5_Missense_Mutation_p.D24N|PAK3_ENST00000360648.4_Missense_Mutation_p.D24N|PAK3_ENST00000262836.4_Missense_Mutation_p.D24N|PAK3_ENST00000425146.1_Missense_Mutation_p.D24N|PAK3_ENST00000519681.1_Missense_Mutation_p.D24N			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	24					activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.D24N(2)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						TAACAACCGGGATTCTTCAGC	0.488										TSP Lung(19;0.15)																													uc004epa.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(6)|ovary(3)|large_intestine(1)	10						c.(70-72)GAT>AAT		p21-activated kinase 3 isoform d							129.0	126.0	127.0					X																	110366401		2203	4300	6503	SO:0001583	missense	5063				multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding	g.chrX:110366401G>A	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.70G>A	X.37:g.110366401G>A	ENSP00000361080:p.Asp24Asn	TSP Lung(19;0.15)				PAK3_uc010npt.1_Missense_Mutation_p.D24N|PAK3_uc010npu.1_Missense_Mutation_p.D24N|PAK3_uc004eoy.1_5'UTR|PAK3_uc004eoz.2_Missense_Mutation_p.D24N|PAK3_uc011mst.1_RNA|PAK3_uc010npv.1_Missense_Mutation_p.D24N|PAK3_uc010npw.1_Missense_Mutation_p.D24N|uc004epb.2_5'Flank	p.D24N	NM_001128173	NP_001121645	O75914	PAK3_HUMAN			1	97	+			24					A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	c.70G>A	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809544	0.70797	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.73681	-0.63;-0.63;-0.67;-0.76;-0.63;-0.77;-0.77;-0.76;-0.67	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.74558	0.3732	L	0.56769	1.78	0.80722	D	1	B;B;B;B	0.20459	0.005;0.045;0.006;0.001	B;B;B;B	0.29663	0.043;0.105;0.027;0.011	T	0.69034	-0.5252	10	0.31617	T	0.26	.	18.8913	0.92406	0.0:0.0:1.0:0.0	.	24;24;24;24	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	N	24	ENSP00000410853:D24N;ENSP00000401982:D24N;ENSP00000361080:D24N;ENSP00000429113:D24N;ENSP00000361077:D24N;ENSP00000428921:D24N;ENSP00000353864:D24N;ENSP00000389172:D24N;ENSP00000262836:D24N	ENSP00000262836:D24N	D	+	1	0	PAK3	110253057	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.143000	0.94623	2.495000	0.84180	0.600000	0.82982	GAT		0.488	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578		78	71	0	0	0	0.01441	0	78	71				
AGTR2	186	broad.mit.edu	37	X	115304043	115304043	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:115304043G>A	ENST00000371906.4	+	3	700	c.510G>A	c.(508-510)atG>atA	p.M170I		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	170					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)	p.M170I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	TTTGGTGTATGGCCTGTTTGT	0.418																																							uc004eqh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(508-510)ATG>ATA		angiotensin II receptor, type 2							183.0	166.0	172.0					X																	115304043		2203	4300	6503	SO:0001583	missense	186				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity	g.chrX:115304043G>A	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.510G>A	X.37:g.115304043G>A	ENSP00000360973:p.Met170Ile						p.M170I	NM_000686	NP_000677	P50052	AGTR2_HUMAN			3	717	+			170			Helical; Name=4; (Potential).		B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	c.510G>A	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950409	0.34377	.	.	ENSG00000180772	ENST00000371906	T	0.70282	-0.47	4.58	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.132668	0.51477	D	0.000081	T	0.45677	0.1354	N	0.03084	-0.415	0.38951	D	0.958346	B	0.18013	0.025	B	0.17098	0.017	T	0.49615	-0.8921	10	0.51188	T	0.08	-11.2471	9.841	0.40999	0.1066:0.0:0.8934:0.0	.	170	P50052	AGTR2_HUMAN	I	170	ENSP00000360973:M170I	ENSP00000360973:M170I	M	+	3	0	AGTR2	115218071	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.357000	0.34090	2.118000	0.64928	0.506000	0.49869	ATG		0.418	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686		17	280	0	0	0	0.006122	0	17	280				
