#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CHD5	26038	broad.mit.edu	37	1	6194814	6194814	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:6194814G>T	ENST00000262450.3	-	19	3075	c.2976C>A	c.(2974-2976)tgC>tgA	p.C992*	CHD5_ENST00000378021.1_De_novo_Start_OutOfFrame	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.C992*(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GGTGGTTGCAGCACTTTTTCA	0.572																																							uc001amb.1		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12						c.(2974-2976)TGC>TGA		chromodomain helicase DNA binding protein 5							268.0	270.0	269.0					1																	6194814		2203	4300	6503	SO:0001587	stop_gained	26038				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	g.chr1:6194814G>T	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2976C>A	1.37:g.6194814G>T	ENSP00000262450:p.Cys992*					CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	p.C992*	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)	19	3076	-	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	992					A8KAP8|A8MQ44|D3DSH9|O60740	Nonsense_Mutation	SNP	ENST00000262450.3	37	c.2976C>A	CCDS57.1	.	.	.	.	.	.	.	.	.	.	G	37	6.570107	0.97671	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	.	.	.	4.65	-2.12	0.07165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.124	10.2966	0.43627	0.4006:0.0:0.5994:0.0	.	.	.	.	X	992;508;400;400	.	ENSP00000262450:C992X	C	-	3	2	CHD5	6117401	1.000000	0.71417	0.963000	0.40424	0.997000	0.91878	1.449000	0.35123	-0.675000	0.05246	0.561000	0.74099	TGC		0.572	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		18	116	1	0	3.51602e-12	0.008871	5.45318e-12	18	116				
EMC1	23065	broad.mit.edu	37	1	19566877	19566877	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:19566877C>T	ENST00000477853.1	-	7	742	c.700G>A	c.(700-702)Gtc>Atc	p.V234I	EMC1_ENST00000375199.3_Missense_Mutation_p.V234I|EMC1_ENST00000375208.3_Missense_Mutation_p.V212I|RP1-43E13.2_ENST00000437898.1_RNA	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	234						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.V234I(1)									CACACCAGGACAGCCTCATCC	0.552																																						GBM(4;72 124 25802 30195)	uc001bbo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(700-702)GTC>ATC		hypothetical protein LOC23065 precursor							110.0	98.0	102.0					1																	19566877		2203	4300	6503	SO:0001583	missense	23065					integral to membrane	protein binding	g.chr1:19566877C>T		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.700G>A	1.37:g.19566877C>T	ENSP00000420608:p.Val234Ile					KIAA0090_uc001bbp.2_Missense_Mutation_p.V234I|KIAA0090_uc001bbq.2_Missense_Mutation_p.V234I|KIAA0090_uc001bbr.2_Missense_Mutation_p.V212I	p.V234I	NM_015047	NP_055862	Q8N766	K0090_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)	7	743	-		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)	234			Extracellular (Potential).		A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	ENST00000477853.1	37	c.700G>A	CCDS190.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.079284	0.55753	.	.	ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208	T;T;T	0.25085	1.85;1.85;1.82	5.77	5.77	0.91146	.	0.145128	0.64402	D	0.000007	T	0.24661	0.0598	L	0.39397	1.21	0.80722	D	1	B;B;B;B	0.21071	0.019;0.019;0.041;0.051	B;B;B;B	0.17433	0.011;0.011;0.011;0.018	T	0.03025	-1.1081	10	0.22109	T	0.4	-33.9366	18.9103	0.92481	0.0:1.0:0.0:0.0	.	212;234;234;234	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.;.;.;K0090_HUMAN	I	234;234;212	ENSP00000420608:V234I;ENSP00000364345:V234I;ENSP00000364354:V212I	ENSP00000364345:V234I	V	-	1	0	KIAA0090	19439464	0.955000	0.32602	1.000000	0.80357	0.998000	0.95712	2.009000	0.40903	2.884000	0.98904	0.655000	0.94253	GTC		0.552	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047		15	22	0	0	0	0.004007	0	15	22				
HSPG2	3339	broad.mit.edu	37	1	22149978	22149978	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:22149978C>T	ENST00000374695.3	-	97	13086	c.13007G>A	c.(13006-13008)gGa>gAa	p.G4336E	LDLRAD2_ENST00000344642.2_3'UTR|LDLRAD2_ENST00000543870.1_Intron|HSPG2_ENST00000486901.1_5'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	4336	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.G4336E(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTCAGGGGCTCCGCCTGCCGG	0.697																																							uc001bfj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.(13006-13008)GGA>GAA		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						15.0	14.0	14.0					1																	22149978		2198	4285	6483	SO:0001583	missense	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22149978C>T	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.13007G>A	1.37:g.22149978C>T	ENSP00000363827:p.Gly4336Glu					LDLRAD2_uc001bfg.1_3'UTR|HSPG2_uc001bfi.2_Missense_Mutation_p.G353E|HSPG2_uc009vqd.2_Missense_Mutation_p.G4337E	p.G4336E	NM_005529	NP_005520	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	97	13047	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	4336			Laminin G-like 3.		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	c.13007G>A	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403723	0.83230	.	.	ENSG00000142798	ENST00000374695	D	0.88354	-2.37	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.36972	N	0.002306	D	0.96470	0.8848	H	0.96691	3.865	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97818	1.0255	10	0.87932	D	0	.	16.2612	0.82547	0.0:1.0:0.0:0.0	.	2276;4336	Q59EG0;P98160	.;PGBM_HUMAN	E	4336	ENSP00000363827:G4336E	ENSP00000363827:G4336E	G	-	2	0	HSPG2	22022565	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	6.960000	0.76036	2.422000	0.82143	0.655000	0.94253	GGA		0.697	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		2	2	0	0	0	0.009096	0	2	2				
LCK	3932	broad.mit.edu	37	1	32741606	32741606	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:32741606C>G	ENST00000336890.5	+	7	711	c.573C>G	c.(571-573)ttC>ttG	p.F191L	LCK_ENST00000333070.4_Missense_Mutation_p.F191L|LCK_ENST00000373564.3_Missense_Mutation_p.F249L	NM_005356.3	NP_005347.3	P06239	LCK_HUMAN	LCK proto-oncogene, Src family tyrosine kinase	191	Interaction with PTPRH.|SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aging (GO:0007568)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular zinc ion homeostasis (GO:0006882)|dephosphorylation (GO:0016311)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hemopoiesis (GO:0030097)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|positive regulation of uterine smooth muscle contraction (GO:0070474)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of defense response to virus by virus (GO:0050690)|regulation of lymphocyte activation (GO:0051249)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to zinc ion (GO:0010043)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|pericentriolar material (GO:0000242)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|ATP binding (GO:0005524)|ATPase binding (GO:0051117)|CD4 receptor binding (GO:0042609)|CD8 receptor binding (GO:0042610)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine kinase activity (GO:0004713)|SH2 domain binding (GO:0042169)	p.F191L(1)|p.F249L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)|Ponatinib(DB08901)	ACGGTGGCTTCTACATCTCCC	0.552			T	TRB@	T-ALL																																		uc001bux.2		NA		Dom	yes		1	1p35-p34.3	3932	T	lymphocyte-specific protein tyrosine kinase			L	TRB@		T-ALL		2	Substitution - Missense(2)		lung(2)	lung(3)|central_nervous_system(2)|ovary(1)	6						c.(571-573)TTC>TTG		lymphocyte-specific protein tyrosine kinase	Dasatinib(DB01254)						119.0	121.0	120.0					1																	32741606		2203	4300	6503	SO:0001583	missense	3932				activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding	g.chr1:32741606C>G	M36881	CCDS359.1	1p34.3	2014-09-17	2014-06-25		ENSG00000182866	ENSG00000182866	2.7.10.1	"""SH2 domain containing"""	6524	protein-coding gene	gene with protein product		153390	"""lymphocyte-specific protein tyrosine kinase"""			2787474	Standard	XM_005270862		Approved		uc001buy.3	P06239	OTTHUMG00000007463	ENST00000336890.5:c.573C>G	1.37:g.32741606C>G	ENSP00000337825:p.Phe191Leu					LCK_uc001buy.2_Missense_Mutation_p.F191L|LCK_uc001buz.2_Missense_Mutation_p.F191L|LCK_uc010ohc.1_Missense_Mutation_p.F235L|LCK_uc001bva.2_Missense_Mutation_p.F249L	p.F191L	NM_005356	NP_005347	P06239	LCK_HUMAN			7	711	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)	191			SH2.|Interaction with PTPRH.		D3DPP8|P07100|Q12850|Q13152|Q5TDH8|Q5TDH9|Q7RTZ3|Q96DW4|Q9NYT8	Missense_Mutation	SNP	ENST00000336890.5	37	c.573C>G	CCDS359.1	.	.	.	.	.	.	.	.	.	.	.	17.42	3.384569	0.61845	.	.	ENSG00000182866	ENST00000336890;ENST00000495610;ENST00000373557;ENST00000333070;ENST00000436824;ENST00000373564	D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31	5.58	3.73	0.42828	SH2 motif (4);	0.000000	0.64402	D	0.000001	D	0.84406	0.5465	L	0.57130	1.785	0.58432	D	0.999999	B;B;B;B	0.15930	0.015;0.007;0.002;0.008	B;B;B;B	0.27796	0.083;0.033;0.027;0.058	T	0.80630	-0.1297	10	0.72032	D	0.01	.	9.2278	0.37418	0.0:0.7737:0.0:0.2263	.	235;249;191;191	E7EN21;Q573B4;P06239-3;P06239	.;.;.;LCK_HUMAN	L	191;191;235;191;235;249	ENSP00000337825:F191L;ENSP00000435605:F191L;ENSP00000362658:F235L;ENSP00000328213:F191L;ENSP00000362665:F249L	ENSP00000328213:F191L	F	+	3	2	LCK	32514193	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	3.311000	0.51919	0.869000	0.35703	-0.263000	0.10527	TTC		0.552	LCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019616.4	NM_005356		29	24	0	0	0	0.009535	0	29	24				
C1orf94	84970	broad.mit.edu	37	1	34631410	34631410	+	5'Flank	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:34631410C>T	ENST00000373374.3	+	0	0				CSMD2_ENST00000373381.4_5'Flank	NM_032884.3	NP_116273.2	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94									p.R2K(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				GCTTATGAGCCTCATTCACAA	0.572																																							uc001bxn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(4-6)AGG>AAG		CUB and Sushi multiple domains 2							138.0	108.0	118.0					1																	34631410		2203	4300	6503	SO:0001631	upstream_gene_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34631410C>T	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012		1.37:g.34631410C>T	Exception_encountered					CSMD2_uc001bxm.1_5'Flank|C1orf94_uc001bxs.3_5'Flank	p.R2K	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN			1	34	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	2			Extracellular (Potential).		B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	ENST00000373374.3	37	c.5G>A	CCDS381.1																																																																																				0.572	C1orf94-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000011463.2	NM_032884		17	23	0	0	0	0.007413	0	17	23				
AGO3	192669	broad.mit.edu	37	1	36501854	36501854	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:36501854C>A	ENST00000373191.4	+	14	2177	c.1828C>A	c.(1828-1830)Cct>Act	p.P610T	AGO3_ENST00000246314.6_Missense_Mutation_p.P376T	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	610	Piwi. {ECO:0000255|HAMAP-Rule:MF_03032}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)	p.P610T(1)									TGGAAAGAAGCCTTCTATTGC	0.398																																						Colon(144;60 2363 31043 40539)	uc001bzp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1828-1830)CCT>ACT		eukaryotic translation initiation factor 2C, 3							165.0	155.0	158.0					1																	36501854		2203	4300	6503	SO:0001583	missense	192669				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding	g.chr1:36501854C>A	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1828C>A	1.37:g.36501854C>A	ENSP00000362287:p.Pro610Thr					EIF2C3_uc001bzq.2_Missense_Mutation_p.P376T	p.P610T	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN			14	2084	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	610			Piwi.		B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	c.1828C>A	CCDS399.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924172	0.92319	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.35236	1.32;1.32	5.51	5.51	0.81932	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.048612	0.85682	D	0.000000	T	0.77658	0.4163	H	0.99273	4.495	0.80722	D	1	D	0.56287	0.975	D	0.66716	0.946	D	0.87037	0.2138	10	0.87932	D	0	-31.5281	19.7828	0.96424	0.0:1.0:0.0:0.0	.	610	Q9H9G7	AGO3_HUMAN	T	610;376	ENSP00000362287:P610T;ENSP00000246314:P376T	ENSP00000246314:P376T	P	+	1	0	EIF2C3	36274441	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.804000	0.85993	2.747000	0.94245	0.650000	0.86243	CCT		0.398	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852		16	67	1	0	3.99206e-14	0.007413	6.45891e-14	16	67				
GRIK3	2899	broad.mit.edu	37	1	37271752	37271752	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:37271752A>G	ENST00000373091.3	-	14	2283	c.2267T>C	c.(2266-2268)aTc>aCc	p.I756T	GRIK3_ENST00000373093.4_Missense_Mutation_p.I756T	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	756					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.I756T(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GAGGCCCCCGATCTGGGTGAG	0.662																																							uc001caz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|large_intestine(1)|breast(1)	7						c.(2266-2268)ATC>ACC		glutamate receptor, ionotropic, kainate 3	L-Glutamic Acid(DB00142)						182.0	126.0	145.0					1																	37271752		2203	4300	6503	SO:0001583	missense	2899				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity	g.chr1:37271752A>G	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2267T>C	1.37:g.37271752A>G	ENSP00000362183:p.Ile756Thr					GRIK3_uc001cba.1_Missense_Mutation_p.I756T	p.I756T	NM_000831	NP_000822	Q13003	GRIK3_HUMAN			14	2402	-		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)	756			Extracellular (Potential).		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	c.2267T>C	CCDS416.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.317698	0.81469	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.12361	2.69;2.69	5.31	5.31	0.75309	Ionotropic glutamate receptor (2);	0.230787	0.37857	N	0.001912	T	0.40815	0.1132	M	0.78801	2.425	0.45806	D	0.998682	P;P	0.42337	0.776;0.776	D;D	0.66716	0.946;0.913	T	0.24012	-1.0172	10	0.87932	D	0	.	15.2525	0.73559	1.0:0.0:0.0:0.0	.	756;756	A9Z1Z8;Q13003	.;GRIK3_HUMAN	T	756	ENSP00000362183:I756T;ENSP00000362185:I756T	ENSP00000362183:I756T	I	-	2	0	GRIK3	37044339	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	9.265000	0.95647	2.009000	0.58944	0.448000	0.29417	ATC		0.662	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831		16	29	0	0	0	0.006122	0	16	29				
SNIP1	79753	broad.mit.edu	37	1	38006344	38006344	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:38006344G>A	ENST00000296215.6	-	3	412	c.340C>T	c.(340-342)Cat>Tat	p.H114Y	SNIP1_ENST00000468040.1_5'UTR	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	114	Arg-rich.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.H114Y(1)		breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				CTCCGGGGATGATCCTCACGC	0.502																																							uc001cbi.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)	2						c.(340-342)CAT>TAT		Smad nuclear interacting protein							79.0	78.0	78.0					1																	38006344		2203	4300	6503	SO:0001583	missense	79753				production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding	g.chr1:38006344G>A		CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.340C>T	1.37:g.38006344G>A	ENSP00000296215:p.His114Tyr					SNIP1_uc010oid.1_Intron	p.H114Y	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN			3	413	-		Myeloproliferative disorder(586;0.0393)	114			Arg-rich.		Q96SP9|Q9H9T7	Missense_Mutation	SNP	ENST00000296215.6	37	c.340C>T	CCDS419.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.559650	0.27827	.	.	ENSG00000163877	ENST00000296215;ENST00000436196	T	0.14391	2.51	5.14	5.14	0.70334	.	0.148639	0.64402	D	0.000013	T	0.19805	0.0476	L	0.32530	0.975	0.52099	D	0.999945	D	0.62365	0.991	P	0.52109	0.69	T	0.00945	-1.1505	10	0.29301	T	0.29	-15.9074	18.7976	0.92001	0.0:0.0:1.0:0.0	.	114	Q8TAD8	SNIP1_HUMAN	Y	114;98	ENSP00000296215:H114Y	ENSP00000296215:H114Y	H	-	1	0	SNIP1	37778931	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	8.031000	0.88826	2.677000	0.91161	0.655000	0.94253	CAT		0.502	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012169.2	NM_024700		7	51	0	0	0	0.00308	0	7	51				
CYP4A11	1579	broad.mit.edu	37	1	47398461	47398461	+	Missense_Mutation	SNP	C	C	T	rs556756716		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:47398461C>T	ENST00000310638.4	-	11	1367	c.1336G>A	c.(1336-1338)Gct>Act	p.A446T	CYP4A11_ENST00000462347.1_Missense_Mutation_p.A348T|CYP4A11_ENST00000371905.1_Missense_Mutation_p.A446T|CYP4A11_ENST00000371904.4_Missense_Mutation_p.A447T|CYP4A11_ENST00000496519.1_5'Flank	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	446					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.A446T(2)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	GGCAGGAAAGCGTGGCTGTGT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		20751	0.001		0.0	False		,,,				2504	0.0						uc001cqp.3		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(2)|skin(2)	4						c.(1336-1338)GCT>ACT		cytochrome P450, family 4, subfamily A,	NADH(DB00157)						272.0	287.0	282.0					1																	47398461		2203	4300	6503	SO:0001583	missense	1579				long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding	g.chr1:47398461C>T	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1336G>A	1.37:g.47398461C>T	ENSP00000311095:p.Ala446Thr					CYP4A11_uc001cqq.2_Missense_Mutation_p.A446T	p.A446T	NM_000778	NP_000769	Q02928	CP4AB_HUMAN			11	1387	-			446					Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	c.1336G>A	CCDS543.1	.	.	.	.	.	.	.	.	.	.	N	17.46	3.395295	0.62066	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.71103	-0.54;-0.54;-0.54	5.11	3.06	0.35304	.	0.110897	0.64402	D	0.000009	T	0.69024	0.3065	N	0.17248	0.465	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.69709	-0.5072	10	0.87932	D	0	.	8.7965	0.34883	0.1786:0.7411:0.0:0.0803	.	446	Q02928	CP4AB_HUMAN	T	446;447;446	ENSP00000311095:A446T;ENSP00000360971:A447T;ENSP00000360972:A446T	ENSP00000311095:A446T	A	-	1	0	CYP4A11	47171048	0.998000	0.40836	0.626000	0.29213	0.169000	0.22640	2.994000	0.49433	0.509000	0.28195	0.650000	0.86243	GCT		0.517	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778		57	282	0	0	0	0.01441	0	57	282				
CACHD1	57685	broad.mit.edu	37	1	65157011	65157011	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:65157011A>T	ENST00000371073.2	+	27	3592	c.3592A>T	c.(3592-3594)Agc>Tgc	p.S1198C	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Missense_Mutation_p.S1147C			Q5VU97	CAHD1_HUMAN	cache domain containing 1	1198					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.S1147C(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TCTAGGTTACAGCACCATGAG	0.483																																							uc001dbo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3439-3441)AGC>TGC		cache domain containing 1							92.0	84.0	87.0					1																	65157011		2203	4300	6503	SO:0001583	missense	57685				calcium ion transport	integral to membrane		g.chr1:65157011A>T	AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.3592A>T	1.37:g.65157011A>T	ENSP00000360113:p.Ser1198Cys					CACHD1_uc001dbp.1_Missense_Mutation_p.S902C|CACHD1_uc001dbq.1_Missense_Mutation_p.S902C|CACHD1_uc010opa.1_Missense_Mutation_p.S391C	p.S1147C	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN			27	3544	+			1198			Cytoplasmic (Potential).		Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37	c.3439A>T		.	.	.	.	.	.	.	.	.	.	A	21.6	4.177190	0.78564	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.60548	0.18;0.24	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.64972	0.2647	L	0.54323	1.7	0.80722	D	1	D	0.69078	0.997	D	0.70935	0.971	T	0.70230	-0.4929	10	0.87932	D	0	-28.4373	15.3597	0.74460	1.0:0.0:0.0:0.0	.	1198	Q5VU97	CAHD1_HUMAN	C	1198;1147	ENSP00000360113:S1198C;ENSP00000290039:S1147C	ENSP00000290039:S1147C	S	+	1	0	CACHD1	64929599	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.850000	0.92190	2.034000	0.60081	0.459000	0.35465	AGC		0.483	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925		18	45	0	0	0	0.007413	0	18	45				
ELTD1	64123	broad.mit.edu	37	1	79383572	79383572	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:79383572G>T	ENST00000370742.3	-	11	1688	c.1625C>A	c.(1624-1626)gCc>gAc	p.A542D		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	542					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A542D(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AACTACCACGGCTGGGCTTAG	0.373																																							uc001diq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1624-1626)GCC>GAC		EGF, latrophilin and seven transmembrane domain							132.0	130.0	131.0					1																	79383572		1839	4091	5930	SO:0001583	missense	64123				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr1:79383572G>T	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1625C>A	1.37:g.79383572G>T	ENSP00000359778:p.Ala542Asp						p.A542D	NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN		COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)	11	1781	-			542			Helical; Name=4; (Potential).		B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	c.1625C>A	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715777	0.89112	.	.	ENSG00000162618	ENST00000370742	T	0.52057	0.68	5.79	5.79	0.91817	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.77994	0.4214	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84433	0.0578	9	.	.	.	.	20.0332	0.97547	0.0:0.0:1.0:0.0	.	542	Q9HBW9	ELTD1_HUMAN	D	542	ENSP00000359778:A542D	.	A	-	2	0	ELTD1	79156160	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	9.869000	0.99810	2.749000	0.94314	0.491000	0.48974	GCC		0.373	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159		21	129	1	0	7.87624e-14	0.00278	1.26175e-13	21	129				
LPHN2	23266	broad.mit.edu	37	1	82416126	82416126	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:82416126G>A	ENST00000370728.1	+	9	2097	c.1452G>A	c.(1450-1452)agG>agA	p.R484R	LPHN2_ENST00000370730.1_Silent_p.R484R|LPHN2_ENST00000370713.1_Silent_p.R484R|LPHN2_ENST00000359929.3_Silent_p.R484R|LPHN2_ENST00000319517.6_Silent_p.R484R|LPHN2_ENST00000370715.1_Silent_p.R484R|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000271029.4_Silent_p.R484R|LPHN2_ENST00000370725.1_Silent_p.R484R|LPHN2_ENST00000394879.1_Silent_p.R484R|LPHN2_ENST00000370727.1_Silent_p.R484R|LPHN2_ENST00000335786.5_Silent_p.R484R|LPHN2_ENST00000370717.2_Silent_p.R484R|LPHN2_ENST00000370723.1_Silent_p.R484R|LPHN2_ENST00000370721.1_Silent_p.R422R			O95490	LPHN2_HUMAN	latrophilin 2	484					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.R484R(2)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		AGACACAAAGGGGAATGATGG	0.393																																							uc001dit.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9						c.(1450-1452)AGG>AGA		latrophilin 2 precursor							89.0	90.0	89.0					1																	82416126		2203	4300	6503	SO:0001819	synonymous_variant	23266				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding	g.chr1:82416126G>A	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1452G>A	1.37:g.82416126G>A						LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Silent_p.R484R|LPHN2_uc001div.2_Silent_p.R484R|LPHN2_uc009wcd.2_Silent_p.R484R|LPHN2_uc001diw.2_Silent_p.R55R	p.R484R	NM_012302	NP_036434	O95490	LPHN2_HUMAN		all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)	7	1633	+			484			Extracellular (Potential).		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Silent	SNP	ENST00000370728.1	37	c.1452G>A		.	.	.	.	.	.	.	.	.	.	G	5.651	0.304747	0.10678	.	.	ENSG00000117114	ENST00000449420	.	.	.	5.88	4.79	0.61399	.	.	.	.	.	T	0.45657	0.1353	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45877	-0.9231	4	.	.	.	.	6.8184	0.23843	0.2406:0.0:0.7594:0.0	.	.	.	.	E	352	.	.	G	+	2	0	LPHN2	82188714	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.267000	0.58877	2.782000	0.95742	0.655000	0.94253	GGG		0.393	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302		7	50	0	0	0	0.00308	0	7	50				
C1orf52	148423	broad.mit.edu	37	1	85724262	85724262	+	Silent	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:85724262T>C	ENST00000471115.1	-	2	428	c.420A>G	c.(418-420)ccA>ccG	p.P140P	C1orf52_ENST00000344356.5_Silent_p.P140P|C1orf52_ENST00000294661.4_5'UTR	NM_198077.3	NP_932343.1	Q8N6N3	CA052_HUMAN	chromosome 1 open reading frame 52	140							poly(A) RNA binding (GO:0044822)	p.P140P(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)	10				all cancers(265;0.0105)|Epithelial(280;0.0293)		TAGCATTCTGTGGAGCATCAT	0.478																																							uc001dkv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(418-420)CCA>CCG		hypothetical protein LOC148423							231.0	215.0	220.0					1																	85724262		2203	4300	6503	SO:0001819	synonymous_variant	148423							g.chr1:85724262T>C	BC029538	CCDS703.1	1p22.3	2008-02-05			ENSG00000162642	ENSG00000162642			24871	protein-coding gene	gene with protein product						11891061	Standard	NM_198077		Approved	gm117, FLJ44982	uc001dkv.3	Q8N6N3	OTTHUMG00000009966	ENST00000471115.1:c.420A>G	1.37:g.85724262T>C						C1orf52_uc001dkw.2_RNA|C1orf52_uc001dkx.3_RNA|C1orf52_uc009wcn.2_Silent_p.P140P	p.P140P	NM_198077	NP_932343	Q8N6N3	CA052_HUMAN		all cancers(265;0.0105)|Epithelial(280;0.0293)	2	459	-			140					B3KX89|Q8TDK5|Q8TDK6	Silent	SNP	ENST00000471115.1	37	c.420A>G	CCDS703.1																																																																																				0.478	C1orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027616.2	NM_198077		73	140	0	0	0	0.01441	0	73	140				
CLCA1	1179	broad.mit.edu	37	1	86954799	86954799	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:86954799G>A	ENST00000234701.3	+	9	1654	c.1303G>A	c.(1303-1305)Gtc>Atc	p.V435I	CLCA1_ENST00000394711.1_Missense_Mutation_p.V435I			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	435	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)	p.V435I(1)		NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CATCCACACAGTCGCTTTGGG	0.502																																							uc001dlt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1303-1305)GTC>ATC		chloride channel accessory 1 precursor							87.0	84.0	85.0					1																	86954799		2203	4300	6503	SO:0001583	missense	1179				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	g.chr1:86954799G>A		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1303G>A	1.37:g.86954799G>A	ENSP00000234701:p.Val435Ile					CLCA1_uc001dls.1_Missense_Mutation_p.V374I	p.V435I	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN		all cancers(265;0.0249)|Epithelial(280;0.0476)	8	1432	+		Lung NSC(277;0.239)	435			VWFA.		B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	c.1303G>A	CCDS709.1	.	.	.	.	.	.	.	.	.	.	G	0.119	-1.128440	0.01756	.	.	ENSG00000016490	ENST00000234701;ENST00000394711;ENST00000539889	T;T	0.14266	2.52;2.52	5.68	4.76	0.60689	von Willebrand factor, type A (3);	0.069505	0.53938	D	0.000049	T	0.01627	0.0052	N	0.03194	-0.395	0.28357	N	0.920625	B;B	0.32396	0.369;0.174	B;B	0.38225	0.268;0.11	T	0.43015	-0.9417	10	0.02654	T	1	-18.4045	8.7558	0.34645	0.2286:0.0:0.7714:0.0	.	435;198	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	I	435;435;148	ENSP00000234701:V435I;ENSP00000378200:V435I	ENSP00000234701:V435I	V	+	1	0	CLCA1	86727387	0.998000	0.40836	0.627000	0.29227	0.087000	0.18053	3.810000	0.55613	1.390000	0.46547	0.655000	0.94253	GTC		0.502	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285		8	34	0	0	0	0.00308	0	8	34				
BCAS2	10286	broad.mit.edu	37	1	115124154	115124154	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:115124154T>C	ENST00000369541.3	-	1	106	c.59A>G	c.(58-60)gAt>gGt	p.D20G	BCAS2_ENST00000485021.1_5'UTR	NM_005872.2	NP_005863.1	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2	20					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cell junction (GO:0030054)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)		p.D20G(1)		biliary_tract(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)	13	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATAACCTTGATCAAAATACGG	0.547																																							uc001efa.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(58-60)GAT>GGT		breast carcinoma amplified sequence 2							80.0	73.0	76.0					1																	115124154		2203	4300	6503	SO:0001583	missense	10286				mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding	g.chr1:115124154T>C	AB020623	CCDS874.1	1p13.2	2010-01-25			ENSG00000116752	ENSG00000116752			975	protein-coding gene	gene with protein product		605783				9731529, 10403562	Standard	NM_005872		Approved	DAM1, SPF27, Snt309	uc001efa.3	O75934	OTTHUMG00000011898	ENST00000369541.3:c.59A>G	1.37:g.115124154T>C	ENSP00000358554:p.Asp20Gly					DENND2C_uc001eez.2_Intron	p.D20G	NM_005872	NP_005863	O75934	SPF27_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	1	112	-	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	20					Q6FGS0	Missense_Mutation	SNP	ENST00000369541.3	37	c.59A>G	CCDS874.1	.	.	.	.	.	.	.	.	.	.	T	34	5.332761	0.95733	.	.	ENSG00000116752	ENST00000369541	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.82655	0.5084	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86752	0.1961	9	0.87932	D	0	-12.0007	16.0822	0.81012	0.0:0.0:0.0:1.0	.	20	O75934	SPF27_HUMAN	G	20	.	ENSP00000358554:D20G	D	-	2	0	BCAS2	114925677	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.153000	0.77428	2.193000	0.70182	0.451000	0.29950	GAT		0.547	BCAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032871.1	NM_005872		8	19	0	0	0	0.006214	0	8	19				
DENND2C	163259	broad.mit.edu	37	1	115168229	115168229	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:115168229C>A	ENST00000393274.1	-	4	1002	c.377G>T	c.(376-378)aGc>aTc	p.S126I	DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393276.3_Missense_Mutation_p.S126I|DENND2C_ENST00000393277.1_Missense_Mutation_p.S126I	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	126					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S126I(1)		NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCTTTACAGCTTTCAATTTC	0.363																																							uc001efd.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(376-378)AGC>ATC		DENN/MADD domain containing 2C							82.0	82.0	82.0					1																	115168229		2203	4300	6503	SO:0001583	missense	163259							g.chr1:115168229C>A		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.377G>T	1.37:g.115168229C>A	ENSP00000376955:p.Ser126Ile					DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.S126I	p.S126I	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	4	1079	-	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	126					B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	37	c.377G>T	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	C	7.989	0.752943	0.15778	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.09350	3.64;3.66;2.99	5.78	1.77	0.24775	.	2.308990	0.00997	N	0.003605	T	0.03608	0.0103	L	0.40543	1.245	0.21579	N	0.999637	P;P	0.39131	0.661;0.483	B;B	0.37387	0.248;0.165	T	0.31475	-0.9942	10	0.72032	D	0.01	.	3.833	0.08882	0.0:0.4602:0.1769:0.3629	.	126;126	Q68D51;Q68D51-3	DEN2C_HUMAN;.	I	126	ENSP00000376957:S126I;ENSP00000376955:S126I;ENSP00000376958:S126I	ENSP00000358553:S126I	S	-	2	0	DENND2C	114969752	0.037000	0.19845	0.691000	0.30163	0.018000	0.09664	0.094000	0.15107	0.347000	0.23924	0.650000	0.86243	AGC		0.363	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459		11	85	1	0	6.40141e-05	0.010729	7.65967e-05	11	85				
FLG	2312	broad.mit.edu	37	1	152275876	152275876	+	Missense_Mutation	SNP	C	C	T	rs145079750	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:152275876C>T	ENST00000368799.1	-	3	11521	c.11486G>A	c.(11485-11487)cGt>cAt	p.R3829H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3829	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R3829H(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCATGGTGACGCGACCCTGA	0.587									Ichthyosis				C|||	7	0.00139776	0.0	0.0029	5008	,	,		19402	0.0		0.001	False		,,,				2504	0.0041						uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(11485-11487)CGT>CAT		filaggrin		C	HIS/ARG	0,4406		0,0,2203	286.0	284.0	284.0		11486	-3.2	0.0	1	dbSNP_134	284	12,8588	9.1+/-34.3	0,12,4288	no	missense	FLG	NM_002016.1	29	0,12,6491	TT,TC,CC		0.1395,0.0,0.0923	possibly-damaging	3829/4062	152275876	12,12994	2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152275876C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11486G>A	1.37:g.152275876C>T	ENSP00000357789:p.Arg3829His						p.R3829H	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	11522	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3829			Filaggrin 23.|Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.11486G>A	CCDS30860.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	11.20	1.569385	0.28003	0.0	0.001395	ENSG00000143631	ENST00000368799	T	0.02369	4.32	2.67	-3.19	0.05171	.	.	.	.	.	T	0.00906	0.0030	N	0.16130	0.375	0.09310	N	1	D	0.71674	0.998	P	0.55303	0.773	T	0.39014	-0.9634	9	0.12103	T	0.63	.	7.3122	0.26481	0.0:0.4566:0.0:0.5434	rs12733038	3829	P20930	FILA_HUMAN	H	3829	ENSP00000357789:R3829H	ENSP00000357789:R3829H	R	-	2	0	FLG	150542500	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.123000	0.00290	-0.643000	0.05473	-0.262000	0.10625	CGT		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		28	321	0	0	0	0.004878	0	28	321				
FLG	2312	broad.mit.edu	37	1	152275883	152275883	+	Missense_Mutation	SNP	C	C	A	rs140464988	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:152275883C>A	ENST00000368799.1	-	3	11514	c.11479G>T	c.(11479-11481)Ggg>Tgg	p.G3827W	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3827	Ser-rich.		G -> W (in dbSNP:rs12728908).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G3827W(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACGCGACCCTGAGTGCCTG	0.597									Ichthyosis				C|||	3	0.000599042	0.0	0.0029	5008	,	,		19901	0.0		0.001	False		,,,				2504	0.0						uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(11479-11481)GGG>TGG		filaggrin		C	TRP/GLY	0,4406		0,0,2203	304.0	302.0	303.0		11479	0.2	0.0	1	dbSNP_134	303	12,8588	9.1+/-34.3	0,12,4288	no	missense	FLG	NM_002016.1	184	0,12,6491	AA,AC,CC		0.1395,0.0,0.0923	possibly-damaging	3827/4062	152275883	12,12994	2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152275883C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11479G>T	1.37:g.152275883C>A	ENSP00000357789:p.Gly3827Trp						p.G3827W	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	11515	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3827			Filaggrin 23.|Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.11479G>T	CCDS30860.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	8.418	0.845737	0.16963	0.0	0.001395	ENSG00000143631	ENST00000368799	T	0.02552	4.25	2.67	0.217	0.15264	.	.	.	.	.	T	0.03915	0.0110	L	0.52126	1.63	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.38478	-0.9659	9	0.72032	D	0.01	.	8.461	0.32927	0.0:0.3783:0.6217:0.0	.	3827	P20930	FILA_HUMAN	W	3827	ENSP00000357789:G3827W	ENSP00000357789:G3827W	G	-	1	0	FLG	150542507	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.545000	0.06069	0.388000	0.25054	0.552000	0.68991	GGG		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		33	337	1	0	3.61848e-18	0.007835	6.29357e-18	33	337				
FLG	2312	broad.mit.edu	37	1	152282768	152282769	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:152282768_152282769GG>TT	ENST00000368799.1	-	3	4628_4629	c.4593_4594CC>AA	c.(4591-4596)tcCCat>tcAAat	p.H1532N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1532	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H1532N(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTGCCCATGGGAGGCATCAG	0.559									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(4591-4596)TCCCAT>TCAAAT		filaggrin																																				SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152282768_152282769GG>TT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4593_4594delinsTT	1.37:g.152282768_152282769delinsTT	ENSP00000357789:p.His1532Asn						p.H1532N	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4629_4630	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1532			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	DNP	ENST00000368799.1	37	c.4593_4594CC>AA	CCDS30860.1																																																																																				0.559	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		120	356	0	0	0	0.004672	0	120	356				
LCE2C	353140	broad.mit.edu	37	1	152648564	152648564	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:152648564C>A	ENST00000368783.1	+	2	128	c.73C>A	c.(73-75)Cca>Aca	p.P25T	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	25	Cys-rich.				keratinization (GO:0031424)			p.P25T(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			cccaaaatgtccacctaagtg	0.572																																							uc001fah.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)CCA>ACA		late cornified envelope 2C							111.0	118.0	116.0					1																	152648564		2203	4298	6501	SO:0001583	missense	353140				keratinization			g.chr1:152648564C>A		CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.73C>A	1.37:g.152648564C>A	ENSP00000357772:p.Pro25Thr						p.P25T	NM_178429	NP_848516	Q5TA81	LCE2C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	128	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		25			Cys-rich.			Missense_Mutation	SNP	ENST00000368783.1	37	c.73C>A	CCDS1019.1	.	.	.	.	.	.	.	.	.	.	C	0.778	-0.763278	0.02996	.	.	ENSG00000187180	ENST00000368783	T	0.03689	3.84	3.27	0.673	0.17941	.	.	.	.	.	T	0.01454	0.0047	M	0.64567	1.98	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.44081	-0.9351	9	0.87932	D	0	.	3.3252	0.07064	0.2261:0.5943:0.0:0.1796	.	25	Q5TA81	LCE2C_HUMAN	T	25	ENSP00000357772:P25T	ENSP00000357772:P25T	P	+	1	0	LCE2C	150915188	0.242000	0.23868	0.001000	0.08648	0.328000	0.28507	0.354000	0.20146	0.012000	0.14892	0.563000	0.77884	CCA		0.572	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	NM_178429		43	73	1	0	2.35958e-20	0.009718	4.2247e-20	43	73				
ARHGEF11	9826	broad.mit.edu	37	1	156955931	156955931	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:156955931G>A	ENST00000361409.2	-	2	809	c.67C>T	c.(67-69)Cca>Tca	p.P23S	RN7SL612P_ENST00000497704.2_RNA|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.P23S	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	23					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P23S(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TTGCGCTCTGGTGCAGAATCT	0.527																																							uc001fqo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9						c.(67-69)CCA>TCA		Rho guanine nucleotide exchange factor (GEF) 11							132.0	125.0	128.0					1																	156955931		2203	4300	6503	SO:0001583	missense	9826				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:156955931G>A	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.67C>T	1.37:g.156955931G>A	ENSP00000354644:p.Pro23Ser					ARHGEF11_uc001fqn.2_Missense_Mutation_p.P23S	p.P23S	NM_014784	NP_055599	O15085	ARHGB_HUMAN			2	1107	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		23					D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	c.67C>T	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929192	0.34096	.	.	ENSG00000132694	ENST00000368194;ENST00000361409	T;T	0.68331	-0.28;-0.32	4.6	3.56	0.40772	PDZ/DHR/GLGF (1);	0.135265	0.34156	N	0.004215	T	0.29850	0.0746	L	0.27053	0.805	0.80722	D	1	B;B	0.28378	0.209;0.161	B;B	0.24006	0.021;0.05	T	0.12091	-1.0561	10	0.27785	T	0.31	-5.1071	7.3207	0.26526	0.1007:0.1649:0.7344:0.0	.	23;23	O15085;O15085-2	ARHGB_HUMAN;.	S	23	ENSP00000357177:P23S;ENSP00000354644:P23S	ENSP00000354644:P23S	P	-	1	0	ARHGEF11	155222555	0.992000	0.36948	1.000000	0.80357	0.993000	0.82548	0.572000	0.23684	0.985000	0.38656	0.650000	0.86243	CCA		0.527	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236		36	64	0	0	0	0.00623	0	36	64				
CD5L	922	broad.mit.edu	37	1	157805822	157805822	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:157805822A>G	ENST00000368174.4	-	3	275	c.179T>C	c.(178-180)gTg>gCg	p.V60A	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	60	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.V60A(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCGGCACAACACAGCCACGTC	0.592																																							uc001frk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(178-180)GTG>GCG		CD5 molecule-like precursor							129.0	130.0	129.0					1																	157805822		2203	4300	6503	SO:0001583	missense	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157805822A>G	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.179T>C	1.37:g.157805822A>G	ENSP00000357156:p.Val60Ala						p.V60A	NM_005894	NP_005885	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	322	-	all_hematologic(112;0.0378)		60			SRCR 1.		A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	c.179T>C	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.441880	0.63067	.	.	ENSG00000073754	ENST00000368174	T	0.46819	0.86	4.85	4.85	0.62838	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.169109	0.28146	N	0.016430	T	0.71333	0.3327	H	0.95780	3.72	0.37398	D	0.912742	D	0.89917	1.0	D	0.77004	0.989	T	0.81322	-0.0985	10	0.87932	D	0	.	12.4384	0.55612	1.0:0.0:0.0:0.0	.	60	O43866	CD5L_HUMAN	A	60	ENSP00000357156:V60A	ENSP00000357156:V60A	V	-	2	0	CD5L	156072446	1.000000	0.71417	0.254000	0.24359	0.251000	0.25915	8.650000	0.91073	2.025000	0.59659	0.460000	0.39030	GTG		0.592	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		24	160	0	0	0	0.00278	0	24	160				
OR10R2	343406	broad.mit.edu	37	1	158450371	158450371	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:158450371G>T	ENST00000368152.1	+	1	704	c.704G>T	c.(703-705)tGt>tTt	p.C235F	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C235F(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CTGTTTATCTGTGTTTCTTAT	0.443																																							uc010pik.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|skin(1)	3						c.(703-705)TGT>TTT		olfactory receptor, family 10, subfamily R,							144.0	126.0	132.0					1																	158450371		2203	4300	6503	SO:0001583	missense	343406				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158450371G>T	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.704G>T	1.37:g.158450371G>T	ENSP00000357134:p.Cys235Phe					uc001fso.1_RNA	p.C235F	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN			1	704	+	all_hematologic(112;0.0378)		235			Helical; Name=5; (Potential).		Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	37	c.704G>T	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	g	0.024	-1.386529	0.01194	.	.	ENSG00000198965	ENST00000368152	T	0.00048	8.82	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.11673	0.155	0.09310	N	1	B	0.13594	0.008	B	0.20384	0.029	T	0.25606	-1.0127	9	0.15499	T	0.54	.	5.2014	0.15267	0.1039:0.0:0.6906:0.2055	.	235	Q8NGX6	O10R2_HUMAN	F	235	ENSP00000357134:C235F	ENSP00000357134:C235F	C	+	2	0	OR10R2	156716995	0.006000	0.16342	0.644000	0.29465	0.896000	0.52359	1.418000	0.34782	2.135000	0.66039	0.655000	0.94253	TGT		0.443	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472		50	65	1	0	6.08268e-21	0.01441	1.09309e-20	50	65				
CRP	1401	broad.mit.edu	37	1	159683541	159683541	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:159683541C>A	ENST00000255030.5	-	2	552	c.449G>T	c.(448-450)aGc>aTc	p.S150I	CRP_ENST00000473196.1_5'UTR|CRP_ENST00000368111.1_Intron|CRP_ENST00000368112.1_Intron|CRP_ENST00000368110.1_Intron|CRP_ENST00000437342.1_5'UTR|CRP_ENST00000343919.2_Intron	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	150	Pentaxin.				acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)	p.S150I(1)		breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	CAAGATGATGCTTGCTTCTGC	0.552																																							uc001ftw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(448-450)AGC>ATC		C-reactive protein, pentraxin-related precursor	Atorvastatin(DB01076)|Bezafibrate(DB01393)						257.0	257.0	257.0					1																	159683541		2203	4300	6503	SO:0001583	missense	1401				acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding	g.chr1:159683541C>A	M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.449G>T	1.37:g.159683541C>A	ENSP00000255030:p.Ser150Ile					CRP_uc001ftx.1_Intron|CRP_uc001fty.1_RNA	p.S150I	NM_000567	NP_000558	P02741	CRP_HUMAN			2	553	-	all_hematologic(112;0.0429)		150			Pentaxin.		A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Missense_Mutation	SNP	ENST00000255030.5	37	c.449G>T	CCDS30911.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239634	0.39598	.	.	ENSG00000132693	ENST00000255030	T	0.58652	0.32	4.73	-0.38	0.12490	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.770926	0.12667	N	0.449079	T	0.37100	0.0991	L	0.52573	1.65	0.19775	N	0.999956	B	0.31859	0.343	P	0.46718	0.525	T	0.50466	-0.8825	10	0.30854	T	0.27	-2.223	4.0023	0.09585	0.2846:0.4935:0.1285:0.0934	.	150	P02741	CRP_HUMAN	I	150	ENSP00000255030:S150I	ENSP00000255030:S150I	S	-	2	0	CRP	157950165	0.000000	0.05858	0.002000	0.10522	0.901000	0.52897	-0.360000	0.07622	0.041000	0.15688	0.650000	0.86243	AGC		0.552	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085553.1	NM_000567		80	293	1	0	3.05217e-42	0.01441	5.82905e-42	80	293				