KIAA1210	57481	broad.mit.edu	37	X	118284535	118284535	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:118284535G>A	ENST00000402510.2	-	1	7	c.8C>T	c.(7-9)gCc>gTc	p.A3V		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	3								p.A3V(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CGTCCAGCCGGCCCTCATTTC	0.662																																							uc004era.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(7-9)GCC>GTC		hypothetical protein LOC57481							58.0	66.0	64.0					X																	118284535		2016	4145	6161	SO:0001583	missense	57481							g.chrX:118284535G>A	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.8C>T	X.37:g.118284535G>A	ENSP00000384670:p.Ala3Val						p.A3V	NM_020721	NP_065772	Q9ULL0	K1210_HUMAN			1	8	-			3					B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	c.8C>T	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	G	9.895	1.205268	0.22205	.	.	ENSG00000250423	ENST00000402510	T	0.12672	2.66	2.6	0.653	0.17828	.	.	.	.	.	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.34625	-0.9821	9	0.87932	D	0	.	4.3212	0.11018	0.2551:0.4856:0.2593:0.0	.	3	Q9ULL0	K1210_HUMAN	V	3	ENSP00000384670:A3V	ENSP00000384670:A3V	A	-	2	0	RP13-347D8.6	118168563	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.038000	0.03553	0.065000	0.16485	-0.200000	0.12747	GCC		0.662	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		24	46	0	0	0	0.00333	0	24	46				
ATP1B4	23439	broad.mit.edu	37	X	119496040	119496040	+	Missense_Mutation	SNP	G	G	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:119496040G>A	ENST00000218008.3	+	1	74	c.17G>A	c.(16-18)cGg>cAg	p.R6Q	ATP1B4_ENST00000539306.1_Missense_Mutation_p.R6Q|ATP1B4_ENST00000361319.3_Missense_Mutation_p.R6Q	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	6					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)	p.R6Q(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						AGGCAACTCCGGTCCAGAAGG	0.522																																							uc004esr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(16-18)CGG>CAG		ATPase, (Na+)/K+ transporting, beta 4							191.0	159.0	170.0					X																	119496040		2203	4300	6503	SO:0001583	missense	23439				ATP biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to plasma membrane|nuclear inner membrane	sodium:potassium-exchanging ATPase activity	g.chrX:119496040G>A	AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.17G>A	X.37:g.119496040G>A	ENSP00000218008:p.Arg6Gln					ATP1B4_uc004esq.2_Missense_Mutation_p.R6Q|ATP1B4_uc011mtx.1_Missense_Mutation_p.R6Q|ATP1B4_uc011mty.1_Missense_Mutation_p.R6Q	p.R6Q	NM_001142447	NP_001135919	Q9UN42	AT1B4_HUMAN			1	101	+			6			Nuclear (Potential).		Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	c.17G>A	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329760	0.41297	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.32753	1.75;1.75;1.44	5.62	3.53	0.40419	.	0.281658	0.24091	N	0.041635	T	0.18923	0.0454	N	0.19112	0.55	0.26015	N	0.98195	B;B;B;B	0.14805	0.006;0.002;0.006;0.011	B;B;B;B	0.10450	0.002;0.001;0.002;0.005	T	0.16571	-1.0398	10	0.87932	D	0	-2.7479	7.7435	0.28856	0.2293:0.0:0.7707:0.0	.	6;6;6;6	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	Q	6	ENSP00000218008:R6Q;ENSP00000355346:R6Q;ENSP00000443334:R6Q	ENSP00000218008:R6Q	R	+	2	0	ATP1B4	119380068	1.000000	0.71417	0.991000	0.47740	0.936000	0.57629	1.967000	0.40491	1.150000	0.42419	0.526000	0.51066	CGG		0.522	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447		12	198	0	0	0	0.00245	0	12	198				