TNR	7143	broad.mit.edu	37	1	175365799	175365799	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:175365799G>A	ENST00000367674.2	-	5	1829	c.1121C>T	c.(1120-1122)cCt>cTt	p.P374L	TNR_ENST00000263525.2_Missense_Mutation_p.P374L			Q92752	TENR_HUMAN	tenascin R	374	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.P374L(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CCAATCTCCAGGCACCCGCTG	0.592																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1120-1122)CCT>CTT		tenascin R precursor							80.0	72.0	75.0					1																	175365799		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175365799G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1121C>T	1.37:g.175365799G>A	ENSP00000356646:p.Pro374Leu					TNR_uc009wwu.1_Missense_Mutation_p.P374L|TNR_uc010pmz.1_Silent_p.A339A	p.P374L	NM_003285	NP_003276	Q92752	TENR_HUMAN			3	1202	-	Renal(580;0.146)		374			Fibronectin type-III 1.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.1121C>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	34	5.299366	0.95574	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.60040	0.22;0.22	5.96	5.96	0.96718	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80401	0.4616	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81623	-0.0849	10	0.66056	D	0.02	.	19.9958	0.97383	0.0:0.0:1.0:0.0	.	374	Q92752	TENR_HUMAN	L	374	ENSP00000356646:P374L;ENSP00000263525:P374L	ENSP00000263525:P374L	P	-	2	0	TNR	173632422	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.328000	0.79160	2.826000	0.97356	0.655000	0.94253	CCT		0.592	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		18	45	0	0	0	0.00499	0	18	45				
PAPPA2	60676	broad.mit.edu	37	1	176564173	176564173	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:176564173T>A	ENST00000367662.3	+	3	2597	c.1433T>A	c.(1432-1434)cTt>cAt	p.L478H	PAPPA2_ENST00000367661.3_Missense_Mutation_p.L478H	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	478	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L478H(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TACCCACGACTTGAGGTTCTC	0.537																																							uc001gkz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1432-1434)CTT>CAT		pappalysin 2 isoform 1							77.0	80.0	79.0					1																	176564173		1984	4165	6149	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176564173T>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1433T>A	1.37:g.176564173T>A	ENSP00000356634:p.Leu478His					PAPPA2_uc001gky.1_Missense_Mutation_p.L478H|PAPPA2_uc009www.2_RNA	p.L478H	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			3	2597	+			478			Metalloprotease.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1433T>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	T	6.450	0.451217	0.12223	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.33865	4.64;1.39	5.18	2.74	0.32292	.	0.966752	0.08547	N	0.929534	T	0.38506	0.1043	L	0.47716	1.5	0.09310	N	1	P;D	0.54397	0.836;0.966	P;P	0.46320	0.474;0.512	T	0.21690	-1.0238	10	0.39692	T	0.17	-0.2538	11.8733	0.52534	0.0:0.0:0.5373:0.4627	.	478;478	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	H	478	ENSP00000356634:L478H;ENSP00000356633:L478H	ENSP00000356633:L478H	L	+	2	0	PAPPA2	174830796	0.000000	0.05858	0.097000	0.21041	0.024000	0.10985	-0.086000	0.11233	0.258000	0.21686	0.528000	0.53228	CTT		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			30	57	0	0	0	0.009535	0	30	57				
CACNA1E	777	broad.mit.edu	37	1	181725204	181725204	+	Missense_Mutation	SNP	G	G	A	rs574530214		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:181725204G>A	ENST00000367573.2	+	29	4102	c.4102G>A	c.(4102-4104)Gtc>Atc	p.V1368I	CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1349I|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1349I|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V975I|CACNA1E_ENST00000357570.5_Missense_Mutation_p.V1319I|CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1368I|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V1300I	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1368					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.V1368I(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCTCTTCACCGTCTCCACAGG	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		18671	0.0		0.0	False		,,,				2504	0.001						uc001gow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(4102-4104)GTC>ATC		calcium channel, voltage-dependent, R type,							59.0	61.0	61.0					1																	181725204		2067	4224	6291	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181725204G>A	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4102G>A	1.37:g.181725204G>A	ENSP00000356545:p.Val1368Ile					CACNA1E_uc009wxs.2_Missense_Mutation_p.V1256I|CACNA1E_uc001gox.1_Missense_Mutation_p.V594I|CACNA1E_uc009wxt.2_Missense_Mutation_p.V594I	p.V1368I	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			29	4267	+			1368			Extracellular (Potential).|III.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.4102G>A	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509392	0.85282	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97620	-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46	5.6	5.6	0.85130	Ion transport (1);	0.053828	0.64402	D	0.000001	D	0.97614	0.9218	L	0.39397	1.21	0.80722	D	1	P;D;D	0.76494	0.769;0.968;0.999	P;P;D	0.76071	0.509;0.693;0.987	D	0.98487	1.0608	10	0.87932	D	0	.	19.5773	0.95450	0.0:0.0:1.0:0.0	.	1349;1368;1368	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	I	1368;1349;1319;1300;975;1349;1368	ENSP00000356542:V1368I;ENSP00000434814:V1349I;ENSP00000350183:V1319I;ENSP00000351101:V1300I;ENSP00000356539:V975I;ENSP00000353222:V1349I;ENSP00000356545:V1368I	ENSP00000350183:V1319I	V	+	1	0	CACNA1E	179991827	1.000000	0.71417	0.965000	0.40720	0.939000	0.58152	9.675000	0.98638	2.788000	0.95919	0.650000	0.86243	GTC		0.517	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		8	25	0	0	0	0.004482	0	8	25				
SWT1	54823	broad.mit.edu	37	1	185191096	185191096	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:185191096T>C	ENST00000367500.4	+	15	2402	c.2237T>C	c.(2236-2238)cTt>cCt	p.L746P	SWT1_ENST00000367501.3_Missense_Mutation_p.L746P	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	746								p.L746P(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						AGTTCTCATCTTCCCCAACCC	0.363																																							uc001grg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2236-2238)CTT>CCT		hypothetical protein LOC54823							158.0	168.0	165.0					1																	185191096		2203	4300	6503	SO:0001583	missense	54823							g.chr1:185191096T>C	AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.2237T>C	1.37:g.185191096T>C	ENSP00000356470:p.Leu746Pro					C1orf26_uc001grh.3_Missense_Mutation_p.L746P	p.L746P	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN			15	2351	+			746					Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	ENST00000367500.4	37	c.2237T>C	CCDS1367.1	.	.	.	.	.	.	.	.	.	.	T	2.590	-0.295471	0.05532	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.20881	2.04;2.04	5.33	1.66	0.24008	.	1.022280	0.07755	N	0.949208	T	0.13200	0.0320	N	0.19112	0.55	0.22601	N	0.998943	B	0.15141	0.012	B	0.12837	0.008	T	0.33854	-0.9852	10	0.49607	T	0.09	.	4.3653	0.11222	0.1366:0.2359:0.0:0.6275	.	746	Q5T5J6	SWT1_HUMAN	P	746	ENSP00000356471:L746P;ENSP00000356470:L746P	ENSP00000356470:L746P	L	+	2	0	SWT1	183457719	0.014000	0.17966	0.021000	0.16686	0.087000	0.18053	1.430000	0.34914	0.025000	0.15241	0.482000	0.46254	CTT		0.363	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673		32	241	0	0	0	0.012213	0	32	241				
HMCN1	83872	broad.mit.edu	37	1	186158963	186158963	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:186158963C>A	ENST00000271588.4	+	107	17090	c.16861C>A	c.(16861-16863)Cag>Aag	p.Q5621K	HMCN1_ENST00000367492.2_Missense_Mutation_p.Q5504K	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5621					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.Q5621K(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CATTGAATATCAGACCACATT	0.453																																							uc001grq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(22)|skin(1)	23						c.(16861-16863)CAG>AAG		hemicentin 1 precursor							122.0	111.0	115.0					1																	186158963		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186158963C>A	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16861C>A	1.37:g.186158963C>A	ENSP00000271588:p.Gln5621Lys					HMCN1_uc001grs.1_Missense_Mutation_p.Q1073K	p.Q5621K	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN			107	17090	+			5621					A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.16861C>A	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337441	0.81911	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.63580	-0.04;-0.05	5.91	5.91	0.95273	.	0.053017	0.85682	D	0.000000	T	0.62804	0.2458	M	0.71036	2.16	0.40377	D	0.979407	P	0.42456	0.78	B	0.34931	0.192	T	0.67726	-0.5596	10	0.46703	T	0.11	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	5621	Q96RW7	HMCN1_HUMAN	K	5621;5504	ENSP00000271588:Q5621K;ENSP00000356462:Q5504K	ENSP00000271588:Q5621K	Q	+	1	0	HMCN1	184425586	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.770000	0.85390	2.793000	0.96121	0.655000	0.94253	CAG		0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		13	97	1	0	0.00010058	0.013537	0.000118315	13	97				
RGS1	5996	broad.mit.edu	37	1	192545461	192545461	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:192545461G>T	ENST00000367459.3	+	2	250	c.184G>T	c.(184-186)Gaa>Taa	p.E62*	RGS1_ENST00000469578.2_Nonsense_Mutation_p.E62*	NM_002922.3	NP_002913.3	Q08116	RGS1_HUMAN	regulator of G-protein signaling 1	62					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|immune response (GO:0006955)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.E49*(1)|p.E62*(1)		kidney(8)|large_intestine(1)|lung(13)	22		Breast(1374;0.188)				CCCACATCTGGAATCTGGAAT	0.318																																							uc001gsi.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(184-186)GAA>TAA		regulator of G-protein signalling 1							79.0	79.0	79.0					1																	192545461		2203	4297	6500	SO:0001587	stop_gained	5996				immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of signal transduction	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:192545461G>T	AF493925	CCDS1375.2	1q31	2008-02-05	2007-08-14		ENSG00000090104	ENSG00000090104		"""Regulators of G-protein signaling"""	9991	protein-coding gene	gene with protein product		600323	"""regulator of G-protein signalling 1"""	IER1		8241276, 8602223	Standard	NM_002922		Approved	1R20, IR20, BL34	uc001gsi.1	Q08116	OTTHUMG00000035598	ENST00000367459.3:c.184G>T	1.37:g.192545461G>T	ENSP00000356429:p.Glu62*					RGS1_uc010pou.1_Nonsense_Mutation_p.E62*	p.E62*	NM_002922	NP_002913	Q08116	RGS1_HUMAN			2	250	+		Breast(1374;0.188)	62					B2RDM9|B4DZY0|Q07918|Q9H1W2	Nonsense_Mutation	SNP	ENST00000367459.3	37	c.184G>T	CCDS1375.2	.	.	.	.	.	.	.	.	.	.	G	35	5.489064	0.96323	.	.	ENSG00000090104	ENST00000367459	.	.	.	5.91	5.91	0.95273	.	0.810184	0.11122	N	0.597318	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	18.8623	0.92278	0.0:0.0:1.0:0.0	.	.	.	.	X	62	.	ENSP00000356429:E62X	E	+	1	0	RGS1	190812084	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.265000	0.65519	2.793000	0.96121	0.655000	0.94253	GAA		0.318	RGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086391.1	NM_002922		27	57	1	0	3.1745e-13	0.008361	5.00317e-13	27	57				
RGS1	5996	broad.mit.edu	37	1	192547461	192547461	+	Silent	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:192547461C>A	ENST00000367459.3	+	4	456	c.390C>A	c.(388-390)ccC>ccA	p.P130P	RGS1_ENST00000469578.2_Silent_p.P130P	NM_002922.3	NP_002913.3	Q08116	RGS1_HUMAN	regulator of G-protein signaling 1	130	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|immune response (GO:0006955)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.P130P(1)|p.P117P(1)		kidney(8)|large_intestine(1)|lung(13)	22		Breast(1374;0.188)				ATCTTTTGCCCTGTAAAGCAG	0.368																																							uc001gsi.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(388-390)CCC>CCA		regulator of G-protein signalling 1							151.0	156.0	154.0					1																	192547461		2203	4300	6503	SO:0001819	synonymous_variant	5996				immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of signal transduction	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:192547461C>A	AF493925	CCDS1375.2	1q31	2008-02-05	2007-08-14		ENSG00000090104	ENSG00000090104		"""Regulators of G-protein signaling"""	9991	protein-coding gene	gene with protein product		600323	"""regulator of G-protein signalling 1"""	IER1		8241276, 8602223	Standard	NM_002922		Approved	1R20, IR20, BL34	uc001gsi.1	Q08116	OTTHUMG00000035598	ENST00000367459.3:c.390C>A	1.37:g.192547461C>A						RGS1_uc010pou.1_Silent_p.P130P	p.P130P	NM_002922	NP_002913	Q08116	RGS1_HUMAN			4	456	+		Breast(1374;0.188)	130			RGS.		B2RDM9|B4DZY0|Q07918|Q9H1W2	Silent	SNP	ENST00000367459.3	37	c.390C>A	CCDS1375.2																																																																																				0.368	RGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086391.1	NM_002922		70	139	1	0	7.46257e-40	0.01441	1.41964e-39	70	139				
DENND1B	163486	broad.mit.edu	37	1	197621405	197621405	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:197621405T>A	ENST00000367396.3	-	7	576	c.407A>T	c.(406-408)cAc>cTc	p.H136L	DENND1B_ENST00000235453.4_Missense_Mutation_p.H126L|DENND1B_ENST00000400967.2_Missense_Mutation_p.H126L	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B	136	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.H126L(1)|p.H136L(1)		NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						TGGTACTGGGTGGTTATACAG	0.323																																							uc001guf.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(406-408)CAC>CTC		DENN/MADD domain containing 1B isoform 2							108.0	103.0	104.0					1																	197621405		1837	4083	5920	SO:0001583	missense	163486					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity	g.chr1:197621405T>A	BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.407A>T	1.37:g.197621405T>A	ENSP00000356366:p.His136Leu					DENND1B_uc010ppe.1_Missense_Mutation_p.H136L|DENND1B_uc010ppf.1_RNA|DENND1B_uc001gue.3_Missense_Mutation_p.H126L|DENND1B_uc001gug.3_5'UTR	p.H136L	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN			7	745	-			136			DENN.		B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Missense_Mutation	SNP	ENST00000367396.3	37	c.407A>T	CCDS41452.2	.	.	.	.	.	.	.	.	.	.	T	5.763	0.325084	0.10900	.	.	ENSG00000213047	ENST00000542760;ENST00000450419;ENST00000235453;ENST00000367396;ENST00000400967;ENST00000422998	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	5.43	5.43	0.79202	DENN (3);	0.077199	0.56097	D	0.000032	T	0.06917	0.0176	N	0.13327	0.33	0.54753	D	0.999982	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.12837	0.008;0.008;0.0	T	0.18840	-1.0324	10	0.07644	T	0.81	-13.1164	15.4884	0.75584	0.0:0.0:0.0:1.0	.	136;136;126	Q6P3S1-5;Q6P3S1;Q6P3S1-4	.;DEN1B_HUMAN;.	L	136;136;126;136;126;100	ENSP00000235453:H126L;ENSP00000356366:H136L;ENSP00000383751:H126L;ENSP00000410025:H100L	ENSP00000235453:H126L	H	-	2	0	DENND1B	195888028	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.712000	0.61888	2.073000	0.62155	0.533000	0.62120	CAC		0.323	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086539.1	NM_144977		11	47	0	0	0	0.010729	0	11	47				
LGR6	59352	broad.mit.edu	37	1	202245537	202245537	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:202245537C>A	ENST00000367278.3	+	5	621	c.532C>A	c.(532-534)Cct>Act	p.P178T	LGR6_ENST00000439764.2_Intron|LGR6_ENST00000255432.7_Missense_Mutation_p.P126T|LGR6_ENST00000308543.3_3'UTR	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	178					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)	p.P178T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						CACGGAGATCCCTGTCAGGGC	0.627																																							uc001gxu.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(532-534)CCT>ACT		leucine-rich repeat-containing G protein-coupled							80.0	62.0	68.0					1																	202245537		2203	4300	6503	SO:0001583	missense	59352					integral to membrane|plasma membrane	protein-hormone receptor activity	g.chr1:202245537C>A	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.532C>A	1.37:g.202245537C>A	ENSP00000356247:p.Pro178Thr					LGR6_uc001gxv.2_Missense_Mutation_p.P126T|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_RNA	p.P178T	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN			5	532	+			178			LRR 4.|Extracellular (Potential).		Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	37	c.532C>A	CCDS30971.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.905739	0.92107	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000367277;ENST00000423542	T;T;T	0.59772	0.24;0.24;1.52	5.07	5.07	0.68467	.	0.056908	0.64402	D	0.000001	T	0.74794	0.3763	M	0.64260	1.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77117	-0.2706	10	0.87932	D	0	.	18.6354	0.91376	0.0:1.0:0.0:0.0	.	126;178	Q9HBX8-2;Q9HBX8	.;LGR6_HUMAN	T	178;126;104;104	ENSP00000356247:P178T;ENSP00000255432:P126T;ENSP00000402284:P104T	ENSP00000255432:P126T	P	+	1	0	LGR6	200512160	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.608000	0.82898	2.632000	0.89209	0.637000	0.83480	CCT		0.627	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636		15	26	1	0	1.3612e-06	0.003163	1.78681e-06	15	26				
USH2A	7399	broad.mit.edu	37	1	216369927	216369927	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:216369927G>T	ENST00000307340.3	-	19	4605	c.4219C>A	c.(4219-4221)Cct>Act	p.P1407T	USH2A_ENST00000366942.3_Missense_Mutation_p.P1407T|USH2A_ENST00000366943.2_Missense_Mutation_p.P1407T|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1407	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.P1407T(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GACTGTTGAGGTGATTGTTCA	0.388										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(4219-4221)CCT>ACT		usherin isoform B							185.0	169.0	175.0					1																	216369927		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216369927G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4219C>A	1.37:g.216369927G>T	ENSP00000305941:p.Pro1407Thr	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.P1407T	p.P1407T	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	19	4606	-			1407			Extracellular (Potential).|Fibronectin type-III 4.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.4219C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	4.417	0.077024	0.08485	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.56611	0.45;0.45;0.45	5.96	3.88	0.44766	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.520312	0.15984	N	0.235167	T	0.36635	0.0974	L	0.40543	1.245	0.09310	N	1	B;B	0.20550	0.046;0.001	B;B	0.17979	0.02;0.008	T	0.25779	-1.0122	10	0.13470	T	0.59	.	4.6365	0.12527	0.2969:0.1557:0.5474:0.0	.	1407;1407	O75445-2;O75445	.;USH2A_HUMAN	T	1407	ENSP00000305941:P1407T;ENSP00000355910:P1407T;ENSP00000355909:P1407T	ENSP00000305941:P1407T	P	-	1	0	USH2A	214436550	0.004000	0.15560	0.002000	0.10522	0.229000	0.25112	0.559000	0.23485	0.678000	0.31325	0.655000	0.94253	CCT		0.388	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		32	89	1	0	1.45844e-13	0.013726	2.32871e-13	32	89				
OBSCN	84033	broad.mit.edu	37	1	228412410	228412410	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:228412410G>T	ENST00000422127.1	+	9	2948	c.2904G>T	c.(2902-2904)cgG>cgT	p.R968R	OBSCN_ENST00000570156.2_Silent_p.R1060R|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.R968R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	968	Ig-like 9.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.R968R(4)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGGGCCAGCGGCTCTCCTTCC	0.612																																							uc009xez.1		NA																	4	Substitution - coding silent(4)		lung(4)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(2902-2904)CGG>CGT		obscurin, cytoskeletal calmodulin and							29.0	33.0	32.0					1																	228412410		1991	4160	6151	SO:0001819	synonymous_variant	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228412410G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.2904G>T	1.37:g.228412410G>T						OBSCN_uc001hsn.2_Silent_p.R968R	p.R968R	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			9	2948	+		Prostate(94;0.0405)	968			Ig-like 9.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	c.2904G>T	CCDS58065.1																																																																																				0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		10	23	1	0	7.48243e-07	0.006214	9.87518e-07	10	23				
HEATR1	55127	broad.mit.edu	37	1	236746130	236746130	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:236746130C>A	ENST00000366582.3	-	19	2582	c.2468G>T	c.(2467-2469)aGg>aTg	p.R823M	HEATR1_ENST00000366581.2_Missense_Mutation_p.R823M	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	823					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.R823M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CAGATAGTCCCTGCTGTCTTC	0.423																																							uc001hyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2467-2469)AGG>ATG		protein BAP28							168.0	133.0	145.0					1																	236746130		2203	4300	6503	SO:0001583	missense	55127				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding	g.chr1:236746130C>A	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.2468G>T	1.37:g.236746130C>A	ENSP00000355541:p.Arg823Met					HEATR1_uc009xgh.1_Missense_Mutation_p.R66M	p.R823M	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)		19	2593	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	823					Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	c.2468G>T	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010348	0.75046	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.67171	3.47;-0.25	5.62	4.71	0.59529	Armadillo-type fold (1);	0.052810	0.85682	D	0.000000	T	0.71451	0.3341	M	0.67953	2.075	0.80722	D	1	D;D	0.63880	0.993;0.993	P;P	0.53185	0.72;0.641	T	0.73509	-0.3960	10	0.59425	D	0.04	.	9.1766	0.37116	0.0:0.7923:0.0:0.2077	.	823;823	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	M	823	ENSP00000355541:R823M;ENSP00000355540:R823M	ENSP00000355540:R823M	R	-	2	0	HEATR1	234812753	0.752000	0.28338	0.948000	0.38648	0.985000	0.73830	2.186000	0.42593	1.371000	0.46172	0.655000	0.94253	AGG		0.423	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		20	42	1	0	1.40151e-16	0.010504	2.36171e-16	20	42				
GREM2	64388	broad.mit.edu	37	1	240656615	240656615	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:240656615G>T	ENST00000318160.4	-	2	427	c.161C>A	c.(160-162)gCc>gAc	p.A54D		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	54					BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)	p.A54D(1)		endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CTGGCTGGAGGCCAGCACCTC	0.667																																							uc001hys.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(160-162)GCC>GAC		gremlin 2 precursor							37.0	39.0	38.0					1																	240656615		2203	4300	6503	SO:0001583	missense	64388				BMP signaling pathway	extracellular space	cytokine activity	g.chr1:240656615G>T	AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.161C>A	1.37:g.240656615G>T	ENSP00000318650:p.Ala54Asp						p.A54D	NM_022469	NP_071914	Q9H772	GREM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0123)		2	441	-		all_cancers(173;0.0196)	54					Q86UD9	Missense_Mutation	SNP	ENST00000318160.4	37	c.161C>A	CCDS31070.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253454	0.39797	.	.	ENSG00000180875	ENST00000318160	T	0.02323	4.34	5.03	4.12	0.48240	DAN (1);	0.071326	0.56097	U	0.000032	T	0.03095	0.0091	L	0.46157	1.445	0.52501	D	0.999955	B	0.09022	0.002	B	0.14578	0.011	T	0.43180	-0.9407	10	0.13853	T	0.58	-0.7638	8.7349	0.34523	0.0773:0.0:0.7748:0.1479	.	54	Q9H772	GREM2_HUMAN	D	54	ENSP00000318650:A54D	ENSP00000318650:A54D	A	-	2	0	GREM2	238723238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.393000	0.66279	1.104000	0.41587	0.557000	0.71058	GCC		0.667	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096286.1	NM_022469		7	33	1	0	1.06961e-07	0.00308	1.45911e-07	7	33				
ZBTB18	10472	broad.mit.edu	37	1	244218618	244218618	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:244218618G>A	ENST00000358704.4	+	2	1691	c.1542G>A	c.(1540-1542)ttG>ttA	p.L514L		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	505					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L505L(1)									CACTGAGCTTGCCTACTGTCA	0.388																																							uc001iae.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(2)	5						c.(1513-1515)TTG>TTA		zinc finger protein 238 isoform 2							86.0	89.0	88.0					1																	244218618		2203	4300	6503	SO:0001819	synonymous_variant	10472				negative regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:244218618G>A	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1542G>A	1.37:g.244218618G>A						ZNF238_uc001iad.3_Silent_p.L514L|ZNF238_uc001iaf.1_3'UTR	p.L505L	NM_006352	NP_006343	Q99592	ZN238_HUMAN	all cancers(7;1.35e-08)|GBM - Glioblastoma multiforme(7;1e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00223)		1	2037	+	all_cancers(71;6.42e-05)|all_epithelial(71;7e-05)|Breast(184;0.0333)|Ovarian(71;0.0619)|all_lung(81;0.089)|all_neural(11;0.101)|Lung NSC(105;0.123)		505					A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Silent	SNP	ENST00000358704.4	37	c.1515G>A	CCDS1622.1																																																																																				0.388	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768		21	87	0	0	0	0.003954	0	21	87				
ZNF124	7678	broad.mit.edu	37	1	247319988	247319988	+	Silent	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:247319988A>G	ENST00000543802.2	-	4	1025	c.936T>C	c.(934-936)caT>caC	p.H312H	ZNF124_ENST00000340684.6_Silent_p.H250H|ZNF124_ENST00000472531.1_Intron|ZNF124_ENST00000491356.1_Intron|ZNF124_ENST00000491848.1_5'Flank			Q15973	ZN124_HUMAN	zinc finger protein 124	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H250H(1)		biliary_tract(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(2)	14	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			TCTCTCCAGTATGAGTCCTTT	0.413																																							uc001ick.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(934-936)CAT>CAC		zinc finger protein 124							117.0	114.0	115.0					1																	247319988		2203	4300	6503	SO:0001819	synonymous_variant	7678				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:247319988A>G	S54641	CCDS31089.1, CCDS58067.1, CCDS73057.1	1q44	2013-01-08	2006-06-13		ENSG00000196418	ENSG00000196418		"""Zinc fingers, C2H2-type"", ""-"""	12907	protein-coding gene	gene with protein product		194631	"""zinc finger protein 124 (HZF-16)"""			7916577	Standard	XM_005273256		Approved	HZF16, HZF-16	uc001icj.1	Q15973	OTTHUMG00000041112	ENST00000543802.2:c.936T>C	1.37:g.247319988A>G						ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_Silent_p.H250H	p.H312H	NM_003431	NP_003422	Q15973	ZN124_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00739)		4	1075	-	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		312			C2H2-type 7.		B3KNP3|J3KSE1|Q15974|Q4VAJ7|Q5T2V4	Silent	SNP	ENST00000543802.2	37	c.936T>C																																																																																					0.413	ZNF124-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000447393.1	NM_003431		37	80	0	0	0	0.00874	0	37	80				
VN1R5	317705	broad.mit.edu	37	1	247419801	247419801	+	IGR	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:247419801A>G								RP11-488L18.8 (14676 upstream) : Y_RNA (38335 downstream)																							AGTGTGCTCCAGGCCATCATC	0.483																																						GBM(98;63 1399 4825 21305 33017)	uc010pyu.1		NA																	0					0						c.(427-429)CAG>CGG		vomeronasal 1 receptor 5							121.0	121.0	121.0					1																	247419801		2069	4216	6285	SO:0001628	intergenic_variant	317705				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr1:247419801A>G																													1.37:g.247419801A>G							p.Q143R	NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00854)		2	428	+	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	143			Helical; Name=4; (Potential).			Missense_Mutation	SNP		37	c.428A>G																																																																																				0	0.483									17	109	0	0	0	0.006122	0	17	109				
OR2B11	127623	broad.mit.edu	37	1	247614347	247614347	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:247614347C>A	ENST00000318749.6	-	1	961	c.938G>T	c.(937-939)tGg>tTg	p.W313L		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W313L(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			ACAGAGCCTCCAGATCCTGGC	0.458																																							uc010pyx.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(937-939)TGG>TTG		olfactory receptor, family 2, subfamily B,							196.0	207.0	203.0					1																	247614347		2203	4300	6503	SO:0001583	missense	127623				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247614347C>A		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.938G>T	1.37:g.247614347C>A	ENSP00000325682:p.Trp313Leu						p.W313L	NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	938	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	313			Cytoplasmic (Potential).		B2RP03	Missense_Mutation	SNP	ENST00000318749.6	37	c.938G>T	CCDS31090.1	.	.	.	.	.	.	.	.	.	.	C	5.058	0.196300	0.09599	.	.	ENSG00000177535	ENST00000318749	T	0.35048	1.33	4.85	4.85	0.62838	.	1.042050	0.07603	N	0.923939	T	0.21962	0.0529	N	0.03608	-0.345	0.09310	N	1	B	0.20887	0.049	B	0.16722	0.016	T	0.08166	-1.0735	10	0.26408	T	0.33	.	15.8723	0.79129	0.0:1.0:0.0:0.0	.	313	Q5JQS5	OR2BB_HUMAN	L	313	ENSP00000325682:W313L	ENSP00000325682:W313L	W	-	2	0	OR2B11	245680970	0.002000	0.14202	0.050000	0.19076	0.150000	0.21749	1.353000	0.34045	2.702000	0.92279	0.643000	0.83706	TGG		0.458	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		96	298	1	0	4.04957e-52	0.01441	7.76434e-52	96	298				
OR1C1	26188	broad.mit.edu	37	1	247921653	247921653	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:247921653C>A	ENST00000408896.2	-	1	329	c.56G>T	c.(55-57)aGc>aTc	p.S19I		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	19					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S19I(2)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CTCTGCTGAGCTAGGAAGTCC	0.423																																							uc010pza.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(55-57)AGC>ATC		olfactory receptor, family 1, subfamily C,							50.0	49.0	50.0					1																	247921653		2031	4180	6211	SO:0001583	missense	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921653C>A	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.56G>T	1.37:g.247921653C>A	ENSP00000386138:p.Ser19Ile						p.S19I	NM_012353	NP_036485	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	56	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	19			Extracellular (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	c.56G>T	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	C	9.433	1.086144	0.20390	.	.	ENSG00000221888	ENST00000408896	T	0.00438	7.42	3.03	-6.06	0.02165	.	.	.	.	.	T	0.00412	0.0013	M	0.64567	1.98	0.09310	N	1	P	0.45011	0.848	P	0.47075	0.536	T	0.01416	-1.1360	9	0.30078	T	0.28	.	5.8498	0.18685	0.4283:0.1006:0.0:0.4711	.	19	Q15619	OR1C1_HUMAN	I	19	ENSP00000386138:S19I	ENSP00000386138:S19I	S	-	2	0	OR1C1	245988276	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.821000	0.04452	-2.583000	0.00461	-0.142000	0.14014	AGC		0.423	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			7	19	1	0	2.0095e-06	0.001984	2.59582e-06	7	19				
OR2T2	401992	broad.mit.edu	37	1	248616419	248616419	+	Silent	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr1:248616419C>A	ENST00000342927.3	+	1	343	c.321C>A	c.(319-321)acC>acA	p.T107T		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T107T(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTACCTGACCCTGATTGGAG	0.547																																							uc001iek.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(319-321)ACC>ACA		olfactory receptor, family 2, subfamily T,							244.0	268.0	260.0					1																	248616419		2203	4300	6503	SO:0001819	synonymous_variant	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616419C>A	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.321C>A	1.37:g.248616419C>A							p.T107T	NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	321	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		107			Helical; Name=3; (Potential).		B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	c.321C>A	CCDS31116.1																																																																																				0.547	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		31	162	1	0	1.99505e-19	0.012213	3.54595e-19	31	162				
FAM208B	54906	broad.mit.edu	37	10	5781857	5781857	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:5781857C>A	ENST00000328090.5	+	13	2349	c.1724C>A	c.(1723-1725)tCt>tAt	p.S575Y	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	575								p.S575Y(1)									AAAGAAAATTCTTTGCGAGGT	0.378																																							uc001iij.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1723-1725)TCT>TAT		hypothetical protein LOC54906							84.0	78.0	80.0					10																	5781857		1838	4087	5925	SO:0001583	missense	54906							g.chr10:5781857C>A	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.1724C>A	10.37:g.5781857C>A	ENSP00000328426:p.Ser575Tyr					C10orf18_uc001iik.2_Intron	p.S575Y	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN			13	2349	+			575					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	c.1724C>A	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.153422	0.38021	.	.	ENSG00000108021	ENST00000328090	D	0.97906	-4.6	5.7	2.67	0.31697	.	0.799060	0.11516	N	0.556185	D	0.97542	0.9195	L	0.50333	1.59	0.09310	N	1	D	0.61080	0.989	D	0.65323	0.934	D	0.92084	0.5675	10	0.62326	D	0.03	.	8.4109	0.32642	0.0:0.6255:0.2943:0.0802	.	575	Q5VWN6	F208B_HUMAN	Y	575	ENSP00000328426:S575Y	ENSP00000328426:S575Y	S	+	2	0	C10orf18	5821863	0.011000	0.17503	0.011000	0.14972	0.350000	0.29205	1.611000	0.36879	0.745000	0.32763	0.491000	0.48974	TCT		0.378	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		16	118	1	0	5.03518e-11	0.007413	7.59175e-11	16	118				
USP6NL	9712	broad.mit.edu	37	10	11505455	11505455	+	Nonsense_Mutation	SNP	G	G	T	rs35440878		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:11505455G>T	ENST00000609104.1	-	15	1866	c.1472C>A	c.(1471-1473)tCa>tAa	p.S491*	USP6NL_ENST00000277575.5_Nonsense_Mutation_p.S508*|USP6NL_ENST00000379237.2_Nonsense_Mutation_p.S514*	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	491					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.S508*(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						TGAGACGTCTGACGGTTTATT	0.527																																							uc001ikt.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1471-1473)TCA>TAA		USP6 N-terminal like isoform 1							203.0	199.0	201.0					10																	11505455		2009	4186	6195	SO:0001587	stop_gained	9712					intracellular	Rab GTPase activator activity	g.chr10:11505455G>T	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1472C>A	10.37:g.11505455G>T	ENSP00000476462:p.Ser491*					USP6NL_uc001iks.1_Nonsense_Mutation_p.S508*	p.S491*	NM_014688	NP_055503	Q92738	US6NL_HUMAN			15	1793	-			491					A8KA79|Q15400|Q5VV10|Q7L0K9	Nonsense_Mutation	SNP	ENST00000609104.1	37	c.1472C>A	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	G	37	6.362876	0.97507	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	.	.	.	5.47	5.47	0.80525	.	0.160063	0.41396	D	0.000894	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.7017	0.96057	0.0:0.0:1.0:0.0	.	.	.	.	X	491;508;491	.	ENSP00000277575:S508X	S	-	2	0	USP6NL	11545461	1.000000	0.71417	0.527000	0.27925	0.008000	0.06430	4.868000	0.63021	2.724000	0.93272	0.561000	0.74099	TCA		0.527	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688		23	143	1	0	1.55469e-16	0.00333	2.61081e-16	23	143				
CUBN	8029	broad.mit.edu	37	10	16955844	16955844	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:16955844G>T	ENST00000377833.4	-	48	7564	c.7499C>A	c.(7498-7500)gCc>gAc	p.A2500D		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2500	CUB 18. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A2500D(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CGGATGCGTGGCCAGCCTCAG	0.502																																							uc001ioo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(7498-7500)GCC>GAC		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						148.0	133.0	138.0					10																	16955844		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16955844G>T	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7499C>A	10.37:g.16955844G>T	ENSP00000367064:p.Ala2500Asp						p.A2500D	NM_001081	NP_001072	O60494	CUBN_HUMAN			48	7551	-			2500			CUB 18.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.7499C>A	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	6.598	0.478670	0.12521	.	.	ENSG00000107611	ENST00000377833	T	0.27557	1.66	5.41	-2.04	0.07343	CUB (5);	1.312740	0.05265	N	0.516435	T	0.11024	0.0269	N	0.01809	-0.71	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.26950	-1.0088	10	0.17832	T	0.49	.	6.8571	0.24046	0.0:0.2757:0.3252:0.3991	.	2500	O60494	CUBN_HUMAN	D	2500	ENSP00000367064:A2500D	ENSP00000367064:A2500D	A	-	2	0	CUBN	16995850	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.007000	0.13174	-0.290000	0.09025	-0.485000	0.04761	GCC		0.502	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		28	66	1	0	9.65021e-13	0.010818	1.5063e-12	28	66				
CCDC7	79741	broad.mit.edu	37	10	33135305	33135305	+	Splice_Site	SNP	G	G	T	rs144109242		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:33135305G>T	ENST00000375030.2	+	18	1830	c.1212G>T	c.(1210-1212)gaG>gaT	p.E404D	C10orf68_ENST00000375025.4_Splice_Site_p.E509D|C10orf68_ENST00000375028.3_Splice_Site_p.E449D			Q9H943	CJ068_HUMAN		445								p.E445D(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						ATTCTATAGAGACTGATAAAG	0.284																																							uc001iwn.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1333-1335)GAG>GAT		chromosome 10 open reading frame 68							36.0	41.0	39.0					10																	33135305		2193	4271	6464	SO:0001630	splice_region_variant	79741							g.chr10:33135305G>T																												ENST00000375030.2:c.1211-1G>T	10.37:g.33135305G>T						C10orf68_uc001iwl.1_Missense_Mutation_p.E404D|C10orf68_uc001iwm.1_Missense_Mutation_p.E449D|C10orf68_uc010qei.1_Missense_Mutation_p.E421D|C10orf68_uc001iwo.3_RNA	p.E445D	NM_024688	NP_078964	Q9H943	CJ068_HUMAN			17	1808	+			445					B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	ENST00000375030.2	37	c.1335G>T		.	.	.	.	.	.	.	.	.	.	.	8.840	0.942098	0.18281	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.29917	1.57;1.72;1.55;1.55	2.21	1.29	0.21616	.	.	.	.	.	T	0.25531	0.0621	M	0.62723	1.935	0.09310	N	1	B;B;B;D	0.58620	0.0;0.0;0.0;0.983	B;B;B;B	0.42282	0.001;0.001;0.002;0.382	T	0.15122	-1.0448	9	0.20519	T	0.43	.	4.8255	0.13414	0.1842:0.0:0.8158:0.0	.	426;445;449;404	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	D	445;404;449;509;421	ENSP00000303710:E445D;ENSP00000364170:E404D;ENSP00000364168:E449D;ENSP00000364165:E509D	ENSP00000303710:E445D	E	+	3	2	C10orf68	33175311	0.000000	0.05858	0.062000	0.19696	0.279000	0.26890	-3.796000	0.00364	0.486000	0.27676	-0.397000	0.06425	GAG		0.284	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2		Missense_Mutation	7	45	1	0	8.12818e-05	0.001984	9.60783e-05	7	45				
ITGB1	3688	broad.mit.edu	37	10	33209284	33209284	+	Silent	SNP	G	G	A	rs199940049		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:33209284G>A	ENST00000396033.2	-	10	1293	c.1158C>T	c.(1156-1158)aaC>aaT	p.N386N	ITGB1_ENST00000302278.3_Silent_p.N386N|ITGB1_ENST00000374956.4_Silent_p.N386N|ITGB1_ENST00000423113.1_Silent_p.N386N	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	386				EN -> DG (in Ref. 6; AAI13902). {ECO:0000305}.	axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)	p.N386N(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	ACAATTTGCCGTTTTCCAAAA	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		16399	0.001		0.0	False		,,,				2504	0.0						uc001iws.3		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1156-1158)AAC>AAT		integrin beta 1 isoform 1A precursor							121.0	106.0	111.0					10																	33209284		2203	4300	6503	SO:0001819	synonymous_variant	3688				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity	g.chr10:33209284G>A	BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.1158C>T	10.37:g.33209284G>A						ITGB1_uc001iwp.3_Silent_p.N386N|ITGB1_uc001iwq.3_Silent_p.N386N|ITGB1_uc001iwr.3_Silent_p.N386N|ITGB1_uc001iwt.3_Silent_p.N386N|ITGB1_uc001iwu.1_Silent_p.N386N	p.N386N	NM_133376	NP_596867	P05556	ITB1_HUMAN			10	1294	-		Ovarian(717;1.34e-05)|Breast(68;0.0634)	386	EN -> DG (in Ref. 6; AAI13902).		Extracellular (Potential).		A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Silent	SNP	ENST00000396033.2	37	c.1158C>T	CCDS7174.1																																																																																				0.363	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211		17	45	0	0	0	0.004007	0	17	45				
GDF2	2658	broad.mit.edu	37	10	48414122	48414122	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:48414122C>G	ENST00000249598.1	-	2	905	c.746G>C	c.(745-747)aGa>aCa	p.R249T		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	249					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R249T(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						GGGCAGGTTTCTGGAACCTGG	0.557																																							uc001jfa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(745-747)AGA>ACA		growth differentiation factor 2 precursor							75.0	70.0	72.0					10																	48414122		2203	4300	6503	SO:0001583	missense	2658				activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr10:48414122C>G	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.746G>C	10.37:g.48414122C>G	ENSP00000249598:p.Arg249Thr						p.R249T	NM_016204	NP_057288	Q9UK05	GDF2_HUMAN			2	909	-			249					Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	37	c.746G>C	CCDS7219.1	.	.	.	.	.	.	.	.	.	.	C	7.574	0.667327	0.14710	.	.	ENSG00000128802	ENST00000249598	T	0.64803	-0.12	5.67	2.05	0.26809	Transforming growth factor-beta, N-terminal (1);	0.379713	0.34603	N	0.003826	T	0.44117	0.1278	N	0.22421	0.69	0.19775	N	0.999953	B	0.17852	0.024	B	0.21917	0.037	T	0.29610	-1.0006	10	0.39692	T	0.17	.	7.7973	0.29154	0.0:0.2437:0.0:0.7563	.	249	Q9UK05	GDF2_HUMAN	T	249	ENSP00000249598:R249T	ENSP00000249598:R249T	R	-	2	0	GDF2	48034128	1.000000	0.71417	0.122000	0.21767	0.182000	0.23217	1.454000	0.35178	0.100000	0.17581	-0.373000	0.07131	AGA		0.557	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204		5	27	0	0	0	0.000602	0	5	27				
GDF2	2658	broad.mit.edu	37	10	48416440	48416440	+	Missense_Mutation	SNP	G	G	A	rs199804679	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:48416440G>A	ENST00000249598.1	-	1	413	c.254C>T	c.(253-255)cCg>cTg	p.P85L		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	85			P -> L (in HHT5; impaired protein processing and function). {ECO:0000269|PubMed:23972370}.		activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.P85L(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						GTACTGCGGCGGCTCCACCCT	0.542													G|||	2	0.000399361	0.0	0.0014	5008	,	,		17837	0.0		0.0	False		,,,				2504	0.001						uc001jfa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(253-255)CCG>CTG		growth differentiation factor 2 precursor							96.0	83.0	88.0					10																	48416440		2203	4300	6503	SO:0001583	missense	2658				activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr10:48416440G>A	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.254C>T	10.37:g.48416440G>A	ENSP00000249598:p.Pro85Leu						p.P85L	NM_016204	NP_057288	Q9UK05	GDF2_HUMAN			1	417	-			85					Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	37	c.254C>T	CCDS7219.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	33	5.241094	0.95272	.	.	ENSG00000128802	ENST00000249598	T	0.65549	-0.16	5.37	5.37	0.77165	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80919	0.4716	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79697	-0.1695	10	0.35671	T	0.21	.	18.4454	0.90682	0.0:0.0:1.0:0.0	.	85	Q9UK05	GDF2_HUMAN	L	85	ENSP00000249598:P85L	ENSP00000249598:P85L	P	-	2	0	GDF2	48036446	1.000000	0.71417	0.964000	0.40570	0.860000	0.49131	9.570000	0.98174	2.676000	0.91093	0.655000	0.94253	CCG		0.542	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204		6	42	0	0	0	0.00308	0	6	42				
JMJD1C	221037	broad.mit.edu	37	10	64968213	64968213	+	Silent	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:64968213G>C	ENST00000399262.2	-	10	3434	c.3216C>G	c.(3214-3216)cgC>cgG	p.R1072R	JMJD1C_ENST00000399251.1_Silent_p.R853R|JMJD1C_ENST00000542921.1_Silent_p.R890R|JMJD1C_ENST00000402544.1_Silent_p.R853R	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1072					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.R853R(1)|p.R1072R(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTGATACTGAGCGTTCTACAT	0.398																																							uc001jmn.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|breast(1)|central_nervous_system(1)	6						c.(3214-3216)CGC>CGG		jumonji domain containing 1C isoform a							210.0	196.0	201.0					10																	64968213		1873	4116	5989	SO:0001819	synonymous_variant	221037				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding	g.chr10:64968213G>C	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.3216C>G	10.37:g.64968213G>C						JMJD1C_uc001jml.2_Silent_p.R853R|JMJD1C_uc001jmm.2_Silent_p.R784R|JMJD1C_uc010qiq.1_Silent_p.R890R|JMJD1C_uc009xpi.2_Silent_p.R890R|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc009xpk.1_Silent_p.R109R	p.R1072R	NM_032776	NP_116165	Q15652	JHD2C_HUMAN			10	3516	-	Prostate(12;0.0119)|all_hematologic(501;0.191)		1072					A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	37	c.3216C>G	CCDS41532.1																																																																																				0.398	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241		29	196	0	0	0	0.007291	0	29	196				