UTP14A	10813	broad.mit.edu	37	X	129063425	129063425	+	Silent	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:129063425C>G	ENST00000394422.3	+	15	2185	c.2157C>G	c.(2155-2157)ccC>ccG	p.P719P	UTP14A_ENST00000371051.5_Silent_p.P665P|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000425117.2_Silent_p.P667P|UTP14A_ENST00000371042.3_Silent_p.P551P	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	719					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.P719P(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						TGACTACTCCCAAGGTCGTCA	0.507																																							uc004euz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2155-2157)CCC>CCG		UTP14, U3 small nucleolar ribonucleoprotein,							103.0	90.0	95.0					X																	129063425		2203	4300	6503	SO:0001819	synonymous_variant	10813				rRNA processing	nucleolus|small-subunit processome	protein binding	g.chrX:129063425C>G	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.2157C>G	X.37:g.129063425C>G						UTP14A_uc011mup.1_Silent_p.P667P|UTP14A_uc011muq.1_Silent_p.P665P	p.P719P	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN			15	2185	+			719					A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	ENST00000394422.3	37	c.2157C>G	CCDS14615.1																																																																																				0.507	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649		17	78	0	0	0	0.00499	0	17	78				
BRS3	680	broad.mit.edu	37	X	135570341	135570341	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:135570341C>T	ENST00000370648.3	+	1	296	c.68C>T	c.(67-69)tCa>tTa	p.S23L	Z97632.1_ENST00000580943.1_RNA	NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	23					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)	p.S23L(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					ACAGAATCATCAAGCTCTGTG	0.393																																							uc004ezv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(67-69)TCA>TTA		bombesin-like receptor 3							96.0	83.0	87.0					X																	135570341		2203	4300	6503	SO:0001583	missense	680				adult feeding behavior|glucose metabolic process|regulation of blood pressure	integral to membrane|plasma membrane	bombesin receptor activity	g.chrX:135570341C>T		CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.68C>T	X.37:g.135570341C>T	ENSP00000359682:p.Ser23Leu						p.S23L	NM_001727	NP_001718	P32247	BRS3_HUMAN			1	217	+	Acute lymphoblastic leukemia(192;0.000127)		23			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000370648.3	37	c.68C>T	CCDS14656.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208812	0.39003	.	.	ENSG00000102239	ENST00000370648	T	0.64618	-0.11	5.76	4.88	0.63580	.	0.593875	0.15367	N	0.266096	T	0.58566	0.2131	N	0.14661	0.345	0.32357	N	0.557748	D	0.56521	0.976	P	0.54815	0.761	T	0.62909	-0.6754	10	0.26408	T	0.33	-2.6337	15.7323	0.77817	0.0:0.8668:0.1332:0.0	.	23	P32247	BRS3_HUMAN	L	23	ENSP00000359682:S23L	ENSP00000359682:S23L	S	+	2	0	BRS3	135398007	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.428000	0.44749	1.159000	0.42565	0.600000	0.82982	TCA		0.393	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059005.1	NM_001727		5	99	0	0	0	0.000602	0	5	99				
HTATSF1	27336	broad.mit.edu	37	X	135592353	135592353	+	Missense_Mutation	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:135592353C>G	ENST00000218364.4	+	8	1211	c.1037C>G	c.(1036-1038)gCa>gGa	p.A346G	HTATSF1_ENST00000535601.1_Missense_Mutation_p.A346G	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	346	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A346G(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					ACTGCCCAGGCATGGGATGGG	0.448																																							uc004ezw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(1036-1038)GCA>GGA		HIV-1 Tat specific factor 1							198.0	180.0	186.0					X																	135592353		2203	4300	6503	SO:0001583	missense	27336				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding	g.chrX:135592353C>G	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1037C>G	X.37:g.135592353C>G	ENSP00000218364:p.Ala346Gly					HTATSF1_uc004ezx.2_Missense_Mutation_p.A346G	p.A346G	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN			9	1459	+	Acute lymphoblastic leukemia(192;0.000127)		346			RRM 2.		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	c.1037C>G	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.889365	0.33348	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.06218	3.33;3.33	5.63	2.26	0.28386	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.398601	0.30142	N	0.010318	T	0.08846	0.0219	L	0.49778	1.585	0.09310	N	1	B	0.21309	0.054	B	0.33121	0.158	T	0.25082	-1.0142	10	0.38643	T	0.18	-6.5058	11.2156	0.48825	0.0:0.7401:0.0:0.2599	.	346	O43719	HTSF1_HUMAN	G	346	ENSP00000442699:A346G;ENSP00000218364:A346G	ENSP00000218364:A346G	A	+	2	0	HTATSF1	135420019	0.979000	0.34478	0.034000	0.17996	0.968000	0.65278	2.344000	0.44010	0.467000	0.27218	0.538000	0.68166	GCA		0.448	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		77	298	0	0	0	0.01441	0	77	298				
MAGEC1	9947	broad.mit.edu	37	X	140994659	140994659	+	Missense_Mutation	SNP	C	C	A			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:140994659C>A	ENST00000285879.4	+	4	1755	c.1469C>A	c.(1468-1470)aCt>aAt	p.T490N	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	490								p.T490N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTCCTCCACTTTATTGAGT	0.498										HNSCC(15;0.026)																													uc004fbt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1468-1470)ACT>AAT		melanoma antigen family C, 1							116.0	128.0	124.0					X																	140994659		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140994659C>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1469C>A	X.37:g.140994659C>A	ENSP00000285879:p.Thr490Asn	HNSCC(15;0.026)				MAGEC1_uc010nsl.1_Intron	p.T490N	NM_005462	NP_005453	O60732	MAGC1_HUMAN			4	1755	+	Acute lymphoblastic leukemia(192;6.56e-05)		490					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.1469C>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	2.416	-0.334145	0.05278	.	.	ENSG00000155495	ENST00000285879	T	0.02763	4.17	0.892	-1.78	0.07957	.	.	.	.	.	T	0.02929	0.0087	N	0.08118	0	0.09310	N	0.999998	P	0.51653	0.947	P	0.55965	0.788	T	0.47484	-0.9114	9	0.66056	D	0.02	.	4.7956	0.13270	0.3482:0.6517:0.0:1.0E-4	.	490	O60732	MAGC1_HUMAN	N	490	ENSP00000285879:T490N	ENSP00000285879:T490N	T	+	2	0	MAGEC1	140822325	0.005000	0.15991	0.054000	0.19295	0.055000	0.15305	0.089000	0.15002	0.147000	0.19030	0.149000	0.16113	ACT		0.498	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		52	243	1	0	8.28887e-21	0.01441	1.26567e-20	52	243				
MAGEC2	51438	broad.mit.edu	37	X	141291003	141291003	+	Silent	SNP	C	C	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:141291003C>G	ENST00000247452.3	-	3	1118	c.771G>C	c.(769-771)ggG>ggC	p.G257G		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	257	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.G257G(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCATATACCCCTACTGCAT	0.532										HNSCC(46;0.14)																													uc004fbu.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(769-771)GGG>GGC		melanoma antigen family C, 2							124.0	120.0	122.0					X																	141291003		2203	4300	6503	SO:0001819	synonymous_variant	51438					cytoplasm|nucleus		g.chrX:141291003C>G	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.771G>C	X.37:g.141291003C>G		HNSCC(46;0.14)					p.G257G	NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN			3	1119	-	Acute lymphoblastic leukemia(192;6.56e-05)		257			MAGE.		Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Silent	SNP	ENST00000247452.3	37	c.771G>C	CCDS14678.1																																																																																				0.532	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249		61	178	0	0	0	0.01441	0	61	178				