ECD	11319	broad.mit.edu	37	10	74899485	74899485	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:74899485T>A	ENST00000372979.4	-	10	1344	c.1138A>T	c.(1138-1140)Atg>Ttg	p.M380L	ECD_ENST00000454759.2_Missense_Mutation_p.M337L|ECD_ENST00000430082.2_Missense_Mutation_p.M413L	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	380					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.M380L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					CCAGGGCTCATAGCAAGAGAA	0.323																																							uc001jtn.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1138-1140)ATG>TTG		suppressor of S. cerevisiae gcr2 isoform 1							151.0	165.0	160.0					10																	74899485		2203	4300	6503	SO:0001583	missense	11319				regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity	g.chr10:74899485T>A	BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.1138A>T	10.37:g.74899485T>A	ENSP00000362070:p.Met380Leu					ECD_uc009xqx.2_Missense_Mutation_p.M413L|ECD_uc009xqy.2_Missense_Mutation_p.M337L|ECD_uc001jto.2_Missense_Mutation_p.M79L	p.M380L	NM_007265	NP_009196	O95905	SGT1_HUMAN			10	1381	-	Prostate(51;0.0119)		380					C9JX46|E9PAW8	Missense_Mutation	SNP	ENST00000372979.4	37	c.1138A>T	CCDS7321.1	.	.	.	.	.	.	.	.	.	.	T	6.423	0.446140	0.12164	.	.	ENSG00000122882	ENST00000372979;ENST00000430082;ENST00000454759	T;T;T	0.16457	2.34;2.34;2.34	4.78	-0.608	0.11611	.	0.469748	0.24708	N	0.036255	T	0.03477	0.0100	N	0.01277	-0.915	0.28124	N	0.930472	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.42085	-0.9472	10	0.02654	T	1	-9.0864	5.4785	0.16710	0.0:0.1948:0.4891:0.3161	.	337;413;380	E9PAW8;C9JX46;O95905	.;.;SGT1_HUMAN	L	380;413;337	ENSP00000362070:M380L;ENSP00000401566:M413L;ENSP00000395786:M337L	ENSP00000362070:M380L	M	-	1	0	ECD	74569491	0.025000	0.19082	0.994000	0.49952	0.936000	0.57629	-0.652000	0.05366	-0.009000	0.14296	-0.313000	0.08912	ATG		0.323	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048606.1	NM_007265		75	167	0	0	0	0.01441	0	75	167				
CFAP70	118491	broad.mit.edu	37	10	75029452	75029452	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:75029452C>A	ENST00000310715.3	-	26	3277	c.3157G>T	c.(3157-3159)Gag>Tag	p.E1053*	TTC18_ENST00000355577.3_Nonsense_Mutation_p.E522*|TTC18_ENST00000394865.1_Nonsense_Mutation_p.E1023*|TTC18_ENST00000493787.1_Intron|DNAJC9-AS1_ENST00000440197.2_RNA|TTC18_ENST00000401621.2_Nonsense_Mutation_p.E1053*|TTC18_ENST00000340329.3_Nonsense_Mutation_p.E293*	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		1053						extracellular vesicular exosome (GO:0070062)		p.E1053*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					AGAGCATCCTCAGCCTCTGTG	0.423																																							uc009xrc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(3157-3159)GAG>TAG		tetratricopeptide repeat domain 18							133.0	110.0	117.0					10																	75029452		2203	4300	6503	SO:0001587	stop_gained	118491						binding	g.chr10:75029452C>A																												ENST00000310715.3:c.3157G>T	10.37:g.75029452C>A	ENSP00000310829:p.Glu1053*					TTC18_uc001jty.2_Nonsense_Mutation_p.E1053*|TTC18_uc001jtv.3_Nonsense_Mutation_p.E157*|TTC18_uc001jtw.3_Nonsense_Mutation_p.E127*|TTC18_uc001jtx.2_Nonsense_Mutation_p.E404*	p.E1053*	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN			26	3278	-	Prostate(51;0.0119)		1053			TPR 7.		C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Nonsense_Mutation	SNP	ENST00000310715.3	37	c.3157G>T	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	C	41	8.964614	0.99019	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000340329;ENST00000433268;ENST00000394865	.	.	.	5.96	5.96	0.96718	.	0.056069	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	0.5076	17.8865	0.88856	0.0:1.0:0.0:0.0	.	.	.	.	X	1053;1053;1053;293;430;1023	.	ENSP00000310829:E1053X	E	-	1	0	TTC18	74699458	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.287000	0.72671	2.823000	0.97156	0.655000	0.94253	GAG		0.423	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				6	36	1	0	0.00198382	0.001984	0.0022108	6	36				
GHITM	27069	broad.mit.edu	37	10	85904649	85904649	+	Silent	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:85904649C>G	ENST00000372134.3	+	5	553	c.360C>G	c.(358-360)gtC>gtG	p.V120V		NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	120					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.V120V(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						CTCAGTATGTCAAGGATAGAA	0.408																																							uc001kcs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(358-360)GTC>GTG		growth hormone inducible transmembrane protein							146.0	135.0	138.0					10																	85904649		1896	4113	6009	SO:0001819	synonymous_variant	27069				apoptosis	integral to membrane|mitochondrial inner membrane		g.chr10:85904649C>G	AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.360C>G	10.37:g.85904649C>G						GHITM_uc010qma.1_Intron|GHITM_uc010qmb.1_Silent_p.V50V	p.V120V	NM_014394	NP_055209	Q9H3K2	GHITM_HUMAN			5	564	+			120			Mitochondrial intermembrane (Potential).		A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Silent	SNP	ENST00000372134.3	37	c.360C>G	CCDS41542.1																																																																																				0.408	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049125.1	NM_014394		9	86	0	0	0	0.006214	0	9	86				
GRID1	2894	broad.mit.edu	37	10	87407154	87407155	+	Splice_Site	DNP	CC	CC	AA			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:87407154_87407155CC>AA	ENST00000327946.7	-	13	2083	c.1998_1998GG>TT	c.(1996-1998)agGG>agTTg	p.R666S	GRID1_ENST00000536331.1_Splice_Site_p.R237S|RP11-93H12.4_ENST00000474115.2_RNA|RN7SKP238_ENST00000516483.1_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	666					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.?(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CCTGGAAAGTCCTGAAATGCAG	0.53										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	1	Unknown(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.e13-1		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)																																			SO:0001630	splice_region_variant	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87407154_87407155CC>AA	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1998_1998delinsAA	10.37:g.87407154_87407155delinsAA		Multiple Myeloma(13;0.14)				GRID1_uc009xsu.1_Splice_Site|GRID1_uc010qmf.1_Splice_Site_p.R237_splice|uc001kdm.1_RNA	p.R666_splice	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN			13	2099	-								B3KXD5|B7Z7L0|Q8IXT3	Splice_Site	DNP	ENST00000327946.7	37	c.1998_splice	CCDS31236.1																																																																																				0.530	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	Missense_Mutation	20	105	0	0	0	0.004672	0	20	105				
BTAF1	9044	broad.mit.edu	37	10	93788545	93788545	+	Splice_Site	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:93788545A>T	ENST00000265990.6	+	38	5714		c.e38-1		BTAF1_ENST00000544642.1_Splice_Site	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa						negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				ATTTTTCTTAAGGATGGCAAA	0.308																																							uc001khr.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.e38-2		BTAF1 RNA polymerase II, B-TFIID transcription							40.0	41.0	41.0					10																	93788545		2203	4299	6502	SO:0001630	splice_region_variant	9044				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	g.chr10:93788545A>T	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.5407-1A>T	10.37:g.93788545A>T							p.D1803_splice	NM_003972	NP_003963	O14981	BTAF1_HUMAN			38	5505	+		Colorectal(252;0.0846)						B4E0W6|O43578	Splice_Site	SNP	ENST00000265990.6	37	c.5407_splice	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	A	15.72	2.916690	0.52546	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2859	0.73828	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BTAF1	93778525	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	5.842000	0.69417	2.259000	0.74868	0.482000	0.46254	.		0.308	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	Intron	4	42	0	0	0	0.009096	0	4	42				
TLL2	7093	broad.mit.edu	37	10	98192670	98192671	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:98192670_98192671GG>AT	ENST00000357947.3	-	4	638_639	c.413_414CC>AT	c.(412-414)gCC>gAT	p.A138D	TLL2_ENST00000469598.1_Intron	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	138					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A138D(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TCTTGGCTGCGGCATGCAAGGT	0.55																																							uc001kml.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(412-414)GCC>GAT		tolloid-like 2 precursor																																				SO:0001583	missense	7093				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:98192670_98192671GG>AT	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.413_414delinsAT	10.37:g.98192670_98192671delinsAT	ENSP00000350630:p.Ala138Asp					TLL2_uc009xvf.1_Intron	p.A138D	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	4	639_640	-		Colorectal(252;0.0846)	138					A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	DNP	ENST00000357947.3	37	c.413_414CC>AT	CCDS7449.1																																																																																				0.550	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			13	44	0	0	0	0.004672	0	13	44				
HPSE2	60495	broad.mit.edu	37	10	100995342	100995342	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:100995342G>C	ENST00000370552.3	-	1	277	c.218C>G	c.(217-219)aCa>aGa	p.T73R	HPSE2_ENST00000370549.1_Missense_Mutation_p.T73R|HPSE2_ENST00000404542.1_Missense_Mutation_p.T73R|HPSE2_ENST00000370546.1_Missense_Mutation_p.T73R	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	73					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)	p.T73R(2)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CTCATTGACTGTCCTGACTGG	0.502																																							uc001kpn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(217-219)ACA>AGA		heparanase 2							179.0	176.0	177.0					10																	100995342		2203	4300	6503	SO:0001583	missense	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100995342G>C	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.218C>G	10.37:g.100995342G>C	ENSP00000359583:p.Thr73Arg					HPSE2_uc009xwc.1_Missense_Mutation_p.T63R|HPSE2_uc001kpo.1_Missense_Mutation_p.T63R|HPSE2_uc009xwd.1_Missense_Mutation_p.T63R	p.T73R	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	1	278	-			73					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	c.218C>G	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824013	0.32237	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.00473	7.18;7.18;7.18;7.18	5.8	5.8	0.92144	.	0.186923	0.46758	D	0.000269	T	0.00356	0.0011	N	0.19112	0.55	0.26142	N	0.98027	P;P;P;P	0.49559	0.899;0.899;0.925;0.838	P;P;P;B	0.44990	0.466;0.466;0.466;0.276	T	0.68379	-0.5424	10	0.17369	T	0.5	-9.094	11.0303	0.47769	0.1112:0.0:0.8888:0.0	.	73;73;73;73	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	R	73	ENSP00000359583:T73R;ENSP00000359580:T73R;ENSP00000359577:T73R;ENSP00000384384:T73R	ENSP00000359577:T73R	T	-	2	0	HPSE2	100985332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.189000	0.58358	2.758000	0.94735	0.561000	0.74099	ACA		0.502	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		16	112	0	0	0	0.003163	0	16	112				
TRIM8	81603	broad.mit.edu	37	10	104404673	104404673	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:104404673C>T	ENST00000302424.7	+	1	421	c.299C>T	c.(298-300)cCg>cTg	p.P100L	RP11-47A8.5_ENST00000607967.1_lincRNA	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	100					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.P100L(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CGCGGCCCCCCGCTGCCCGCG	0.701																																							uc001kvz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(298-300)CCG>CTG		tripartite motif-containing 8							7.0	10.0	9.0					10																	104404673		2132	4204	6336	SO:0001583	missense	81603					cytoplasm|PML body	ligase activity|protein homodimerization activity|zinc ion binding	g.chr10:104404673C>T	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.299C>T	10.37:g.104404673C>T	ENSP00000302120:p.Pro100Leu						p.P100L	NM_030912	NP_112174	Q9BZR9	TRIM8_HUMAN		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	1	422	+		Colorectal(252;0.122)	100			B box-type 1.		A6NI31|Q9C028	Missense_Mutation	SNP	ENST00000302424.7	37	c.299C>T	CCDS31274.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044472	0.93685	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	T	0.79554	-1.28	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.90438	0.7006	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92000	0.5610	10	0.72032	D	0.01	.	17.9987	0.89192	0.0:1.0:0.0:0.0	.	100	Q9BZR9	TRIM8_HUMAN	L	100	ENSP00000302120:P100L	ENSP00000302120:P100L	P	+	2	0	TRIM8	104394663	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.914000	0.69964	2.320000	0.78422	0.561000	0.74099	CCG		0.701	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912		4	5	0	0	0	0.009096	0	4	5				
TDRD1	56165	broad.mit.edu	37	10	115971637	115971637	+	Nonsense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:115971637G>A	ENST00000369280.1	+	14	2133	c.1673G>A	c.(1672-1674)tGg>tAg	p.W558*	TDRD1_ENST00000369282.1_Nonsense_Mutation_p.W558*|TDRD1_ENST00000251864.2_Nonsense_Mutation_p.W558*|TDRD1_ENST00000369281.2_Intron|TDRD1_ENST00000422662.1_Intron			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	558	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)	p.W558*(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GATGATCAGTGGTACCGTGCC	0.378																																							uc001lbg.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1672-1674)TGG>TAG		tudor domain containing 1							177.0	169.0	171.0					10																	115971637		2203	4300	6503	SO:0001587	stop_gained	56165				DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding	g.chr10:115971637G>A	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1673G>A	10.37:g.115971637G>A	ENSP00000358286:p.Trp558*					TDRD1_uc001lbf.2_Intron|TDRD1_uc001lbh.1_Nonsense_Mutation_p.W549*|TDRD1_uc001lbi.1_Nonsense_Mutation_p.W549*|TDRD1_uc010qsc.1_Intron|TDRD1_uc001lbj.2_Nonsense_Mutation_p.W267*	p.W558*	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN		Epithelial(162;0.0343)|all cancers(201;0.0754)	14	1826	+		Colorectal(252;0.172)|Breast(234;0.188)	558			Tudor 2.		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Nonsense_Mutation	SNP	ENST00000369280.1	37	c.1673G>A		.	.	.	.	.	.	.	.	.	.	G	40	7.968283	0.98588	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369280	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2644	18.2425	0.89971	0.0:0.0:1.0:0.0	.	.	.	.	X	558	.	ENSP00000251864:W558X	W	+	2	0	TDRD1	115961627	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.212000	0.89756	2.730000	0.93505	0.563000	0.77884	TGG		0.378	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2			16	114	0	0	0	0.010504	0	16	114				
FAM160B1	57700	broad.mit.edu	37	10	116608455	116608455	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:116608455G>T	ENST00000369248.4	+	13	2097	c.1762G>T	c.(1762-1764)Ggc>Tgc	p.G588C	FAM160B1_ENST00000369250.3_Missense_Mutation_p.G588C	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	588								p.G588C(2)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						CCATGTTGAGGGCACAGGATA	0.428																																							uc001lcb.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)	1						c.(1762-1764)GGC>TGC		hypothetical protein LOC57700 isoform a							127.0	98.0	108.0					10																	116608455		2203	4300	6503	SO:0001583	missense	57700							g.chr10:116608455G>T	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1762G>T	10.37:g.116608455G>T	ENSP00000358251:p.Gly588Cys					FAM160B1_uc001lcc.2_Missense_Mutation_p.G588C	p.G588C	NM_020940	NP_065991	Q5W0V3	F16B1_HUMAN			13	2097	+			588					Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	37	c.1762G>T	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.728778	0.89390	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.18174	2.26;2.23	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.41534	0.1163	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.985	T	0.06734	-1.0810	10	0.59425	D	0.04	-15.4342	19.9439	0.97175	0.0:0.0:1.0:0.0	.	588;588	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	C	588	ENSP00000358251:G588C;ENSP00000358253:G588C	ENSP00000358251:G588C	G	+	1	0	FAM160B1	116598445	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	9.477000	0.97925	2.797000	0.96272	0.561000	0.74099	GGC		0.428	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351		4	26	1	0	0.00024832	0.009096	0.000285217	4	26				
MKI67	4288	broad.mit.edu	37	10	129906387	129906387	+	Silent	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr10:129906387T>C	ENST00000368654.3	-	13	4092	c.3717A>G	c.(3715-3717)gaA>gaG	p.E1239E	MKI67_ENST00000368653.3_Silent_p.E879E	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1239	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.E1239E(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CAGCCACTAATTCCTCGGTGT	0.512																																							uc001lke.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(1)	7						c.(3715-3717)GAA>GAG		antigen identified by monoclonal antibody Ki-67							95.0	99.0	98.0					10																	129906387		2203	4300	6503	SO:0001819	synonymous_variant	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129906387T>C	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3717A>G	10.37:g.129906387T>C						MKI67_uc001lkf.2_Silent_p.E879E|MKI67_uc009yav.1_Silent_p.E814E|MKI67_uc009yaw.1_Silent_p.E389E	p.E1239E	NM_002417	NP_002408	P46013	KI67_HUMAN			13	3912	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	1239			16 X 122 AA approximate repeats.		Q5VWH2	Silent	SNP	ENST00000368654.3	37	c.3717A>G	CCDS7659.1																																																																																				0.512	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		19	53	0	0	0	0.008871	0	19	53				
NLRP6	171389	broad.mit.edu	37	11	284494	284494	+	Nonsense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:284494C>T	ENST00000312165.5	+	7	2392	c.2392C>T	c.(2392-2394)Cag>Tag	p.Q798*	RP11-326C3.2_ENST00000533924.1_RNA|NLRP6_ENST00000534750.1_Nonsense_Mutation_p.Q797*	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	798					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)	p.Q798*(1)		breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCTGACCCCCAGCGAGGGCT	0.697																																							uc010qvs.1		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|skin(1)	2						c.(2392-2394)CAG>TAG		NLR family, pyrin domain containing 6							28.0	30.0	29.0					11																	284494		2203	4299	6502	SO:0001587	stop_gained	171389					cytoplasm	ATP binding	g.chr11:284494C>T	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.2392C>T	11.37:g.284494C>T	ENSP00000309767:p.Gln798*					NLRP6_uc010qvt.1_Nonsense_Mutation_p.Q797*	p.Q798*	NM_138329	NP_612202	P59044	NALP6_HUMAN		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)	7	2392	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	798					A8K9F3|E9PJZ8	Nonsense_Mutation	SNP	ENST00000312165.5	37	c.2392C>T	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	C	37	6.248369	0.97412	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	.	.	.	2.84	2.84	0.33178	.	1.050780	0.07678	U	0.936575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	9.3063	0.37876	0.0:1.0:0.0:0.0	.	.	.	.	X	797;798	.	ENSP00000309767:Q798X	Q	+	1	0	NLRP6	274494	0.001000	0.12720	0.214000	0.23707	0.039000	0.13416	1.068000	0.30629	1.612000	0.50221	0.456000	0.33151	CAG		0.697	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329		12	14	0	0	0	0.013537	0	12	14				
OR56A1	120796	broad.mit.edu	37	11	6048493	6048493	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:6048493C>T	ENST00000316650.5	-	1	478	c.442G>A	c.(442-444)Gtg>Atg	p.V148M		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V148M(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTTTGGCCACAAATTGATTA	0.507																																							uc010qzw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(442-444)GTG>ATG		olfactory receptor, family 56, subfamily A,							140.0	121.0	127.0					11																	6048493		2201	4296	6497	SO:0001583	missense	120796				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6048493C>T	AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.442G>A	11.37:g.6048493C>T	ENSP00000321246:p.Val148Met						p.V148M	NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	442	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	148			Helical; Name=4; (Potential).		B2RNI2|Q6IFL0	Missense_Mutation	SNP	ENST00000316650.5	37	c.442G>A	CCDS31405.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370827	0.24771	.	.	ENSG00000180934	ENST00000316650	T	0.39056	1.1	4.16	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38381	N	0.001710	T	0.57548	0.2061	M	0.72894	2.215	0.09310	N	1	D	0.71674	0.998	D	0.76575	0.988	T	0.50294	-0.8845	10	0.72032	D	0.01	.	6.4733	0.22020	0.0:0.7999:0.0:0.2001	.	148	Q8NGH5	O56A1_HUMAN	M	148	ENSP00000321246:V148M	ENSP00000321246:V148M	V	-	1	0	OR56A1	6005069	0.000000	0.05858	0.978000	0.43139	0.159000	0.22180	0.049000	0.14099	2.303000	0.77524	0.655000	0.94253	GTG		0.507	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383757.1	NM_001001917		6	42	0	0	0	0.001984	0	6	42				
FAM160A2	84067	broad.mit.edu	37	11	6236055	6236055	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:6236055C>A	ENST00000449352.2	-	10	2565	c.2302G>T	c.(2302-2304)Gcc>Tcc	p.A768S	FAM160A2_ENST00000265978.4_Missense_Mutation_p.A782S|FAM160A2_ENST00000529360.1_5'UTR			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	768					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)		p.A782S(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCCAGCTGGGCCACCAGCCCC	0.612																																							uc001mcl.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(2302-2304)GCC>TCC		hypothetical protein LOC84067 isoform 2							53.0	44.0	47.0					11																	6236055		2201	4296	6497	SO:0001583	missense	84067				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|protein transport	FHF complex	protein binding	g.chr11:6236055C>A		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.2302G>T	11.37:g.6236055C>A	ENSP00000416918:p.Ala768Ser					FAM160A2_uc001mck.3_Missense_Mutation_p.A782S	p.A768S	NM_001098794	NP_001092264	Q8N612	F16A2_HUMAN			10	2661	-			768					Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	ENST00000449352.2	37	c.2302G>T	CCDS44530.1	.	.	.	.	.	.	.	.	.	.	c	13.04	2.118854	0.37436	.	.	ENSG00000051009	ENST00000449352;ENST00000265978	T;T	0.07327	3.2;3.21	4.71	4.71	0.59529	.	0.159538	0.56097	D	0.000031	T	0.05044	0.0135	N	0.13235	0.315	0.80722	D	1	P;P	0.46912	0.818;0.886	B;B	0.44278	0.259;0.445	T	0.31530	-0.9940	10	0.02654	T	1	-9.6003	10.4512	0.44524	0.0:0.9115:0.0:0.0885	.	768;782	Q8N612;Q8N612-2	F16A2_HUMAN;.	S	768;782	ENSP00000416918:A768S;ENSP00000265978:A782S	ENSP00000265978:A782S	A	-	1	0	FAM160A2	6192631	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.778000	0.38614	2.462000	0.83206	0.550000	0.68814	GCC		0.612	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127		5	18	1	0	3.59834e-05	0.001168	4.39195e-05	5	18				
NELL1	4745	broad.mit.edu	37	11	21555957	21555957	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:21555957C>G	ENST00000357134.5	+	16	1835	c.1683C>G	c.(1681-1683)caC>caG	p.H561Q	NELL1_ENST00000532434.1_Intron|NELL1_ENST00000298925.5_Missense_Mutation_p.H589Q|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000325319.5_Missense_Mutation_p.H504Q	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	561	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.H561Q(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TTGAGTGCCACAACCATTCCC	0.483																																							uc001mqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(1681-1683)CAC>CAG		nel-like 1 isoform 1 precursor							177.0	151.0	160.0					11																	21555957		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21555957C>G	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1683C>G	11.37:g.21555957C>G	ENSP00000349654:p.His561Gln					NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Missense_Mutation_p.H589Q|NELL1_uc010rdo.1_Missense_Mutation_p.H504Q|NELL1_uc010rdp.1_Intron|NELL1_uc001mqh.2_Missense_Mutation_p.T171R	p.H561Q	NM_006157	NP_006148	Q92832	NELL1_HUMAN			16	1836	+			561			EGF-like 5; calcium-binding (Potential).		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.1683C>G	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.646680	0.29246	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319	D;D;D	0.91792	-2.91;-2.91;-2.91	5.37	5.37	0.77165	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	D	0.86326	0.5906	N	0.12746	0.255	0.48040	D	0.999571	P;P;P	0.48764	0.879;0.915;0.808	P;B;B	0.45449	0.481;0.374;0.288	D	0.84563	0.0651	10	0.13108	T	0.6	-16.4381	19.1101	0.93313	0.0:1.0:0.0:0.0	.	504;589;561	F5H6I3;B3KXR2;Q92832	.;.;NELL1_HUMAN	Q	589;561;504	ENSP00000298925:H589Q;ENSP00000349654:H561Q;ENSP00000317837:H504Q	ENSP00000298925:H589Q	H	+	3	2	NELL1	21512533	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.468000	0.66743	2.522000	0.85027	0.460000	0.39030	CAC		0.483	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		25	43	0	0	0	0.005443	0	25	43				
API5	8539	broad.mit.edu	37	11	43364037	43364037	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:43364037C>T	ENST00000531273.1	+	14	1691	c.1552C>T	c.(1552-1554)Cgt>Tgt	p.R518C	API5_ENST00000378852.3_3'UTR|RP11-484D2.2_ENST00000526220.1_RNA|API5_ENST00000534695.1_Intron|API5_ENST00000455725.2_Missense_Mutation_p.R507C|API5_ENST00000420461.2_3'UTR			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	518					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)	p.R518C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						ACGAGGAAATCGTAGTCGGGG	0.463																																					Pancreas(1;98 122 5625 20895 49453)	Pancreas(1;98 122 5625 20895 49453)	uc010rfh.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1552-1554)CGT>TGT		apoptosis inhibitor 5 isoform a							83.0	78.0	80.0					11																	43364037		2203	4300	6503	SO:0001583	missense	8539				anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding	g.chr11:43364037C>T	U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.1552C>T	11.37:g.43364037C>T	ENSP00000431391:p.Arg518Cys					API5_uc010rfg.1_Missense_Mutation_p.R507C|API5_uc001mxf.2_3'UTR|API5_uc010rfi.1_3'UTR	p.R518C	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN			14	1725	+			Error:Variant_position_missing_in_Q9BZZ5_after_alignment					B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Missense_Mutation	SNP	ENST00000531273.1	37	c.1552C>T	CCDS44572.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771071	0.49680	.	.	ENSG00000166181	ENST00000455725;ENST00000531273	T;T	0.27890	1.64;1.65	5.61	5.61	0.85477	.	0.177217	0.49305	D	0.000147	T	0.37679	0.1012	N	0.08118	0	0.80722	D	1	D;D	0.89917	0.976;1.0	D;D	0.79784	0.919;0.993	T	0.46775	-0.9167	10	0.59425	D	0.04	.	18.1791	0.89771	0.0:1.0:0.0:0.0	.	518;507	Q9BZZ5;B4E283	API5_HUMAN;.	C	507;518	ENSP00000399341:R507C;ENSP00000431391:R518C	ENSP00000399341:R507C	R	+	1	0	API5	43320613	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.662000	0.68032	2.805000	0.96524	0.460000	0.39030	CGT		0.463	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595		7	38	0	0	0	0.00308	0	7	38				
AGBL2	79841	broad.mit.edu	37	11	47726214	47726214	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:47726214A>T	ENST00000525123.1	-	7	752	c.467T>A	c.(466-468)gTa>gAa	p.V156E	AGBL2_ENST00000528244.1_Missense_Mutation_p.V118E|AGBL2_ENST00000298861.4_Missense_Mutation_p.V156E|AGBL2_ENST00000357610.3_Missense_Mutation_p.V156E|AGBL2_ENST00000529712.1_5'UTR	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	156						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.V156E(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						ACGTGGGTTTACTTCATCCAA	0.448																																							uc001ngg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(466-468)GTA>GAA		carboxypeptidase 2, cytosolic							152.0	138.0	143.0					11																	47726214		2201	4298	6499	SO:0001583	missense	79841				proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding	g.chr11:47726214A>T		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.467T>A	11.37:g.47726214A>T	ENSP00000435582:p.Val156Glu					AGBL2_uc010rhq.1_Missense_Mutation_p.V118E|AGBL2_uc001ngh.1_Missense_Mutation_p.V100E	p.V156E	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN			6	567	-			156					A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	c.467T>A	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	A	7.452	0.642846	0.14451	.	.	ENSG00000165923	ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244;ENST00000532595;ENST00000420784;ENST00000530577	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.47	1.65	0.23941	.	0.738556	0.13361	N	0.393672	T	0.21468	0.0517	L	0.46157	1.445	0.09310	N	1	B;B;B	0.18310	0.012;0.007;0.027	B;B;B	0.16289	0.015;0.007;0.007	T	0.34850	-0.9812	10	0.07644	T	0.81	-3.2568	7.8796	0.29614	0.5614:0.3537:0.0849:0.0	.	118;118;156	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	E	156;156;156;118;100;100;98	ENSP00000435582:V156E;ENSP00000350228:V156E;ENSP00000298861:V156E;ENSP00000436630:V118E;ENSP00000436063:V100E;ENSP00000432264:V98E	ENSP00000298861:V156E	V	-	2	0	AGBL2	47682790	0.000000	0.05858	0.000000	0.03702	0.175000	0.22909	0.508000	0.22692	0.305000	0.22832	0.482000	0.46254	GTA		0.448	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783		17	78	0	0	0	0.006122	0	17	78				
OR4A47	403253	broad.mit.edu	37	11	48511031	48511031	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:48511031A>T	ENST00000446524.1	+	1	763	c.687A>T	c.(685-687)aaA>aaT	p.K229N		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K229N(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TTAGTCAGAAAGGGAGGCAAA	0.443																																							uc010rhx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(685-687)AAA>AAT		olfactory receptor, family 4, subfamily A,							127.0	123.0	124.0					11																	48511031		2201	4298	6499	SO:0001583	missense	403253				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48511031A>T	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.687A>T	11.37:g.48511031A>T	ENSP00000412752:p.Lys229Asn						p.K229N	NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN			1	687	+			229			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000446524.1	37	c.687A>T	CCDS31490.1	.	.	.	.	.	.	.	.	.	.	N	6.971	0.549111	0.13312	.	.	ENSG00000237388	ENST00000446524	T	0.00145	8.67	4.59	0.809	0.18725	GPCR, rhodopsin-like superfamily (1);	0.108891	0.40728	N	0.001031	T	0.00144	0.0004	L	0.38692	1.165	0.09310	N	1	B	0.19073	0.033	B	0.27170	0.077	T	0.33033	-0.9884	10	0.87932	D	0	.	7.8405	0.29395	0.7259:0.0:0.2741:0.0	.	229	Q6IF82	O4A47_HUMAN	N	229	ENSP00000412752:K229N	ENSP00000412752:K229N	K	+	3	2	OR4A47	48467607	0.054000	0.20591	0.897000	0.35233	0.161000	0.22273	-0.158000	0.10070	0.145000	0.18977	0.172000	0.16884	AAA		0.443	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		43	94	0	0	0	0.007835	0	43	94				
OR8J1	219477	broad.mit.edu	37	11	56128008	56128008	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:56128008G>T	ENST00000303039.3	+	1	318	c.286G>T	c.(286-288)Gaa>Taa	p.E96*		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E96*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					CTCATTCTATGAATGTGCCAC	0.418																																							uc010rjh.1		NA																	1	Substitution - Nonsense(1)	p.E96A(1)	lung(1)	ovary(2)	2						c.(286-288)GAA>TAA		olfactory receptor, family 8, subfamily J,							144.0	137.0	139.0					11																	56128008		2201	4296	6497	SO:0001587	stop_gained	219477				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56128008G>T	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.286G>T	11.37:g.56128008G>T	ENSP00000304060:p.Glu96*						p.E96*	NM_001005205	NP_001005205	Q8NGP2	OR8J1_HUMAN			1	286	+	Esophageal squamous(21;0.00448)		96			Extracellular (Potential).		B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Nonsense_Mutation	SNP	ENST00000303039.3	37	c.286G>T	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706630	0.48412	.	.	ENSG00000172487	ENST00000303039	.	.	.	4.76	4.76	0.60689	.	0.497754	0.19291	N	0.117900	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	16.6811	0.85291	0.0:0.0:1.0:0.0	.	.	.	.	X	96	.	ENSP00000304060:E96X	E	+	1	0	OR8J1	55884584	0.020000	0.18652	0.998000	0.56505	0.413000	0.31143	1.968000	0.40500	2.358000	0.79984	0.643000	0.83706	GAA		0.418	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205		13	115	1	0	0.00244969	0.00245	0.00272375	13	115				
OR9I1	219954	broad.mit.edu	37	11	57886684	57886684	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:57886684G>T	ENST00000302610.1	-	1	232	c.233C>A	c.(232-234)aCc>aAc	p.T78N	OR9Q1_ENST00000335397.3_Intron	NM_001005211.1	NP_001005211.1	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I, member 1	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T78N(1)		endometrium(2)|large_intestine(2)|liver(1)|lung(15)|pancreas(1)|skin(1)|urinary_tract(1)	23		Breast(21;0.0589)				GATCTGAGGGGTGATGACTGA	0.498																																							uc001nml.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(232-234)ACC>AAC		olfactory receptor, family 9, subfamily I,							128.0	100.0	109.0					11																	57886684		2201	4296	6497	SO:0001583	missense	219954				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57886684G>T	AB065733	CCDS31542.1	11q12.1	2012-08-09			ENSG00000172377	ENSG00000172377		"""GPCR / Class A : Olfactory receptors"""	14718	protein-coding gene	gene with protein product							Standard	NM_001005211		Approved		uc021qjl.1	Q8NGQ6	OTTHUMG00000167404	ENST00000302610.1:c.233C>A	11.37:g.57886684G>T	ENSP00000302606:p.Thr78Asn					OR9Q1_uc001nmj.2_Intron	p.T78N	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN			1	233	-		Breast(21;0.0589)	78			Extracellular (Potential).		Q6IFH0|Q96RA8	Missense_Mutation	SNP	ENST00000302610.1	37	c.233C>A	CCDS31542.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.411543	0.62399	.	.	ENSG00000172377	ENST00000302610	T	0.03065	4.06	5.06	1.88	0.25563	GPCR, rhodopsin-like superfamily (1);	0.268612	0.26738	N	0.022749	T	0.08935	0.0221	M	0.77103	2.36	0.27873	N	0.939975	D	0.59767	0.986	P	0.53146	0.719	T	0.09079	-1.0691	10	0.87932	D	0	-19.8142	3.6894	0.08340	0.3187:0.1866:0.4947:0.0	.	78	Q8NGQ6	OR9I1_HUMAN	N	78	ENSP00000302606:T78N	ENSP00000302606:T78N	T	-	2	0	OR9I1	57643260	0.000000	0.05858	0.994000	0.49952	0.970000	0.65996	0.263000	0.18478	0.718000	0.32166	0.467000	0.42956	ACC		0.498	OR9I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394539.1	NM_001005211		23	17	1	0	6.44725e-10	0.014323	9.42886e-10	23	17				
MS4A14	84689	broad.mit.edu	37	11	60184263	60184263	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:60184263G>C	ENST00000300187.6	+	5	2099	c.1822G>C	c.(1822-1824)Gac>Cac	p.D608H	MS4A14_ENST00000395005.2_Missense_Mutation_p.D591H|MS4A14_ENST00000531783.1_Missense_Mutation_p.D641H|MS4A14_ENST00000531787.1_Missense_Mutation_p.D496H	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	608	Gln-rich.					integral component of membrane (GO:0016021)		p.D608H(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						GCAAACTGAAGACCAGCCGGC	0.453																																							uc001npj.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1822-1824)GAC>CAC		membrane-spanning 4-domains, subfamily A, member							55.0	46.0	49.0					11																	60184263		2203	4300	6503	SO:0001583	missense	84689					integral to membrane	receptor activity	g.chr11:60184263G>C	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1822G>C	11.37:g.60184263G>C	ENSP00000300187:p.Asp608His					MS4A14_uc001npi.2_Missense_Mutation_p.D496H|MS4A14_uc001npn.2_Missense_Mutation_p.D346H|MS4A14_uc001npk.2_Missense_Mutation_p.D591H|MS4A14_uc001npl.2_Missense_Mutation_p.D346H|MS4A14_uc001npm.2_Missense_Mutation_p.D346H	p.D608H	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN			5	2387	+			608			Gln-rich.		E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000300187.6	37	c.1822G>C	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298799	0.40694	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.47177	0.85;2.03;0.87;2.34	3.55	1.55	0.23275	.	2.914980	0.01046	N	0.004394	T	0.38772	0.1053	L	0.46157	1.445	0.09310	N	0.999999	P;P	0.40180	0.705;0.58	B;B	0.28385	0.089;0.041	T	0.38112	-0.9676	10	0.72032	D	0.01	-2.7711	6.6416	0.22913	0.1105:0.1834:0.7061:0.0	.	591;608	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	H	496;608;591;641	ENSP00000437222:D496H;ENSP00000300187:D608H;ENSP00000378453:D591H;ENSP00000433761:D641H	ENSP00000300187:D608H	D	+	1	0	MS4A14	59940839	0.007000	0.16637	0.004000	0.12327	0.006000	0.05464	1.233000	0.32648	0.244000	0.21351	0.655000	0.94253	GAC		0.453	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2			4	20	0	0	0	0.009096	0	4	20				
MOGAT2	80168	broad.mit.edu	37	11	75438534	75438535	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:75438534_75438535CC>AA	ENST00000198801.5	+	3	395_396	c.325_326CC>AA	c.(325-327)CCc>AAc	p.P109N	MOGAT2_ENST00000526712.1_Missense_Mutation_p.P27N	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	109					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)	p.P109N(1)		NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					GGGCTTCCACCCCCATGGAGTC	0.619																																							uc010rru.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(325-327)CCC>AAC		monoacylglycerol O-acyltransferase 2																																				SO:0001583	missense	80168				glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity	g.chr11:75438534_75438535CC>AA	AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	Exception_encountered	11.37:g.75438534_75438535delinsAA	ENSP00000198801:p.Pro109Asn					MOGAT2_uc001oww.1_Missense_Mutation_p.P109N|MOGAT2_uc010rrv.1_Missense_Mutation_p.P27N	p.P109N	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN			3	325_326	+	Ovarian(111;0.103)		109			Helical; (Potential).		A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	DNP	ENST00000198801.5	37	c.325_326CC>AA	CCDS8240.1																																																																																				0.619	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098		41	21	0	0	0	0.004672	0	41	21				
FAT3	120114	broad.mit.edu	37	11	92495099	92495099	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:92495099C>A	ENST00000298047.6	+	4	3764	c.3747C>A	c.(3745-3747)gaC>gaA	p.D1249E	FAT3_ENST00000409404.2_Missense_Mutation_p.D1249E|RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000525166.1_Missense_Mutation_p.D1099E			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1249	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1249E(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATGAAAATGACAACAAGCCCC	0.463										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(3745-3747)GAC>GAA		FAT tumor suppressor homolog 3							185.0	180.0	182.0					11																	92495099		1916	4119	6035	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92495099C>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3747C>A	11.37:g.92495099C>A	ENSP00000298047:p.Asp1249Glu	TCGA Ovarian(4;0.039)					p.D1249E	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			4	3764	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1249			Cadherin 11.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.3747C>A		.	.	.	.	.	.	.	.	.	.	C	22.5	4.297856	0.81025	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.67171	-0.25;-0.25;-0.25	5.58	4.67	0.58626	.	.	.	.	.	D	0.85239	0.5651	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87885	0.2680	9	0.87932	D	0	.	10.7507	0.46207	0.0:0.8548:0.0:0.1452	.	1249	Q8TDW7-3	.	E	1249;1249;1099	ENSP00000298047:D1249E;ENSP00000387040:D1249E;ENSP00000432586:D1099E	ENSP00000298047:D1249E	D	+	3	2	FAT3	92134747	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.061000	0.41403	1.351000	0.45789	0.563000	0.77884	GAC		0.463	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		15	186	1	0	6.31663e-08	0.003163	8.66534e-08	15	186				
HEPHL1	341208	broad.mit.edu	37	11	93837765	93837765	+	Silent	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:93837765A>G	ENST00000315765.9	+	16	2762	c.2754A>G	c.(2752-2754)agA>agG	p.R918R		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	918	Plastocyanin-like 6.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.R922R(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				AGGGAAGAAGAAGTGACGTTG	0.348																																							uc001pep.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(2752-2754)AGA>AGG		hephaestin-like 1 precursor							130.0	129.0	129.0					11																	93837765		1861	4093	5954	SO:0001819	synonymous_variant	341208				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity	g.chr11:93837765A>G	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2754A>G	11.37:g.93837765A>G						uc001pen.1_Intron	p.R918R	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN			16	2911	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	918			Extracellular (Potential).|Plastocyanin-like 6.		Q3C1W7	Silent	SNP	ENST00000315765.9	37	c.2754A>G	CCDS44710.1																																																																																				0.348	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947		10	86	0	0	0	0.006214	0	10	86				
HEPHL1	341208	broad.mit.edu	37	11	93839281	93839281	+	Missense_Mutation	SNP	G	G	T	rs367854178		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:93839281G>T	ENST00000315765.9	+	17	3038	c.3030G>T	c.(3028-3030)gaG>gaT	p.E1010D		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	1010	Plastocyanin-like 6.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.E1014D(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				ATCATGCTGAGAGCTTTCTTT	0.358																																							uc001pep.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(3028-3030)GAG>GAT		hephaestin-like 1 precursor							131.0	130.0	130.0					11																	93839281		1880	4114	5994	SO:0001583	missense	341208				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity	g.chr11:93839281G>T	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.3030G>T	11.37:g.93839281G>T	ENSP00000313699:p.Glu1010Asp					uc001pen.1_Intron	p.E1010D	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN			17	3187	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	1010			Extracellular (Potential).|Plastocyanin-like 6.		Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	c.3030G>T	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.568231	0.65651	.	.	ENSG00000181333	ENST00000315765	D	0.99660	-6.32	5.95	4.86	0.63082	Cupredoxin (2);Multicopper oxidase, type 2 (1);	0.097518	0.64402	D	0.000002	D	0.99205	0.9724	L	0.58669	1.825	0.34812	D	0.737763	P	0.51791	0.948	P	0.56343	0.796	D	0.99913	1.1213	10	0.72032	D	0.01	-12.0848	12.4071	0.55445	0.1416:0.0:0.8584:0.0	.	1010	Q6MZM0	HPHL1_HUMAN	D	1010	ENSP00000313699:E1010D	ENSP00000313699:E1010D	E	+	3	2	HEPHL1	93478929	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	2.101000	0.41787	2.824000	0.97209	0.655000	0.94253	GAG		0.358	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947		50	47	1	0	2.23044e-30	0.01441	4.21017e-30	50	47				
APOA4	337	broad.mit.edu	37	11	116692349	116692349	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:116692349A>T	ENST00000357780.3	-	3	539	c.425T>A	c.(424-426)cTg>cAg	p.L142Q		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	142	13 X 22 AA approximate tandem repeats.				cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)	p.L142Q(1)		cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CTGGGTGCGCAGCTGGTCCGC	0.687																																							uc001pps.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(424-426)CTG>CAG		apolipoprotein A-IV precursor							34.0	35.0	35.0					11																	116692349		2200	4296	6496	SO:0001583	missense	337							g.chr11:116692349A>T		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.425T>A	11.37:g.116692349A>T	ENSP00000350425:p.Leu142Gln						p.L142Q	NM_000482	NP_000473				BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)	3	529	-	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)						A8MSL6|Q14CW8|Q6Q787	Missense_Mutation	SNP	ENST00000357780.3	37	c.425T>A	CCDS31681.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.174443	0.57692	.	.	ENSG00000110244	ENST00000357780	T	0.80653	-1.4	5.02	5.02	0.67125	Apolipoprotein/apolipophorin (1);	0.121996	0.37261	N	0.002167	D	0.91389	0.7283	M	0.91300	3.195	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.93283	0.6662	10	0.87932	D	0	-17.4776	14.379	0.66900	1.0:0.0:0.0:0.0	.	142	P06727	APOA4_HUMAN	Q	142	ENSP00000350425:L142Q	ENSP00000350425:L142Q	L	-	2	0	APOA4	116197559	0.990000	0.36364	0.980000	0.43619	0.133000	0.20885	4.752000	0.62176	1.893000	0.54813	0.379000	0.24179	CTG		0.687	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106279.2	NM_000482		15	6	0	0	0	0.003163	0	15	6				
IFT46	56912	broad.mit.edu	37	11	118425705	118425705	+	Splice_Site	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:118425705C>G	ENST00000264021.3	-	6	772	c.354G>C	c.(352-354)aaG>aaC	p.K118N	IFT46_ENST00000530872.1_Splice_Site_p.K169N|IFT46_ENST00000264020.2_Splice_Site_p.K169N	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	118					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)	p.K169N(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						CTGACTATACCTTTAAGAATG	0.418																																							uc001ptp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(352-354)AAG>AAC		IFT46							103.0	97.0	99.0					11																	118425705		2200	4295	6495	SO:0001630	splice_region_variant	56912				flagellum assembly|intraflagellar transport|protein stabilization	microtubule basal body|microtubule-based flagellum|nucleus	protein C-terminus binding	g.chr11:118425705C>G	AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.354+1G>C	11.37:g.118425705C>G						IFT46_uc001pto.1_Missense_Mutation_p.K169N|IFT46_uc009zaf.1_Missense_Mutation_p.K169N	p.K118N	NM_020153	NP_064538	Q9NQC8	IFT46_HUMAN			6	732	-			118					A8K0F6|Q9H6V5	Missense_Mutation	SNP	ENST00000264021.3	37	c.354G>C	CCDS53718.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608695	0.87258	.	.	ENSG00000118096	ENST00000264021;ENST00000264020;ENST00000530872;ENST00000531939;ENST00000534156	T;T;T;T;T	0.65178	-0.11;-0.14;-0.1;-0.11;-0.1	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.83811	0.5335	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.86184	0.1608	9	.	.	.	-3.8755	19.6454	0.95775	0.0:1.0:0.0:0.0	.	169;118;169	E9PR06;Q9NQC8;Q9NQC8-2	.;IFT46_HUMAN;.	N	118;169;169;118;118	ENSP00000264021:K118N;ENSP00000264020:K169N;ENSP00000432384:K169N;ENSP00000435826:K118N;ENSP00000434175:K118N	.	K	-	3	2	IFT46	117930915	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.325000	0.65869	2.714000	0.92807	0.561000	0.74099	AAG		0.418	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389627.1	NM_020153	Missense_Mutation	25	74	0	0	0	0.00333	0	25	74				
PVRL1	5818	broad.mit.edu	37	11	119508809	119508809	+	Nonstop_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:119508809T>C	ENST00000341398.2	-	8	1375	c.1376A>G	c.(1375-1377)tAg>tGg	p.*459W	RP11-196E1.3_ENST00000601999.1_RNA|RP11-196E1.3_ENST00000532153.1_RNA	NM_203285.1	NP_976030.1	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	0					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)	p.*459W(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		GGTCCTGGGCTAGGGGCACTC	0.642																																							uc001pwu.1		NA																	1	Nonstop extension(1)		lung(1)		0						c.(1375-1377)TAG>TGG		poliovirus receptor-related 1 isoform 2							28.0	32.0	31.0					11																	119508809		2199	4295	6494	SO:0001578	stop_lost	5818				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity	g.chr11:119508809T>C	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000341398.2:c.1376A>G	11.37:g.119508809T>C	ENSP00000344974:p.*459Serext*?						p.*459W	NM_203285	NP_976030	Q15223	PVRL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)	8	1548	-		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	459			Cytoplasmic (Potential).		O75465|Q2M3D3|Q9HBE6|Q9HBW2	Nonstop_Mutation	SNP	ENST00000341398.2	37	c.1376A>G	CCDS8425.1	.	.	.	.	.	.	.	.	.	.	T	4.644	0.119625	0.08881	.	.	ENSG00000110400	ENST00000341398	.	.	.	2.57	-2.59	0.06209	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.0051	0.09597	0.0:0.4201:0.2206:0.3593	.	.	.	.	W	459	.	.	X	-	2	0	PVRL1	119014019	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.005000	0.12855	-0.670000	0.05282	-0.334000	0.08254	TAG		0.642	PVRL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388230.1			7	14	0	0	0	0.001984	0	7	14				
OR10S1	219873	broad.mit.edu	37	11	123847594	123847594	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:123847594G>A	ENST00000531945.1	-	1	894	c.805C>T	c.(805-807)Cct>Tct	p.P269S		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P269S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ATACAGACAGGTGGCACGTAG	0.612																																							uc001pzm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(805-807)CCT>TCT		olfactory receptor, family 10, subfamily S,							69.0	71.0	70.0					11																	123847594		2202	4299	6501	SO:0001583	missense	219873				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123847594G>A	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.805C>T	11.37:g.123847594G>A	ENSP00000431914:p.Pro269Ser						p.P269S	NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	805	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	269			Helical; Name=6; (Potential).		B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	c.805C>T	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708456	0.30322	.	.	ENSG00000196248	ENST00000531945	T	0.00063	8.78	4.67	4.67	0.58626	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34986	U	0.003537	T	0.00073	0.0002	N	0.00123	-2.06	0.09310	N	1	D	0.59357	0.985	P	0.57620	0.824	T	0.76055	-0.3099	10	0.42905	T	0.14	-13.0293	13.9417	0.64059	0.0:0.1531:0.8469:0.0	.	269	Q8NGN2	O10S1_HUMAN	S	269	ENSP00000431914:P269S	ENSP00000431914:P269S	P	-	1	0	OR10S1	123352804	0.000000	0.05858	0.196000	0.23383	0.553000	0.35397	-0.131000	0.10482	2.418000	0.82041	0.655000	0.94253	CCT		0.612	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474		9	75	0	0	0	0.004482	0	9	75				
ROBO4	54538	broad.mit.edu	37	11	124756396	124756396	+	Missense_Mutation	SNP	C	C	T	rs529793135	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:124756396C>T	ENST00000306534.3	-	16	3243	c.2758G>A	c.(2758-2760)Ggt>Agt	p.G920S	ROBO4_ENST00000533054.1_Missense_Mutation_p.G775S|RP11-664I21.5_ENST00000524453.1_RNA	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	920					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G920S(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGCTCTAGACCGAAACCAAAG	0.567													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17677	0.0		0.0	False		,,,				2504	0.001						uc001qbg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2758-2760)GGT>AGT		roundabout homolog 4, magic roundabout							49.0	53.0	52.0					11																	124756396		2201	4299	6500	SO:0001583	missense	54538				angiogenesis|cell differentiation	integral to membrane	receptor activity	g.chr11:124756396C>T	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.2758G>A	11.37:g.124756396C>T	ENSP00000304945:p.Gly920Ser					ROBO4_uc010sas.1_Missense_Mutation_p.G775S|ROBO4_uc001qbh.2_3'UTR|ROBO4_uc001qbi.2_Missense_Mutation_p.G478S	p.G920S	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)	16	2898	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	920					A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	37	c.2758G>A	CCDS8455.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338535	0.60963	.	.	ENSG00000154133	ENST00000306534;ENST00000533054	T;T	0.63255	-0.03;0.33	4.7	2.77	0.32553	.	0.205146	0.24649	N	0.036739	T	0.44973	0.1319	N	0.26042	0.785	0.21782	N	0.999541	P;P	0.46578	0.88;0.597	B;B	0.42361	0.385;0.035	T	0.26087	-1.0113	10	0.19590	T	0.45	.	8.6141	0.33820	0.0:0.7311:0.0:0.2689	.	920;920	Q8WZ75-2;Q8WZ75	.;ROBO4_HUMAN	S	920;775	ENSP00000304945:G920S;ENSP00000437129:G775S	ENSP00000304945:G920S	G	-	1	0	ROBO4	124261606	0.032000	0.19561	0.987000	0.45799	0.964000	0.63967	0.326000	0.19646	1.074000	0.40909	0.655000	0.94253	GGT		0.567	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		31	18	0	0	0	0.008361	0	31	18				
OPCML	4978	broad.mit.edu	37	11	132290114	132290114	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:132290114G>T	ENST00000331898.7	-	7	1589	c.1011C>A	c.(1009-1011)ctC>ctA	p.L337L	OPCML_ENST00000374778.4_Silent_p.L296L|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000541867.1_Silent_p.L346L|OPCML_ENST00000524381.1_Silent_p.L330L	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	337					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.L330L(1)|p.L337L(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		AGTGGGCTAAGAGGGTCCCTG	0.512																																							uc001qgs.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(1009-1011)CTC>CTA		opioid binding protein/cell adhesion							118.0	103.0	108.0					11																	132290114		2201	4297	6498	SO:0001819	synonymous_variant	4978				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity	g.chr11:132290114G>T	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.1011C>A	11.37:g.132290114G>T						OPCML_uc001qgu.2_Silent_p.L330L|OPCML_uc010sck.1_Silent_p.L346L|OPCML_uc001qgt.2_Silent_p.L336L|OPCML_uc010scl.1_Silent_p.L296L	p.L337L	NM_002545	NP_002536	Q14982	OPCM_HUMAN		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)	7	1061	-	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)	337					B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Silent	SNP	ENST00000331898.7	37	c.1011C>A	CCDS8492.1																																																																																				0.512	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393		28	24	1	0	6.00712e-18	0.012213	1.03373e-17	28	24				
TULP3	7289	broad.mit.edu	37	12	3040343	3040343	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:3040343G>T	ENST00000448120.2	+	6	684	c.633G>T	c.(631-633)agG>agT	p.R211S	RNU7-166P_ENST00000459397.1_RNA|TULP3_ENST00000397132.2_Missense_Mutation_p.R211S	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	211					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)	p.R211S(1)		endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GGGATAAAAGGGGAATGGATC	0.443																																							uc010seh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(631-633)AGG>AGT		tubby like protein 3 isoform 1							89.0	85.0	86.0					12																	3040343		2203	4300	6503	SO:0001583	missense	7289				G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding	g.chr12:3040343G>T	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.633G>T	12.37:g.3040343G>T	ENSP00000410051:p.Arg211Ser					TULP3_uc010sef.1_RNA|TULP3_uc009zec.1_5'UTR|TULP3_uc010seg.1_RNA|TULP3_uc001qlj.2_Missense_Mutation_p.R211S|TULP3_uc010sei.1_Missense_Mutation_p.R68S	p.R211S	NM_003324	NP_003315	O75386	TULP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000818)		6	714	+			211					B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	c.633G>T	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944231	0.34283	.	.	ENSG00000078246	ENST00000228245;ENST00000542730;ENST00000448120;ENST00000397132	D;D	0.95788	-3.81;-3.81	5.58	-5.47	0.02600	Tubby, C-terminal (3);	0.174163	0.64402	D	0.000010	D	0.85150	0.5631	N	0.03930	-0.32	0.21782	N	0.999547	B;B;B	0.21225	0.016;0.006;0.053	B;B;B	0.28916	0.042;0.043;0.096	T	0.75326	-0.3357	10	0.87932	D	0	-3.1889	9.4707	0.38839	0.7261:0.0:0.1699:0.1041	.	68;211;211	B7Z1E7;O75386;F8WBZ9	.;TULP3_HUMAN;.	S	211;68;211;211	ENSP00000410051:R211S;ENSP00000380321:R211S	ENSP00000228245:R211S	R	+	3	2	TULP3	2910604	0.944000	0.32072	0.347000	0.25668	0.797000	0.45037	0.159000	0.16442	-0.880000	0.03997	-0.345000	0.07892	AGG		0.443	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324		17	79	1	0	1.33834e-09	0.007413	1.92263e-09	17	79				
ANO2	57101	broad.mit.edu	37	12	5672645	5672645	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:5672645G>T	ENST00000356134.5	-	27	2891	c.2820C>A	c.(2818-2820)agC>agA	p.S940R	ANO2_ENST00000327087.8_Missense_Mutation_p.S939R|ANO2_ENST00000546188.1_Missense_Mutation_p.S940R	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	944					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.S939R(1)|p.S940R(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CCACTAATAAGCTCTTCTCTT	0.532																																							uc001qnm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|central_nervous_system(1)	7						c.(2815-2817)AGC>AGA		anoctamin 2							64.0	63.0	63.0					12																	5672645		1948	4159	6107	SO:0001583	missense	57101					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity	g.chr12:5672645G>T	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2820C>A	12.37:g.5672645G>T	ENSP00000348453:p.Ser940Arg						p.S939R	NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN			26	2889	-			944			Cytoplasmic (Potential).		C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37	c.2817C>A		.	.	.	.	.	.	.	.	.	.	G	9.450	1.090379	0.20471	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277;ENST00000543568	T;T;T	0.65549	-0.16;-0.16;-0.16	4.79	2.51	0.30379	.	0.189450	0.56097	D	0.000038	T	0.47078	0.1426	L	0.34521	1.04	0.09310	N	0.999999	B	0.27140	0.169	B	0.28553	0.091	T	0.45673	-0.9245	10	0.66056	D	0.02	.	6.7909	0.23699	0.3903:0.0:0.6097:0.0	.	939	Q9NQ90-3	.	R	939;940;940;944;27	ENSP00000314048:S939R;ENSP00000348453:S940R;ENSP00000440981:S940R	ENSP00000314048:S939R	S	-	3	2	ANO2	5542906	0.002000	0.14202	0.949000	0.38748	0.864000	0.49448	-0.059000	0.11731	1.136000	0.42199	0.555000	0.69702	AGC		0.532	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373		11	32	1	0	6.40141e-05	0.010729	7.65967e-05	11	32				
VWF	7450	broad.mit.edu	37	12	6182795	6182795	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:6182795G>T	ENST00000261405.5	-	8	1241	c.987C>A	c.(985-987)tgC>tgA	p.C329*		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	329	TIL 1.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.C329*(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGGGCAGCTGCAGCCATCCA	0.532																																							uc001qnn.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(985-987)TGC>TGA		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						109.0	92.0	98.0					12																	6182795		2203	4300	6503	SO:0001587	stop_gained	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6182795G>T		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.987C>A	12.37:g.6182795G>T	ENSP00000261405:p.Cys329*					VWF_uc010set.1_Nonsense_Mutation_p.C329*	p.C329*	NM_000552	NP_000543	P04275	VWF_HUMAN			8	1237	-			329			TIL 1.		Q8TCE8|Q99806	Nonsense_Mutation	SNP	ENST00000261405.5	37	c.987C>A	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	G	40	8.179299	0.98693	.	.	ENSG00000110799	ENST00000261405	.	.	.	5.07	3.19	0.36642	.	0.000000	0.45361	D	0.000378	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8785	0.41218	0.1753:0.0:0.8247:0.0	.	.	.	.	X	329	.	ENSP00000261405:C329X	C	-	3	2	VWF	6053056	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.881000	0.48538	1.103000	0.41568	0.491000	0.48974	TGC		0.532	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		9	53	1	0	1.12685e-05	0.004482	1.39994e-05	9	53				
A2M	2	broad.mit.edu	37	12	9243991	9243991	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:9243991G>T	ENST00000318602.7	-	19	2582	c.2275C>A	c.(2275-2277)Cct>Act	p.P759T		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	759					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.P759T(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	ATGGTGTCAGGGACTGTTACT	0.517																																							uc001qvk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(1)	5						c.(2275-2277)CCT>ACT		alpha-2-macroglobulin precursor	Bacitracin(DB00626)|Becaplermin(DB00102)						75.0	79.0	78.0					12																	9243991		2203	4300	6503	SO:0001583	missense	2				blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding	g.chr12:9243991G>T	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2275C>A	12.37:g.9243991G>T	ENSP00000323929:p.Pro759Thr					A2M_uc009zgk.1_Missense_Mutation_p.P609T	p.P759T	NM_000014	NP_000005	P01023	A2MG_HUMAN			19	2388	-			759					Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	c.2275C>A	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648133	0.67358	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.41758	0.99	5.28	5.28	0.74379	Alpha-2-macroglobulin (1);	0.000000	0.64402	D	0.000001	T	0.79458	0.4449	H	0.98351	4.21	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.87995	0.2752	10	0.87932	D	0	.	18.4939	0.90856	0.0:0.0:1.0:0.0	.	759	P01023	A2MG_HUMAN	T	759;774	ENSP00000323929:P759T	ENSP00000323929:P759T	P	-	1	0	A2M	9135258	1.000000	0.71417	0.999000	0.59377	0.244000	0.25665	9.869000	0.99810	2.464000	0.83262	0.557000	0.71058	CCT		0.517	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014		4	76	1	0	1.23904e-05	0.000602	1.5354e-05	4	76				
PZP	5858	broad.mit.edu	37	12	9317929	9317929	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:9317929G>T	ENST00000261336.2	-	19	2321	c.2293C>A	c.(2293-2295)Cct>Act	p.P765T	PZP_ENST00000539983.1_5'UTR|PZP_ENST00000381997.2_Missense_Mutation_p.P634T	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	765					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.P634T(1)|p.P765T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ATGGTGTCAGGGACTGTTACT	0.527																																					Melanoma(125;1402 1695 4685 34487 38571)	Melanoma(125;1402 1695 4685 34487 38571)	uc001qvl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						c.(2293-2295)CCT>ACT		pregnancy-zone protein precursor							71.0	64.0	67.0					12																	9317929		2203	4300	6503	SO:0001583	missense	5858							g.chr12:9317929G>T	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2293C>A	12.37:g.9317929G>T	ENSP00000261336:p.Pro765Thr					PZP_uc009zgl.2_Missense_Mutation_p.P634T|PZP_uc010sgo.1_RNA|PZP_uc009zgm.1_Missense_Mutation_p.P97T	p.P765T	NM_002864	NP_002855					19	2322	-								A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	c.2293C>A	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.615046	0.66672	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.41758	0.99;0.99	3.7	2.81	0.32909	Alpha-2-macroglobulin (1);	0.000000	0.64402	U	0.000014	T	0.74053	0.3666	H	0.97635	4.045	0.34207	D	0.67386	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85354	0.1103	10	0.87932	D	0	.	11.427	0.50015	0.0938:0.0:0.9062:0.0	.	765;634;765	B2R950;P20742-2;P20742	.;.;PZP_HUMAN	T	765;634	ENSP00000261336:P765T;ENSP00000371427:P634T	ENSP00000261336:P765T	P	-	1	0	PZP	9209196	1.000000	0.71417	0.980000	0.43619	0.893000	0.52053	7.496000	0.81526	0.863000	0.35553	0.467000	0.42956	CCT		0.527	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864		12	42	1	0	9.31168e-06	0.001855	1.16277e-05	12	42				
CLEC1B	51266	broad.mit.edu	37	12	10150960	10150960	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:10150960G>A	ENST00000298527.6	-	2	263	c.84C>T	c.(82-84)tcC>tcT	p.S28S	CLEC1B_ENST00000428126.2_Intron|CLEC1B_ENST00000348658.4_Intron	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	28			S -> F (in dbSNP:rs2273987).		cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.S28S(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						CACGCCACCAGGAGGAGGATG	0.557																																							uc001qwu.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(82-84)TCC>TCT		C-type lectin domain family 1, member B isoform							99.0	106.0	104.0					12																	10150960		2103	4211	6314	SO:0001819	synonymous_variant	51266				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity	g.chr12:10150960G>A	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.84C>T	12.37:g.10150960G>A						CLEC1B_uc009zhd.2_Intron	p.S28S	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN			2	284	-			28			Cytoplasmic (Potential).		Q6UWX7|Q8NHR6	Silent	SNP	ENST00000298527.6	37	c.84C>T	CCDS41752.1																																																																																				0.557	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509		22	36	0	0	0	0.012319	0	22	36				
KIAA1467	57613	broad.mit.edu	37	12	13215867	13215867	+	Silent	SNP	C	C	T	rs146598933	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:13215867C>T	ENST00000197268.8	+	5	930	c.810C>T	c.(808-810)gaC>gaT	p.D270D		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	270						integral component of membrane (GO:0016021)		p.D270D(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TGGATGAAGACGGTGTTCGAG	0.448																																							uc001rbi.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(808-810)GAC>GAT		hypothetical protein LOC57613		T		0,4406		0,0,2203	304.0	291.0	295.0		810	-5.4	0.0	12	dbSNP_134	295	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	KIAA1467	NM_020853.1		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		270/623	13215867	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	57613					integral to membrane		g.chr12:13215867C>T	AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.810C>T	12.37:g.13215867C>T						KIAA1467_uc009zhx.1_RNA	p.D270D	NM_020853	NP_065904	A2RU67	K1467_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.157)	5	833	+		Prostate(47;0.184)	270					Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Silent	SNP	ENST00000197268.8	37	c.810C>T	CCDS31750.1																																																																																				0.448	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401007.1	NM_020853		42	242	0	0	0	0.01441	0	42	242				
RERGL	79785	broad.mit.edu	37	12	18234173	18234173	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:18234173C>A	ENST00000229002.2	-	6	776	c.570G>T	c.(568-570)atG>atT	p.M190I	RERGL_ENST00000541632.1_5'Flank|RERGL_ENST00000538724.1_Missense_Mutation_p.M189I	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	190	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.M190I(2)		endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						TCAATTTGGCCATTGATTTAG	0.363																																							uc001rdq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(568-570)ATG>ATT		RERG/RAS-like							110.0	105.0	107.0					12																	18234173		2203	4300	6503	SO:0001583	missense	79785				signal transduction	membrane	GTP binding|GTPase activity	g.chr12:18234173C>A	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.570G>T	12.37:g.18234173C>A	ENSP00000229002:p.Met190Ile					RERGL_uc001rdr.2_Missense_Mutation_p.M189I	p.M190I	NM_024730	NP_079006	Q9H628	RERGL_HUMAN			6	764	-			190			Small GTPase-like.			Missense_Mutation	SNP	ENST00000229002.2	37	c.570G>T	CCDS8679.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297917	0.23650	.	.	ENSG00000111404	ENST00000229002;ENST00000538724	T;T	0.74315	-0.73;-0.83	4.58	4.58	0.56647	.	0.188602	0.53938	D	0.000046	T	0.54886	0.1886	N	0.04508	-0.205	0.80722	D	1	B;B	0.19817	0.0;0.039	B;B	0.21546	0.0;0.035	T	0.52275	-0.8597	10	0.29301	T	0.29	.	16.4305	0.83840	0.0:1.0:0.0:0.0	.	189;190	F5H686;Q9H628	.;RERGL_HUMAN	I	190;189	ENSP00000229002:M190I;ENSP00000437814:M189I	ENSP00000229002:M190I	M	-	3	0	RERGL	18125440	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.357000	0.66058	2.462000	0.83206	0.563000	0.77884	ATG		0.363	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730		10	43	1	0	0.00621372	0.006214	0.00669487	10	43				
SLCO1B3	28234	broad.mit.edu	37	12	21011412	21011412	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:21011412C>G	ENST00000381545.3	+	5	485	c.266C>G	c.(265-267)tCt>tGt	p.S89C	SLCO1B3_ENST00000545880.1_3'UTR|LST3_ENST00000381541.3_Missense_Mutation_p.S89C|LST3_ENST00000540229.1_Missense_Mutation_p.S89C|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.S89C|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.S89C|SLCO1B7_ENST00000554957.1_Missense_Mutation_p.S89C	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	89					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.S89C(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TACTTTGGATCTAAACTACAC	0.318																																							uc001rek.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|skin(1)	4						c.(265-267)TCT>TGT		solute carrier organic anion transporter family,							174.0	155.0	162.0					12																	21011412		2202	4299	6501	SO:0001583	missense	28234				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity	g.chr12:21011412C>G		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.266C>G	12.37:g.21011412C>G	ENSP00000370956:p.Ser89Cys					SLCO1B3_uc001rel.2_Missense_Mutation_p.S89C|SLCO1B3_uc010sil.1_Missense_Mutation_p.S89C|LST-3TM12_uc010sim.1_Missense_Mutation_p.S89C	p.S89C	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN			4	392	+	Esophageal squamous(101;0.149)		89			Cytoplasmic (Potential).		E7EMT8|Q5JAR4	Missense_Mutation	SNP	ENST00000381545.3	37	c.266C>G	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982345	0.74474	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046;ENSG00000257046;ENSG00000205754	ENST00000540853;ENST00000261196;ENST00000381545;ENST00000553473;ENST00000381541;ENST00000540229;ENST00000554957	T;T;T;T;T;T;T	0.80824	0.28;0.28;0.28;0.28;-1.42;0.28;-1.42	3.99	3.99	0.46301	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.162293	0.53938	D	0.000046	D	0.90253	0.6952	M	0.86097	2.795	0.40050	D	0.975766	D;D;D	0.89917	0.998;1.0;0.996	D;D;D	0.77557	0.917;0.99;0.95	D	0.92797	0.6253	10	0.87932	D	0	.	16.4451	0.83925	0.0:1.0:0.0:0.0	.	89;89;89	F5H094;Q5JAR4;Q9NPD5	.;.;SO1B3_HUMAN	C	89	ENSP00000442000:S89C;ENSP00000261196:S89C;ENSP00000370956:S89C;ENSP00000451758:S89C;ENSP00000370952:S89C;ENSP00000441269:S89C;ENSP00000452013:S89C	ENSP00000370952:S89C	S	+	2	0	SLCO1B3;SLCO1B7;RP11-545J16.1	20902679	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.365000	0.79537	1.926000	0.55796	0.460000	0.39030	TCT		0.318	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844		4	44	0	0	0	0.000602	0	4	44				
KIF21A	55605	broad.mit.edu	37	12	39751210	39751210	+	Silent	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:39751210C>T	ENST00000361418.5	-	9	1260	c.1245G>A	c.(1243-1245)gtG>gtA	p.V415V	KIF21A_ENST00000361961.3_Silent_p.V415V|KIF21A_ENST00000395670.3_Silent_p.V415V|KIF21A_ENST00000544797.2_Silent_p.V415V|KIF21A_ENST00000541463.2_Silent_p.V415V			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	415					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V415V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TGATGCTTTCCACACCCTCTT	0.368																																							uc001rly.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)|lung(1)|skin(1)	7						c.(1243-1245)GTG>GTA		kinesin family member 21A							127.0	116.0	120.0					12																	39751210		2203	4300	6503	SO:0001819	synonymous_variant	55605				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr12:39751210C>T	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1245G>A	12.37:g.39751210C>T						KIF21A_uc001rlx.2_Silent_p.V415V|KIF21A_uc001rlz.2_Silent_p.V415V|KIF21A_uc010skl.1_Silent_p.V415V|KIF21A_uc001rma.1_Silent_p.V423V	p.V415V	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN			9	1391	-		Lung NSC(34;0.179)|all_lung(34;0.213)	415			Potential.		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	37	c.1245G>A	CCDS53776.1																																																																																				0.368	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641		30	55	0	0	0	0.004878	0	30	55				
PLEKHA8P1	51054	broad.mit.edu	37	12	45567458	45567458	+	RNA	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:45567458C>A	ENST00000256692.5	-	0	1227					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)	p.D231Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CCAAGTTTGTCTAATACTGGA	0.383																																							uc001rom.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(691-693)GAC>TAC		pleckstrin homology domain containing, family A							202.0	186.0	191.0					12																	45567458		2203	4300	6503			51054							g.chr12:45567458C>A	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567458C>A						PLEKHA9_uc009zke.2_Missense_Mutation_p.D231Y	p.D231Y	NM_015899	NP_056983				GBM - Glioblastoma multiforme(48;0.173)	3	1228	-	Lung SC(27;0.192)|Renal(347;0.236)								Missense_Mutation	SNP	ENST00000256692.5	37	c.691G>T																																																																																					0.383	PLEKHA8P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000404814.1	NR_037144		54	90	1	0	1.83081e-24	0.01441	3.40307e-24	54	90				
ADCY6	112	broad.mit.edu	37	12	49170959	49170960	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:49170959_49170960CC>AA	ENST00000307885.4	-	5	1997_1998	c.1303_1304GG>TT	c.(1303-1305)GGg>TTg	p.G435L	ADCY6_ENST00000357869.3_Missense_Mutation_p.G435L|ADCY6_ENST00000552090.1_5'Flank|ADCY6_ENST00000550422.1_Missense_Mutation_p.G435L	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	435					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.G435L(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						CTCCGGCAGCCCTGACACACAG	0.559																																							uc001rsh.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1303-1305)GGG>TTG		adenylate cyclase 6 isoform a																																				SO:0001583	missense	112				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding	g.chr12:49170959_49170960CC>AA		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.1303_1304delinsAA	12.37:g.49170959_49170960delinsAA	ENSP00000311405:p.Gly435Leu					ADCY6_uc001rsj.3_Missense_Mutation_p.G435L|ADCY6_uc001rsi.3_Missense_Mutation_p.G435L|ADCY6_uc010slw.1_5'Flank	p.G435L	NM_015270	NP_056085	O43306	ADCY6_HUMAN			5	1963_1964	-			435			Cytoplasmic (Potential).		Q9NR75|Q9UDB0	Missense_Mutation	DNP	ENST00000307885.4	37	c.1303_1304GG>TT	CCDS8767.1																																																																																				0.559	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983		28	85	0	0	0	0.004672	0	28	85				
KRT81	3887	broad.mit.edu	37	12	52685241	52685241	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:52685241G>T	ENST00000327741.5	-	1	77	c.9C>A	c.(7-9)tgC>tgA	p.C3*	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	3	Head.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.C3*(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		ATCCTGATCCGCAGGTCATGA	0.657																																							uc001sab.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(7-9)TGC>TGA		keratin, hair, basic, 1							27.0	31.0	30.0					12																	52685241		2178	4237	6415	SO:0001587	stop_gained	3887					keratin filament	protein binding|structural molecule activity	g.chr12:52685241G>T	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.9C>A	12.37:g.52685241G>T	ENSP00000369349:p.Cys3*					KRT86_uc010snq.1_Intron|KRT86_uc009zmg.2_Intron|KRT81_uc001sac.2_Intron	p.C3*	NM_002281	NP_002272	Q14533	KRT81_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	1	59	-			3			Head.		Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Nonsense_Mutation	SNP	ENST00000327741.5	37	c.9C>A	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	g	21.9	4.220444	0.79464	.	.	ENSG00000205426	ENST00000327741;ENST00000389388	.	.	.	5.17	-1.96	0.07525	.	0.000000	0.37577	U	0.002035	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.91	0.24331	0.591:0.0:0.2931:0.116	.	.	.	.	X	3	.	ENSP00000369349:C3X	C	-	3	2	KRT81	50971508	.	.	0.954000	0.39281	0.549000	0.35272	.	.	-0.199000	0.10317	-0.230000	0.12252	TGC		0.657	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281		5	8	1	0	2.0095e-06	0.001984	2.59582e-06	5	8				
GLS2	27165	broad.mit.edu	37	12	56865309	56865309	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:56865309C>T	ENST00000311966.4	-	18	2049	c.1771G>A	c.(1771-1773)Gag>Aag	p.E591K	MIP_ENST00000555551.1_5'Flank|GLS2_ENST00000476991.1_5'Flank	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	591					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.E591K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	GACAGGGCCTCAGCTGCTGCC	0.502																																							uc001slj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1771-1773)GAG>AAG		glutaminase 2 precursor	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						65.0	57.0	60.0					12																	56865309		2203	4300	6503	SO:0001583	missense	27165				cellular amino acid biosynthetic process|glutamate secretion|glutamine metabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity|protein binding	g.chr12:56865309C>T		CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.1771G>A	12.37:g.56865309C>T	ENSP00000310447:p.Glu591Lys					GLS2_uc009zos.2_RNA|GLS2_uc001slk.2_Missense_Mutation_p.E326K|GLS2_uc009zot.2_Missense_Mutation_p.E252K	p.E591K	NM_013267	NP_037399	Q9UI32	GLSL_HUMAN			18	2050	-			591					B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Missense_Mutation	SNP	ENST00000311966.4	37	c.1771G>A	CCDS8921.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122202	0.37436	.	.	ENSG00000135423	ENST00000311966	T	0.26957	1.7	5.7	4.81	0.61882	.	0.178457	0.49916	D	0.000133	T	0.23054	0.0557	L	0.50333	1.59	0.80722	D	1	B	0.24368	0.102	B	0.20767	0.031	T	0.04333	-1.0959	10	0.12766	T	0.61	-42.4878	14.0685	0.64847	0.0:0.9262:0.0:0.0738	.	591	Q9UI32	GLSL_HUMAN	K	591	ENSP00000310447:E591K	ENSP00000310447:E591K	E	-	1	0	GLS2	55151576	0.706000	0.27856	0.709000	0.30452	0.275000	0.26752	2.169000	0.42434	1.561000	0.49584	0.655000	0.94253	GAG		0.502	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267		14	20	0	0	0	0.00245	0	14	20				
CAND1	55832	broad.mit.edu	37	12	67691560	67691560	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:67691560G>T	ENST00000545606.1	+	6	1218	c.781G>T	c.(781-783)Gta>Tta	p.V261L		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	261					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.V261L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TCCTTTGGTGGTAAAATTTTG	0.264																																							uc001stn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(781-783)GTA>TTA		TIP120 protein							84.0	91.0	89.0					12																	67691560		2203	4299	6502	SO:0001583	missense	55832				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding	g.chr12:67691560G>T		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.781G>T	12.37:g.67691560G>T	ENSP00000442318:p.Val261Leu					CAND1_uc001sto.2_5'Flank	p.V261L	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)	6	1218	+			261			HEAT 7.		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	c.781G>T	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138027	0.56936	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047	T	0.61627	0.09	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.111311	0.64402	D	0.000010	T	0.43787	0.1263	N	0.25245	0.725	0.80722	D	1	P	0.42296	0.775	B	0.34489	0.184	T	0.34204	-0.9838	9	.	.	.	-15.0201	20.0758	0.97742	0.0:0.0:1.0:0.0	.	261	Q86VP6	CAND1_HUMAN	L	261;261;103	ENSP00000442318:V261L	.	V	+	1	0	CAND1	65977827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.827000	0.99397	2.763000	0.94921	0.650000	0.86243	GTA		0.264	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448		6	42	1	0	5.18039e-06	0.00308	6.56992e-06	6	42				
NUP107	57122	broad.mit.edu	37	12	69084442	69084442	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:69084442G>T	ENST00000229179.4	+	4	551	c.219G>T	c.(217-219)caG>caT	p.Q73H	NUP107_ENST00000378905.2_5'UTR|NUP107_ENST00000539906.1_Missense_Mutation_p.Q44H	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	73					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)	p.Q73H(1)	NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			TACTAAGGCAGCCAGATATTT	0.423																																							uc001suf.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(217-219)CAG>CAT		nucleoporin 107kDa							107.0	106.0	106.0					12																	69084442		2203	4300	6503	SO:0001583	missense	57122				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding	g.chr12:69084442G>T	AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.219G>T	12.37:g.69084442G>T	ENSP00000229179:p.Gln73His					NUP107_uc001sug.2_5'UTR|NUP107_uc010stj.1_Missense_Mutation_p.Q44H	p.Q73H	NM_020401	NP_065134	P57740	NU107_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)		4	334	+	Breast(13;6.25e-06)		73					B4DZ67|Q6PJE1	Missense_Mutation	SNP	ENST00000229179.4	37	c.219G>T	CCDS8985.1	.	.	.	.	.	.	.	.	.	.	G	1.292	-0.607439	0.03717	.	.	ENSG00000111581	ENST00000229179;ENST00000539906	.	.	.	5.57	-6.23	0.02052	.	0.622262	0.17889	N	0.158574	T	0.10121	0.0248	N	0.00926	-1.1	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28202	-1.0051	8	.	.	.	-0.5664	0.7119	0.00926	0.2095:0.2764:0.172:0.3421	.	44;73	B4DZ67;P57740	.;NU107_HUMAN	H	73;44	.	.	Q	+	3	2	NUP107	67370709	0.298000	0.24417	0.104000	0.21259	0.213000	0.24496	-0.847000	0.04331	-1.546000	0.01717	0.563000	0.77884	CAG		0.423	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403195.1	NM_020401		19	48	1	0	2.39556e-15	0.00278	3.94135e-15	19	48				
OSBPL8	114882	broad.mit.edu	37	12	76788492	76788492	+	Silent	SNP	C	C	T	rs201950442	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:76788492C>T	ENST00000261183.3	-	9	1169	c.690G>A	c.(688-690)gcG>gcA	p.A230A	OSBPL8_ENST00000393250.4_Silent_p.A188A|OSBPL8_ENST00000393249.2_Silent_p.A188A	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	230	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)	p.A230A(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						TGGATCCAACCGCTTCACCTT	0.333													C|||	4	0.000798722	0.0	0.0	5008	,	,		16386	0.0		0.0	False		,,,				2504	0.0041						uc001sye.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(688-690)GCG>GCA		oxysterol-binding protein-like protein 8 isoform							70.0	68.0	69.0					12																	76788492		2203	4300	6503	SO:0001819	synonymous_variant	114882				lipid transport		lipid binding	g.chr12:76788492C>T	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.690G>A	12.37:g.76788492C>T						OSBPL8_uc001syf.1_Silent_p.A188A|OSBPL8_uc001syg.1_Silent_p.A188A|OSBPL8_uc001syh.1_Silent_p.A205A	p.A230A	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN			9	1170	-			230			PH.		A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Silent	SNP	ENST00000261183.3	37	c.690G>A	CCDS31862.1																																																																																				0.333	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1	NM_020841		11	26	0	0	0	0.008291	0	11	26				
NEDD1	121441	broad.mit.edu	37	12	97328824	97328824	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:97328824T>C	ENST00000266742.4	+	7	899	c.560T>C	c.(559-561)gTa>gCa	p.V187A	NEDD1_ENST00000429527.2_Missense_Mutation_p.V187A|NEDD1_ENST00000555114.1_3'UTR|NEDD1_ENST00000457368.2_Missense_Mutation_p.V98A|NEDD1_ENST00000557644.1_Missense_Mutation_p.V194A|NEDD1_ENST00000411739.2_Missense_Mutation_p.V98A	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	187					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)		p.V187A(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						AATGGAATAGTAACTCTCTGG	0.373																																							uc001teu.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(559-561)GTA>GCA		neural precursor cell expressed, developmentally							184.0	177.0	179.0					12																	97328824		2203	4300	6503	SO:0001583	missense	121441				cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol		g.chr12:97328824T>C		CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.560T>C	12.37:g.97328824T>C	ENSP00000266742:p.Val187Ala					NEDD1_uc001tev.3_Missense_Mutation_p.V187A|NEDD1_uc010svc.1_Missense_Mutation_p.V98A|NEDD1_uc001tew.2_Missense_Mutation_p.V194A|NEDD1_uc001tex.2_Missense_Mutation_p.V98A	p.V187A	NM_152905	NP_690869	Q8NHV4	NEDD1_HUMAN			7	899	+			187			WD 5.		B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	37	c.560T>C	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.012061	0.93346	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000553609;ENST00000557644;ENST00000457368	T;T;T;T;T;T	0.37584	1.22;1.22;1.19;1.22;1.22;1.19	5.71	5.71	0.89125	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.051446	0.85682	D	0.000000	T	0.59183	0.2175	M	0.69358	2.11	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.77557	0.99;0.874	T	0.61387	-0.7073	10	0.59425	D	0.04	.	15.9862	0.80155	0.0:0.0:0.0:1.0	.	194;187	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	A	187;187;98;98;194;98	ENSP00000266742:V187A;ENSP00000404978:V187A;ENSP00000411307:V98A;ENSP00000451830:V98A;ENSP00000451211:V194A;ENSP00000407964:V98A	ENSP00000266742:V187A	V	+	2	0	NEDD1	95852955	1.000000	0.71417	0.913000	0.36048	0.950000	0.60333	5.824000	0.69279	2.173000	0.68751	0.528000	0.53228	GTA		0.373	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1			9	139	0	0	0	0.010729	0	9	139				
SLC17A8	246213	broad.mit.edu	37	12	100796515	100796515	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:100796515A>G	ENST00000323346.5	+	8	1358	c.1045A>G	c.(1045-1047)Ata>Gta	p.I349V	SLC17A8_ENST00000392989.3_Intron|snoU13_ENST00000459038.1_RNA	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	349					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.I349V(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						TGGATTTGCAATAAGTAAGGT	0.323																																							uc010svi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1045-1047)ATA>GTA		solute carrier family 17 (sodium-dependent							74.0	67.0	69.0					12																	100796515		2202	4300	6502	SO:0001583	missense	246213				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr12:100796515A>G	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1045A>G	12.37:g.100796515A>G	ENSP00000316909:p.Ile349Val					SLC17A8_uc009ztx.2_Intron	p.I349V	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN			8	1358	+			349			Vesicular (Potential).		B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	c.1045A>G	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914625	0.72983	.	.	ENSG00000179520	ENST00000323346	T	0.54071	0.59	5.94	5.94	0.96194	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.51719	0.1691	L	0.48877	1.53	0.80722	D	1	B	0.24043	0.096	B	0.33392	0.163	T	0.45264	-0.9273	10	0.30854	T	0.27	.	16.3908	0.83537	1.0:0.0:0.0:0.0	.	349	Q8NDX2	VGLU3_HUMAN	V	349	ENSP00000316909:I349V	ENSP00000316909:I349V	I	+	1	0	SLC17A8	99320646	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.238000	0.95380	2.269000	0.75478	0.455000	0.32223	ATA		0.323	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319		12	16	0	0	0	0.001855	0	12	16				
HCFC2	29915	broad.mit.edu	37	12	104492250	104492250	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:104492250A>T	ENST00000229330.4	+	13	1974	c.1870A>T	c.(1870-1872)Atc>Ttc	p.I624F	HCFC2_ENST00000550335.1_3'UTR	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	624	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)	p.I624F(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GAAGCAAAGCATCTCAAAGGT	0.343																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)	Esophageal Squamous(184;1814 2036 4771 6974 15702)	uc001tkj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1870-1872)ATC>TTC		host cell factor C2							58.0	66.0	63.0					12																	104492250		2203	4300	6503	SO:0001583	missense	29915				regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity	g.chr12:104492250A>T	AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.1870A>T	12.37:g.104492250A>T	ENSP00000229330:p.Ile624Phe					HCFC2_uc009zul.2_RNA	p.I624F	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN			13	1973	+			624			Fibronectin type-III 2.		B2R8Q5|C0H5X3	Missense_Mutation	SNP	ENST00000229330.4	37	c.1870A>T	CCDS9097.1	.	.	.	.	.	.	.	.	.	.	A	2.383	-0.341727	0.05243	.	.	ENSG00000111727	ENST00000229330	T	0.01804	4.63	5.71	4.57	0.56435	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.624737	0.17359	N	0.177113	T	0.01695	0.0054	L	0.43152	1.355	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.49113	-0.8973	10	0.10902	T	0.67	-0.6898	4.4777	0.11752	0.6531:0.0:0.2115:0.1354	.	624	Q9Y5Z7	HCFC2_HUMAN	F	624	ENSP00000229330:I624F	ENSP00000229330:I624F	I	+	1	0	HCFC2	103016380	0.641000	0.27251	1.000000	0.80357	0.996000	0.88848	1.657000	0.37366	1.012000	0.39366	0.528000	0.53228	ATC		0.343	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320		37	67	0	0	0	0.006999	0	37	67				
CUX2	23316	broad.mit.edu	37	12	111785687	111785687	+	Missense_Mutation	SNP	G	G	T	rs375555910		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:111785687G>T	ENST00000261726.6	+	22	4173	c.4019G>T	c.(4018-4020)gGa>gTa	p.G1340V		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1340	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.G1340V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GGTAATGATGGACTCCCAAAA	0.637																																							uc001tsa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|breast(1)	6						c.(4018-4020)GGA>GTA		cut-like 2							71.0	82.0	78.0					12																	111785687		1939	4106	6045	SO:0001583	missense	23316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:111785687G>T	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.4019G>T	12.37:g.111785687G>T	ENSP00000261726:p.Gly1340Val						p.G1340V	NM_015267	NP_056082	O14529	CUX2_HUMAN			22	4172	+			1340			Pro-rich.		A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	c.4019G>T	CCDS41837.1	.	.	.	.	.	.	.	.	.	.	G	1.614	-0.523198	0.04141	.	.	ENSG00000111249	ENST00000261726	T	0.44881	0.91	5.44	-1.44	0.08856	.	1.319570	0.04827	N	0.438090	T	0.20007	0.0481	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.15484	0.013	T	0.14755	-1.0461	10	0.16896	T	0.51	0.3573	6.2865	0.21037	0.5402:0.0:0.3325:0.1273	.	1340	O14529	CUX2_HUMAN	V	1340	ENSP00000261726:G1340V	ENSP00000261726:G1340V	G	+	2	0	CUX2	110270070	0.011000	0.17503	0.005000	0.12908	0.012000	0.07955	0.488000	0.22371	-0.146000	0.11274	0.557000	0.71058	GGA		0.637	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		28	59	1	0	3.86903e-22	0.013726	7.03066e-22	28	59				
ACAD10	80724	broad.mit.edu	37	12	112186168	112186168	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:112186168G>T	ENST00000313698.4	+	17	2688	c.2533G>T	c.(2533-2535)Gac>Tac	p.D845Y	ACAD10_ENST00000392636.2_Missense_Mutation_p.D447Y|ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000455480.2_Missense_Mutation_p.D876Y	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	845						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.D845Y(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GGGAAAAACAGACCCACATGC	0.532																																							uc001tsq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2533-2535)GAC>TAC		acyl-Coenzyme A dehydrogenase family, member 10							135.0	121.0	126.0					12																	112186168		2203	4300	6503	SO:0001583	missense	80724						acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups	g.chr12:112186168G>T	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2533G>T	12.37:g.112186168G>T	ENSP00000325137:p.Asp845Tyr					ACAD10_uc001tsp.2_Missense_Mutation_p.D845Y|ACAD10_uc009zvx.2_Missense_Mutation_p.D876Y|ACAD10_uc001tss.1_RNA	p.D845Y	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN			17	2733	+			845					G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	c.2533G>T	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162877	0.78226	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000455480;ENST00000313698	D;D;D	0.96334	-3.98;-3.98;-3.98	5.87	4.98	0.66077	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.621765	0.16285	N	0.221156	D	0.98982	0.9653	H	0.99225	4.475	0.44055	D	0.996798	D;D;D	0.89917	0.976;1.0;1.0	P;D;D	0.87578	0.718;0.998;0.971	D	0.99164	1.0862	10	0.87932	D	0	.	13.3577	0.60638	0.0769:0.0:0.9231:0.0	.	876;845;845	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	Y	447;845;876;845	ENSP00000376411:D447Y;ENSP00000389813:D876Y;ENSP00000325137:D845Y	ENSP00000325137:D845Y	D	+	1	0	ACAD10	110670551	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	2.742000	0.47434	2.778000	0.95560	0.655000	0.94253	GAC		0.532	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247		11	64	1	0	3.86212e-05	0.008291	4.67874e-05	11	64				