SLITRK2	84631	broad.mit.edu	37	X	144905670	144905670	+	Missense_Mutation	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:144905670C>T	ENST00000370490.1	+	1	5982	c.1727C>T	c.(1726-1728)gCt>gTt	p.A576V	SLITRK2_ENST00000428560.2_Missense_Mutation_p.A576V|SLITRK2_ENST00000434188.2_Missense_Mutation_p.A576V|SLITRK2_ENST00000447897.2_Missense_Mutation_p.A576V|SLITRK2_ENST00000413937.2_Missense_Mutation_p.A576V			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	576	LRRCT 2.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.A576V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGGAGGGAGGCTATCTGTCCA	0.473																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(1726-1728)GCT>GTT		SLIT and NTRK-like family, member 2 precursor							65.0	57.0	60.0					X																	144905670		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144905670C>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1727C>T	X.37:g.144905670C>T	ENSP00000359521:p.Ala576Val					SLITRK2_uc010nsp.2_Missense_Mutation_p.A576V|SLITRK2_uc010nso.2_Missense_Mutation_p.A576V|SLITRK2_uc011mwq.1_Missense_Mutation_p.A576V|SLITRK2_uc011mwr.1_Missense_Mutation_p.A576V|SLITRK2_uc011mws.1_Missense_Mutation_p.A576V|SLITRK2_uc004fcg.2_Missense_Mutation_p.A576V|SLITRK2_uc011mwt.1_Missense_Mutation_p.A576V	p.A576V	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	2717	+	Acute lymphoblastic leukemia(192;6.56e-05)		576			Extracellular (Potential).|LRRCT 2.		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.1727C>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	3.254	-0.152681	0.06585	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.49720	0.78;0.77;0.77;0.77;0.77;0.77	5.51	4.65	0.58169	Cysteine-rich flanking region, C-terminal (1);	0.056371	0.64402	D	0.000001	T	0.22551	0.0544	N	0.04335	-0.225	0.45777	D	0.998661	B	0.02656	0.0	B	0.04013	0.001	T	0.05550	-1.0878	10	0.22706	T	0.39	-6.8472	7.5304	0.27679	0.0:0.8049:0.0:0.1951	.	576	Q9H156	SLIK2_HUMAN	V	576	ENSP00000334374:A576V;ENSP00000411681:A576V;ENSP00000359521:A576V;ENSP00000397015:A576V;ENSP00000407347:A576V;ENSP00000412010:A576V	ENSP00000334374:A576V	A	+	2	0	SLITRK2	144713362	1.000000	0.71417	0.597000	0.28824	0.922000	0.55478	4.791000	0.62460	1.093000	0.41377	0.600000	0.82982	GCT		0.473	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		30	50	0	0	0	0.009535	0	30	50				
TMEM257	9142	broad.mit.edu	37	X	144909297	144909297	+	Silent	SNP	A	A	G			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:144909297A>G	ENST00000408967.2	+	1	370	c.102A>G	c.(100-102)ctA>ctG	p.L34L		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	34						integral component of membrane (GO:0016021)		p.L34L(1)									TTAACTCACTAGCATCCCCAC	0.279																																							uc004fch.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(100-102)CTA>CTG		hypothetical protein LOC9142							70.0	69.0	69.0					X																	144909297		2203	4300	6503	SO:0001819	synonymous_variant	9142							g.chrX:144909297A>G	Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.102A>G	X.37:g.144909297A>G							p.L34L	NM_004709	NP_004700	O96002	CX001_HUMAN			1	370	+	Acute lymphoblastic leukemia(192;6.56e-05)		34					Q14CW0	Silent	SNP	ENST00000408967.2	37	c.102A>G	CCDS14681.1																																																																																				0.279	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356465.1	NM_004709		31	83	0	0	0	0.007291	0	31	83				
MTM1	4534	broad.mit.edu	37	X	149828153	149828153	+	Missense_Mutation	SNP	A	A	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:149828153A>T	ENST00000370396.2	+	12	1331	c.1277A>T	c.(1276-1278)gAt>gTt	p.D426V	MTM1_ENST00000413012.2_Missense_Mutation_p.D389V|MTM1_ENST00000542741.1_Missense_Mutation_p.D331V|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.D311V	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	426	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)	p.D426V(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					GGTCATGGTGATAAAAACCAC	0.333																																							uc004fef.