OAS2	4939	broad.mit.edu	37	12	113416336	113416336	+	5'UTR	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:113416336C>A	ENST00000342315.4	+	0	137				OAS2_ENST00000392583.2_5'UTR|OAS2_ENST00000449768.2_5'UTR|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa						cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						TTTCAGTTTCCTGGCTCTGGG	0.532																																					Pancreas(199;709 2232 18410 33584 35052)	Pancreas(199;709 2232 18410 33584 35052)	uc001tuj.2		NA																	0				ovary(1)	1						c.(-79--75)TCCTG>TCATG		2'-5'-oligoadenylate synthetase 2 isoform 1																																				SO:0001623	5_prime_UTR_variant	4939				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding	g.chr12:113416336C>A	M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.-78C>A	12.37:g.113416336C>A						OAS2_uc001tuh.2_Translation_Start_Site|OAS2_uc001tui.1_Translation_Start_Site		NM_016817	NP_058197	P29728	OAS2_HUMAN			1	63	+								A8K9T1|Q6PJ33|Q86XX8	Translation_Start_Site	SNP	ENST00000342315.4	37	c.-77C>A	CCDS31906.1																																																																																				0.532	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1			3	8	1	0	0.004672	0.004672	0.00507871	3	8				
OAS2	4939	broad.mit.edu	37	12	113436106	113436106	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:113436106A>T	ENST00000342315.4	+	5	1113	c.899A>T	c.(898-900)aAt>aTt	p.N300I	OAS2_ENST00000392583.2_Missense_Mutation_p.N300I|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	300	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.N300I(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CCAACCAATAATGTGAGTGGA	0.423																																					Pancreas(199;709 2232 18410 33584 35052)	Pancreas(199;709 2232 18410 33584 35052)	uc001tuj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(898-900)AAT>ATT		2'-5'-oligoadenylate synthetase 2 isoform 1							124.0	119.0	121.0					12																	113436106		2203	4300	6503	SO:0001583	missense	4939				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding	g.chr12:113436106A>T	M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.899A>T	12.37:g.113436106A>T	ENSP00000342278:p.Asn300Ile					OAS2_uc001tui.1_Missense_Mutation_p.N300I	p.N300I	NM_016817	NP_058197	P29728	OAS2_HUMAN			5	1039	+			300			OAS domain 1.		A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	ENST00000342315.4	37	c.899A>T	CCDS31906.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341104	0.41498	.	.	ENSG00000111335	ENST00000342315;ENST00000392583;ENST00000552756	T;T;T	0.57752	0.38;0.38;0.38	3.82	2.63	0.31362	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	0.000000	0.36034	U	0.002832	T	0.69593	0.3128	M	0.86268	2.805	0.19945	N	0.999946	D;D	0.76494	0.997;0.999	D;D	0.70016	0.959;0.967	T	0.60120	-0.7325	10	0.87932	D	0	-14.6662	7.2189	0.25975	0.7723:0.2277:0.0:0.0	.	300;300	P29728;P29728-2	OAS2_HUMAN;.	I	300;300;225	ENSP00000342278:N300I;ENSP00000376362:N300I;ENSP00000446977:N225I	ENSP00000342278:N300I	N	+	2	0	OAS2	111920489	0.003000	0.15002	0.008000	0.14137	0.010000	0.07245	1.106000	0.31098	0.606000	0.29965	0.377000	0.23210	AAT		0.423	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1			69	80	0	0	0	0.01441	0	69	80				
RASAL1	8437	broad.mit.edu	37	12	113552717	113552717	+	Splice_Site	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:113552717G>A	ENST00000261729.5	-	13	1384	c.1069C>T	c.(1069-1071)Ctc>Ttc	p.L357F	RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000446861.3_Splice_Site_p.L357F|RASAL1_ENST00000548055.1_Splice_Site_p.L357F|RASAL1_ENST00000546530.1_Splice_Site_p.L357F			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	357	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.L357F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						ATGCCCACGAGCTGGGGGCAG	0.637																																							uc001tum.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1069-1071)CTC>TTC		RAS protein activator like 1							106.0	110.0	108.0					12																	113552717		2203	4300	6503	SO:0001630	splice_region_variant	8437				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity	g.chr12:113552717G>A	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1069-1C>T	12.37:g.113552717G>A						RASAL1_uc010syp.1_Missense_Mutation_p.L357F|RASAL1_uc001tul.2_Missense_Mutation_p.L357F|RASAL1_uc001tun.1_Missense_Mutation_p.L357F|RASAL1_uc010syq.1_Missense_Mutation_p.L357F|RASAL1_uc001tuo.3_Missense_Mutation_p.L357F|RASAL1_uc010syr.1_Missense_Mutation_p.L357F	p.L357F	NM_004658	NP_004649	O95294	RASL1_HUMAN			13	1362	-			357			Ras-GAP.		B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	c.1069C>T	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080888	0.55753	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	4.43	2.22	0.28083	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.416369	0.23554	N	0.046931	D	0.83445	0.5256	M	0.70595	2.14	0.41153	D	0.986045	D;D;D;D;D;D;D	0.67145	0.996;0.993;0.995;0.996;0.958;0.985;0.995	D;P;P;D;P;P;P	0.64687	0.928;0.88;0.881;0.928;0.823;0.889;0.881	T	0.82770	-0.0293	10	0.66056	D	0.02	.	2.0866	0.03647	0.12:0.3059:0.3957:0.1784	.	357;357;357;369;357;357;357	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	F	357	ENSP00000450244:L357F;ENSP00000261729:L357F;ENSP00000395920:L357F;ENSP00000448510:L357F	ENSP00000261729:L357F	L	-	1	0	RASAL1	112037100	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	3.591000	0.53986	2.014000	0.59158	0.313000	0.20887	CTC		0.637	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658	Missense_Mutation	10	133	0	0	0	0.008291	0	10	133				
FBXW8	26259	broad.mit.edu	37	12	117426644	117426644	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:117426644G>T	ENST00000309909.5	+	7	1291	c.1209G>T	c.(1207-1209)caG>caT	p.Q403H	RP11-231I16.1_ENST00000548738.1_RNA|FBXW8_ENST00000455858.2_Missense_Mutation_p.Q337H			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	403					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)		p.Q403H(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		TTGGTGTACAGGGTCTGGGAT	0.448																																							uc001twg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1207-1209)CAG>CAT		F-box and WD repeat domain containing 8 isoform							86.0	88.0	87.0					12																	117426644		2203	4300	6503	SO:0001583	missense	26259						protein binding	g.chr12:117426644G>T	AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1209G>T	12.37:g.117426644G>T	ENSP00000310686:p.Gln403His					FBXW8_uc001twf.1_Missense_Mutation_p.Q337H|FBXW8_uc009zwp.1_RNA	p.Q403H	NM_153348	NP_699179	Q8N3Y1	FBXW8_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0353)	7	1291	+	all_neural(191;0.117)|Medulloblastoma(191;0.163)		403					Q9UK95	Missense_Mutation	SNP	ENST00000309909.5	37	c.1209G>T	CCDS9182.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757787	0.49468	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.08720	3.07;3.06	5.9	4.84	0.62591	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.050423	0.85682	D	0.000000	T	0.06142	0.0159	N	0.08118	0	0.26624	N	0.972608	B;B	0.30361	0.277;0.234	B;B	0.41691	0.364;0.155	T	0.30851	-0.9964	10	0.40728	T	0.16	-26.8937	6.8532	0.24026	0.24:0.0:0.76:0.0	.	403;337	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	H	403;337;337	ENSP00000310686:Q403H;ENSP00000389144:Q337H	ENSP00000310686:Q403H	Q	+	3	2	FBXW8	115911027	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	2.326000	0.43849	2.806000	0.96561	0.655000	0.94253	CAG		0.448	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174		19	92	1	0	3.62473e-10	0.012319	5.36548e-10	19	92				
BRI3BP	140707	broad.mit.edu	37	12	125509731	125509731	+	Missense_Mutation	SNP	G	G	A	rs201462094		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:125509731G>A	ENST00000341446.8	+	3	602	c.511G>A	c.(511-513)Gtg>Atg	p.V171M		NM_080626.5	NP_542193.3			BRI3 binding protein									p.V171M(1)		large_intestine(1)|lung(8)|ovary(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)		CATGTCCTGCGTGTACATCCT	0.607																																							uc001uha.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(511-513)GTG>ATG		BRI3-binding protein							141.0	106.0	118.0					12																	125509731		2203	4300	6503	SO:0001583	missense	140707					integral to membrane|mitochondrial outer membrane		g.chr12:125509731G>A	AF284094	CCDS9262.1	12q24.1	2008-08-04			ENSG00000184992	ENSG00000184992			14251	protein-coding gene	gene with protein product		615627				11860200, 17765869	Standard	NM_080626		Approved	BNAS1, KG19, HCCR-2	uc001uha.1	Q8WY22	OTTHUMG00000168548	ENST00000341446.8:c.511G>A	12.37:g.125509731G>A	ENSP00000340761:p.Val171Met						p.V171M	NM_080626	NP_542193	Q8WY22	BRI3B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)	3	654	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		171						Missense_Mutation	SNP	ENST00000341446.8	37	c.511G>A	CCDS9262.1	.	.	.	.	.	.	.	.	.	.	g	14.03	2.412991	0.42817	.	.	ENSG00000184992	ENST00000341446	.	.	.	5.09	2.28	0.28536	.	0.329035	0.31673	N	0.007246	T	0.47192	0.1432	L	0.46157	1.445	0.34880	D	0.744536	B	0.26258	0.145	B	0.24269	0.052	T	0.52609	-0.8553	9	0.72032	D	0.01	-6.7558	8.614	0.33820	0.378:0.0:0.622:0.0	.	171	Q8WY22	BRI3B_HUMAN	M	171	.	ENSP00000340761:V171M	V	+	1	0	BRI3BP	124075684	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	2.049000	0.41288	0.181000	0.19994	0.556000	0.70494	GTG		0.607	BRI3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400200.2	NM_080626		14	76	0	0	0	0.001855	0	14	76				
CHFR	55743	broad.mit.edu	37	12	133420622	133420622	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr12:133420622C>G	ENST00000432561.2	-	16	1943	c.1870G>C	c.(1870-1872)Gag>Cag	p.E624Q	CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000315585.7_Missense_Mutation_p.E583Q|CHFR_ENST00000537522.1_Missense_Mutation_p.E246Q|CHFR_ENST00000541341.1_Missense_Mutation_p.E51Q|CHFR_ENST00000443047.2_Missense_Mutation_p.E532Q|CHFR_ENST00000450056.2_Missense_Mutation_p.E612Q|CHFR_ENST00000266880.7_Missense_Mutation_p.E623Q			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	624					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E624Q(1)|p.E583Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		CCTGGCAACTCGGAAGCAGGA	0.517																																							uc001ulf.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1870-1872)GAG>CAG		checkpoint with forkhead and ring finger domains							97.0	84.0	88.0					12																	133420622		2203	4300	6503	SO:0001583	missense	55743				cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr12:133420622C>G	AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.1870G>C	12.37:g.133420622C>G	ENSP00000392395:p.Glu624Gln					CHFR_uc001ulc.1_RNA|CHFR_uc001ule.2_Missense_Mutation_p.E612Q|CHFR_uc010tbs.1_Missense_Mutation_p.E623Q|CHFR_uc001uld.2_Missense_Mutation_p.E583Q|CHFR_uc010tbt.1_Missense_Mutation_p.E532Q	p.E624Q	NM_001161344	NP_001154816	Q96EP1	CHFR_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)	16	1954	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)	624					A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	37	c.1870G>C	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711391	0.48517	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000537522;ENST00000432561	T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3	5.78	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.61060	0.2317	M	0.78637	2.42	0.80722	D	1	P;D;D;D;D	0.71674	0.674;0.998;0.996;0.998;0.968	P;D;D;D;P	0.72625	0.549;0.978;0.952;0.978;0.859	T	0.63519	-0.6619	10	0.40728	T	0.16	-12.6029	16.4857	0.84183	0.0:0.8686:0.1314:0.0	.	532;623;624;612;583	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	Q	583;532;612;623;246;624	ENSP00000320557:E583Q;ENSP00000416431:E532Q;ENSP00000398735:E612Q;ENSP00000266880:E623Q;ENSP00000442327:E246Q;ENSP00000392395:E624Q	ENSP00000266880:E623Q	E	-	1	0	CHFR	131930695	1.000000	0.71417	0.060000	0.19600	0.035000	0.12851	6.887000	0.75616	1.428000	0.47296	-0.181000	0.13052	GAG		0.517	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2			6	18	0	0	0	0.001984	0	6	18				
BRCA2	675	broad.mit.edu	37	13	32937423	32937423	+	Nonsense_Mutation	SNP	C	C	A	rs80359048		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr13:32937423C>A	ENST00000380152.3	+	18	8317	c.8084C>A	c.(8083-8085)tCa>tAa	p.S2695*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.S2695*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2695					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.S2695*(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GACATAATTTCATTGAGCGCA	0.368			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	uc001uub.1		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	D|Mis|N|F|S	familial breast/ovarian cancer gene 2			"""L, E"""		breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)	breast|ovarian|pancreatic		2	Substitution - Nonsense(2)		lung(2)	ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64						c.(8083-8085)TCA>TAA	Direct_reversal_of_damage|Homologous_recombination	breast cancer 2, early onset							100.0	97.0	98.0					13																	32937423		2203	4300	6503	SO:0001587	stop_gained	675	FanconAnemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	g.chr13:32937423C>A	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8084C>A	13.37:g.32937423C>A	ENSP00000369497:p.Ser2695*	TCGA Ovarian(8;0.087)					p.S2695*	NM_000059	NP_000050	P51587	BRCA2_HUMAN		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)	18	8311	+		Lung SC(185;0.0262)	2695					O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	ENST00000380152.3	37	c.8084C>A	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	49	15.427978	0.99833	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	4.94	4.1	0.47936	.	0.068240	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.655	0.62333	0.0:0.9243:0.0:0.0757	.	.	.	.	X	2695	.	ENSP00000369497:S2695X	S	+	2	0	BRCA2	31835423	0.667000	0.27484	0.153000	0.22517	0.524000	0.34500	3.023000	0.49666	1.217000	0.43442	0.313000	0.20887	TCA		0.368	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		15	87	1	0	1.02788e-11	0.00499	1.57911e-11	15	87				
TRPC4	7223	broad.mit.edu	37	13	38320279	38320279	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr13:38320279C>A	ENST00000379705.3	-	3	1549	c.692G>T	c.(691-693)aGc>aTc	p.S231I	TRPC4_ENST00000379681.3_Missense_Mutation_p.S231I|TRPC4_ENST00000426868.2_Missense_Mutation_p.S231I|TRPC4_ENST00000379673.2_Missense_Mutation_p.S231I|TRPC4_ENST00000338947.5_Intron|TRPC4_ENST00000447043.1_Missense_Mutation_p.S231I|TRPC4_ENST00000358477.2_Missense_Mutation_p.S231I|TRPC4_ENST00000379679.1_Intron|TRPC4_ENST00000355779.2_Missense_Mutation_p.S231I			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	231					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.S231I(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTCCACCTTGCTCAGTTCCTG	0.463																																							uc001uws.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)	6						c.(691-693)AGC>ATC		transient receptor potential cation channel,							126.0	114.0	118.0					13																	38320279		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38320279C>A	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.692G>T	13.37:g.38320279C>A	ENSP00000369027:p.Ser231Ile					TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.S231I|TRPC4_uc010tey.1_Missense_Mutation_p.S231I|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Missense_Mutation_p.S231I|TRPC4_uc010aby.2_Missense_Mutation_p.S231I	p.S231I	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	3	927	-			231			Potential.|Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.692G>T	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928471	0.92389	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	6.07	6.07	0.98685	Transient receptor potential II (1);	0.000000	0.85682	D	0.000000	D	0.89539	0.6744	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.997;0.999;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.994;0.999;1.0	D	0.89466	0.3740	10	0.87932	D	0	-24.6076	20.6593	0.99626	0.0:1.0:0.0:0.0	.	231;231;231;231;231	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	I	231	ENSP00000369027:S231I;ENSP00000369003:S231I;ENSP00000410133:S231I;ENSP00000348025:S231I;ENSP00000351264:S231I;ENSP00000368995:S231I;ENSP00000414316:S231I	ENSP00000348025:S231I	S	-	2	0	TRPC4	37218279	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	AGC		0.463	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		11	49	1	0	3.86212e-05	0.008291	4.67874e-05	11	49				
CKAP2	26586	broad.mit.edu	37	13	53036058	53036058	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr13:53036058G>C	ENST00000378037.5	+	4	1190	c.1100G>C	c.(1099-1101)aGa>aCa	p.R367T	CKAP2_ENST00000490903.1_Missense_Mutation_p.R318T|CKAP2_ENST00000258607.5_Missense_Mutation_p.R366T|CKAP2_ENST00000378034.3_Missense_Mutation_p.R366T	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2									p.R366T(1)		breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		TCGGAAGAGAGAAAGTAAGTA	0.348																																							uc001vgv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1099-1101)AGA>ACA		cytoskeleton associated protein 2 isoform 2							34.0	34.0	34.0					13																	53036058		2011	4210	6221	SO:0001583	missense	26586				apoptosis|cell cycle	centrosome|microtubule|spindle pole		g.chr13:53036058G>C	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1100G>C	13.37:g.53036058G>C	ENSP00000367276:p.Arg367Thr					CKAP2_uc001vgt.2_Missense_Mutation_p.R366T|CKAP2_uc001vgu.2_Missense_Mutation_p.R366T|CKAP2_uc010tha.1_Missense_Mutation_p.R318T	p.R367T	NM_001098525	NP_001091995	Q8WWK9	CKAP2_HUMAN		GBM - Glioblastoma multiforme(99;2.6e-08)	4	1297	+		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	367						Missense_Mutation	SNP	ENST00000378037.5	37	c.1100G>C	CCDS41893.1	.	.	.	.	.	.	.	.	.	.	.	16.16	3.043681	0.55003	.	.	ENSG00000136108	ENST00000398044;ENST00000258607;ENST00000378034;ENST00000378037;ENST00000490903	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	6.05	6.05	0.98169	.	0.057209	0.64402	D	0.000001	T	0.54224	0.1845	M	0.84683	2.71	0.47441	D	0.999424	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.85130	0.913;0.913;0.997;0.935	T	0.56884	-0.7905	9	.	.	.	-36.3463	12.4772	0.55821	0.0763:0.0:0.9237:0.0	.	318;367;366;367	E9PD90;Q8WWK9;B2RMQ4;A8MYU4	.;CKAP2_HUMAN;.;.	T	367;366;366;367;318	ENSP00000258607:R366T;ENSP00000367273:R366T;ENSP00000367276:R367T;ENSP00000417830:R318T	.	R	+	2	0	CKAP2	51934059	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	5.294000	0.65687	2.878000	0.98634	0.650000	0.86243	AGA		0.348	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355010.2			9	31	0	0	0	0.004482	0	9	31				
PCDH8	5100	broad.mit.edu	37	13	53418802	53418802	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr13:53418802G>T	ENST00000377942.3	-	3	3309	c.3106C>A	c.(3106-3108)Ccc>Acc	p.P1036T	PCDH8_ENST00000338862.4_Missense_Mutation_p.P939T	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	1036					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.P1036T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CCTGGACGGGGAGGGGAGAGC	0.582																																					GBM(36;25 841 9273 49207)	GBM(36;25 841 9273 49207)	uc001vhi.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(3106-3108)CCC>ACC		protocadherin 8 isoform 1 precursor							145.0	135.0	139.0					13																	53418802		2203	4300	6503	SO:0001583	missense	5100				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding	g.chr13:53418802G>T	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.3106C>A	13.37:g.53418802G>T	ENSP00000367177:p.Pro1036Thr					PCDH8_uc001vhj.2_Missense_Mutation_p.P939T	p.P1036T	NM_002590	NP_002581	O95206	PCDH8_HUMAN		GBM - Glioblastoma multiforme(99;2.19e-08)	3	3309	-		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	1036			Cytoplasmic (Potential).		B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	c.3106C>A	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320486	0.23994	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.57436	0.56;0.4	5.95	5.1	0.69264	.	0.000000	0.41712	D	0.000825	T	0.48077	0.1480	L	0.40543	1.245	0.47862	D	0.999533	B;B	0.14438	0.01;0.006	B;B	0.17098	0.017;0.007	T	0.44590	-0.9318	10	0.87932	D	0	.	16.6884	0.85315	0.0:0.0:0.8693:0.1307	.	939;1036	O95206-2;O95206	.;PCDH8_HUMAN	T	1036;939;562;879	ENSP00000367177:P1036T;ENSP00000341350:P939T	ENSP00000341350:P939T	P	-	1	0	PCDH8	52316803	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	6.396000	0.73234	1.516000	0.48900	-0.261000	0.10672	CCC		0.582	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590		11	77	1	0	3.86212e-05	0.008291	4.67874e-05	11	77				
TMTC4	84899	broad.mit.edu	37	13	101320951	101320951	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr13:101320951G>C	ENST00000376234.3	-	2	233	c.44C>G	c.(43-45)tCt>tGt	p.S15C	TMTC4_ENST00000342624.5_Missense_Mutation_p.S34C|TMTC4_ENST00000328767.5_Missense_Mutation_p.S15C	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	15						integral component of membrane (GO:0016021)		p.S34C(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGGAAGAACAGAAGATGGAAG	0.473																																							uc001vou.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(43-45)TCT>TGT		transmembrane and tetratricopeptide repeat							123.0	113.0	117.0					13																	101320951		1976	4154	6130	SO:0001583	missense	84899					integral to membrane	binding	g.chr13:101320951G>C		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.44C>G	13.37:g.101320951G>C	ENSP00000365408:p.Ser15Cys					TMTC4_uc001vot.2_Missense_Mutation_p.S34C|TMTC4_uc010tja.1_Missense_Mutation_p.S15C	p.S15C	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN			2	204	-	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		15			Helical; (Potential).		A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	c.44C>G	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	g	6.290	0.421522	0.11928	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767;ENST00000475272;ENST00000423847	T;T;T	0.46063	0.88;0.88;1.03	5.29	3.45	0.39498	.	0.283185	0.40908	N	0.000991	T	0.32315	0.0825	L	0.48642	1.525	0.09310	N	1	B;B;B	0.13594	0.0;0.005;0.008	B;B;B	0.16289	0.0;0.004;0.015	T	0.31998	-0.9923	10	0.66056	D	0.02	.	4.9935	0.14226	0.1748:0.3722:0.453:0.0	.	15;15;34	B7Z666;Q5T4D3;Q5T4D3-3	.;TMTC4_HUMAN;.	C	15;34;15;34;15	ENSP00000365408:S15C;ENSP00000343871:S34C;ENSP00000365409:S15C	ENSP00000365409:S15C	S	-	2	0	TMTC4	100118952	0.140000	0.22579	0.001000	0.08648	0.058000	0.15608	2.077000	0.41557	0.537000	0.28751	0.558000	0.71614	TCT		0.473	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813		11	43	0	0	0	0.008291	0	11	43				
OR4N2	390429	broad.mit.edu	37	14	20296384	20296384	+	Silent	SNP	G	G	A	rs149732016	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:20296384G>A	ENST00000315947.1	+	1	777	c.777G>A	c.(775-777)acG>acA	p.T259T	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T259T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCATCTACACGCGCCCCTTCA	0.468													.|||	8	0.00159744	0.0008	0.0029	5008	,	,		26768	0.0		0.005	False		,,,				2504	0.0						uc010tkv.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(775-777)ACG>ACA		olfactory receptor, family 4, subfamily N,		G		4,4402		0,4,2199	103.0	109.0	107.0		777	-9.1	0.7	14	dbSNP_134	107	14,8586		0,14,4286	no	coding-synonymous	OR4N2	NM_001004723.1		0,18,6485	AA,AG,GG		0.1628,0.0908,0.1384		259/308	20296384	18,12988	2203	4300	6503	SO:0001819	synonymous_variant	390429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20296384G>A		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.777G>A	14.37:g.20296384G>A							p.T259T	NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	777	+	all_cancers(95;0.00108)		259			Extracellular (Potential).		Q6IEY9|Q6IFA2	Silent	SNP	ENST00000315947.1	37	c.777G>A	CCDS32022.1																																																																																				0.468	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			15	83	0	0	0	0.00245	0	15	83				
CTSG	1511	broad.mit.edu	37	14	25044512	25044512	+	Silent	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:25044512C>A	ENST00000216336.2	-	2	198	c.162G>T	c.(160-162)gtG>gtT	p.V54V		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	54	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.V54V(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		AGTCTTCTCGCACCAGGAACC	0.602																																							uc001wpq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(160-162)GTG>GTT		cathepsin G preproprotein							111.0	103.0	106.0					14																	25044512		2203	4300	6503	SO:0001819	synonymous_variant	1511				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity	g.chr14:25044512C>A	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.162G>T	14.37:g.25044512C>A							p.V54V	NM_001911	NP_001902	P08311	CATG_HUMAN		GBM - Glioblastoma multiforme(265;0.0269)	2	199	-			54			Peptidase S1.		Q6IBJ6|Q9UCA5|Q9UCU6	Silent	SNP	ENST00000216336.2	37	c.162G>T	CCDS9631.1																																																																																				0.602	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911		7	56	1	0	8.12818e-05	0.001984	9.60783e-05	7	56				
EGLN3	112399	broad.mit.edu	37	14	34396240	34396240	+	Splice_Site	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:34396240C>A	ENST00000250457.3	-	4	943		c.e4-1		EGLN3_ENST00000553215.1_Splice_Site	NM_022073.3	NP_071356.1	Q9H6Z9	EGLN3_HUMAN	egl-9 family hypoxia-inducible factor 3						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein hydroxylation (GO:0018126)|regulation of cell proliferation (GO:0042127)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.?(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|upper_aerodigestive_tract(1)	15	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)	CATAGCATATCTGTGAAAGAT	0.313																																					Esophageal Squamous(161;245 1904 13895 22565 30076)	Esophageal Squamous(161;245 1904 13895 22565 30076)	uc001wsa.3		NA																	1	Unknown(1)		lung(1)		0						c.e4-1		egl nine homolog 3	Vitamin C(DB00126)						62.0	57.0	59.0					14																	34396240		2203	4297	6500	SO:0001630	splice_region_variant	112399				apoptosis	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding	g.chr14:34396240C>A	AJ310545	CCDS9646.1	14q12	2013-08-21	2013-08-21		ENSG00000129521	ENSG00000129521			14661	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 3"""	606426	"""EGL nine (C.elegans) homolog 3"", ""egl nine homolog 3 (C. elegans)"""				Standard	NM_022073		Approved	PHD3, HIFPH3	uc001wsa.4	Q9H6Z9	OTTHUMG00000029498	ENST00000250457.3:c.615-1G>T	14.37:g.34396240C>A						EGLN3_uc001wry.2_Splice_Site_p.R111_splice|EGLN3_uc001wrz.2_Splice_Site_p.R205_splice	p.R205_splice	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	4	941	-	Breast(36;0.0303)|Hepatocellular(127;0.133)							Q2TA79|Q3B8N4|Q6P1R2	Splice_Site	SNP	ENST00000250457.3	37	c.615_splice	CCDS9646.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450286	0.84101	.	.	ENSG00000129521	ENST00000250457;ENST00000539567;ENST00000553215	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8366	0.96659	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EGLN3	33465991	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.773000	0.85462	2.760000	0.94817	0.644000	0.83932	.		0.313	EGLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276647.1		Intron	6	49	1	0	0.00307968	0.00308	0.00339322	6	49				
MDGA2	161357	broad.mit.edu	37	14	47346708	47346708	+	Silent	SNP	A	A	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:47346708A>C	ENST00000399232.2	-	12	2578	c.2214T>G	c.(2212-2214)ccT>ccG	p.P738P	MDGA2_ENST00000426342.1_Silent_p.P509P|MDGA2_ENST00000439988.3_Silent_p.P807P|MDGA2_ENST00000357362.3_Silent_p.P509P|MDGA2_ENST00000399222.3_Intron	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	738	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P509P(2)|p.P807P(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						GAGGATTTACAGGAGCTACAA	0.239																																							uc001wwj.3		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(4)|large_intestine(1)|pancreas(1)	6						c.(2212-2214)CCT>CCG		MAM domain containing 1 isoform 1							10.0	10.0	10.0					14																	47346708		1749	3910	5659	SO:0001819	synonymous_variant	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47346708A>C	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2214T>G	14.37:g.47346708A>C						MDGA2_uc001wwh.3_Intron|MDGA2_uc001wwi.3_Silent_p.P509P|MDGA2_uc010ani.2_Silent_p.P298P	p.P738P	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN			12	2410	-			738					F6W3S7|J3KPX6	Silent	SNP	ENST00000399232.2	37	c.2214T>G																																																																																					0.239	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		3	3	0	0	0	0.004672	0	3	3				
SPTB	6710	broad.mit.edu	37	14	65271709	65271709	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:65271709C>A	ENST00000389721.5	-	2	280	c.248G>T	c.(247-249)cGg>cTg	p.R83L	SPTB_ENST00000389722.3_Missense_Mutation_p.R83L|SPTB_ENST00000389720.3_Missense_Mutation_p.R83L|SPTB_ENST00000556626.1_Missense_Mutation_p.R83L|SPTB_ENST00000542895.1_Missense_Mutation_p.R83L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	83	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.R83L(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCGCCCATCCCGCAGGTCCTT	0.587																																							uc001xht.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11						c.(247-249)CGG>CTG		spectrin beta isoform b							88.0	85.0	86.0					14																	65271709		2203	4300	6503	SO:0001583	missense	6710				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton	g.chr14:65271709C>A		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.248G>T	14.37:g.65271709C>A	ENSP00000374371:p.Arg83Leu					SPTB_uc001xhr.2_Missense_Mutation_p.R83L|SPTB_uc001xhs.2_Missense_Mutation_p.R83L|SPTB_uc001xhu.2_Missense_Mutation_p.R83L	p.R83L	NM_000347	NP_000338	P11277	SPTB1_HUMAN		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)	2	302	-		all_lung(585;4.15e-09)	83			CH 1.|Actin-binding.		Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	c.248G>T	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	33	5.214443	0.95104	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08	4.67	4.67	0.58626	Calponin homology domain (5);	0.090781	0.51477	D	0.000083	T	0.81456	0.4826	M	0.92412	3.305	0.58432	D	0.999997	D;D	0.89917	1.0;0.992	D;P	0.79108	0.992;0.87	D	0.86284	0.1669	10	0.87932	D	0	.	16.9303	0.86189	0.0:1.0:0.0:0.0	.	83;87	P11277;Q59FP5	SPTB1_HUMAN;.	L	87;83;83;83;83;83	ENSP00000374372:R83L;ENSP00000451752:R83L;ENSP00000374371:R83L;ENSP00000443882:R83L;ENSP00000374370:R83L	ENSP00000374370:R83L	R	-	2	0	SPTB	64341462	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.492000	0.81482	2.602000	0.87976	0.650000	0.86243	CGG		0.587	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			17	53	1	0	0.000422831	0.004007	0.000482246	17	53				
ISM2	145501	broad.mit.edu	37	14	77942014	77942014	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:77942014T>A	ENST00000342219.4	-	7	1696	c.1640A>T	c.(1639-1641)aAc>aTc	p.N547I	ISM2_ENST00000429906.1_Missense_Mutation_p.N466I|ISM2_ENST00000493585.1_3'UTR|ISM2_ENST00000393684.3_Missense_Mutation_p.N459I|ISM2_ENST00000412904.1_Missense_Mutation_p.N466I	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	547	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)		p.N547I(1)		endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						TCGGCCGTTGTTGGGAGGGAG	0.607																																							uc001xtz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1639-1641)AAC>ATC		isthmin 2 homolog isoform 1							86.0	81.0	83.0					14																	77942014		2203	4300	6503	SO:0001583	missense	145501					extracellular region		g.chr14:77942014T>A	AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.1640A>T	14.37:g.77942014T>A	ENSP00000341490:p.Asn547Ile					ISM2_uc001xua.2_3'UTR|ISM2_uc001xty.2_Missense_Mutation_p.N459I|ISM2_uc010tvl.1_Missense_Mutation_p.N466I	p.N547I	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN			7	1714	-			547			AMOP.		A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Missense_Mutation	SNP	ENST00000342219.4	37	c.1640A>T	CCDS9864.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.011325	0.54361	.	.	ENSG00000100593	ENST00000342219;ENST00000412904;ENST00000429906;ENST00000393684	T;T;T;T	0.38560	1.13;1.19;1.2;1.52	4.67	4.67	0.58626	AMOP (3);	0.000000	0.85682	D	0.000000	T	0.67562	0.2906	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.74368	-0.3688	10	0.87932	D	0	-9.7569	14.1109	0.65121	0.0:0.0:0.0:1.0	.	466;547	Q6H9L7-5;Q6H9L7	.;ISM2_HUMAN	I	547;466;466;459	ENSP00000341490:N547I;ENSP00000416773:N466I;ENSP00000395387:N466I;ENSP00000377289:N459I	ENSP00000341490:N547I	N	-	2	0	ISM2	77011767	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	7.824000	0.86668	1.740000	0.51718	0.379000	0.24179	AAC		0.607	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509		11	24	0	0	0	0.008291	0	11	24				
ITPK1	3705	broad.mit.edu	37	14	93408241	93408241	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:93408241C>A	ENST00000267615.6	-	11	1083	c.910G>T	c.(910-912)Ggc>Tgc	p.G304C	ITPK1_ENST00000556603.2_Missense_Mutation_p.G304C|ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000555495.1_Missense_Mutation_p.G185C			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	304	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)	p.G304C(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TCGCTCACGCCCTCGTAGCCT	0.652																																							uc001ybg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(910-912)GGC>TGC		inositol 1,3,4-triphosphate 5/6 kinase isoform							21.0	17.0	18.0					14																	93408241		2128	4174	6302	SO:0001583	missense	3705				blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding	g.chr14:93408241C>A	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.910G>T	14.37:g.93408241C>A	ENSP00000267615:p.Gly304Cys					ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Missense_Mutation_p.G185C|ITPK1_uc001ybh.2_Missense_Mutation_p.G304C	p.G304C	NM_014216	NP_055031	Q13572	ITPK1_HUMAN		Epithelial(152;0.124)|all cancers(159;0.169)	11	1199	-		all_cancers(154;0.077)|all_epithelial(191;0.247)	304			ATP-grasp.		Q9BTL6|Q9H2E7	Missense_Mutation	SNP	ENST00000267615.6	37	c.910G>T	CCDS9907.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356707	0.82243	.	.	ENSG00000100605	ENST00000405174;ENST00000556603;ENST00000555495;ENST00000267615;ENST00000311458	.	.	.	4.59	4.59	0.56863	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.83243	0.5212	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86685	0.1919	9	0.87932	D	0	-11.761	17.42	0.87512	0.0:1.0:0.0:0.0	.	304	Q13572	ITPK1_HUMAN	C	334;304;185;304;304	.	ENSP00000267615:G304C	G	-	1	0	ITPK1	92477994	1.000000	0.71417	0.998000	0.56505	0.842000	0.47809	7.465000	0.80898	2.113000	0.64589	0.563000	0.77884	GGC		0.652	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216		8	8	1	0	0.00621372	0.006214	0.00669487	8	8				
WARS	7453	broad.mit.edu	37	14	100803403	100803403	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:100803403C>A	ENST00000355338.2	-	10	1868	c.1250G>T	c.(1249-1251)aGg>aTg	p.R417M	RP11-638I2.8_ENST00000557226.1_RNA|WARS_ENST00000392882.2_Missense_Mutation_p.R417M|WARS_ENST00000358655.4_Missense_Mutation_p.R376M|WARS_ENST00000556645.1_Missense_Mutation_p.R376M|WARS_ENST00000557135.1_Missense_Mutation_p.R417M|WARS_ENST00000344102.5_Missense_Mutation_p.R376M|RP11-638I2.9_ENST00000556212.1_RNA	NM_173701.1	NP_776049.1	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase	417					angiogenesis (GO:0001525)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|regulation of angiogenesis (GO:0045765)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)	p.R417M(1)|p.?(1)		breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	GCTCACCTTCCTGATCTGCTC	0.602																																							uc001yhf.1		NA																	2	Substitution - Missense(1)|Unknown(1)		ovary(1)|lung(1)	breast(1)	1						c.(1249-1251)AGG>ATG		tryptophanyl-tRNA synthetase isoform a	L-Tryptophan(DB00150)						178.0	157.0	164.0					14																	100803403		2203	4300	6503	SO:0001583	missense	7453				angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity	g.chr14:100803403C>A	M61715	CCDS9960.1, CCDS9961.1	14q32.2	2014-03-19			ENSG00000140105	ENSG00000140105	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12729	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 1, cytoplasmic"""	191050		IFI53		1537332, 1763065	Standard	NM_004184		Approved	IFP53	uc001yhl.1	P23381	OTTHUMG00000171572	ENST00000355338.2:c.1250G>T	14.37:g.100803403C>A	ENSP00000347495:p.Arg417Met					WARS_uc001yhe.1_Missense_Mutation_p.R223M|WARS_uc001yhg.1_Missense_Mutation_p.R417M|WARS_uc001yhh.1_Missense_Mutation_p.R417M|WARS_uc001yhi.1_Missense_Mutation_p.R376M|WARS_uc001yhj.1_Missense_Mutation_p.R376M|WARS_uc001yhk.1_Missense_Mutation_p.R376M|WARS_uc001yhl.1_Missense_Mutation_p.R417M	p.R417M	NM_173701	NP_776049	P23381	SYWC_HUMAN			9	1334	-		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)	417					A6NGN1|A6NID3|P78535|Q502Y0|Q53XB6|Q9UDI5|Q9UDL3	Missense_Mutation	SNP	ENST00000355338.2	37	c.1250G>T	CCDS9960.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123019	0.77436	.	.	ENSG00000140105	ENST00000392882;ENST00000358655;ENST00000355338;ENST00000344102;ENST00000557135;ENST00000556645	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76	5.67	2.65	0.31530	.	0.201459	0.51477	D	0.000087	T	0.65554	0.2702	M	0.92555	3.32	0.49299	D	0.99977	D	0.55385	0.971	P	0.56700	0.804	T	0.67035	-0.5772	10	0.51188	T	0.08	-5.3317	6.9306	0.24439	0.0:0.585:0.0:0.415	.	417	P23381	SYWC_HUMAN	M	417;376;417;376;417;376	ENSP00000376620:R417M;ENSP00000351481:R376M;ENSP00000347495:R417M;ENSP00000339485:R376M;ENSP00000451460:R417M;ENSP00000451887:R376M	ENSP00000339485:R376M	R	-	2	0	WARS	99873156	0.986000	0.35501	0.939000	0.37840	0.982000	0.71751	1.160000	0.31761	0.789000	0.33779	0.591000	0.81541	AGG		0.602	WARS-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414236.1	NM_004184		13	96	1	0	3.41278e-10	0.00499	5.06715e-10	13	96				
AHNAK2	113146	broad.mit.edu	37	14	105410286	105410286	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr14:105410286C>A	ENST00000333244.5	-	7	11621	c.11502G>T	c.(11500-11502)gaG>gaT	p.E3834D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3834						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.E3834D(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCACATCGGCCTCCACCTTGG	0.592																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(11500-11502)GAG>GAT		AHNAK nucleoprotein 2							176.0	177.0	176.0					14																	105410286		2007	4162	6169	SO:0001583	missense	113146					nucleus		g.chr14:105410286C>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11502G>T	14.37:g.105410286C>A	ENSP00000353114:p.Glu3834Asp					AHNAK2_uc001ypx.2_Missense_Mutation_p.E3734D	p.E3834D	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	11622	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3834					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.11502G>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	t	7.405	0.633477	0.14322	.	.	ENSG00000185567	ENST00000333244	T	0.00557	6.62	4.57	-2.48	0.06423	.	.	.	.	.	T	0.00300	0.0009	N	0.20845	0.615	0.09310	N	1	B	0.23128	0.08	B	0.22601	0.04	T	0.39722	-0.9600	9	0.08599	T	0.76	.	1.5588	0.02590	0.1479:0.2443:0.1449:0.4629	.	3834	Q8IVF2	AHNK2_HUMAN	D	3834	ENSP00000353114:E3834D	ENSP00000353114:E3834D	E	-	3	2	AHNAK2	104481331	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-2.978000	0.00664	0.045000	0.15804	0.491000	0.48974	GAG		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		42	127	1	0	3.61848e-18	0.007835	6.29357e-18	42	127				
NIPA1	123606	broad.mit.edu	37	15	23048984	23048984	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:23048984G>C	ENST00000337435.4	-	5	859	c.835C>G	c.(835-837)Ctc>Gtc	p.L279V	NIPA1_ENST00000561183.1_Missense_Mutation_p.L204V|NIPA1_ENST00000437912.2_Missense_Mutation_p.L204V|NIPA1_ENST00000538684.1_Missense_Mutation_p.L109V	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	279					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)	p.L279V(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		TCCCGGAAGAGGATGGCTGAG	0.582																																							uc001yvc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(835-837)CTC>GTC		non-imprinted in Prader-Willi/Angelman syndrome							90.0	69.0	76.0					15																	23048984		2203	4300	6503	SO:0001583	missense	123606				cell death	early endosome|integral to membrane|plasma membrane		g.chr15:23048984G>C	BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.835C>G	15.37:g.23048984G>C	ENSP00000337452:p.Leu279Val					NIPA1_uc001yvd.2_Missense_Mutation_p.L109V|NIPA1_uc001yve.2_Missense_Mutation_p.L204V	p.L279V	NM_144599	NP_653200	Q7RTP0	NIPA1_HUMAN		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)	5	860	-		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)	279			Helical; (Potential).		B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Missense_Mutation	SNP	ENST00000337435.4	37	c.835C>G	CCDS10011.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513213	0.85389	.	.	ENSG00000170113	ENST00000337435;ENST00000437912;ENST00000538684	D;D;D	0.92397	-3.03;-3.03;-3.03	5.64	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.96605	0.8892	M	0.91717	3.235	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.96988	0.9720	10	0.87932	D	0	-24.1593	13.9772	0.64279	0.0725:0.0:0.9275:0.0	.	279	Q7RTP0	NIPA1_HUMAN	V	279;204;109	ENSP00000337452:L279V;ENSP00000393962:L204V;ENSP00000440957:L109V	ENSP00000337452:L279V	L	-	1	0	NIPA1	20600425	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.933000	0.87642	2.675000	0.91044	0.591000	0.81541	CTC		0.582	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251135.2	NM_144599		4	19	0	0	0	0.009096	0	4	19				
GABRB3	2562	broad.mit.edu	37	15	26812850	26812850	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:26812850C>A	ENST00000311550.5	-	7	824	c.713G>T	c.(712-714)cGg>cTg	p.R238L	GABRB3_ENST00000541819.2_Missense_Mutation_p.R294L|GABRB3_ENST00000299267.4_Missense_Mutation_p.R238L|GABRB3_ENST00000400188.3_Missense_Mutation_p.R167L|GABRB3_ENST00000545868.1_Missense_Mutation_p.R153L	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	238					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)	p.R238L(2)|p.R294L(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCTCTTCAACCGAAAGCTCAG	0.423																																							uc001zaz.2		NA																	3	Substitution - Missense(3)		lung(3)	upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5						c.(712-714)CGG>CTG		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						125.0	107.0	113.0					15																	26812850		2203	4300	6503	SO:0001583	missense	2562				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr15:26812850C>A		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.713G>T	15.37:g.26812850C>A	ENSP00000308725:p.Arg238Leu					GABRB3_uc010uae.1_Missense_Mutation_p.R153L|GABRB3_uc001zba.2_Missense_Mutation_p.R238L|GABRB3_uc001zbb.2_Missense_Mutation_p.R294L	p.R238L	NM_000814	NP_000805	P28472	GBRB3_HUMAN		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	7	855	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	238			Extracellular (Probable).		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	c.713G>T	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496539	0.44352	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18	6.06	5.14	0.70334	Neurotransmitter-gated ion-channel ligand-binding (3);	0.096499	0.64402	D	0.000001	T	0.63153	0.2487	N	0.19112	0.55	0.48762	D	0.999705	B;B;B	0.22541	0.071;0.013;0.028	B;B;B	0.18871	0.023;0.009;0.016	T	0.61744	-0.7000	10	0.62326	D	0.03	.	10.0786	0.42375	0.0:0.8536:0.0:0.1464	.	294;238;238	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	L	238;294;238;167;153	ENSP00000308725:R238L;ENSP00000442408:R294L;ENSP00000299267:R238L;ENSP00000383049:R167L;ENSP00000439169:R153L	ENSP00000299267:R238L	R	-	2	0	GABRB3	24363943	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.188000	0.50958	2.879000	0.98667	0.650000	0.86243	CGG		0.423	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2			6	48	1	0	2.0095e-06	0.001984	2.59582e-06	6	48				
OCA2	4948	broad.mit.edu	37	15	28196981	28196981	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:28196981T>A	ENST00000354638.3	-	18	2055	c.1900A>T	c.(1900-1902)Atc>Ttc	p.I634F	OCA2_ENST00000382996.2_Missense_Mutation_p.I634F|OCA2_ENST00000353809.5_Missense_Mutation_p.I610F	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	634					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.I634F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AACATGAAGATAACAAATCCC	0.428									Oculocutaneous Albinism																														uc001zbh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|pancreas(1)	5						c.(1900-1902)ATC>TTC		oculocutaneous albinism II							192.0	148.0	163.0					15																	28196981		2203	4300	6503	SO:0001583	missense	4948	Oculocutaneous_Albinism	Familial Cancer Database		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding	g.chr15:28196981T>A		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1900A>T	15.37:g.28196981T>A	ENSP00000346659:p.Ile634Phe					OCA2_uc010ayv.2_Missense_Mutation_p.I610F	p.I634F	NM_000275	NP_000266	Q04671	P_HUMAN		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)	18	2010	-		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)	634			Helical; (Potential).		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	c.1900A>T	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.324016	0.81580	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.91996	-2.95;-2.95;-2.95	5.24	5.24	0.73138	Divalent ion symporter (1);	0.000000	0.85682	D	0.000000	D	0.93514	0.7930	L	0.56396	1.775	0.58432	D	0.999999	P;D	0.55605	0.866;0.972	P;P	0.57620	0.591;0.824	D	0.93366	0.6731	10	0.49607	T	0.09	-18.5778	13.0978	0.59202	0.0:0.0:0.0:1.0	.	610;634	Q04671-2;Q04671	.;P_HUMAN	F	634;610;634	ENSP00000346659:I634F;ENSP00000261276:I610F;ENSP00000372457:I634F	ENSP00000261276:I610F	I	-	1	0	OCA2	25870576	1.000000	0.71417	0.997000	0.53966	0.815000	0.46073	5.388000	0.66249	1.981000	0.57761	0.460000	0.39030	ATC		0.428	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275		8	30	0	0	0	0.006214	0	8	30				
HERC2	8924	broad.mit.edu	37	15	28422209	28422209	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:28422209C>A	ENST00000261609.7	-	61	9427	c.9319G>T	c.(9319-9321)Ggg>Tgg	p.G3107W		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.G3107W(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGCGAGCTCCCACAGGCGATA	0.562																																							uc001zbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(9319-9321)GGG>TGG		hect domain and RLD 2							71.0	65.0	67.0					15																	28422209		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28422209C>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9319G>T	15.37:g.28422209C>A	ENSP00000261609:p.Gly3107Trp						p.G3107W	NM_004667	NP_004658	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	61	9425	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3107			RCC1 8.			Missense_Mutation	SNP	ENST00000261609.7	37	c.9319G>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112785	0.77210	.	.	ENSG00000128731	ENST00000261609	D	0.98135	-4.74	5.6	5.6	0.85130	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.99462	0.9809	H	0.99609	4.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97903	1.0304	10	0.87932	D	0	.	19.628	0.95687	0.0:1.0:0.0:0.0	.	3107	O95714	HERC2_HUMAN	W	3107	ENSP00000261609:G3107W	ENSP00000261609:G3107W	G	-	1	0	HERC2	26095804	1.000000	0.71417	0.980000	0.43619	0.303000	0.27691	7.818000	0.86416	2.648000	0.89879	0.650000	0.86243	GGG		0.562	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		7	36	1	0	8.12818e-05	0.001984	9.60783e-05	7	36				
RYR3	6263	broad.mit.edu	37	15	33603291	33603291	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:33603291G>T	ENST00000389232.4	+	1	115	c.45G>T	c.(43-45)ctG>ctT	p.L15L	RP11-489D6.2_ENST00000559457.1_RNA|RP11-489D6.2_ENST00000561458.1_RNA|RYR3_ENST00000415757.3_Silent_p.L15L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	15					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.L15L(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCCAGTTTCTGAGGACTGTGA	0.756																																							uc001zhi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(43-45)CTG>CTT		ryanodine receptor 3							26.0	33.0	31.0					15																	33603291		1918	4116	6034	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33603291G>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.45G>T	15.37:g.33603291G>T						RYR3_uc010bar.2_Silent_p.L15L	p.L15L	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	1	115	+		all_lung(180;7.18e-09)	15			Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.45G>T	CCDS45210.1																																																																																				0.756	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			8	13	1	0	0.00448238	0.004482	0.00491649	8	13				
COPS2	9318	broad.mit.edu	37	15	49426281	49426281	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:49426281C>G	ENST00000388901.5	-	8	813	c.740G>C	c.(739-741)aGg>aCg	p.R247T	COPS2_ENST00000542928.1_Missense_Mutation_p.R183T|COPS2_ENST00000299259.6_Missense_Mutation_p.R254T	NM_001143887.1|NM_004236.3	NP_001137359.1|NP_004227.1	P61201	CSN2_HUMAN	COP9 signalosome subunit 2	247					cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)	p.R247T(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(2)	18		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		TTCACCTTCCCTCAAGTGCAT	0.358																																					NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)	NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)	uc001zxf.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(739-741)AGG>ACG		COP9 constitutive photomorphogenic homolog							83.0	89.0	87.0					15																	49426281		2194	4295	6489	SO:0001583	missense	9318				cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity	g.chr15:49426281C>G	AF212227	CCDS32235.1, CCDS45257.1	15q21.2	2013-03-14	2013-03-14						30747	protein-coding gene	gene with protein product		604508	"""COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)"""			7776974, 9535219	Standard	NM_004236		Approved	TRIP15, ALIEN, CSN2	uc001zxh.3	P61201		ENST00000388901.5:c.740G>C	15.37:g.49426281C>G	ENSP00000373553:p.Arg247Thr					COPS2_uc001zxh.2_Missense_Mutation_p.R254T|COPS2_uc010ufa.1_Missense_Mutation_p.R183T	p.R247T	NM_004236	NP_004227	P61201	CSN2_HUMAN		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)	8	819	-		all_lung(180;0.0428)	247					O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Missense_Mutation	SNP	ENST00000388901.5	37	c.740G>C	CCDS32235.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963980	0.53507	.	.	ENSG00000166200	ENST00000299259;ENST00000388901;ENST00000542928	T;T;T	0.19938	2.11;2.11;2.11	5.93	5.93	0.95920	Tetratricopeptide-like helical (1);PCI/PINT associated module (1);	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	L	0.54323	1.7	0.80722	D	1	B;B;B	0.24618	0.061;0.107;0.107	B;B;B	0.23150	0.03;0.044;0.03	T	0.01679	-1.1297	10	0.42905	T	0.14	-20.4453	20.3465	0.98790	0.0:1.0:0.0:0.0	.	183;255;247	B4DIH5;Q59EL2;P61201	.;.;CSN2_HUMAN	T	254;247;183	ENSP00000299259:R254T;ENSP00000373553:R247T;ENSP00000443664:R183T	ENSP00000299259:R254T	R	-	2	0	COPS2	47213573	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.798000	0.96311	0.655000	0.94253	AGG		0.358	COPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417840.1	NM_004236		12	47	0	0	0	0.001855	0	12	47				
CYP19A1	1588	broad.mit.edu	37	15	51507397	51507397	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:51507397G>T	ENST00000396402.1	-	8	1044	c.891C>A	c.(889-891)aaC>aaA	p.N297K	RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000559878.1_Missense_Mutation_p.N297K|CYP19A1_ENST00000260433.2_Missense_Mutation_p.N297K|CYP19A1_ENST00000396404.4_Missense_Mutation_p.N297K	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	297					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.N297K(1)		endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	ATATGCACTGGTTCACATTCT	0.413																																					Melanoma(142;1016 1807 39614 48966 51721)	Melanoma(142;1016 1807 39614 48966 51721)	uc001zyz.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(889-891)AAC>AAA		cytochrome P450, family 19	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)						134.0	125.0	128.0					15																	51507397		2196	4293	6489	SO:0001583	missense	1588				estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity	g.chr15:51507397G>T	D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.891C>A	15.37:g.51507397G>T	ENSP00000379683:p.Asn297Lys					CYP19A1_uc001zza.3_Missense_Mutation_p.N297K|CYP19A1_uc001zzb.2_Missense_Mutation_p.N297K	p.N297K	NM_031226	NP_112503	P11511	CP19A_HUMAN		all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	9	1142	-			297					Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	ENST00000396402.1	37	c.891C>A	CCDS10139.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006550	0.74932	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404;ENST00000420301;ENST00000439712	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.93	5.01	0.66863	.	0.125431	0.64402	D	0.000001	T	0.61476	0.2350	L	0.43646	1.37	0.58432	D	0.999995	P	0.39424	0.673	P	0.46718	0.525	T	0.63457	-0.6633	10	0.56958	D	0.05	-25.8238	10.4241	0.44367	0.1488:0.0:0.8512:0.0	.	297	P11511	CP19A_HUMAN	K	297	ENSP00000379683:N297K;ENSP00000260433:N297K;ENSP00000379685:N297K;ENSP00000390614:N297K	ENSP00000260433:N297K	N	-	3	2	CYP19A1	49294689	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.700000	0.47085	1.500000	0.48636	0.655000	0.94253	AAC		0.413	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1			10	78	1	0	1.33987e-11	0.008291	2.04551e-11	10	78				
DMXL2	23312	broad.mit.edu	37	15	51755682	51755682	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:51755682G>A	ENST00000251076.5	-	33	8104	c.7817C>T	c.(7816-7818)tCt>tTt	p.S2606F	RP11-707P17.2_ENST00000559173.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.S2607F|DMXL2_ENST00000449909.3_Missense_Mutation_p.S1970F|RP11-707P17.1_ENST00000561007.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA|RP11-707P17.2_ENST00000560727.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2606						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.S2606F(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AAATGCAGAAGAATCCCGGGA	0.294																																							uc002abf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)	9						c.(7816-7818)TCT>TTT		Dmx-like 2							62.0	70.0	67.0					15																	51755682		2195	4288	6483	SO:0001583	missense	23312					cell junction|synaptic vesicle membrane	Rab GTPase binding	g.chr15:51755682G>A	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7817C>T	15.37:g.51755682G>A	ENSP00000251076:p.Ser2606Phe					DMXL2_uc002abd.2_Missense_Mutation_p.S677F|DMXL2_uc010ufy.1_Missense_Mutation_p.S2607F|DMXL2_uc010bfa.2_Missense_Mutation_p.S1970F	p.S2606F	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN		all cancers(107;0.00494)	33	8042	-			2606					B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	c.7817C>T	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414134	0.25465	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.25749	1.92;1.92;1.78	5.26	5.26	0.73747	.	0.222920	0.46758	D	0.000278	T	0.21921	0.0528	L	0.55990	1.75	0.35837	D	0.825743	B;B;B;B	0.28801	0.029;0.223;0.017;0.009	B;B;B;B	0.22753	0.017;0.041;0.012;0.016	T	0.12268	-1.0554	10	0.14252	T	0.57	.	11.7993	0.52118	0.0:0.0:0.7069:0.2931	.	2607;1970;2606;2607	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	F	2606;2607;1970;151	ENSP00000251076:S2606F;ENSP00000441858:S2607F;ENSP00000400855:S1970F	ENSP00000251076:S2606F	S	-	2	0	DMXL2	49542974	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.256000	0.51492	2.732000	0.93576	0.557000	0.71058	TCT		0.294	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		16	97	0	0	0	0.007413	0	16	97				
MAP2K1	5604	broad.mit.edu	37	15	66727441	66727441	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:66727441T>C	ENST00000307102.5	+	2	688	c.157T>C	c.(157-159)Ttt>Ctt	p.F53L		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	53			F -> S (in CFC3). {ECO:0000269|PubMed:16439621}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)	p.F53L(2)|p.F53S(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	CCTTGAGGCCTTTCTTACCCA	0.547																																							uc010bhq.2		NA																	3	Substitution - Missense(3)		lung(2)|large_intestine(1)		0						c.(157-159)TTT>CTT		mitogen-activated protein kinase kinase 1							155.0	146.0	149.0					15																	66727441		2201	4299	6500	SO:0001583	missense	5604	Cardiofaciocutaneous_syndrome			activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr15:66727441T>C	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.157T>C	15.37:g.66727441T>C	ENSP00000302486:p.Phe53Leu					MAP2K1_uc010ujp.1_Missense_Mutation_p.F31L	p.F53L	NM_002755	NP_002746	Q02750	MP2K1_HUMAN			2	632	+			53		F -> S (in CFC syndrome).				Missense_Mutation	SNP	ENST00000307102.5	37	c.157T>C	CCDS10216.1	.	.	.	.	.	.	.	.	.	.	T	35	5.500444	0.96355	.	.	ENSG00000169032	ENST00000307102	D	0.93019	-3.15	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.95188	0.8440	M	0.76170	2.325	0.80722	D	1	D;D	0.61080	0.989;0.98	P;P	0.59115	0.852;0.805	D	0.93980	0.7257	10	0.26408	T	0.33	-14.6287	14.0473	0.64712	0.0:0.0:0.0:1.0	.	31;53	B4DFY5;Q02750	.;MP2K1_HUMAN	L	53	ENSP00000302486:F53L	ENSP00000302486:F53L	F	+	1	0	MAP2K1	64514495	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.924000	0.87555	1.911000	0.55334	0.383000	0.25322	TTT		0.547	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4			46	104	0	0	0	0.01441	0	46	104				
LCTL	197021	broad.mit.edu	37	15	66850109	66850109	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:66850109G>T	ENST00000341509.5	-	8	1004	c.873C>A	c.(871-873)gcC>gcA	p.A291A	LCTL_ENST00000537670.1_Silent_p.A118A	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	291					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.A291A(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AAATGGGGTTGGCAAACCAGC	0.498																																							uc002aqc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(871-873)GCC>GCA		lactase-like precursor							97.0	101.0	100.0					15																	66850109		2201	4299	6500	SO:0001819	synonymous_variant	197021				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr15:66850109G>T	AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.873C>A	15.37:g.66850109G>T						LCTL_uc002aqd.3_Silent_p.A118A|LCTL_uc010bhw.2_5'UTR	p.A291A	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN			8	1005	-			291			Extracellular (Potential).		B3KQY0	Silent	SNP	ENST00000341509.5	37	c.873C>A	CCDS10220.1																																																																																				0.498	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338		34	70	1	0	1.60099e-16	0.004878	2.67014e-16	34	70				
PTPN9	5780	broad.mit.edu	37	15	75815560	75815560	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:75815560G>A	ENST00000306726.2	-	4	836	c.324C>T	c.(322-324)tcC>tcT	p.S108S		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	108	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)	p.S108S(1)		central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGAGGGCAATGGAGGCTCCTG	0.403																																							uc002bal.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|skin(1)	2						c.(322-324)TCC>TCT		protein tyrosine phosphatase, non-receptor type							107.0	105.0	106.0					15																	75815560		2197	4294	6491	SO:0001819	synonymous_variant	5780					cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding	g.chr15:75815560G>A		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.324C>T	15.37:g.75815560G>A							p.S108S	NM_002833	NP_002824	P43378	PTN9_HUMAN			4	832	-			108			CRAL-TRIO.		Q53XR9	Silent	SNP	ENST00000306726.2	37	c.324C>T	CCDS10280.1																																																																																				0.403	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1			10	30	0	0	0	0.008291	0	10	30				
CSPG4	1464	broad.mit.edu	37	15	75981627	75981627	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:75981627C>G	ENST00000308508.5	-	3	1871	c.1779G>C	c.(1777-1779)caG>caC	p.Q593H		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	593	Globular or compact configuration stabilized by disulfide bonds.|Interaction with COL6A2. {ECO:0000250}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.Q593H(1)		breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGCCAAGGACCTGGAAGGTGA	0.672																																							uc002baw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1777-1779)CAG>CAC		chondroitin sulfate proteoglycan 4 precursor							23.0	27.0	26.0					15																	75981627		2196	4290	6486	SO:0001583	missense	1464				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity	g.chr15:75981627C>G	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1779G>C	15.37:g.75981627C>G	ENSP00000312506:p.Gln593His						p.Q593H	NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN			3	1872	-			593			Extracellular (Potential).|CSPG 2.|Globular or compact configuration stabilized by disulfide bonds.|Interaction with COL6A2 (By similarity).|Neurite growth inhibition (By similarity).		D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	c.1779G>C	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	4.181	0.032163	0.08101	.	.	ENSG00000173546	ENST00000308508	T	0.19806	2.12	5.35	1.41	0.22369	.	0.191347	0.36703	N	0.002457	T	0.34106	0.0886	M	0.62723	1.935	0.37101	D	0.899892	D	0.69078	0.997	P	0.61800	0.894	T	0.15435	-1.0437	10	0.44086	T	0.13	.	8.8596	0.35249	0.0:0.6975:0.0:0.3025	.	593	Q6UVK1	CSPG4_HUMAN	H	593	ENSP00000312506:Q593H	ENSP00000312506:Q593H	Q	-	3	2	CSPG4	73768682	0.996000	0.38824	0.161000	0.22692	0.099000	0.18886	0.417000	0.21214	0.014000	0.14944	-0.266000	0.10368	CAG		0.672	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897		6	20	0	0	0	0.001984	0	6	20				
SCAPER	49855	broad.mit.edu	37	15	77087629	77087629	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:77087629C>T	ENST00000563290.1	-	8	859	c.764G>A	c.(763-765)cGc>cAc	p.R255H	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000324767.7_Missense_Mutation_p.R255H|SCAPER_ENST00000562890.1_5'UTR			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	255						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R255H(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GCCATTTTTGCGTGAGGCCTT	0.408																																							uc002bby.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)	3						c.(763-765)CGC>CAC		S-phase cyclin A-associated protein in the ER							138.0	134.0	135.0					15																	77087629		1903	4124	6027	SO:0001583	missense	49855					endoplasmic reticulum|nucleus	zinc ion binding	g.chr15:77087629C>T	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.764G>A	15.37:g.77087629C>T	ENSP00000454973:p.Arg255His					SCAPER_uc002bbx.2_5'UTR|SCAPER_uc002bbz.1_Missense_Mutation_p.R120H|SCAPER_uc002bca.1_Missense_Mutation_p.R120H|SCAPER_uc002bcb.1_Missense_Mutation_p.R255H|SCAPER_uc002bcc.1_Missense_Mutation_p.R255H	p.R255H	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN			7	823	-			254					F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	c.764G>A	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618154	0.66787	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.24350	1.86	5.43	4.5	0.54988	.	0.261084	0.38436	N	0.001697	T	0.38401	0.1039	M	0.68317	2.08	0.34091	D	0.660748	D;D	0.60575	0.985;0.988	P;P	0.50617	0.536;0.646	T	0.58696	-0.7591	10	0.54805	T	0.06	.	14.5648	0.68168	0.0:0.7218:0.2782:0.0	.	255;270	Q6NSF1;Q9BY12-2	.;.	H	255;271	ENSP00000326924:R255H	ENSP00000303560:R271H	R	-	2	0	SCAPER	74874684	1.000000	0.71417	0.955000	0.39395	0.798000	0.45092	2.027000	0.41078	1.266000	0.44231	0.484000	0.47621	CGC		0.408	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843		15	97	0	0	0	0.006122	0	15	97				
NTRK3	4916	broad.mit.edu	37	15	88483959	88483959	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:88483959G>A	ENST00000360948.2	-	14	1772	c.1611C>T	c.(1609-1611)gaC>gaT	p.D537D	NTRK3_ENST00000558676.1_Silent_p.D529D|NTRK3_ENST00000355254.2_Silent_p.D537D|NTRK3_ENST00000557856.1_Silent_p.D529D|NTRK3_ENST00000394480.2_Silent_p.D537D|NTRK3_ENST00000542733.2_Silent_p.D439D|NTRK3_ENST00000357724.2_Silent_p.D529D	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	537					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D537D(2)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TCAGCACGATGTCTCTCCTCT	0.537			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	2	Substitution - coding silent(2)		lung(2)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1609-1611)GAC>GAT		neurotrophic tyrosine kinase, receptor, type 3							193.0	159.0	170.0					15																	88483959		2201	4299	6500	SO:0001819	synonymous_variant	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88483959G>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1611C>T	15.37:g.88483959G>A		TSP Lung(13;0.10)				NTRK3_uc002bmh.2_Silent_p.D529D|NTRK3_uc002bmf.1_Silent_p.D537D|NTRK3_uc010upl.1_Silent_p.D439D|NTRK3_uc010bnh.1_Silent_p.D529D	p.D537D	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		14	1773	-			537			Cytoplasmic (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	c.1611C>T	CCDS32322.1																																																																																				0.537	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				13	102	0	0	0	0.00245	0	13	102				
ACAN	176	broad.mit.edu	37	15	89392759	89392759	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr15:89392759C>A	ENST00000561243.1	+	9	1823	c.1823C>A	c.(1822-1824)aCg>aAg	p.T608K	ACAN_ENST00000439576.2_Missense_Mutation_p.T608K|ACAN_ENST00000559004.1_Missense_Mutation_p.T608K|ACAN_ENST00000352105.7_Missense_Mutation_p.T608K|ACAN_ENST00000558207.1_Missense_Mutation_p.T608K			P16112	PGCA_HUMAN	aggrecan	607	G2-B'.|Link 4. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.T608K(2)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTGGCCACCACGGGCCAGCTC	0.652																																							uc010upo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(1822-1824)ACG>AAG		aggrecan isoform 2 precursor							14.0	15.0	15.0					15																	89392759		1973	4155	6128	SO:0001583	missense	176				cell adhesion		hyaluronic acid binding|sugar binding	g.chr15:89392759C>A	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1823C>A	15.37:g.89392759C>A	ENSP00000453342:p.Thr608Lys					ACAN_uc002bmx.2_Missense_Mutation_p.T608K|ACAN_uc010upp.1_Missense_Mutation_p.T608K|ACAN_uc002bna.2_RNA	p.T608K	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)		10	2197	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		608					Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	c.1823C>A	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.441724	0.63067	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.09163	3.01;3.01	5.11	5.11	0.69529	.	0.255070	0.20736	N	0.086628	T	0.27798	0.0684	L	0.55017	1.72	0.32945	D	0.518884	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77557	0.954;0.954;0.99	T	0.19745	-1.0296	10	0.87932	D	0	-10.3486	13.2859	0.60243	0.0:0.9207:0.0:0.0793	.	608;608;608	E7ENV9;E7EX88;Q6PID9	.;.;.	K	608	ENSP00000387356:T608K;ENSP00000341615:T608K	ENSP00000268134:T608K	T	+	2	0	ACAN	87193763	0.998000	0.40836	0.941000	0.38009	0.858000	0.48976	3.954000	0.56708	2.532000	0.85374	0.655000	0.94253	ACG		0.652	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135		4	10	1	0	0.00024832	0.009096	0.000285217	4	10				
MSLN	10232	broad.mit.edu	37	16	816697	816697	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:816697G>T	ENST00000382862.3	+	13	1379	c.1284G>T	c.(1282-1284)aaG>aaT	p.K428N	MSLN_ENST00000545450.2_Missense_Mutation_p.K420N|MSLN_ENST00000563941.1_Missense_Mutation_p.K420N|MSLN_ENST00000566549.1_Missense_Mutation_p.K420N	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	428					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.K428N(2)		breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				GCTTTGTGAAGGGAAGGGGCC	0.632																																							uc002cjw.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1282-1284)AAG>AAT		mesothelin isoform 2 preproprotein							72.0	73.0	73.0					16																	816697		2189	4290	6479	SO:0001583	missense	10232				cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane		g.chr16:816697G>T	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.1284G>T	16.37:g.816697G>T	ENSP00000372313:p.Lys428Asn					MSLN_uc002cjt.1_Missense_Mutation_p.K420N|MSLN_uc002cju.1_Missense_Mutation_p.K420N|MSLN_uc010brd.1_Missense_Mutation_p.K419N|MSLN_uc002cjv.1_Missense_Mutation_p.K420N|MSLN_uc002cjx.1_Missense_Mutation_p.K420N|MSLN_uc002cjy.1_Missense_Mutation_p.K85N	p.K428N	NM_013404	NP_037536	Q13421	MSLN_HUMAN			13	1335	+		Hepatocellular(780;0.00335)	428					D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Missense_Mutation	SNP	ENST00000382862.3	37	c.1284G>T	CCDS32356.1	.	.	.	.	.	.	.	.	.	.	G	6.268	0.417572	0.11870	.	.	ENSG00000102854	ENST00000446427;ENST00000445361;ENST00000545450;ENST00000382862	T;T	0.14144	2.53;2.53	4.18	-1.6	0.08426	.	2.624730	0.02460	N	0.086531	T	0.06600	0.0169	N	0.08118	0	0.09310	N	1	B;B;B;B	0.26708	0.095;0.116;0.157;0.095	B;B;B;B	0.26693	0.043;0.072;0.069;0.043	T	0.24728	-1.0152	10	0.21014	T	0.42	0.0557	3.4494	0.07493	0.4204:0.0:0.4018:0.1778	.	419;428;420;420	Q13421-4;Q13421;Q13421-2;Q13421-3	.;MSLN_HUMAN;.;.	N	428;420;420;428	ENSP00000442965:K420N;ENSP00000372313:K428N	ENSP00000372313:K428N	K	+	3	2	MSLN	756698	0.000000	0.05858	0.005000	0.12908	0.036000	0.12997	-0.496000	0.06436	-0.117000	0.11872	0.313000	0.20887	AAG		0.632	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109253.2			20	43	1	0	4.35082e-09	0.010504	6.12384e-09	20	43				
NLRC3	197358	broad.mit.edu	37	16	3614682	3614682	+	RNA	SNP	T	T	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:3614682T>G	ENST00000301749.7	-	0	661				NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.R133R(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAGGCCAGCCTGTGCCAGGGT	0.706																																							uc010btn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(256-258)AGG>CGG		NOD3 protein							10.0	13.0	12.0					16																	3614682		1954	3986	5940			197358				I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding	g.chr16:3614682T>G	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614682T>G							p.R86R	NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN			5	667	-			86					Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	37	c.256A>C																																																																																					0.706	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844		5	8	0	0	0	0.000602	0	5	8				
ITGAL	3683	broad.mit.edu	37	16	30510692	30510692	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:30510692A>T	ENST00000356798.6	+	17	2207	c.2027A>T	c.(2026-2028)cAg>cTg	p.Q676L	ITGAL_ENST00000433423.2_Missense_Mutation_p.Q72L|RP11-297C4.1_ENST00000563751.1_RNA|ITGAL_ENST00000358164.5_Missense_Mutation_p.Q593L	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	676					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.Q676L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	TACACTCTGCAGCTGGATGGC	0.567																																					NSCLC(110;1462 1641 3311 33990 49495)	NSCLC(110;1462 1641 3311 33990 49495)	uc002dyi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10						c.(2026-2028)CAG>CTG		integrin alpha L isoform a precursor	Efalizumab(DB00095)						114.0	110.0	111.0					16																	30510692		2197	4300	6497	SO:0001583	missense	3683				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity	g.chr16:30510692A>T		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2027A>T	16.37:g.30510692A>T	ENSP00000349252:p.Gln676Leu					ITGAL_uc002dyj.3_Missense_Mutation_p.Q593L|ITGAL_uc010vev.1_Missense_Mutation_p.Q72L	p.Q676L	NM_002209	NP_002200	P20701	ITAL_HUMAN			17	2203	+			676			Extracellular (Potential).		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	c.2027A>T	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.900456	0.52227	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.49139	0.79;0.79;1.82	5.79	5.79	0.91817	Integrin alpha-2 (1);	0.000000	0.53938	D	0.000060	T	0.67496	0.2899	M	0.75447	2.3	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.976	D;D;P	0.71656	0.946;0.974;0.9	T	0.71307	-0.4632	10	0.72032	D	0.01	.	13.6933	0.62562	1.0:0.0:0.0:0.0	.	72;593;676	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	L	676;593;72	ENSP00000349252:Q676L;ENSP00000350886:Q593L;ENSP00000409377:Q72L	ENSP00000349252:Q676L	Q	+	2	0	ITGAL	30418193	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	3.705000	0.54823	2.222000	0.72286	0.529000	0.55759	CAG		0.567	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			22	75	0	0	0	0.00333	0	22	75				
ZNF688	146542	broad.mit.edu	37	16	30581633	30581633	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:30581633G>A	ENST00000223459.6	-	3	1539	c.435C>T	c.(433-435)agC>agT	p.S145S	ZNF688_ENST00000395219.1_Silent_p.S131S|AC002310.7_ENST00000492040.1_RNA|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S145S(1)|p.S131S(1)		endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CCGGGGCCACGCTAATAGCTG	0.627																																							uc002dyt.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(433-435)AGC>AGT		zinc finger protein 688 isoform a							39.0	38.0	38.0					16																	30581633		2197	4300	6497	SO:0001819	synonymous_variant	146542				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:30581633G>A	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.435C>T	16.37:g.30581633G>A						ZNF688_uc002dys.2_Silent_p.S131S|uc002dyu.2_5'Flank	p.S145S	NM_145271	NP_660314	P0C7X2	ZN688_HUMAN			3	1213	-			145					A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Silent	SNP	ENST00000223459.6	37	c.435C>T	CCDS10684.1																																																																																				0.627	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271		6	35	0	0	0	0.001168	0	6	35				
ZNF423	23090	broad.mit.edu	37	16	49660112	49660112	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:49660112C>G	ENST00000561648.1	-	5	3599	c.3546G>C	c.(3544-3546)gaG>gaC	p.E1182D	ZNF423_ENST00000535559.1_Missense_Mutation_p.E1065D|ZNF423_ENST00000567169.1_Missense_Mutation_p.E1065D|ZNF423_ENST00000562520.1_Missense_Mutation_p.E1122D|ZNF423_ENST00000562871.1_Missense_Mutation_p.E1122D|ZNF423_ENST00000262383.2_Missense_Mutation_p.E1182D|ZNF423_ENST00000563137.2_Missense_Mutation_p.E1122D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1182					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E1182D(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGATTTGGATCTCTCTCTCGT	0.443																																							uc002efs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(3544-3546)GAG>GAC		zinc finger protein 423							321.0	283.0	296.0					16																	49660112		2199	4300	6499	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49660112C>G	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3546G>C	16.37:g.49660112C>G	ENSP00000455426:p.Glu1182Asp					ZNF423_uc010vgn.1_Missense_Mutation_p.E1065D	p.E1182D	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			6	3844	-		all_cancers(37;0.0155)	1182			C2H2-type 27.		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.3546G>C	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	9.652	1.141896	0.21205	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.27720	1.65;1.65	4.81	3.6	0.41247	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.15696	0.0378	N	0.14661	0.345	0.37036	D	0.896891	B	0.09022	0.002	B	0.13407	0.009	T	0.12372	-1.0550	9	.	.	.	-34.5409	8.8791	0.35363	0.0:0.792:0.0:0.208	.	1182	Q2M1K9	ZN423_HUMAN	D	1182;1065	ENSP00000262383:E1182D;ENSP00000442321:E1065D	.	E	-	3	2	ZNF423	48217613	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.667000	0.37471	2.399000	0.81585	0.306000	0.20318	GAG		0.443	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		38	149	0	0	0	0.010771	0	38	149				
ZNF423	23090	broad.mit.edu	37	16	49670744	49670744	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:49670744G>T	ENST00000561648.1	-	4	2372	c.2319C>A	c.(2317-2319)caC>caA	p.H773Q	ZNF423_ENST00000535559.1_Missense_Mutation_p.H656Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.H656Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.H713Q|ZNF423_ENST00000562871.1_Missense_Mutation_p.H713Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.H773Q|ZNF423_ENST00000563137.2_Missense_Mutation_p.H713Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	773					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H773Q(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGTTGCCCAGGTGGCTGTGTT	0.587																																							uc002efs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(2317-2319)CAC>CAA		zinc finger protein 423							137.0	121.0	126.0					16																	49670744		2198	4300	6498	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49670744G>T	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2319C>A	16.37:g.49670744G>T	ENSP00000455426:p.His773Gln					ZNF423_uc010vgn.1_Missense_Mutation_p.H656Q	p.H773Q	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			5	2617	-		all_cancers(37;0.0155)	773			C2H2-type 18.		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.2319C>A	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317644	0.40996	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.16897	2.31;2.36	4.81	4.81	0.61882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.096342	0.64402	D	0.000001	T	0.47078	0.1426	M	0.90252	3.1	0.46542	D	0.999097	D	0.89917	1.0	D	0.85130	0.997	T	0.54741	-0.8248	9	.	.	.	-27.6291	11.1326	0.48356	0.1355:0.0:0.8645:0.0	.	773	Q2M1K9	ZN423_HUMAN	Q	773;656	ENSP00000262383:H773Q;ENSP00000442321:H656Q	.	H	-	3	2	ZNF423	48228245	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.584000	0.23864	2.234000	0.73211	0.561000	0.74099	CAC		0.587	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		8	30	1	0	0.00307968	0.00308	0.00339322	8	30				
NKD1	85407	broad.mit.edu	37	16	50642220	50642220	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:50642220G>T	ENST00000268459.3	+	4	432	c.208G>T	c.(208-210)Gtg>Ttg	p.V70L	NKD1_ENST00000564336.1_3'UTR|RP11-401P9.6_ENST00000379963.1_RNA	NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	70					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V70L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CGTGGGCGACGTGTTGAGAGA	0.592																																							uc002egg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(208-210)GTG>TTG		naked cuticle homolog 1							174.0	155.0	162.0					16																	50642220		2198	4300	6498	SO:0001583	missense	85407				Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding	g.chr16:50642220G>T	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.208G>T	16.37:g.50642220G>T	ENSP00000268459:p.Val70Leu						p.V70L	NM_033119	NP_149110	Q969G9	NKD1_HUMAN		GBM - Glioblastoma multiforme(240;0.243)	4	432	+		all_cancers(37;0.229)	70					B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	37	c.208G>T	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	G	4.788	0.146524	0.09134	.	.	ENSG00000140807	ENST00000268459	T	0.63096	-0.02	4.69	2.68	0.31781	.	1.201180	0.06089	N	0.663357	T	0.49012	0.1532	L	0.29908	0.895	0.09310	N	1	B	0.27013	0.166	B	0.23275	0.045	T	0.32719	-0.9896	10	0.27785	T	0.31	-0.3885	7.8911	0.29677	0.2011:0.0:0.7989:0.0	.	70	Q969G9	NKD1_HUMAN	L	70	ENSP00000268459:V70L	ENSP00000268459:V70L	V	+	1	0	NKD1	49199721	0.999000	0.42202	0.104000	0.21259	0.015000	0.08874	2.255000	0.43222	0.473000	0.27368	0.655000	0.94253	GTG		0.592	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1			21	89	1	0	1.90627e-21	0.012319	3.43834e-21	21	89				
CHD9	80205	broad.mit.edu	37	16	53341597	53341597	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:53341597G>T	ENST00000398510.3	+	32	6872	c.6785G>T	c.(6784-6786)cGt>cTt	p.R2262L	CHD9_ENST00000564845.1_Missense_Mutation_p.R2262L|CHD9_ENST00000566029.1_Missense_Mutation_p.R2262L|CHD9_ENST00000447540.1_Missense_Mutation_p.R2263L			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2262					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R2263L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TTCTAGGATCGTGTGATGATC	0.378																																							uc002ehb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7						c.(6784-6786)CGT>CTT		chromodomain helicase DNA binding protein 9							48.0	47.0	47.0					16																	53341597		1877	4101	5978	SO:0001583	missense	80205				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding	g.chr16:53341597G>T	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6785G>T	16.37:g.53341597G>T	ENSP00000381522:p.Arg2262Leu					CHD9_uc002egy.2_Missense_Mutation_p.R2262L|CHD9_uc002ehc.2_Missense_Mutation_p.R2263L|CHD9_uc002ehf.2_Missense_Mutation_p.R1376L|CHD9_uc010cbw.2_Missense_Mutation_p.R328L|CHD9_uc002ehg.1_Missense_Mutation_p.R269L	p.R2262L	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN			32	6949	+		all_cancers(37;0.0212)	2262					B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37	c.6785G>T		.	.	.	.	.	.	.	.	.	.	G	22.1	4.244728	0.79912	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D;D	0.93547	-3.19;-3.24	5.44	5.44	0.79542	.	0.000000	0.52532	D	0.000062	D	0.96503	0.8859	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.995;0.998;0.996;0.998	D;D;D;D;D	0.80764	0.985;0.977;0.994;0.983;0.994	D	0.96640	0.9473	10	0.87932	D	0	-11.3183	19.6436	0.95767	0.0:0.0:1.0:0.0	.	328;2262;2263;2262;2262	C9JR69;B7ZML1;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;.;CHD9_HUMAN;.	L	2263;2262;328	ENSP00000396345:R2263L;ENSP00000381522:R2262L	ENSP00000381522:R2262L	R	+	2	0	CHD9	51899098	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.751000	0.98889	2.712000	0.92718	0.650000	0.86243	CGT		0.378	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134		4	9	1	0	0.00024832	0.009096	0.000285217	4	9				
NFATC3	4775	broad.mit.edu	37	16	68224795	68224795	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:68224795G>T	ENST00000346183.3	+	9	2247	c.2223G>T	c.(2221-2223)ctG>ctT	p.L741L	NFATC3_ENST00000349223.5_Silent_p.L741L|NFATC3_ENST00000329524.4_Silent_p.L741L|NFATC3_ENST00000575270.1_Silent_p.L741L|SNORA48_ENST00000391143.1_RNA|NFATC3_ENST00000535127.2_3'UTR	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	741					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.L741L(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		ACAGTGTACTGTCAGGACAGA	0.473																																							uc002evo.1		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3						c.(2221-2223)CTG>CTT		nuclear factor of activated T-cells,							114.0	95.0	101.0					16																	68224795		2198	4300	6498	SO:0001819	synonymous_variant	4775				inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding	g.chr16:68224795G>T	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2223G>T	16.37:g.68224795G>T						NFATC3_uc010vkl.1_Silent_p.L262L|NFATC3_uc010vkm.1_Silent_p.L262L|NFATC3_uc010vkn.1_Silent_p.L262L|NFATC3_uc010vko.1_Silent_p.L262L|NFATC3_uc010vkp.1_Silent_p.L262L|NFATC3_uc010vkq.1_Silent_p.L262L|NFATC3_uc002evl.2_Silent_p.L262L|NFATC3_uc002evk.2_Silent_p.L741L|NFATC3_uc002evm.1_Silent_p.L741L|NFATC3_uc002evn.1_Silent_p.L741L|NFATC3_uc010vkr.1_Silent_p.L262L|NFATC3_uc010vks.1_Silent_p.L262L|NFATC3_uc010vkt.1_Silent_p.L262L|NFATC3_uc010vku.1_Silent_p.L262L|NFATC3_uc010vkv.1_Silent_p.L262L|NFATC3_uc010vkw.1_Silent_p.L262L|NFATC3_uc010vkx.1_Silent_p.L262L|NFATC3_uc010vky.1_Silent_p.L262L|NFATC3_uc010vkz.1_Silent_p.L262L|NFATC3_uc010vla.1_Silent_p.L262L|NFATC3_uc010vlb.1_Silent_p.L262L|NFATC3_uc010vlc.1_Silent_p.L262L	p.L741L	NM_173165	NP_775188	Q12968	NFAC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)	9	2433	+		Ovarian(137;0.0563)	741					O75211|Q14516|Q99840|Q99841|Q99842	Silent	SNP	ENST00000346183.3	37	c.2223G>T	CCDS10860.1																																																																																				0.473	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555		21	71	1	0	0.000175454	0.010504	0.000203929	21	71				
SF3B3	23450	broad.mit.edu	37	16	70605714	70605715	+	Nonstop_Mutation	DNP	TG	TG	CT			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:70605714_70605715TG>CT	ENST00000302516.5	+	26	3863_3864	c.3652_3653TG>CT	c.(3652-3654)TGa>CTa	p.*1218L		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	0					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.*1218L(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CTACGCCTTCTGAGCCCTCCTT	0.564																																							uc002ezf.2		NA																	1	Nonstop extension(1)		lung(1)	ovary(1)	1						c.(3652-3654)TGA>CTA		splicing factor 3b, subunit 3																																				SO:0001578	stop_lost	23450				protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr16:70605714_70605715TG>CT	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	Exception_encountered	16.37:g.70605714_70605715delinsCT	Exception_encountered						p.*1218L	NM_012426	NP_036558	Q15393	SF3B3_HUMAN			26	3863_3864	+		Ovarian(137;0.0694)	1218					Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Nonstop_Mutation	DNP	ENST00000302516.5	37	c.3652_3653TG>CT	CCDS10894.1																																																																																				0.564	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		9	36	0	0	0	0.004672	0	9	36				
ZNF19	7567	broad.mit.edu	37	16	71509360	71509360	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:71509360T>C	ENST00000288177.5	-	6	1345	c.1090A>G	c.(1090-1092)Aaa>Gaa	p.K364E	ZNF19_ENST00000565637.1_Missense_Mutation_p.K322E|ZNF19_ENST00000567225.1_Intron|AC010547.9_ENST00000561908.1_Intron|ZNF19_ENST00000564230.1_Missense_Mutation_p.K364E|ZNF19_ENST00000565100.2_Missense_Mutation_p.K294E	NM_006961.3	NP_008892.2	P17023	ZNF19_HUMAN	zinc finger protein 19	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K364E(1)		NS(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|prostate(1)|stomach(1)	22		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		CTGAAGGCTTTTCCACAATCT	0.403																																							uc010cgc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1090-1092)AAA>GAA		zinc finger protein 19							79.0	78.0	78.0					16																	71509360		2198	4300	6498	SO:0001583	missense	7567					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:71509360T>C	X52343	CCDS10901.1	16q22	2013-01-08	2006-05-10		ENSG00000157429	ENSG00000157429		"""Zinc fingers, C2H2-type"", ""-"""	12981	protein-coding gene	gene with protein product		194525	"""zinc finger protein 19 (KOX 12)"""			1505991, 1946370	Standard	NM_006961		Approved	KOX12, MGC51021	uc002fam.1	P17023	OTTHUMG00000137593	ENST00000288177.5:c.1090A>G	16.37:g.71509360T>C	ENSP00000288177:p.Lys364Glu					ZNF23_uc002fai.2_Intron|ZNF19_uc002fak.1_Missense_Mutation_p.K352E|ZNF19_uc002fal.1_Missense_Mutation_p.K352E|ZNF19_uc002fam.1_Missense_Mutation_p.K364E	p.K364E	NM_006961	NP_008892	P17023	ZNF19_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)	6	1596	-		Ovarian(137;0.00965)	364			C2H2-type 8.		A8K895|Q86Y66|Q8NDE2|Q96M79|Q96NE5	Missense_Mutation	SNP	ENST00000288177.5	37	c.1090A>G	CCDS10901.1	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511241	0.44660	.	.	ENSG00000157429	ENST00000288177	T	0.27104	1.69	2.88	2.88	0.33553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36778	N	0.002403	T	0.40196	0.1107	L	0.49699	1.58	0.25641	N	0.986202	D	0.76494	0.999	D	0.72075	0.976	T	0.06041	-1.0849	10	0.87932	D	0	.	9.5301	0.39189	0.0:0.0:0.0:1.0	.	364	P17023	ZNF19_HUMAN	E	364	ENSP00000288177:K364E	ENSP00000288177:K364E	K	-	1	0	ZNF19	70066861	0.999000	0.42202	0.975000	0.42487	0.852000	0.48524	4.645000	0.61404	1.573000	0.49748	0.533000	0.62120	AAA		0.403	ZNF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268993.2	NM_006961		11	64	0	0	0	0.008291	0	11	64				
ADAMTS18	170692	broad.mit.edu	37	16	77356285	77356285	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:77356285C>A	ENST00000282849.5	-	14	2529	c.2111G>T	c.(2110-2112)gGa>gTa	p.G704V		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	704	Cys-rich.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G704V(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GCAGGGAGTTCCATCTTTCAC	0.398																																							uc002ffc.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(2110-2112)GGA>GTA		ADAM metallopeptidase with thrombospondin type 1							172.0	160.0	164.0					16																	77356285		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77356285C>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2111G>T	16.37:g.77356285C>A	ENSP00000282849:p.Gly704Val					ADAMTS18_uc010chc.1_Missense_Mutation_p.G292V|ADAMTS18_uc002ffe.1_Missense_Mutation_p.G400V	p.G704V	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN			14	2530	-			704			Cys-rich.		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.2111G>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046433	0.93740	.	.	ENSG00000140873	ENST00000282849	D	0.90261	-2.64	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.97579	0.9207	H	0.98507	4.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	D	0.98514	1.0620	10	0.87932	D	0	.	19.3421	0.94347	0.0:1.0:0.0:0.0	.	704;704	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	V	704	ENSP00000282849:G704V	ENSP00000282849:G704V	G	-	2	0	ADAMTS18	75913786	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	7.480000	0.81109	2.826000	0.97356	0.655000	0.94253	GGA		0.398	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			14	141	1	0	0.000219431	0.00245	0.000254436	14	141				
PKD1L2	114780	broad.mit.edu	37	16	81232459	81232459	+	RNA	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:81232459A>T	ENST00000525539.1	-	0	1350				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.S451T(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TGCAGCCCTGACAGCAGCTCC	0.582																																							uc002fgh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1351-1353)TCA>ACA		polycystin 1-like 2 isoform a							146.0	152.0	150.0					16																	81232459		2004	4147	6151			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81232459A>T	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81232459A>T						PKD1L2_uc002fgj.2_Missense_Mutation_p.S451T	p.S451T	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN			7	1351	-			451			REJ.|Extracellular (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37	c.1351T>A		.	.	.	.	.	.	.	.	.	.	A	11.64	1.699385	0.30142	.	.	ENSG00000166473	ENST00000337114	T	0.01388	4.95	4.98	2.57	0.30868	Egg jelly receptor, REJ-like (1);	0.333656	0.26065	N	0.026556	T	0.03053	0.0090	.	.	.	0.09310	N	1	D;P	0.53619	0.961;0.704	P;B	0.52159	0.691;0.197	T	0.33471	-0.9867	9	0.87932	D	0	-2.8851	7.3975	0.26944	0.781:0.1432:0.0758:0.0	.	451;451	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	T	451	ENSP00000337397:S451T	ENSP00000337397:S451T	S	-	1	0	PKD1L2	79789960	0.225000	0.23685	0.004000	0.12327	0.080000	0.17528	1.374000	0.34283	0.749000	0.32854	0.448000	0.29417	TCA		0.582	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			40	92	0	0	0	0.005524	0	40	92				