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(1276-1278)GAT>GTT		myotubularin							166.0	138.0	147.0					X																	149828153		2203	4300	6503	SO:0001583	missense	4534				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity	g.chrX:149828153A>T	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1277A>T	X.37:g.149828153A>T	ENSP00000359423:p.Asp426Val					MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Missense_Mutation_p.D389V|MTM1_uc011mxz.1_Missense_Mutation_p.D311V|MTM1_uc010nte.2_Missense_Mutation_p.D294V	p.D426V	NM_000252	NP_000243	Q13496	MTM1_HUMAN			12	1353	+	Acute lymphoblastic leukemia(192;6.56e-05)		426			Myotubularin phosphatase.		A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	37	c.1277A>T	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.352884	0.61293	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13	5.54	5.54	0.83059	Myotubularin phosphatase domain (1);	0.044562	0.85682	D	0.000000	D	0.94016	0.8083	M	0.81341	2.54	0.80722	D	1	B;B	0.33073	0.117;0.396	B;B	0.43536	0.094;0.423	D	0.94075	0.7339	10	0.87932	D	0	.	14.723	0.69323	1.0:0.0:0.0:0.0	.	389;426	B7Z491;Q13496	.;MTM1_HUMAN	V	426;331;311;389	ENSP00000359423:D426V;ENSP00000444015:D331V;ENSP00000439784:D311V;ENSP00000389157:D389V	ENSP00000359423:D426V	D	+	2	0	MTM1	149578811	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.295000	0.96095	1.858000	0.53909	0.441000	0.28932	GAT		0.333	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252		6	69	0	0	0	0.001984	0	6	69				
FAM50A	9130	broad.mit.edu	37	X	153678637	153678637	+	Silent	SNP	C	C	T			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:153678637C>T	ENST00000393600.3	+	12	1091	c.981C>T	c.(979-981)taC>taT	p.Y327Y		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	327					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Y327Y(1)		breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGGAACCCTACGACCCTGAAA	0.622																																							uc004fll.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(979-981)TAC>TAT		XAP-5 protein							80.0	71.0	74.0					X																	153678637		2203	4300	6503	SO:0001819	synonymous_variant	9130				spermatogenesis	nucleus		g.chrX:153678637C>T	BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.981C>T	X.37:g.153678637C>T							p.Y327Y	NM_004699	NP_004690	Q14320	FA50A_HUMAN			12	1079	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		327					A8KAQ4|B2R997|Q5HY37|Q6PJH5	Silent	SNP	ENST00000393600.3	37	c.981C>T	CCDS14751.1																																																																																				0.622	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081643.2	NM_004699		6	69	0	0	0	0.004482	0	6	69				
RSBN1	54665	broad.mit.edu	37	1	114308968	114308986	+	Frame_Shift_Del	DEL	ATTTCTAGGGATGAAGTAG	ATTTCTAGGGATGAAGTAG	-			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	ATTTCTAGGGATGAAGTAG	ATTTCTAGGGATGAAGTAG	-	-	ATTTCTAGGGATGAAGTAG	ATTTCTAGGGATGAAGTAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr1:114308968_114308986delATTTCTAGGGATGAAGTAG	ENST00000261441.5	-	7	2088_2106	c.2025_2043delCTACTTCATCCCTAGAAAT	c.(2023-2043)atctacttcatccctagaaatfs	p.IYFIPRN675fs	RSBN1_ENST00000369581.2_5'UTR	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	675						nucleus (GO:0005634)		p.F677F(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GATGAATGACATTTCTAGGGATGAAGTAGATATCATTGT	0.438																																							uc001edq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2023-2043)ATCTACTTCATCCCTAGAAATfs		round spermatid basic protein 1																																				SO:0001589	frameshift_variant	54665					nucleus		g.chr1:114308968_114308986delATTTCTAGGGATGAAGTAG	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.2025_2043delCTACTTCATCCCTAGAAAT	1.37:g.114308968_114308986delATTTCTAGGGATGAAGTAG	ENSP00000261441:p.Ile675fs					RSBN1_uc001edr.2_RNA	p.I675fs	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	7	2061_2079	-	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)	675_681					A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Frame_Shift_Del	DEL	ENST00000261441.5	37	c.2025_2043delCTACTTCATCCCTAGAAAT	CCDS862.1																																																																																				0.438	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364		37	137	NA	NA	NA	NA	NA	37	137	---	---	---	---
LTBP2	4053	broad.mit.edu	37	14	74989609	74989610	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr14:74989609_74989610insTT	ENST00000261978.4	-	16	2928_2929	c.2542_2543insAA	c.(2542-2544)tgcfs	p.C848fs	LTBP2_ENST00000556690.1_Frame_Shift_Ins_p.C848fs	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	848	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TCCAGCAGCGCATCTGTCAATG	0.619																																							uc001xqa.2		NA																	0				liver(1)|skin(1)	2						c.(2542-2544)TGCfs		latent transforming growth factor beta binding																																				SO:0001589	frameshift_variant	4053				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding	g.chr14:74989609_74989610insTT		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2542_2543insAA	14.37:g.74989609_74989610insTT	ENSP00000261978:p.Cys848fs						p.C848fs	NM_000428	NP_000419	Q14767	LTBP2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)	16	2929_2930	-			848			EGF-like 4.		Q99907|Q9NS51	Frame_Shift_Ins	INS	ENST00000261978.4	37	c.2542_2543insAA	CCDS9831.1																																																																																				0.619	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428		7	19	NA	NA	NA	NA	NA	7	19	---	---	---	---
KRT13	3860	broad.mit.edu	37	17	39658805	39658806	+	Frame_Shift_Ins	INS	-	-	A	rs148296285	byFrequency	TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr17:39658805_39658806insA	ENST00000246635.3	-	6	1110_1111	c.1064_1065insT	c.(1063-1065)cgcfs	p.R355fs	KRT13_ENST00000587118.1_5'Flank|AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Frame_Shift_Ins_p.R355fs|KRT13_ENST00000336861.3_Frame_Shift_Ins_p.R355fs	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	355	Coil 2.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				GCAGGGCATAGCGGCACTCCGT	0.599																																							uc002hwu.1		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(1063-1065)CGCfs		keratin 13 isoform a																																				SO:0001589	frameshift_variant	3860				epidermis development	intermediate filament	structural molecule activity	g.chr17:39658805_39658806insA		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.1064_1065insT	17.37:g.39658805_39658806insA	ENSP00000246635:p.Arg355fs					KRT13_uc002hwv.1_Frame_Shift_Ins_p.R355fs|KRT13_uc002hww.2_Frame_Shift_Ins_p.R248fs|KRT13_uc010wfr.1_Frame_Shift_Ins_p.R248fs|KRT13_uc010cxo.2_Frame_Shift_Ins_p.R355fs|KRT13_uc002hwx.1_Frame_Shift_Ins_p.R343fs	p.R355fs	NM_153490	NP_705694	P13646	K1C13_HUMAN			6	1127_1128	-		Breast(137;0.000286)	355			Rod.|Coil 2.		Q53G54|Q6AZK5|Q8N240	Frame_Shift_Ins	INS	ENST00000246635.3	37	c.1064_1065insT	CCDS11396.1																																																																																				0.599	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490		11	107	NA	NA	NA	NA	NA	11	107	---	---	---	---
GATAD2A	54815	broad.mit.edu	37	19	19612093	19612093	+	Frame_Shift_Del	DEL	C	C	-			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr19:19612093delC	ENST00000360315.3	+	9	1680	c.1368delC	c.(1366-1368)agcfs	p.S456fs	GATAD2A_ENST00000537887.1_Frame_Shift_Del_p.S85fs|GATAD2A_ENST00000429563.2_Frame_Shift_Del_p.S284fs|GATAD2A_ENST00000358713.3_Frame_Shift_Del_p.S456fs|GATAD2A_ENST00000404158.1_Frame_Shift_Del_p.S457fs|GATAD2A_ENST00000252577.5_Frame_Shift_Del_p.S456fs	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	456	CR2; histone tail-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						AGCACACCAGCCGGCTGAAGG	0.637																																							uc010xqt.1		NA																	0					0						c.