SLC38A8	146167	broad.mit.edu	37	16	84050277	84050277	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:84050277C>A	ENST00000299709.3	-	8	1008	c.1009G>T	c.(1009-1011)Gcc>Tcc	p.A337S		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	337					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)		p.A337S(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TCGGCCAGGGCGCTGGGCCCC	0.657																																							uc002fhg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1009-1011)GCC>TCC		solute carrier family 38, member 8							45.0	48.0	47.0					16																	84050277		2200	4300	6500	SO:0001583	missense	146167				amino acid transport|sodium ion transport	integral to membrane		g.chr16:84050277C>A		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.1009G>T	16.37:g.84050277C>A	ENSP00000299709:p.Ala337Ser						p.A337S	NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN			8	1009	-			337						Missense_Mutation	SNP	ENST00000299709.3	37	c.1009G>T	CCDS32495.1	.	.	.	.	.	.	.	.	.	.	C	2.381	-0.342100	0.05243	.	.	ENSG00000166558	ENST00000299709	T	0.02258	4.37	3.84	0.434	0.16539	.	1.169400	0.06205	N	0.684013	T	0.02727	0.0082	L	0.36672	1.1	0.09310	N	1	P	0.39060	0.657	B	0.42593	0.392	T	0.47861	-0.9084	10	0.20046	T	0.44	.	5.1165	0.14836	0.0:0.5917:0.1777:0.2306	.	337	A6NNN8	S38A8_HUMAN	S	337	ENSP00000299709:A337S	ENSP00000299709:A337S	A	-	1	0	SLC38A8	82607778	0.000000	0.05858	0.137000	0.22149	0.348000	0.29142	0.316000	0.19469	0.296000	0.22592	0.478000	0.44815	GCC		0.657	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1	NM_001080442		13	40	1	0	0.000151284	0.001855	0.00017668	13	40				
SLC38A8	146167	broad.mit.edu	37	16	84050766	84050766	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:84050766G>C	ENST00000299709.3	-	7	931	c.932C>G	c.(931-933)cCc>cGc	p.P311R		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	311					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)		p.P311R(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						GAGCACGATGGGGTAGACAGT	0.547																																							uc002fhg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(931-933)CCC>CGC		solute carrier family 38, member 8							103.0	81.0	88.0					16																	84050766		2200	4300	6500	SO:0001583	missense	146167				amino acid transport|sodium ion transport	integral to membrane		g.chr16:84050766G>C		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.932C>G	16.37:g.84050766G>C	ENSP00000299709:p.Pro311Arg						p.P311R	NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN			7	932	-			311			Helical; (Potential).			Missense_Mutation	SNP	ENST00000299709.3	37	c.932C>G	CCDS32495.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215221	0.79352	.	.	ENSG00000166558	ENST00000299709	T	0.03212	4.01	4.75	4.75	0.60458	.	0.057587	0.64402	D	0.000001	T	0.21590	0.0520	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01966	-1.1238	10	0.87932	D	0	-23.3369	16.5211	0.84317	0.0:0.0:1.0:0.0	.	311	A6NNN8	S38A8_HUMAN	R	311	ENSP00000299709:P311R	ENSP00000299709:P311R	P	-	2	0	SLC38A8	82608267	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.875000	0.92372	2.184000	0.69523	0.478000	0.44815	CCC		0.547	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1	NM_001080442		4	24	0	0	0	0.009096	0	4	24				
MTHFSD	64779	broad.mit.edu	37	16	86582141	86582141	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:86582141C>A	ENST00000360900.6	-	4	305	c.280G>T	c.(280-282)Gga>Tga	p.G94*	MTHFSD_ENST00000322911.6_Nonsense_Mutation_p.G93*|MTHFSD_ENST00000546093.1_5'UTR|MTHFSD_ENST00000568037.1_5'UTR|MTHFSD_ENST00000543303.2_Nonsense_Mutation_p.G93*|MTHFSD_ENST00000381214.5_Nonsense_Mutation_p.G94*	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	94							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G94*(1)|p.G93*(1)		endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						TTAAACAATCCCGTTCTCAGT	0.388																																							uc002fjn.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(280-282)GGA>TGA		methenyltetrahydrofolate synthetase domain							160.0	149.0	153.0					16																	86582141		1856	4087	5943	SO:0001587	stop_gained	64779				folic acid-containing compound biosynthetic process		5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|RNA binding	g.chr16:86582141C>A	AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.280G>T	16.37:g.86582141C>A	ENSP00000354152:p.Gly94*					MTHFSD_uc010voo.1_Nonsense_Mutation_p.G74*|MTHFSD_uc002fjo.2_5'UTR|MTHFSD_uc002fjm.2_Nonsense_Mutation_p.G93*|MTHFSD_uc010vop.1_5'UTR|MTHFSD_uc010voq.1_Nonsense_Mutation_p.G93*|MTHFSD_uc010vor.1_Nonsense_Mutation_p.G94*|MTHFSD_uc002fjp.2_Nonsense_Mutation_p.G74*	p.G94*	NM_001159377	NP_001152849	Q2M296	MTHSD_HUMAN			4	331	-			94					A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Nonsense_Mutation	SNP	ENST00000360900.6	37	c.280G>T	CCDS54047.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760365	0.89932	.	.	ENSG00000103248	ENST00000543303;ENST00000381214;ENST00000360900;ENST00000322911	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-12.6443	17.9576	0.89074	0.0:1.0:0.0:0.0	.	.	.	.	X	92;94;94;93	.	ENSP00000326777:G93X	G	-	1	0	MTHFSD	85139642	1.000000	0.71417	0.492000	0.27490	0.965000	0.64279	6.860000	0.75473	2.485000	0.83878	0.655000	0.94253	GGA		0.388	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432182.1	NM_022764		26	92	1	0	1.50538e-07	0.00632	2.04782e-07	26	92				
CBFA2T3	863	broad.mit.edu	37	16	88951655	88951655	+	Missense_Mutation	SNP	G	G	T	rs367560755		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr16:88951655G>T	ENST00000268679.4	-	7	1312	c.916C>A	c.(916-918)Cgc>Agc	p.R306S	CBFA2T3_ENST00000327483.5_Missense_Mutation_p.R220S|RP11-830F9.5_ENST00000565053.1_RNA|CBFA2T3_ENST00000436887.2_Missense_Mutation_p.R281S|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.R220S|CBFA2T3_ENST00000448839.1_Missense_Mutation_p.R230S|RP11-830F9.5_ENST00000562405.1_RNA|RP11-830F9.5_ENST00000562574.1_RNA|RP11-830F9.5_ENST00000569249.1_RNA	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	306	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.		R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R306S(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		AGCGGGTCGCGGTCTGACCCG	0.677			T	RUNX1	AML																																		uc002fmm.1		NA		Dom	yes		16	16q24	863	T	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""			L	RUNX1		AML		1	Substitution - Missense(1)	p.R306H(1)	lung(1)	large_intestine(3)|ovary(1)	4						c.(916-918)CGC>AGC		myeloid translocation gene on chromosome 16							62.0	48.0	53.0					16																	88951655		2188	4285	6473	SO:0001583	missense	863				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:88951655G>T	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.916C>A	16.37:g.88951655G>T	ENSP00000268679:p.Arg306Ser					CBFA2T3_uc002fml.1_Missense_Mutation_p.R220S|CBFA2T3_uc010cif.1_Missense_Mutation_p.R245S|CBFA2T3_uc002fmn.1_Missense_Mutation_p.R281S	p.R306S	NM_005187	NP_005178	O75081	MTG16_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0275)	7	1102	-			306		R -> H (in a colorectal cancer sample; somatic mutation).	Mediates localization to the nucleus (By similarity).|Mediates interaction with PDE7A (in isoform 2).		D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	ENST00000268679.4	37	c.916C>A	CCDS10972.1	.	.	.	.	.	.	.	.	.	.	G	9.425	1.084063	0.20309	.	.	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000448839;ENST00000360302	T;T;T;T;T	0.52057	1.31;0.68;0.81;1.28;1.31	5.18	-1.33	0.09172	.	0.226593	0.35970	N	0.002872	T	0.41534	0.1163	M	0.69248	2.105	0.32525	N	0.535751	B;B;B;B	0.27932	0.06;0.15;0.194;0.055	B;B;B;B	0.27608	0.013;0.018;0.081;0.061	T	0.50676	-0.8800	10	0.72032	D	0.01	-16.6547	9.6591	0.39943	0.0:0.3452:0.3009:0.3539	.	281;306;306;220	E7EU24;B2RBQ7;O75081;O75081-2	.;.;MTG16_HUMAN;.	S	220;306;281;230;220	ENSP00000332122:R220S;ENSP00000268679:R306S;ENSP00000395739:R281S;ENSP00000401254:R230S;ENSP00000353449:R220S	ENSP00000268679:R306S	R	-	1	0	CBFA2T3	87479156	0.050000	0.20438	0.027000	0.17364	0.290000	0.27261	0.377000	0.20552	-0.035000	0.13691	0.462000	0.41574	CGC		0.677	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187		6	11	1	0	0.00198382	0.001984	0.0022108	6	11				
AIPL1	23746	broad.mit.edu	37	17	6330265	6330265	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:6330265C>A	ENST00000381129.3	-	4	658	c.578G>T	c.(577-579)cGc>cTc	p.R193L	AIPL1_ENST00000574506.1_Missense_Mutation_p.R181L|AIPL1_ENST00000575265.1_Missense_Mutation_p.R193L|AIPL1_ENST00000576307.1_Missense_Mutation_p.R133L|AIPL1_ENST00000250087.5_Missense_Mutation_p.R130L|AIPL1_ENST00000576776.1_Missense_Mutation_p.R193L|AIPL1_ENST00000570466.1_Missense_Mutation_p.R171L|AIPL1_ENST00000571740.1_Missense_Mutation_p.R185L	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	193					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)	p.R193L(1)		NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		CTCCTCGTAGCGGCCCAGCTT	0.597																																							uc002gcp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(577-579)CGC>CTC		aryl hydrocarbon receptor interacting							133.0	124.0	127.0					17																	6330265		2203	4300	6503	SO:0001583	missense	23746				protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding	g.chr17:6330265C>A	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.578G>T	17.37:g.6330265C>A	ENSP00000370521:p.Arg193Leu					AIPL1_uc002gcq.2_Missense_Mutation_p.R133L|AIPL1_uc002gcr.2_Missense_Mutation_p.R130L|AIPL1_uc010clk.2_Missense_Mutation_p.R171L|AIPL1_uc010cll.2_Missense_Mutation_p.R193L|AIPL1_uc002gcs.2_Missense_Mutation_p.R193L	p.R193L	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN		COAD - Colon adenocarcinoma(228;0.141)	4	673	-			193			TPR 1.		D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	ENST00000381129.3	37	c.578G>T	CCDS11075.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979487	0.74360	.	.	ENSG00000129221	ENST00000381129;ENST00000381128;ENST00000250087;ENST00000444243	D;D	0.89681	-2.55;-2.55	4.71	4.71	0.59529	Elongated TPR repeat-containing domain (1);Tetratricopeptide repeat-containing (1);	0.294589	0.37437	N	0.002095	D	0.93200	0.7834	M	0.75777	2.31	0.52501	D	0.999952	D;P;P;D;D;D	0.64830	0.994;0.791;0.858;0.986;0.985;0.988	P;B;B;P;P;P	0.62298	0.9;0.378;0.411;0.722;0.88;0.889	D	0.93902	0.7189	10	0.66056	D	0.02	-32.628	15.4942	0.75637	0.0:1.0:0.0:0.0	.	193;171;193;130;133;193	Q659W3;Q659W4;F1T0C4;Q9NZN9-3;Q9NZN9-2;Q9NZN9	.;.;.;.;.;AIPL1_HUMAN	L	193;133;130;193	ENSP00000370521:R193L;ENSP00000250087:R130L	ENSP00000250087:R130L	R	-	2	0	AIPL1	6270989	0.949000	0.32298	0.989000	0.46669	0.962000	0.63368	2.299000	0.43611	2.326000	0.78906	0.491000	0.48974	CGC		0.597	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219828.3	NM_014336		51	49	1	0	9.52127e-25	0.01441	1.77657e-24	51	49				
USP43	124739	broad.mit.edu	37	17	9578299	9578299	+	Splice_Site	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:9578299A>T	ENST00000285199.7	+	4	928	c.832A>T	c.(832-834)Agg>Tgg	p.R278W	USP43_ENST00000570475.1_Splice_Site_p.R278W|USP43_ENST00000570827.2_3'UTR	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	278	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.R279W(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						GCGCCAGACGAGGTACGTGAG	0.537																																							uc010cod.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(832-834)AGG>TGG		ubiquitin specific protease 43							248.0	241.0	243.0					17																	9578299		2069	4198	6267	SO:0001630	splice_region_variant	124739				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr17:9578299A>T	AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.833+1A>T	17.37:g.9578299A>T						USP43_uc002gma.3_5'UTR|USP43_uc010vva.1_Missense_Mutation_p.R278W|USP43_uc010coe.2_Missense_Mutation_p.R75W	p.R278W	NM_153210	NP_694942	Q70EL4	UBP43_HUMAN			4	832	+			278					A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Missense_Mutation	SNP	ENST00000285199.7	37	c.832A>T	CCDS45610.1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.776628	0.70107	.	.	ENSG00000154914	ENST00000285199	T	0.02974	4.09	4.46	3.35	0.38373	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	U	0.000000	T	0.07818	0.0196	L	0.39085	1.19	0.52501	D	0.999958	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.13575	-1.0504	10	0.62326	D	0.03	-9.0391	8.8028	0.34918	0.6298:0.3702:0.0:0.0	.	278;278	B7ZVX5;Q70EL4	.;UBP43_HUMAN	W	278	ENSP00000285199:R278W	ENSP00000285199:R278W	R	+	1	2	USP43	9519024	0.892000	0.30473	0.969000	0.41365	0.797000	0.45037	3.439000	0.52878	0.552000	0.29026	0.460000	0.39030	AGG		0.537	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439855.3	NM_153210	Missense_Mutation	76	93	0	0	0	0.01441	0	76	93				
MYH4	4622	broad.mit.edu	37	17	10366242	10366242	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:10366242G>T	ENST00000255381.2	-	11	1058	c.948C>A	c.(946-948)gtC>gtA	p.V316V	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	316	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.V316V(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CCCCTTGGCTGACAAATGCGA	0.393																																							uc002gmn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|skin(2)|central_nervous_system(1)	13						c.(946-948)GTC>GTA		myosin, heavy polypeptide 4, skeletal muscle							129.0	124.0	126.0					17																	10366242		2203	4300	6503	SO:0001819	synonymous_variant	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10366242G>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.948C>A	17.37:g.10366242G>T						uc002gml.1_Intron	p.V316V	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN			11	1059	-			316			Myosin head-like.			Silent	SNP	ENST00000255381.2	37	c.948C>A	CCDS11154.1																																																																																				0.393	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		38	37	1	0	9.9191e-30	0.00874	1.8651e-29	38	37				
MYH1	4619	broad.mit.edu	37	17	10417165	10417165	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:10417165G>T	ENST00000226207.5	-	8	808	c.714C>A	c.(712-714)acC>acA	p.T238T	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	238	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.T238T(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CATTCCTCACGGTCTTGGCGT	0.502																																							uc002gmo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(712-714)ACC>ACA		myosin, heavy chain 1, skeletal muscle, adult							70.0	70.0	70.0					17																	10417165		2203	4300	6503	SO:0001819	synonymous_variant	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10417165G>T		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.714C>A	17.37:g.10417165G>T						uc002gml.1_Intron	p.T238T	NM_005963	NP_005954	P12882	MYH1_HUMAN			8	808	-			238			Myosin head-like.		Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	c.714C>A	CCDS11155.1																																																																																				0.502	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		28	23	1	0	3.11337e-16	0.013726	5.17479e-16	28	23				
MYH2	4620	broad.mit.edu	37	17	10446451	10446451	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:10446451T>A	ENST00000245503.5	-	9	1153	c.769A>T	c.(769-771)Act>Tct	p.T257S	CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.T257S|MYH2_ENST00000397183.2_Missense_Mutation_p.T257S	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	257	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.T257S(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TTTCCAGTAGTGCCAAAGTGG	0.279																																							uc010coi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(769-771)ACT>TCT		myosin heavy chain IIa							72.0	84.0	80.0					17																	10446451		2203	4294	6497	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10446451T>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.769A>T	17.37:g.10446451T>A	ENSP00000245503:p.Thr257Ser					uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.T257S|MYH2_uc010coj.2_Missense_Mutation_p.T257S	p.T257S	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN			9	897	-			257			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.769A>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	T	13.71	2.318835	0.41096	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.86865	-2.18;-2.18;-2.18	4.87	3.8	0.43715	Myosin head, motor domain (2);	0.180393	0.26450	U	0.024313	T	0.79592	0.4472	L	0.33710	1.025	0.36396	D	0.862793	B;B	0.19583	0.037;0.005	B;B	0.28638	0.092;0.019	T	0.74711	-0.3573	10	0.35671	T	0.21	.	7.1188	0.25431	0.0:0.1926:0.0:0.8074	.	257;257	Q567P6;Q9UKX2	.;MYH2_HUMAN	S	257	ENSP00000433944:T257S;ENSP00000245503:T257S;ENSP00000380367:T257S	ENSP00000245503:T257S	T	-	1	0	MYH2	10387176	0.061000	0.20836	0.992000	0.48379	0.993000	0.82548	0.381000	0.20619	0.900000	0.36469	0.459000	0.35465	ACT		0.279	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		19	92	0	0	0	0.014323	0	19	92				
MYH2	4620	broad.mit.edu	37	17	10447283	10447283	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:10447283T>C	ENST00000245503.5	-	7	968	c.584A>G	c.(583-585)tAc>tGc	p.Y195C	CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.Y195C|MYH2_ENST00000397183.2_Missense_Mutation_p.Y195C	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	195	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.Y195C(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TGTTGCAAAGTACTGGATGAC	0.433																																							uc010coi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(583-585)TAC>TGC		myosin heavy chain IIa							133.0	122.0	126.0					17																	10447283		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10447283T>C		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.584A>G	17.37:g.10447283T>C	ENSP00000245503:p.Tyr195Cys					uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.Y195C|MYH2_uc010coj.2_Missense_Mutation_p.Y195C	p.Y195C	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN			7	712	-			195			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.584A>G	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	T	11.68	1.712090	0.30322	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.91577	-2.87;-2.87;-2.87	4.86	3.77	0.43336	Myosin head, motor domain (3);	0.000000	0.35903	U	0.002905	D	0.97111	0.9056	H	0.99286	4.5	0.53688	D	0.999971	D;D	0.89917	0.997;1.0	D;D	0.85130	0.971;0.997	D	0.96484	0.9358	10	0.87932	D	0	.	10.3516	0.43939	0.1467:0.0:0.0:0.8533	.	195;195	Q567P6;Q9UKX2	.;MYH2_HUMAN	C	195	ENSP00000433944:Y195C;ENSP00000245503:Y195C;ENSP00000380367:Y195C	ENSP00000245503:Y195C	Y	-	2	0	MYH2	10388008	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.024000	0.70857	0.862000	0.35528	0.533000	0.62120	TAC		0.433	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		13	75	0	0	0	0.013537	0	13	75				
MYH3	4621	broad.mit.edu	37	17	10535312	10535312	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:10535312C>G	ENST00000583535.1	-	35	5065	c.4978G>C	c.(4978-4980)Gat>Cat	p.D1660H	MYH3_ENST00000226209.7_Missense_Mutation_p.D1660H	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1660					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.D1660H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CGGAGGGCATCATCCAGGTGG	0.572																																							uc002gmq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(4978-4980)GAT>CAT		myosin, heavy chain 3, skeletal muscle,							34.0	34.0	34.0					17																	10535312		2203	4300	6503	SO:0001583	missense	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10535312C>G		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4978G>C	17.37:g.10535312C>G	ENSP00000464317:p.Asp1660His						p.D1660H	NM_002470	NP_002461	P11055	MYH3_HUMAN			34	5055	-			1660			Potential.		Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	c.4978G>C	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454547	0.84209	.	.	ENSG00000109063	ENST00000226209	T	0.80653	-1.4	4.15	4.15	0.48705	Myosin tail (1);	.	.	.	.	D	0.92319	0.7563	H	0.95884	3.735	0.51012	D	0.999909	P	0.47910	0.902	P	0.61533	0.89	D	0.94691	0.7874	9	0.66056	D	0.02	.	16.9636	0.86279	0.0:1.0:0.0:0.0	.	1660	P11055	MYH3_HUMAN	H	1660	ENSP00000226209:D1660H	ENSP00000226209:D1660H	D	-	1	0	MYH3	10476037	1.000000	0.71417	0.982000	0.44146	0.986000	0.74619	7.332000	0.79203	2.311000	0.77944	0.655000	0.94253	GAT		0.572	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		21	20	0	0	0	0.014323	0	21	20				
NF1	4763	broad.mit.edu	37	17	29663445	29663445	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:29663445C>T	ENST00000358273.4	+	41	6484	c.6101C>T	c.(6100-6102)aCt>aTt	p.T2034I	NF1_ENST00000581113.2_3'UTR|NF1_ENST00000444181.2_5'Flank|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000356175.3_Missense_Mutation_p.T2013I	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2034					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.T2034I(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATGGCAGATACTGCTGTAGCT	0.393			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		13	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(2)		soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(6100-6102)ACT>ATT		neurofibromin isoform 1							112.0	97.0	103.0					17																	29663445		2203	4300	6503	SO:0001583	missense	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29663445C>T		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6101C>T	17.37:g.29663445C>T	ENSP00000351015:p.Thr2034Ile	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_uc002hgh.2_Missense_Mutation_p.T2013I|NF1_uc010cso.2_Missense_Mutation_p.T222I|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	p.T2034I	NM_001042492	NP_001035957	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	41	6434	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	2034					O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	c.6101C>T	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375832	0.82682	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.93953	-3.32;-3.32;-3.32	5.63	5.63	0.86233	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	D	0.95255	0.8461	L	0.45581	1.43	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.78314	0.991;0.987	D	0.93315	0.6688	10	0.27082	T	0.32	.	19.0223	0.92920	0.0:1.0:0.0:0.0	.	2013;2034	P21359-2;P21359	.;NF1_HUMAN	I	2034;2013;1679	ENSP00000351015:T2034I;ENSP00000348498:T2013I;ENSP00000389907:T1679I	ENSP00000348498:T2013I	T	+	2	0	NF1	26687571	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.334000	0.79224	2.797000	0.96272	0.655000	0.94253	ACT		0.393	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		15	62	0	0	0	0.00499	0	15	62				
KRTAP3-3	85293	broad.mit.edu	37	17	39150336	39150336	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:39150336G>A	ENST00000391586.1	-	1	49	c.14C>T	c.(13-15)gCc>gTc	p.A5V		NM_033185.2	NP_149441.1	Q9BYR6	KRA33_HUMAN	keratin associated protein 3-3	5	3 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.A5V(1)		lung(2)|prostate(2)	4		Breast(137;0.00043)				GCCTCGAGAGGCACAGCAATC	0.547																																							uc002hvr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13-15)GCC>GTC		keratin associated protein 3-3							95.0	93.0	94.0					17																	39150336		2203	4296	6499	SO:0001583	missense	85293					keratin filament	structural molecule activity	g.chr17:39150336G>A	AJ406933	CCDS32643.1	17q21.2	2013-06-25			ENSG00000212899	ENSG00000212899		"""Keratin associated proteins"""	18890	protein-coding gene	gene with protein product						11279113	Standard	NM_033185		Approved	KAP3.3	uc002hvr.1	Q9BYR6	OTTHUMG00000133591	ENST00000391586.1:c.14C>T	17.37:g.39150336G>A	ENSP00000375428:p.Ala5Val						p.A5V	NM_033185	NP_149441	Q9BYR6	KRA33_HUMAN			1	50	-		Breast(137;0.00043)	5			1.|3 X 5 AA repeats of C-C-X(3).		Q52LP0|Q6NTD4	Missense_Mutation	SNP	ENST00000391586.1	37	c.14C>T	CCDS32643.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-2.004514	0.00431	.	.	ENSG00000212899	ENST00000391586	T	0.24538	1.85	5.3	-6.31	0.02001	.	1.558290	0.03527	N	0.221968	T	0.10981	0.0268	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28554	-1.0040	9	0.10902	T	0.67	.	7.6993	0.28613	0.576:0.1135:0.3105:0.0	.	5	Q9BYR6	KRA33_HUMAN	V	5	ENSP00000375428:A5V	ENSP00000375428:A5V	A	-	2	0	KRTAP3-3	36403862	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.740000	0.01839	-0.657000	0.05373	-1.121000	0.02013	GCC		0.547	KRTAP3-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257695.1			31	84	0	0	0	0.009535	0	31	84				
OSBPL7	114881	broad.mit.edu	37	17	45886818	45886818	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:45886818T>A	ENST00000007414.3	-	19	2098	c.1907A>T	c.(1906-1908)aAg>aTg	p.K636M	OSBPL7_ENST00000392507.3_Missense_Mutation_p.K636M	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	636					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.K636M(1)		autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						GGATGTCACCTTGTTCCACTC	0.567																																							uc002ilx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1906-1908)AAG>ATG		oxysterol-binding protein-like protein 7							113.0	85.0	94.0					17																	45886818		2203	4300	6503	SO:0001583	missense	114881				lipid transport		lipid binding	g.chr17:45886818T>A	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.1907A>T	17.37:g.45886818T>A	ENSP00000007414:p.Lys636Met					OSBPL7_uc002ilw.1_Missense_Mutation_p.K198M	p.K636M	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN			19	2110	-			636					D3DTT6|Q6PIV6	Missense_Mutation	SNP	ENST00000007414.3	37	c.1907A>T	CCDS11515.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.330545	0.81690	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.34275	1.37;1.37	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.91300	3.195	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.75642	-0.3247	10	0.87932	D	0	-39.0058	13.5361	0.61648	0.0:0.0:0.0:1.0	.	636	Q9BZF2	OSBL7_HUMAN	M	636	ENSP00000007414:K636M;ENSP00000376295:K636M	ENSP00000007414:K636M	K	-	2	0	OSBPL7	43241817	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.979000	0.88103	1.842000	0.53543	0.459000	0.35465	AAG		0.567	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731		10	27	0	0	0	0.010729	0	10	27				
BCAS3	54828	broad.mit.edu	37	17	58946045	58946045	+	Splice_Site	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:58946045G>T	ENST00000390652.5	+	8	615		c.e8+1		BCAS3_ENST00000588462.1_Splice_Site|BCAS3_ENST00000589222.1_Splice_Site|BCAS3_ENST00000408905.3_Splice_Site|BCAS3_ENST00000407086.3_Splice_Site	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3									p.?(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GCAATAAACGGTAAGGATTTT	0.373																																							uc002iyv.3		NA																	1	Unknown(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.e8+1		breast carcinoma amplified sequence 3 isoform 1							118.0	108.0	111.0					17																	58946045		1818	4078	5896	SO:0001630	splice_region_variant	54828					nucleus		g.chr17:58946045G>T	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.584+1G>T	17.37:g.58946045G>T						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Splice_Site_p.R195_splice|BCAS3_uc002iyw.3_Splice_Site_p.R191_splice	p.R195_splice	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)		8	693	+									Splice_Site	SNP	ENST00000390652.5	37	c.584_splice	CCDS45749.1	.	.	.	.	.	.	.	.	.	.	g	21.8	4.208200	0.79240	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6469	0.91413	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BCAS3	56300827	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	9.095000	0.94175	2.694000	0.91930	0.645000	0.84053	.		0.373	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679	Intron	10	37	1	0	2.17888e-05	0.006214	2.68636e-05	10	37				
NACA2	342538	broad.mit.edu	37	17	59668525	59668525	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:59668525G>T	ENST00000521764.1	-	1	38	c.17C>A	c.(16-18)aCa>aAa	p.T6K		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	6					myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.T6K(1)		large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					GACGGTTTCTGTGGCTTCGCC	0.582																																							uc002izj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(16-18)ACA>AAA		nascent-polypeptide-associated complex alpha							59.0	54.0	56.0					17																	59668525		2203	4300	6503	SO:0001583	missense	342538				protein transport	cytoplasm|nucleus		g.chr17:59668525G>T	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.17C>A	17.37:g.59668525G>T	ENSP00000427802:p.Thr6Lys						p.T6K	NM_199290	NP_954984	Q9H009	NACA2_HUMAN			1	43	-	all_epithelial(1;3.12e-14)		6					Q2VIR9	Missense_Mutation	SNP	ENST00000521764.1	37	c.17C>A	CCDS11630.1	.	.	.	.	.	.	.	.	.	.	G	9.790	1.177703	0.21787	.	.	ENSG00000253506	ENST00000521764	T	0.46819	0.86	0.753	-0.344	0.12628	.	0.000000	0.64402	U	0.000018	T	0.32615	0.0835	L	0.48362	1.52	0.32601	N	0.525926	P	0.37525	0.598	B	0.34722	0.188	T	0.34004	-0.9846	8	.	.	.	.	.	.	.	.	6	Q9H009	NACA2_HUMAN	K	6	ENSP00000427802:T6K	.	T	-	2	0	NACA2	57023307	1.000000	0.71417	0.612000	0.29024	0.019000	0.09904	4.717000	0.61923	-0.116000	0.11893	-0.474000	0.04947	ACA		0.582	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2	NM_199290		11	26	1	0	2.27111e-07	0.013537	3.0638e-07	11	26				
KCNJ2	3759	broad.mit.edu	37	17	68172048	68172048	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:68172048G>A	ENST00000243457.3	+	2	1251	c.868G>A	c.(868-870)Gca>Aca	p.A290T	KCNJ2_ENST00000535240.1_Missense_Mutation_p.A290T	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	290					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)	p.A290T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					CATTGACAACGCAGACTTTGA	0.438																																							uc010dfg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(868-870)GCA>ACA		potassium inwardly-rectifying channel J2							80.0	81.0	81.0					17																	68172048		2203	4300	6503	SO:0001583	missense	3759				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding	g.chr17:68172048G>A	AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.868G>A	17.37:g.68172048G>A	ENSP00000243457:p.Ala290Thr					KCNJ2_uc002jir.2_Missense_Mutation_p.A290T	p.A290T	NM_000891	NP_000882	P63252	IRK2_HUMAN			2	1269	+	Breast(10;1.64e-08)		290			Cytoplasmic (By similarity).		O15110|P48049	Missense_Mutation	SNP	ENST00000243457.3	37	c.868G>A	CCDS11688.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491699	0.44249	.	.	ENSG00000123700	ENST00000535240;ENST00000243457	D;D	0.93953	-3.32;-3.32	5.77	5.77	0.91146	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.051900	0.85682	D	0.000000	D	0.92401	0.7588	L	0.53671	1.685	0.44117	D	0.996894	B	0.29835	0.258	B	0.38655	0.278	D	0.89063	0.3464	9	.	.	.	.	15.1221	0.72453	0.0:0.0:0.8586:0.1414	.	290	P63252	IRK2_HUMAN	T	290	ENSP00000441848:A290T;ENSP00000243457:A290T	.	A	+	1	0	KCNJ2	65683643	1.000000	0.71417	0.979000	0.43373	0.951000	0.60555	5.837000	0.69381	2.885000	0.99019	0.655000	0.94253	GCA		0.438	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450889.1	NM_000891		7	69	0	0	0	0.004482	0	7	69				
QRICH2	84074	broad.mit.edu	37	17	74289961	74289961	+	Missense_Mutation	SNP	G	G	A	rs536269106	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:74289961G>A	ENST00000262765.5	-	4	528	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	117								p.R117W(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GATGCAGTCCGATCCGGGCCA	0.557																																							uc002jrd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(349-351)CGG>TGG		glutamine rich 2							84.0	81.0	82.0					17																	74289961		2203	4300	6503	SO:0001583	missense	84074						protein binding	g.chr17:74289961G>A	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.349C>T	17.37:g.74289961G>A	ENSP00000262765:p.Arg117Trp					QRICH2_uc010wsz.1_Missense_Mutation_p.R43W|QRICH2_uc010dgw.1_Intron	p.R117W	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN			4	529	-			117					A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	c.349C>T	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.354017	0.24512	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.10099	2.91	3.44	-3.39	0.04868	.	.	.	.	.	T	0.06462	0.0166	N	0.22421	0.69	0.09310	N	1	D;D	0.60160	0.987;0.987	B;B	0.40741	0.339;0.335	T	0.32771	-0.9894	9	0.72032	D	0.01	-0.0072	7.9539	0.30031	0.0:0.1296:0.217:0.6534	.	117;117	B5MD94;Q9H0J4	.;QRIC2_HUMAN	W	117	ENSP00000262765:R117W	ENSP00000262765:R117W	R	-	1	2	QRICH2	71801556	0.001000	0.12720	0.000000	0.03702	0.015000	0.08874	0.344000	0.19962	-0.528000	0.06366	0.563000	0.77884	CGG		0.557	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		9	49	0	0	0	0.004482	0	9	49				
CD7	924	broad.mit.edu	37	17	80274796	80274796	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:80274796G>A	ENST00000312648.3	-	2	250	c.144C>T	c.(142-144)tgC>tgT	p.C48C	CD7_ENST00000578509.1_5'UTR|CD7_ENST00000584284.1_Silent_p.C48C|CD7_ENST00000583376.1_5'UTR	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	48	Ig-like.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.C48C(1)		endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			CGCTGGTGGAGCAGGTGATGT	0.642																																					Pancreas(45;804 1068 19702 28207 28798)	Pancreas(45;804 1068 19702 28207 28798)	uc002kel.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(142-144)TGC>TGT		CD7 antigen precursor							43.0	44.0	44.0					17																	80274796		2203	4300	6503	SO:0001819	synonymous_variant	924				immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity	g.chr17:80274796G>A	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.144C>T	17.37:g.80274796G>A						CD7_uc010din.2_Silent_p.C48C|CD7_uc002kem.2_Missense_Mutation_p.L30F|CD7_uc010wvk.1_Silent_p.C48C	p.C48C	NM_006137	NP_006128	P09564	CD7_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)		2	253	-	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		48			Ig-like.|Extracellular (Probable).			Silent	SNP	ENST00000312648.3	37	c.144C>T	CCDS11807.1																																																																																				0.642	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137		7	28	0	0	0	0.004482	0	7	28				
COLEC12	81035	broad.mit.edu	37	18	348117	348117	+	Silent	SNP	G	G	C	rs143313397		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:348117G>C	ENST00000400256.3	-	4	435	c.228C>G	c.(226-228)cgC>cgG	p.R76R		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	76					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.R76R(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CATAGGTTTGGCGAGATGTTT	0.363																																							uc002kkm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(226-228)CGC>CGG		collectin sub-family member 12							230.0	185.0	201.0					18																	348117		2203	4300	6503	SO:0001819	synonymous_variant	81035				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity	g.chr18:348117G>C	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.228C>G	18.37:g.348117G>C							p.R76R	NM_130386	NP_569057	Q5KU26	COL12_HUMAN			4	443	-		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)	76			Potential.|Extracellular (Potential).		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000400256.3	37	c.228C>G	CCDS32782.1																																																																																				0.363	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1			23	66	0	0	0	0.005443	0	23	66				
CEP192	55125	broad.mit.edu	37	18	13049430	13049430	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:13049430G>T	ENST00000325971.8	+	14	2445	c.852G>T	c.(850-852)aaG>aaT	p.K284N	CEP192_ENST00000506447.1_Missense_Mutation_p.K880N|CEP192_ENST00000430049.2_Missense_Mutation_p.K405N			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	284					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.K880N(1)|p.K284N(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTGATGTGAAGACATGTTCCA	0.363																																							uc010xac.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(2638-2640)AAG>AAT		centrosomal protein 192kDa							101.0	91.0	95.0					18																	13049430		2203	4300	6503	SO:0001583	missense	55125							g.chr18:13049430G>T	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.852G>T	18.37:g.13049430G>T	ENSP00000317156:p.Lys284Asn					CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.K405N|CEP192_uc002kru.2_RNA|CEP192_uc002krs.1_Missense_Mutation_p.K621N	p.K880N	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN			16	2720	+			880					A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37	c.2640G>T		.	.	.	.	.	.	.	.	.	.	G	3.369	-0.128897	0.06753	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.77489	-1.1;-1.1;-1.1	5.16	2.32	0.28847	.	0.435529	0.19386	N	0.115537	T	0.67961	0.2949	L	0.51422	1.61	0.09310	N	1	B;B;P	0.43701	0.358;0.358;0.815	B;B;B	0.42422	0.219;0.277;0.387	T	0.55198	-0.8178	10	0.19590	T	0.45	-0.3537	5.5381	0.17023	0.1687:0.0:0.6732:0.1581	.	405;880;284	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	N	880;284;284;405	ENSP00000427550:K880N;ENSP00000317156:K284N;ENSP00000389190:K405N	ENSP00000317156:K284N	K	+	3	2	CEP192	13039430	0.064000	0.20934	0.000000	0.03702	0.008000	0.06430	2.502000	0.45398	0.257000	0.21650	0.650000	0.86243	AAG		0.363	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		18	79	1	0	7.07596e-05	0.006122	8.44606e-05	18	79				
ZNF521	25925	broad.mit.edu	37	18	22804890	22804890	+	Nonsense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:22804890G>A	ENST00000361524.3	-	4	3140	c.2992C>T	c.(2992-2994)Cag>Tag	p.Q998*	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Nonsense_Mutation_p.Q778*|ZNF521_ENST00000538137.2_Nonsense_Mutation_p.Q998*	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	998					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.Q998*(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TCTTCACTCTGGAGAGGCATC	0.493			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		1	Substitution - Nonsense(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)	7						c.(2992-2994)CAG>TAG		zinc finger protein 521							64.0	62.0	63.0					18																	22804890		2203	4300	6503	SO:0001587	stop_gained	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22804890G>A	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2992C>T	18.37:g.22804890G>A	ENSP00000354794:p.Gln998*					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Nonsense_Mutation_p.Q998*|ZNF521_uc002kvl.2_Nonsense_Mutation_p.Q778*	p.Q998*	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	3239	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		998					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Nonsense_Mutation	SNP	ENST00000361524.3	37	c.2992C>T	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	43	10.079837	0.99332	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	.	.	.	5.97	5.97	0.96955	.	0.055459	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-34.4389	20.4238	0.99064	0.0:0.0:1.0:0.0	.	.	.	.	X	998;1032;998	.	ENSP00000354794:Q998X	Q	-	1	0	ZNF521	21058888	1.000000	0.71417	0.989000	0.46669	0.991000	0.79684	9.476000	0.97823	2.828000	0.97474	0.655000	0.94253	CAG		0.493	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		13	39	0	0	0	0.001855	0	13	39				
ZNF521	25925	broad.mit.edu	37	18	22806795	22806795	+	Missense_Mutation	SNP	G	G	C	rs555923496		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:22806795G>C	ENST00000361524.3	-	4	1235	c.1087C>G	c.(1087-1089)Ctc>Gtc	p.L363V	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.L143V|ZNF521_ENST00000538137.2_Missense_Mutation_p.L363V	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	363					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.L363F(1)|p.L363V(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TCCACTGAGAGGTTGGAATCT	0.582			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|lung(1)	7						c.(1087-1089)CTC>GTC		zinc finger protein 521							76.0	73.0	74.0					18																	22806795		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22806795G>C	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1087C>G	18.37:g.22806795G>C	ENSP00000354794:p.Leu363Val					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.L363V|ZNF521_uc002kvl.2_Missense_Mutation_p.L143V	p.L363V	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	1334	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		363					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.1087C>G	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	9.907	1.208360	0.22205	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.08546	3.08;3.1	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.07548	0.0190	N	0.08118	0	0.35911	D	0.831096	P	0.38992	0.653	B	0.42422	0.387	T	0.34279	-0.9835	10	0.62326	D	0.03	-27.1946	16.2608	0.82541	0.0:0.1316:0.8683:0.0	.	363	Q96K83	ZN521_HUMAN	V	363;397;363	ENSP00000354794:L363V;ENSP00000382352:L363V	ENSP00000354794:L363V	L	-	1	0	ZNF521	21060793	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.350000	0.73017	2.941000	0.99782	0.655000	0.94253	CTC		0.582	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		9	51	0	0	0	0.004482	0	9	51				
CDH2	1000	broad.mit.edu	37	18	25543368	25543368	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:25543368G>T	ENST00000269141.3	-	15	2890	c.2467C>A	c.(2467-2469)Cga>Aga	p.R823R	CDH2_ENST00000399380.3_Silent_p.R792R|AC015933.2_ENST00000423367.1_RNA	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	823					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.R823R(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCTGCAGATCGGACCGGATAC	0.522																																							uc002kwg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(1)	4						c.(2467-2469)CGA>AGA		cadherin 2, type 1 preproprotein							85.0	69.0	74.0					18																	25543368		2203	4300	6503	SO:0001819	synonymous_variant	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25543368G>T	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2467C>A	18.37:g.25543368G>T						CDH2_uc010xbn.1_Silent_p.R792R	p.R823R	NM_001792	NP_001783	P19022	CADH2_HUMAN			15	2926	-			823			Cytoplasmic (Potential).		A8MWK3|B0YIY6|Q14923|Q8N173	Silent	SNP	ENST00000269141.3	37	c.2467C>A	CCDS11891.1																																																																																				0.522	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		8	20	1	0	2.17888e-05	0.006214	2.68636e-05	8	20				
DSG4	147409	broad.mit.edu	37	18	28979267	28979267	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:28979267G>T	ENST00000308128.4	+	9	1173	c.1038G>T	c.(1036-1038)caG>caT	p.Q346H	RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.Q346H	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	346	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q346H(2)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTAACATTCAGCTTAGTATCG	0.373																																							uc002kwq.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(3)	8						c.(1036-1038)CAG>CAT		desmoglein 4 isoform 2 preproprotein							105.0	107.0	107.0					18																	28979267		2203	4300	6503	SO:0001583	missense	147409				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28979267G>T	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1038G>T	18.37:g.28979267G>T	ENSP00000311859:p.Gln346His					DSG4_uc002kwr.2_Missense_Mutation_p.Q346H	p.Q346H	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		9	1173	+			346			Cadherin 3.|Extracellular (Potential).		A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	c.1038G>T	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	G	2.972	-0.212283	0.06140	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.51325	0.71;0.71	5.11	-10.2	0.00374	Cadherin (5);Cadherin-like (1);	1.564370	0.04490	N	0.379330	T	0.39655	0.1086	M	0.82132	2.575	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.008	T	0.28681	-1.0036	10	0.33141	T	0.24	.	2.374	0.04337	0.2112:0.3661:0.2332:0.1895	.	346;346	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	H	346	ENSP00000311859:Q346H;ENSP00000352785:Q346H	ENSP00000311859:Q346H	Q	+	3	2	DSG4	27233265	0.000000	0.05858	0.107000	0.21349	0.272000	0.26649	-1.792000	0.01756	-1.793000	0.01258	-0.271000	0.10264	CAG		0.373	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986		26	90	1	0	3.7963e-18	0.00333	6.55603e-18	26	90				
CCDC178	374864	broad.mit.edu	37	18	30803130	30803130	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:30803130T>A	ENST00000383096.3	-	18	2054	c.1872A>T	c.(1870-1872)aaA>aaT	p.K624N	CCDC178_ENST00000300227.8_Intron|CCDC178_ENST00000406524.2_Missense_Mutation_p.K624N|CCDC178_ENST00000579947.1_Missense_Mutation_p.K624N|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Missense_Mutation_p.K624N|CCDC178_ENST00000583930.1_Missense_Mutation_p.K624N|CCDC178_ENST00000402325.1_Missense_Mutation_p.K624N			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	624								p.K624N(1)									TTTTCTTTACTTTTCCCACCT	0.299																																							uc002kxn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1870-1872)AAA>AAT		hypothetical protein LOC374864 isoform 1							118.0	109.0	112.0					18																	30803130		1796	4061	5857	SO:0001583	missense	374864							g.chr18:30803130T>A	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1872A>T	18.37:g.30803130T>A	ENSP00000372576:p.Lys624Asn					C18orf34_uc010dme.1_Missense_Mutation_p.K138N|C18orf34_uc010xbr.1_Missense_Mutation_p.K624N|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Intron|C18orf34_uc002kxp.2_Missense_Mutation_p.K624N	p.K624N	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN			17	2014	-			624					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.1872A>T	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	T	7.406	0.633847	0.14322	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000406524;ENST00000402325	T;T;T;T	0.18657	2.22;2.22;2.2;2.25	4.87	1.03	0.20045	.	.	.	.	.	T	0.18841	0.0452	L	0.29908	0.895	0.09310	N	1	P;P;P;P	0.52061	0.95;0.95;0.95;0.95	P;P;P;P	0.49887	0.625;0.625;0.625;0.625	T	0.14980	-1.0453	9	0.31617	T	0.26	-0.7537	7.1206	0.25442	0.0:0.2735:0.0:0.7265	.	624;624;624;624	F8W7A7;Q5BJE1-3;B5MD75;Q5BJE1	.;.;.;CR034_HUMAN	N	624	ENSP00000385591:K624N;ENSP00000372576:K624N;ENSP00000385867:K624N;ENSP00000385234:K624N	ENSP00000372576:K624N	K	-	3	2	C18orf34	29057128	0.052000	0.20516	0.077000	0.20336	0.003000	0.03518	0.517000	0.22832	0.086000	0.17137	0.528000	0.53228	AAA		0.299	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		8	44	0	0	0	0.008291	0	8	44				