(1366-1368)AGCfs		GATA zinc finger domain containing 2A							38.0	31.0	33.0					19																	19612093		2203	4300	6503	SO:0001589	frameshift_variant	54815				DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:19612093delC	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1368delC	19.37:g.19612093delC	ENSP00000353463:p.Ser456fs					GATAD2A_uc010xqu.1_Frame_Shift_Del_p.S85fs|GATAD2A_uc010xqv.1_Frame_Shift_Del_p.S476fs|GATAD2A_uc010xqw.1_Frame_Shift_Del_p.S284fs	p.S456fs	NM_017660	NP_060130	Q86YP4	P66A_HUMAN			9	1680	+			456			GATA-type.		B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Frame_Shift_Del	DEL	ENST00000360315.3	37	c.1368delC	CCDS12402.2																																																																																				0.637	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660		7	31	NA	NA	NA	NA	NA	7	31	---	---	---	---
STXBP5L	9515	broad.mit.edu	37	3	120998798	120998798	+	Frame_Shift_Del	DEL	T	T	-			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chr3:120998798delT	ENST00000273666.6	+	19	2376	c.2105delT	c.(2104-2106)attfs	p.I702fs	STXBP5L_ENST00000472879.1_Frame_Shift_Del_p.I702fs|STXBP5L_ENST00000471454.1_Frame_Shift_Del_p.I702fs|STXBP5L_ENST00000497029.1_Frame_Shift_Del_p.I702fs|STXBP5L_ENST00000492541.1_Frame_Shift_Del_p.I702fs	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	702					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AAACAGTTCATTGCAGGTAGG	0.368																																							uc003eec.3		NA																	0				ovary(7)|skin(2)	9						c.(2104-2106)ATTfs		syntaxin binding protein 5-like							80.0	73.0	75.0					3																	120998798		1858	4108	5966	SO:0001589	frameshift_variant	9515				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane		g.chr3:120998798delT	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2105delT	3.37:g.120998798delT	ENSP00000273666:p.Ile702fs					STXBP5L_uc011bji.1_Frame_Shift_Del_p.I702fs	p.I702fs	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN		GBM - Glioblastoma multiforme(114;0.0694)	19	2245	+			702			WD 10.		Q4G1B4|Q6PIC3	Frame_Shift_Del	DEL	ENST00000273666.6	37	c.2105delT	CCDS43137.1																																																																																				0.368	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			15	55	NA	NA	NA	NA	NA	15	55	---	---	---	---
BMX	660	broad.mit.edu	37	X	15544216	15544219	+	Splice_Site	DEL	TGAG	TGAG	-			TCGA-67-6217-01A-11D-1753-08	TCGA-67-6217-10A-01D-1753-08	TGAG	TGAG	-	-	TGAG	TGAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	cb98d825-668f-4b16-a05e-501e1c94f3fe	3f3bd303-83e1-4896-8c92-b287da34fbf8	g.chrX:15544216_15544219delTGAG	ENST00000357607.2	+	9	1070_1072	c.882_884delTGAG	c.(880-885)tatgag>tag	p.YE294fs	BMX_ENST00000342014.6_Splice_Site_p.YE294fs|BMX_ENST00000348343.6_Splice_Site_p.YE294fs			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	294					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					TGGATGATTATGAGTGAGTATTGA	0.387																																							uc004cww.2		NA																	0				lung(3)|ovary(2)	5						c.e9+1		BMX non-receptor tyrosine kinase																																				SO:0001630	splice_region_variant	660				cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity	g.chrX:15544216_15544219delTGAG	AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.884+1TGAG>-	X.37:g.15544220_15544223delTGAG						BMX_uc004cwx.3_Splice_Site_p.D295_splice|BMX_uc004cwy.3_Splice_Site_p.D295_splice	p.D295_splice	NM_203281	NP_975010	P51813	BMX_HUMAN			9	1072	+	Hepatocellular(33;0.183)							A6NIH9|O60564|Q12871	Splice_Site	DEL	ENST00000357607.2	37	c.884_splice	CCDS14168.1																																																																																				0.387	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1	NM_001721	Frame_Shift_Del	10	131	NA	NA	NA	NA	NA	10	131	---	---	---	---