CDH19	28513	broad.mit.edu	37	18	64172379	64172379	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr18:64172379G>A	ENST00000262150.2	-	12	2281	c.1989C>T	c.(1987-1989)acC>acT	p.T663T	CDH19_ENST00000540086.1_3'UTR	NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T663T(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CCCGCATTATGGTACTACTCC	0.463																																							uc002lkc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1987-1989)ACC>ACT		cadherin 19, type 2 preproprotein							194.0	185.0	188.0					18																	64172379		2203	4300	6503	SO:0001819	synonymous_variant	28513				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:64172379G>A	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.1989C>T	18.37:g.64172379G>A						CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_3'UTR	p.T663T	NM_021153	NP_066976	Q9H159	CAD19_HUMAN			12	2127	-		Esophageal squamous(42;0.0132)	663			Cytoplasmic (Potential).		O15098	Silent	SNP	ENST00000262150.2	37	c.1989C>T	CCDS11994.1																																																																																				0.463	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153		72	180	0	0	0	0.01441	0	72	180				
MUC16	94025	broad.mit.edu	37	19	9024488	9024488	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:9024488G>T	ENST00000397910.4	-	17	37248	c.37045C>A	c.(37045-37047)Cat>Aat	p.H12349N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12351					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.H12349N(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCTCTGATGGGTGAAACCT	0.537																																							uc002mkp.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(37045-37047)CAT>AAT		mucin 16							114.0	102.0	106.0					19																	9024488		1941	4149	6090	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9024488G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37045C>A	19.37:g.9024488G>T	ENSP00000381008:p.His12349Asn						p.H12349N	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			17	37249	-			12351			Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.37045C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	5.682	0.310349	0.10733	.	.	ENSG00000181143	ENST00000397910	T	0.24350	1.86	2.68	0.0388	0.14202	.	.	.	.	.	T	0.20007	0.0481	M	0.75777	2.31	.	.	.	P	0.44344	0.833	B	0.32022	0.139	T	0.32640	-0.9899	8	0.87932	D	0	.	2.6031	0.04871	0.1738:0.0:0.5428:0.2834	.	12349	B5ME49	.	N	12349	ENSP00000381008:H12349N	ENSP00000381008:H12349N	H	-	1	0	MUC16	8885488	0.014000	0.17966	0.080000	0.20451	0.041000	0.13682	0.026000	0.13599	0.385000	0.24970	0.436000	0.28706	CAT		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		11	17	1	0	4.36969e-10	0.001855	6.4486e-10	11	17				
MUC16	94025	broad.mit.edu	37	19	9059194	9059194	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:9059194C>A	ENST00000397910.4	-	3	28455	c.28252G>T	c.(28252-28254)Gat>Tat	p.D9418Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9420	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.D5051Y(1)|p.D9418Y(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CATGACACATCCTCAGGACCT	0.512																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(28252-28254)GAT>TAT		mucin 16							123.0	120.0	121.0					19																	9059194		2017	4195	6212	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9059194C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28252G>T	19.37:g.9059194C>A	ENSP00000381008:p.Asp9418Tyr						p.D9418Y	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	28456	-			9420			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.28252G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	2.610	-0.291071	0.05568	.	.	ENSG00000181143	ENST00000397910	T	0.24908	1.83	2.14	-4.29	0.03721	.	.	.	.	.	T	0.19644	0.0472	N	0.24115	0.695	.	.	.	D	0.53462	0.96	P	0.50754	0.649	T	0.21759	-1.0236	8	0.87932	D	0	.	5.4057	0.16320	0.0:0.2057:0.5173:0.277	.	9418	B5ME49	.	Y	9418	ENSP00000381008:D9418Y	ENSP00000381008:D9418Y	D	-	1	0	MUC16	8920194	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.219000	0.09228	-1.296000	0.02353	0.306000	0.20318	GAT		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		36	52	1	0	1.414e-09	0.003755	2.02535e-09	36	52				
KEAP1	9817	broad.mit.edu	37	19	10610099	10610099	+	Missense_Mutation	SNP	C	C	G	rs370296794		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:10610099C>G	ENST00000171111.5	-	2	1158	c.611G>C	c.(610-612)cGg>cCg	p.R204P	KEAP1_ENST00000393623.2_Missense_Mutation_p.R204P|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	204	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.R204P(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GATGTACTCCCGGGCACGCTG	0.597																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(610-612)CGG>CCG		kelch-like ECH-associated protein 1							45.0	36.0	39.0					19																	10610099		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610099C>G	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.611G>C	19.37:g.10610099C>G	ENSP00000171111:p.Arg204Pro					KEAP1_uc002mor.1_Missense_Mutation_p.R204P	p.R204P	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	767	-			204			BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.611G>C	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.498273	0.64186	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.69806	-0.43;-0.43	4.81	4.81	0.61882	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.83069	0.5174	M	0.86343	2.81	0.58432	D	0.999998	D	0.76494	0.999	D	0.70227	0.968	D	0.85914	0.1442	10	0.56958	D	0.05	.	15.3825	0.74669	0.0:1.0:0.0:0.0	.	204	Q14145	KEAP1_HUMAN	P	204	ENSP00000171111:R204P;ENSP00000377245:R204P	ENSP00000171111:R204P	R	-	2	0	KEAP1	10471099	1.000000	0.71417	0.992000	0.48379	0.568000	0.35870	4.763000	0.62257	2.232000	0.73038	0.561000	0.74099	CGG		0.597	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		5	3	0	0	0	0.000602	0	5	3				
ZNF44	51710	broad.mit.edu	37	19	12384274	12384274	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:12384274T>A	ENST00000356109.5	-	5	1058	c.940A>T	c.(940-942)Agt>Tgt	p.S314C	ZNF44_ENST00000355684.5_Missense_Mutation_p.S266C	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S266C(1)		ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		AGATATGAACTGTAATCAGGG	0.413																																							uc010xmj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(940-942)AGT>TGT		zinc finger protein 44 isoform 1							102.0	108.0	106.0					19																	12384274		2203	4298	6501	SO:0001583	missense	51710				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding	g.chr19:12384274T>A	X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.940A>T	19.37:g.12384274T>A	ENSP00000348419:p.Ser314Cys					ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_RNA|ZNF44_uc002mtn.3_RNA|ZNF44_uc010dys.2_Missense_Mutation_p.S266C	p.S314C	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)	5	1145	-		Renal(1328;0.157)	314			C2H2-type 5.		B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	ENST00000356109.5	37	c.940A>T	CCDS54223.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.530759	0.45073	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.08008	3.14;3.14;3.14	0.997	-0.223	0.13118	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29783	0.0744	M	0.91510	3.215	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.91635	0.969;0.999	T	0.30995	-0.9959	8	0.87932	D	0	.	5.9	0.18962	0.0:0.0:0.2697:0.7303	.	314;266	P15621;F8W7T7	ZNF44_HUMAN;.	C	314;314;266;266	ENSP00000377008:S314C;ENSP00000348419:S314C;ENSP00000347910:S266C	ENSP00000347910:S266C	S	-	1	0	ZNF44	12245274	0.000000	0.05858	0.000000	0.03702	0.630000	0.37929	-0.067000	0.11579	-0.114000	0.11936	0.254000	0.18369	AGT		0.413	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344132.1	NM_016264		26	54	0	0	0	0.003954	0	26	54				
OR1I1	126370	broad.mit.edu	37	19	15198003	15198003	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:15198003G>T	ENST00000209540.2	+	1	213	c.127G>T	c.(127-129)Gcc>Tcc	p.A43S		NM_001004713.1	NP_001004713.1	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I, member 1	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A43S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(3)|ovary(2)|stomach(2)	20						CATTGGAAATGCCCTCATTAT	0.493																																							uc010xoe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(127-129)GCC>TCC		olfactory receptor, family 1, subfamily I,							302.0	237.0	259.0					19																	15198003		2203	4300	6503	SO:0001583	missense	126370				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15198003G>T	AC004794	CCDS32937.1	19p13.1	2012-08-09				ENSG00000094661		"""GPCR / Class A : Olfactory receptors"""	8207	protein-coding gene	gene with protein product							Standard	NM_001004713		Approved	OR1I1P, OR19-20, OR1I1Q	uc010xoe.2	O60431		ENST00000209540.2:c.127G>T	19.37:g.15198003G>T	ENSP00000209540:p.Ala43Ser						p.A43S	NM_001004713	NP_001004713	O60431	OR1I1_HUMAN			1	127	+			43			Helical; Name=1; (Potential).		Q96R92	Missense_Mutation	SNP	ENST00000209540.2	37	c.127G>T	CCDS32937.1	.	.	.	.	.	.	.	.	.	.	g	7.272	0.607288	0.14002	.	.	ENSG00000094661	ENST00000209540	T	0.00922	5.54	4.84	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	0.401569	0.14376	U	0.323469	T	0.00580	0.0019	N	0.02751	-0.505	0.20638	N	0.999878	B	0.24317	0.101	B	0.29440	0.102	T	0.49153	-0.8969	10	0.87932	D	0	.	3.5931	0.07995	0.1647:0.5657:0.1752:0.0944	.	43	O60431	OR1I1_HUMAN	S	43	ENSP00000209540:A43S	ENSP00000209540:A43S	A	+	1	0	OR1I1	15059003	0.000000	0.05858	0.995000	0.50966	0.014000	0.08584	-1.309000	0.02728	1.264000	0.44198	-0.311000	0.09066	GCC		0.493	OR1I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465665.1			3	26	1	0	0.004672	0.004672	0.00507871	3	26				
SLC5A5	6528	broad.mit.edu	37	19	17988585	17988585	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:17988585G>T	ENST00000222248.3	+	6	1099	c.752G>T	c.(751-753)gGc>gTc	p.G251V		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	251					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)	p.G251V(1)		NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GTGGTGGGTGGCACGTTGGTG	0.592																																					Melanoma(65;1008 1708 7910 46650)	Melanoma(65;1008 1708 7910 46650)	uc002nhr.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(751-753)GGC>GTC		solute carrier family 5 (sodium iodide							176.0	140.0	152.0					19																	17988585		2203	4300	6503	SO:0001583	missense	6528				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity	g.chr19:17988585G>T		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.752G>T	19.37:g.17988585G>T	ENSP00000222248:p.Gly251Val						p.G251V	NM_000453	NP_000444	Q92911	SC5A5_HUMAN			6	1099	+			251			Helical; (Potential).		O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	c.752G>T	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148378	0.57151	.	.	ENSG00000105641	ENST00000222248	D	0.87256	-2.23	5.3	5.3	0.74995	.	0.054398	0.85682	D	0.000000	D	0.94591	0.8257	M	0.93939	3.475	0.80722	D	1	D	0.56287	0.975	P	0.61070	0.883	D	0.95573	0.8640	10	0.72032	D	0.01	.	16.867	0.86032	0.0:0.0:1.0:0.0	.	251	Q92911	SC5A5_HUMAN	V	251	ENSP00000222248:G251V	ENSP00000222248:G251V	G	+	2	0	SLC5A5	17849585	1.000000	0.71417	0.991000	0.47740	0.185000	0.23345	7.630000	0.83225	2.675000	0.91044	0.555000	0.69702	GGC		0.592	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1			28	47	1	0	1.16021e-09	0.007291	1.67662e-09	28	47				
ZNF676	163223	broad.mit.edu	37	19	22362965	22362965	+	Silent	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:22362965C>T	ENST00000397121.2	-	3	1871	c.1554G>A	c.(1552-1554)tcG>tcA	p.S518S		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S518S(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CAGTAAGGATCGAGGACCAGC	0.403																																							uc002nqs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1552-1554)TCG>TCA		zinc finger protein 676							62.0	65.0	64.0					19																	22362965		2150	4273	6423	SO:0001819	synonymous_variant	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22362965C>T	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1554G>A	19.37:g.22362965C>T							p.S518S	NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN			3	1872	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	518			C2H2-type 13.		A8MVX5	Silent	SNP	ENST00000397121.2	37	c.1554G>A	CCDS42539.1																																																																																				0.403	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		17	51	0	0	0	0.00499	0	17	51				
ZNF91	7644	broad.mit.edu	37	19	23545221	23545221	+	Missense_Mutation	SNP	C	C	G	rs539170632	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:23545221C>G	ENST00000300619.7	-	4	765	c.560G>C	c.(559-561)tGt>tCt	p.C187S	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.C155S	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	187					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C187S(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGACTTGACACATTTTTTACA	0.289																																							uc002nre.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(559-561)TGT>TCT		zinc finger protein 91							77.0	77.0	77.0					19																	23545221		2037	4234	6271	SO:0001583	missense	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23545221C>G	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.560G>C	19.37:g.23545221C>G	ENSP00000300619:p.Cys187Ser					ZNF91_uc010xrj.1_Missense_Mutation_p.C155S	p.C187S	NM_003430	NP_003421	Q05481	ZNF91_HUMAN			4	673	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	187			C2H2-type 2.		A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	c.560G>C	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.119243	0.37436	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.39787	1.06;1.06	0.792	0.792	0.18625	Zinc finger, C2H2 (1);	.	.	.	.	T	0.69133	0.3077	H	0.97158	3.95	0.25029	N	0.991289	D;P	0.54772	0.968;0.462	P;B	0.61874	0.895;0.152	T	0.58538	-0.7619	9	0.72032	D	0.01	.	6.9353	0.24463	0.0:0.9999:0.0:1.0E-4	.	155;187	Q05481-2;Q05481	.;ZNF91_HUMAN	S	187;155	ENSP00000300619:C187S;ENSP00000380272:C155S	ENSP00000300619:C187S	C	-	2	0	ZNF91	23337061	0.057000	0.20700	0.105000	0.21289	0.046000	0.14306	1.714000	0.37961	0.159000	0.19401	0.162000	0.16502	TGT		0.289	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		12	43	0	0	0	0.013537	0	12	43				
ZNF536	9745	broad.mit.edu	37	19	31040344	31040344	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:31040344C>T	ENST00000355537.3	+	4	3965	c.3818C>T	c.(3817-3819)tCt>tTt	p.S1273F		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1273					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.S1273F(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCCTACAGTTCTGATGGCTTA	0.557																																							uc002nsu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(3817-3819)TCT>TTT		zinc finger protein 536							40.0	39.0	39.0					19																	31040344		2193	4280	6473	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31040344C>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3818C>T	19.37:g.31040344C>T	ENSP00000347730:p.Ser1273Phe					ZNF536_uc010edd.1_Missense_Mutation_p.S1273F	p.S1273F	NM_014717	NP_055532	O15090	ZN536_HUMAN			4	3956	+	Esophageal squamous(110;0.0834)		1273					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.3818C>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.201876	0.38905	.	.	ENSG00000198597	ENST00000355537	T	0.10192	2.9	5.01	3.94	0.45596	.	0.309941	0.34879	N	0.003610	T	0.09512	0.0234	L	0.29908	0.895	0.34513	D	0.70736	P;P	0.37955	0.612;0.612	B;B	0.33890	0.172;0.172	T	0.14420	-1.0473	10	0.87932	D	0	-1.6265	15.5019	0.75705	0.0:0.8502:0.1498:0.0	.	1273;1273	A7E228;O15090	.;ZN536_HUMAN	F	1273	ENSP00000347730:S1273F	ENSP00000347730:S1273F	S	+	2	0	ZNF536	35732184	0.992000	0.36948	0.093000	0.20910	0.869000	0.49853	3.725000	0.54970	1.027000	0.39758	0.650000	0.86243	TCT		0.557	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		4	53	0	0	0	0.001984	0	4	53				
SLC7A9	11136	broad.mit.edu	37	19	33350773	33350773	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:33350773G>A	ENST00000023064.4	-	8	1038	c.847C>T	c.(847-849)Ctc>Ttc	p.L283F	SLC7A9_ENST00000590341.1_Missense_Mutation_p.L283F|SLC7A9_ENST00000587772.1_Missense_Mutation_p.L283F|RN7SKP22_ENST00000365097.1_RNA	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	283					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.L283F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GACTGCAGGAGTTCGGTGGCA	0.617																																					GBM(181;1335 2108 9644 44178 46689)	GBM(181;1335 2108 9644 44178 46689)	uc002ntv.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1	GRCh37	CM050101	SLC7A9	M		c.(847-849)CTC>TTC		solute carrier family 7, member 9	L-Cystine(DB00138)						76.0	67.0	70.0					19																	33350773		2203	4300	6503	SO:0001583	missense	11136				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding	g.chr19:33350773G>A	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.847C>T	19.37:g.33350773G>A	ENSP00000023064:p.Leu283Phe					SLC7A9_uc002ntt.3_RNA|SLC7A9_uc002ntu.3_Missense_Mutation_p.L283F|SLC7A9_uc002ntw.3_Missense_Mutation_p.L74F	p.L283F	NM_001126335	NP_001119807	P82251	BAT1_HUMAN			8	964	-	Esophageal squamous(110;0.137)		283			Extracellular (Potential).		B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	c.847C>T	CCDS12425.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449551	0.84101	.	.	ENSG00000021488	ENST00000023064	D	0.90385	-2.66	5.64	5.64	0.86602	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.94145	0.8122	M	0.72576	2.205	0.80722	D	1	D;D	0.56287	0.975;0.975	P;P	0.56823	0.807;0.807	D	0.94277	0.7516	10	0.72032	D	0.01	.	19.7115	0.96098	0.0:0.0:1.0:0.0	.	283;283	Q53FY4;P82251	.;BAT1_HUMAN	F	283	ENSP00000023064:L283F	ENSP00000023064:L283F	L	-	1	0	SLC7A9	38042613	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	5.468000	0.66743	2.675000	0.91044	0.462000	0.41574	CTC		0.617	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1			4	44	0	0	0	0.009096	0	4	44				
MAG	4099	broad.mit.edu	37	19	35791291	35791291	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:35791291G>T	ENST00000392213.3	+	6	1113	c.954G>T	c.(952-954)gtG>gtT	p.V318V	MAG_ENST00000361922.4_Silent_p.V318V|MAG_ENST00000537831.2_Silent_p.V293V	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	318	Ig-like C2-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)	p.V318V(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ACCGCACCGTGGGGCTCAGTG	0.652																																							uc002nyy.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7						c.(952-954)GTG>GTT		myelin associated glycoprotein isoform a							27.0	27.0	27.0					19																	35791291		2203	4299	6502	SO:0001819	synonymous_variant	4099				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding	g.chr19:35791291G>T	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.954G>T	19.37:g.35791291G>T						MAG_uc002nyx.1_Silent_p.V318V|MAG_uc010eds.1_Silent_p.V293V|MAG_uc002nyz.1_Silent_p.V318V	p.V318V	NM_002361	NP_002352	P20916	MAG_HUMAN	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		6	1103	+	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	318			Ig-like C2-type 2.|Extracellular (Potential).		B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	c.954G>T	CCDS12455.1																																																																																				0.652	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600		8	18	1	0	5.18039e-06	0.00308	6.56992e-06	8	18				
NFKBID	84807	broad.mit.edu	37	19	36380868	36380868	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:36380868C>A	ENST00000396901.1	-	11	1385	c.812G>T	c.(811-813)gGg>gTg	p.G271V	NFKBID_ENST00000606253.1_Missense_Mutation_p.G271V|NFKBID_ENST00000352614.2_Missense_Mutation_p.G423V|NFKBID_ENST00000340950.2_Missense_Mutation_p.G108V	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	271					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)		p.G271V(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						GGGGTCCGCCCCAGCTGCCAA	0.692																																							uc002oci.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(811-813)GGG>GTG		nuclear factor of kappa light polypeptide gene							22.0	26.0	25.0					19																	36380868		1927	4103	6030	SO:0001583	missense	84807				inflammatory response	nucleus		g.chr19:36380868C>A	AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.812G>T	19.37:g.36380868C>A	ENSP00000380109:p.Gly271Val					NFKBID_uc002och.1_Missense_Mutation_p.G108V|NFKBID_uc002ocj.1_Missense_Mutation_p.G286V	p.G271V	NM_139239	NP_640332	Q8NI38	IKBD_HUMAN			11	1386	-			271			ANK 6.		Q8NI39|Q9BRG9	Missense_Mutation	SNP	ENST00000396901.1	37	c.812G>T	CCDS42552.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535378	0.64972	.	.	ENSG00000167604	ENST00000352614;ENST00000396901;ENST00000340950	T;T;T	0.73258	-0.73;-0.73;-0.21	3.81	3.81	0.43845	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.86230	0.5883	M	0.91972	3.26	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.99;0.993	D	0.89389	0.3687	10	0.87932	D	0	.	13.5639	0.61806	0.0:1.0:0.0:0.0	.	423;271;108	Q8NI38-2;Q8NI38;Q8NI38-3	.;IKBD_HUMAN;.	V	423;271;108	ENSP00000252985:G423V;ENSP00000380109:G271V;ENSP00000343093:G108V	ENSP00000343093:G108V	G	-	2	0	NFKBID	41072708	1.000000	0.71417	0.962000	0.40283	0.581000	0.36288	6.551000	0.73909	2.117000	0.64856	0.305000	0.20034	GGG		0.692	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721		11	38	1	0	0.00010058	0.013537	0.000118315	11	38				
ZFP30	22835	broad.mit.edu	37	19	38126043	38126043	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:38126043C>A	ENST00000351218.2	-	6	1956	c.1399G>T	c.(1399-1401)Gac>Tac	p.D467Y	ZFP30_ENST00000392144.1_Missense_Mutation_p.D467Y|ZFP30_ENST00000589018.1_Intron|ZFP30_ENST00000514101.2_Missense_Mutation_p.D467Y	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D467Y(1)		autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCCTTACAGTCATAGGGCTTT	0.373																																							uc002ogv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1399-1401)GAC>TAC		zinc finger protein 30 homolog							86.0	80.0	82.0					19																	38126043		2203	4300	6503	SO:0001583	missense	22835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38126043C>A	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1399G>T	19.37:g.38126043C>A	ENSP00000343581:p.Asp467Tyr					ZFP30_uc002ogw.1_Missense_Mutation_p.D467Y|ZFP30_uc002ogx.1_Missense_Mutation_p.D467Y|ZFP30_uc010xtt.1_Missense_Mutation_p.D466Y	p.D467Y	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1915	-			467			C2H2-type 12.		Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	37	c.1399G>T	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.573955	0.45902	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.35605	1.3;1.3;1.3	3.89	2.79	0.32731	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39436	0.1078	N	0.17723	0.515	0.33323	D	0.567565	D;D	0.62365	0.991;0.991	D;D	0.63957	0.92;0.92	T	0.52852	-0.8520	9	0.87932	D	0	.	9.5221	0.39143	0.5212:0.4788:0.0:0.0	.	467;467	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	Y	467;467;467;382	ENSP00000343581:D467Y;ENSP00000422930:D467Y;ENSP00000375988:D467Y	ENSP00000343581:D467Y	D	-	1	0	ZFP30	42817883	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-1.956000	0.01522	0.906000	0.36621	0.585000	0.79938	GAC		0.373	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898		15	74	1	0	4.7546e-09	0.004007	6.67289e-09	15	74				
CATSPERG	57828	broad.mit.edu	37	19	38858712	38858712	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:38858712G>T	ENST00000409235.3	+	26	3070	c.2955G>T	c.(2953-2955)acG>acT	p.T985T	CATSPERG_ENST00000410018.1_Silent_p.T945T|CATSPERG_ENST00000215069.4_3'UTR	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	985					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)		p.T625T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						TCTGGACCACGAGGACCACAA	0.612																																							uc002oih.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(2953-2955)ACG>ACT		cation channel, sperm-associated, gamma							288.0	226.0	247.0					19																	38858712		2203	4300	6503	SO:0001819	synonymous_variant	57828				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr19:38858712G>T	AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.2955G>T	19.37:g.38858712G>T						CATSPERG_uc002oig.3_Silent_p.T945T|CATSPERG_uc002oif.3_Silent_p.T625T|CATSPERG_uc010efw.2_RNA	p.T985T	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN			26	3042	+			985			Extracellular (Potential).		A6NEG6|Q659E1	Silent	SNP	ENST00000409235.3	37	c.2955G>T	CCDS12514.2																																																																																				0.612	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	NM_021185		27	51	1	0	3.80469e-20	0.009535	6.78713e-20	27	51				
ITPKC	80271	broad.mit.edu	37	19	41235228	41235228	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:41235228G>T	ENST00000263370.2	+	3	1410	c.1377G>T	c.(1375-1377)atG>atT	p.M459I		NM_025194.2	NP_079470.1	Q96DU7	IP3KC_HUMAN	inositol-trisphosphate 3-kinase C	459					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.M459I(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	14			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ACTATGGCATGGTGCTGCAGG	0.572																																							uc002oot.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1375-1377)ATG>ATT		inositol 1,4,5-trisphosphate 3-kinase C							65.0	58.0	60.0					19																	41235228		2203	4300	6503	SO:0001583	missense	80271					cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity	g.chr19:41235228G>T	Y11999	CCDS12563.1	19q13.1	2011-04-28	2011-04-28		ENSG00000086544	ENSG00000086544	2.7.1.127		14897	protein-coding gene	gene with protein product		606476	"""inositol 1,4,5-trisphosphate 3-kinase C"""			11085927	Standard	NM_025194		Approved	IP3KC, IP3-3KC	uc002oot.3	Q96DU7		ENST00000263370.2:c.1377G>T	19.37:g.41235228G>T	ENSP00000263370:p.Met459Ile						p.M459I	NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		3	1410	+			459					Q9UE25|Q9Y475	Missense_Mutation	SNP	ENST00000263370.2	37	c.1377G>T	CCDS12563.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367658	0.24771	.	.	ENSG00000086544	ENST00000263370	T	0.12465	2.68	5.49	0.777	0.18538	.	1.064250	0.07120	N	0.843694	T	0.07638	0.0192	N	0.11427	0.14	0.35575	D	0.805774	B	0.02656	0.0	B	0.01281	0.0	T	0.22800	-1.0206	10	0.36615	T	0.2	-0.4386	7.1987	0.25868	0.2133:0.0:0.6572:0.1295	.	459	Q96DU7	IP3KC_HUMAN	I	459	ENSP00000263370:M459I	ENSP00000263370:M459I	M	+	3	0	ITPKC	45927068	0.036000	0.19791	0.512000	0.27736	0.968000	0.65278	-0.332000	0.07904	0.337000	0.23665	0.561000	0.74099	ATG		0.572	ITPKC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463104.1	NM_025194		10	22	1	0	0.00621372	0.006214	0.00669487	10	22				
GRIK5	2901	broad.mit.edu	37	19	42563598	42563598	+	Missense_Mutation	SNP	C	C	T	rs368271918		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:42563598C>T	ENST00000262895.3	-	5	589	c.590G>A	c.(589-591)cGg>cAg	p.R197Q	GRIK5_ENST00000593562.1_Missense_Mutation_p.R197Q|GRIK5_ENST00000301218.4_Missense_Mutation_p.R197Q	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	197					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R197Q(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				TGTGGGGTCCCGGCTGTCGTC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		19135	0.0		0.0	False		,,,				2504	0.001						uc002osj.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(589-591)CGG>CAG		glutamate receptor KA2 precursor	L-Glutamic Acid(DB00142)	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	151.0	118.0	129.0		590	3.6	1.0	19		129	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRIK5	NM_002088.3	43	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	197/981	42563598	2,13004	2203	4300	6503	SO:0001583	missense	2901					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr19:42563598C>T		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.590G>A	19.37:g.42563598C>T	ENSP00000262895:p.Arg197Gln					GRIK5_uc010eib.1_Missense_Mutation_p.R116Q	p.R197Q	NM_002088	NP_002079	Q16478	GRIK5_HUMAN			5	625	-		Prostate(69;0.059)	197			Extracellular (Potential).		Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	37	c.590G>A	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348460	0.41599	2.27E-4	1.16E-4	ENSG00000105737	ENST00000262895;ENST00000301218	D;D	0.82619	-1.63;-1.63	4.64	3.61	0.41365	Extracellular ligand-binding receptor (1);	0.635417	0.15154	N	0.277543	T	0.66790	0.2825	N	0.16478	0.41	0.29676	N	0.842107	B	0.17852	0.024	B	0.14023	0.01	T	0.56288	-0.8004	10	0.19147	T	0.46	.	6.8331	0.23921	0.0:0.72:0.0:0.28	.	197	Q16478	GRIK5_HUMAN	Q	197	ENSP00000262895:R197Q;ENSP00000301218:R197Q	ENSP00000262895:R197Q	R	-	2	0	GRIK5	47255438	0.996000	0.38824	1.000000	0.80357	0.949000	0.60115	0.410000	0.21098	1.083000	0.41159	0.561000	0.74099	CGG		0.607	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1			26	57	0	0	0	0.008361	0	26	57				
ZNF526	116115	broad.mit.edu	37	19	42728897	42728897	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:42728897C>G	ENST00000301215.3	+	3	567	c.342C>G	c.(340-342)agC>agG	p.S114R		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S114R(1)		autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				GTGAATGCAGCCAGCTCATCC	0.627																																							uc002osz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(340-342)AGC>AGG		zinc finger protein 526							63.0	65.0	64.0					19																	42728897		2203	4300	6503	SO:0001583	missense	116115				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:42728897C>G	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.342C>G	19.37:g.42728897C>G	ENSP00000301215:p.Ser114Arg						p.S114R	NM_133444	NP_597701	Q8TF50	ZN526_HUMAN			3	498	+		Prostate(69;0.0704)	114			C2H2-type 2.		B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	ENST00000301215.3	37	c.342C>G	CCDS12598.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093004	0.36952	.	.	ENSG00000167625	ENST00000301215	T	0.29142	1.58	4.59	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.212700	0.39615	N	0.001318	T	0.17916	0.0430	N	0.24115	0.695	0.28402	N	0.918593	B	0.20671	0.047	B	0.24701	0.055	T	0.18178	-1.0345	9	.	.	.	-8.5131	7.577	0.27942	0.0:0.5982:0.3091:0.0927	.	114	Q8TF50	ZN526_HUMAN	R	114	ENSP00000301215:S114R	.	S	+	3	2	ZNF526	47420737	0.000000	0.05858	1.000000	0.80357	0.963000	0.63663	0.069000	0.14552	0.599000	0.29845	0.462000	0.41574	AGC		0.627	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463681.2	XM_057401		8	49	0	0	0	0.00308	0	8	49				
SMG9	56006	broad.mit.edu	37	19	44251914	44251914	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:44251914C>A	ENST00000270066.6	-	4	703	c.361G>T	c.(361-363)Ggc>Tgc	p.G121C	SMG9_ENST00000601170.1_Missense_Mutation_p.G121C	NM_019108.2	NP_061981.2	Q9H0W8	SMG9_HUMAN	SMG9 nonsense mediated mRNA decay factor	121	Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|intracellular (GO:0005622)	identical protein binding (GO:0042802)	p.G121C(1)		kidney(1)|large_intestine(5)|liver(1)|lung(7)|pancreas(1)|prostate(2)|urinary_tract(2)	19						GGGGCGGTGCCCTCAGGGGTA	0.682																																							uc002oxj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(361-363)GGC>TGC		SMG9 protein							20.0	24.0	23.0					19																	44251914		2200	4298	6498	SO:0001583	missense	56006				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	intracellular	protein binding	g.chr19:44251914C>A	BC008869	CCDS33043.2	19q13.31	2013-07-02	2013-07-02	2011-06-21	ENSG00000105771	ENSG00000105771			25763	protein-coding gene	gene with protein product		613176	"""chromosome 19 open reading frame 61"", ""smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C19orf61		11230166, 19417104	Standard	NM_019108		Approved	FLJ12886	uc002oxj.2	Q9H0W8	OTTHUMG00000150337	ENST00000270066.6:c.361G>T	19.37:g.44251914C>A	ENSP00000270066:p.Gly121Cys					C19orf61_uc002oxk.2_Missense_Mutation_p.G121C|C19orf61_uc010eiy.1_Missense_Mutation_p.G121C	p.G121C	NM_019108	NP_061981	Q9H0W8	SMG9_HUMAN			4	704	-		Prostate(69;0.0352)	121			Pro-rich.		O60429|Q9H9A9	Missense_Mutation	SNP	ENST00000270066.6	37	c.361G>T	CCDS33043.2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936610	0.73442	.	.	ENSG00000105771	ENST00000270066	.	.	.	5.3	4.27	0.50696	.	0.000000	0.64402	D	0.000012	T	0.52354	0.1729	N	0.19112	0.55	0.44798	D	0.997802	D;D	0.65815	0.995;0.983	P;P	0.60415	0.874;0.536	T	0.56263	-0.8008	9	0.62326	D	0.03	0.9753	11.2945	0.49269	0.0:0.9117:0.0:0.0883	.	121;121	Q9H0W8-2;Q9H0W8	.;SMG9_HUMAN	C	121	.	ENSP00000270066:G121C	G	-	1	0	SMG9	48943754	1.000000	0.71417	0.969000	0.41365	0.978000	0.69477	3.102000	0.50291	1.251000	0.43983	0.655000	0.94253	GGC		0.682	SMG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317668.1	NM_019108		9	28	1	0	0.000274275	0.004482	0.000313549	9	28				
HIF3A	64344	broad.mit.edu	37	19	46825041	46825041	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:46825041G>T	ENST00000377670.4	+	10	1184	c.1153G>T	c.(1153-1155)Ggc>Tgc	p.G385C	HIF3A_ENST00000420102.2_Missense_Mutation_p.G334C|HIF3A_ENST00000600383.1_Missense_Mutation_p.G316C|HIF3A_ENST00000244303.6_Missense_Mutation_p.G316C|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000339613.2_Missense_Mutation_p.G329C|HIF3A_ENST00000300862.3_Missense_Mutation_p.G383C|HIF3A_ENST00000472815.1_Missense_Mutation_p.G316C	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	385					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G383C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		AGACACCCCTGGCCCCCGGAT	0.672																																							uc002peh.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1153-1155)GGC>TGC		hypoxia inducible factor 3, alpha subunit							54.0	67.0	63.0					19																	46825041		2203	4300	6503	SO:0001583	missense	64344				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity	g.chr19:46825041G>T	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1153G>T	19.37:g.46825041G>T	ENSP00000366898:p.Gly385Cys					HIF3A_uc002peg.3_Missense_Mutation_p.G385C|HIF3A_uc010xxx.1_RNA|HIF3A_uc002pei.3_Missense_Mutation_p.G329C|HIF3A_uc002pej.1_Missense_Mutation_p.G316C|HIF3A_uc002pek.2_Missense_Mutation_p.G329C|HIF3A_uc010xxy.1_Missense_Mutation_p.G316C|HIF3A_uc002pel.2_Missense_Mutation_p.G383C|HIF3A_uc010xxz.1_Missense_Mutation_p.G334C	p.G385C	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)	10	1182	+		Ovarian(192;0.00965)|all_neural(266;0.0887)	385					B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	c.1153G>T	CCDS12681.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.74|11.74	1.727998|1.727998	0.30593|0.30593	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102|ENST00000472815	T;T;T;T;T|.	0.66099|.	0.52;-0.18;0.41;0.54;-0.19|.	4.43|4.43	3.4|3.4	0.38934|0.38934	.|.	1.568250|.	0.03586|.	N|.	0.231071|.	T|T	0.26011|0.26011	0.0634|0.0634	N|N	0.24115|0.24115	0.695|0.695	0.24176|0.24176	N|N	0.995607|0.995607	D;D;P;D;P;P;D|.	0.67145|.	0.969;0.987;0.954;0.996;0.923;0.923;0.991|.	P;P;P;P;B;B;P|.	0.57425|.	0.719;0.674;0.639;0.819;0.338;0.436;0.82|.	T|T	0.17501|0.17501	-1.0367|-1.0367	10|5	0.66056|.	D|.	0.02|.	.|.	8.1393|8.1393	0.31073|0.31073	0.1094:0.0:0.8906:0.0|0.1094:0.0:0.8906:0.0	.|.	334;316;383;334;329;385;385|.	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185|.	.;.;.;.;.;HIF3A_HUMAN;.|.	C|L	385;385;316;329;329;383;334|357	ENSP00000366898:G385C;ENSP00000244303:G316C;ENSP00000341877:G329C;ENSP00000300862:G383C;ENSP00000407771:G334C|.	ENSP00000244302:G385C|.	G|W	+|+	1|2	0|0	HIF3A|HIF3A	51516881|51516881	0.105000|0.105000	0.21958|0.21958	0.862000|0.862000	0.33874|0.33874	0.163000|0.163000	0.22366|0.22366	1.517000|1.517000	0.35867|0.35867	1.239000|1.239000	0.43787|0.43787	0.655000|0.655000	0.94253|0.94253	GGC|TGG		0.672	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3			25	68	1	0	2.41591e-17	0.004656	4.11381e-17	25	68				
PTGIR	5739	broad.mit.edu	37	19	47127082	47127082	+	Missense_Mutation	SNP	C	C	A	rs201614820	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:47127082C>A	ENST00000291294.2	-	2	534	c.401G>T	c.(400-402)cGc>cTc	p.R134L	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Missense_Mutation_p.R134L	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	134					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.R134L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	GCGGGCGCAGCGGGGCCCGTC	0.701																																							uc002pex.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(400-402)CGC>CTC		prostaglandin I2 (prostacyclin) receptor (IP)	Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Epoprostenol(DB01240)|Iloprost(DB01088)|Misoprostol(DB00929)						9.0	10.0	9.0					19																	47127082		2042	4034	6076	SO:0001583	missense	5739				cell-cell signaling|G-protein signaling, coupled to cyclic nucleotide second messenger|platelet activation	integral to plasma membrane	G-protein coupled receptor activity|guanyl-nucleotide exchange factor activity	g.chr19:47127082C>A		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.401G>T	19.37:g.47127082C>A	ENSP00000291294:p.Arg134Leu						p.R134L	NM_000960	NP_000951	P43119	PI2R_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	2	514	-		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)	134			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000291294.2	37	c.401G>T	CCDS12686.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115202	0.77210	.	.	ENSG00000160013	ENST00000291294	T	0.41758	0.99	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.116424	0.56097	D	0.000021	T	0.65322	0.2680	M	0.79258	2.445	0.37045	D	0.897314	D	0.76494	0.999	D	0.76575	0.988	T	0.73874	-0.3845	10	0.72032	D	0.01	-13.8031	15.5026	0.75713	0.0:1.0:0.0:0.0	.	134	P43119	PI2R_HUMAN	L	134	ENSP00000291294:R134L	ENSP00000291294:R134L	R	-	2	0	PTGIR	51818922	0.937000	0.31787	0.991000	0.47740	0.875000	0.50365	0.265000	0.18515	2.511000	0.84671	0.563000	0.77884	CGC		0.701	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1			7	5	1	0	0.00621372	0.006214	0.00669487	7	5				
PLA2G4C	8605	broad.mit.edu	37	19	48608688	48608688	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:48608688T>A	ENST00000599921.1	-	3	379	c.22A>T	c.(22-24)Ata>Tta	p.I8L	PLA2G4C_ENST00000413144.2_Missense_Mutation_p.I8L|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.I8L|PLA2G4C_ENST00000599111.1_Intron			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	8	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)	p.I8L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		CCAGGAATTATGGAAACTTCA	0.458																																							uc002phx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(22-24)ATA>TTA		phospholipase A2, group IVC isoform 1 precursor							68.0	80.0	76.0					19																	48608688		2203	4300	6503	SO:0001583	missense	8605				arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding	g.chr19:48608688T>A	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.22A>T	19.37:g.48608688T>A	ENSP00000469473:p.Ile8Leu					PLA2G4C_uc002phw.2_5'UTR|PLA2G4C_uc010elr.2_Missense_Mutation_p.I8L|PLA2G4C_uc010xzd.1_Intron|PLA2G4C_uc002phy.3_Missense_Mutation_p.I8L	p.I8L	NM_003706	NP_003697	Q9UP65	PA24C_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)	3	420	-		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)	8			PLA2c.		B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	c.22A>T	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	t	9.706	1.155847	0.21454	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.03663	3.85;3.85	2.54	-4.39	0.03611	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	1.873420	0.03622	N	0.236630	T	0.01627	0.0052	N	0.13272	0.32	0.09310	N	1	B;P	0.40083	0.307;0.702	B;B	0.36092	0.102;0.217	T	0.40813	-0.9543	10	0.02654	T	1	0.4484	1.0651	0.01609	0.186:0.1353:0.3778:0.3008	.	8;8	Q8WWC5;Q9UP65	.;PA24C_HUMAN	L	8	ENSP00000346228:I8L;ENSP00000400036:I8L	ENSP00000346228:I8L	I	-	1	0	PLA2G4C	53300500	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-0.856000	0.04290	-1.313000	0.02303	-1.134000	0.01955	ATA		0.458	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1			17	88	0	0	0	0.007413	0	17	88				
HRC	3270	broad.mit.edu	37	19	49657099	49657099	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:49657099G>A	ENST00000252825.4	-	1	1582	c.1396C>T	c.(1396-1398)Cca>Tca	p.P466S	HRC_ENST00000595625.1_Missense_Mutation_p.P466S	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	466					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.P466S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		GTGTGTCCTGGGGGGTGATGG	0.547																																					Melanoma(37;75 1097 24567 25669 30645)	Melanoma(37;75 1097 24567 25669 30645)	uc002pmv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1396-1398)CCA>TCA		histidine rich calcium binding protein							156.0	137.0	143.0					19																	49657099		2203	4300	6503	SO:0001583	missense	3270				muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding	g.chr19:49657099G>A		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1396C>T	19.37:g.49657099G>A	ENSP00000252825:p.Pro466Ser						p.P466S	NM_002152	NP_002143	P23327	SRCH_HUMAN		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)	1	1583	-		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	466					Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	c.1396C>T	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	G	9.159	1.018168	0.19355	.	.	ENSG00000130528	ENST00000252825;ENST00000391863;ENST00000434964	T	0.39787	1.06	2.84	1.77	0.24775	.	.	.	.	.	T	0.41834	0.1176	L	0.42245	1.32	0.09310	N	0.999999	D	0.62365	0.991	P	0.58013	0.831	T	0.24941	-1.0146	9	0.10636	T	0.68	1.3624	5.6474	0.17596	0.1596:0.0:0.8404:0.0	.	466	P23327	SRCH_HUMAN	S	466;165;436	ENSP00000252825:P466S	ENSP00000252825:P466S	P	-	1	0	HRC	54348911	0.001000	0.12720	0.088000	0.20740	0.086000	0.17979	0.720000	0.25896	0.536000	0.28733	0.462000	0.41574	CCA		0.547	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152		36	109	0	0	0	0.005524	0	36	109				
SLC6A16	28968	broad.mit.edu	37	19	49797775	49797775	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:49797775C>A	ENST00000335875.4	-	8	1506	c.1265G>T	c.(1264-1266)gGg>gTg	p.G422V	SLC6A16_ENST00000454748.3_Missense_Mutation_p.G422V	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	422					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G422V(1)		NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		AGGCAGTTTCCCTAGGTTTAT	0.488																																							uc002pmz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|kidney(1)	4						c.(1264-1266)GGG>GTG		solute carrier family 6, member 16							124.0	124.0	124.0					19																	49797775		1934	4148	6082	SO:0001583	missense	28968					integral to membrane|intracellular	neurotransmitter:sodium symporter activity	g.chr19:49797775C>A	AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1265G>T	19.37:g.49797775C>A	ENSP00000338627:p.Gly422Val					SLC6A16_uc002pna.2_Missense_Mutation_p.G422V	p.G422V	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)	8	1499	-		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	422			Extracellular (Potential).		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	c.1265G>T	CCDS42590.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109784	0.56398	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.74002	-0.8;-0.77	4.98	4.98	0.66077	.	0.481828	0.21207	N	0.078364	D	0.84261	0.5433	M	0.72479	2.2	0.32126	N	0.587427	D;D	0.71674	0.996;0.998	D;D	0.74023	0.964;0.982	D	0.85289	0.1066	10	0.45353	T	0.12	.	14.4796	0.67573	0.0:1.0:0.0:0.0	.	422;422	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	V	422	ENSP00000338627:G422V;ENSP00000404022:G422V	ENSP00000338627:G422V	G	-	2	0	SLC6A16	54489587	0.007000	0.16637	0.052000	0.19188	0.003000	0.03518	1.753000	0.38359	2.684000	0.91462	0.609000	0.83330	GGG		0.488	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037		35	63	1	0	2.95478e-19	0.00874	5.21368e-19	35	63				
ZNF578	147660	broad.mit.edu	37	19	53007907	53007907	+	Splice_Site	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:53007907G>T	ENST00000421239.2	+	5	307		c.e5-1			NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.?(1)							GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TTTCATTTTAGGGACGCTTGA	0.398																																							uc002pzp.3		NA																	1	Unknown(1)		lung(1)		0						c.e5-1		zinc finger protein 578							109.0	119.0	116.0					19																	53007907		2203	4298	6501	SO:0001630	splice_region_variant	147660				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53007907G>T	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.64-1G>T	19.37:g.53007907G>T							p.G22_splice	NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN		GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)	5	308	+								B4DR51|I3L1Y6	Splice_Site	SNP	ENST00000421239.2	37	c.64_splice	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	g	0.956	-0.704871	0.03255	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.35	1.35	0.21983	.	.	.	.	.	.	.	.	.	.	.	0.43913	D	0.99655	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7487	0.28883	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF578	57699719	0.896000	0.30565	0.183000	0.23137	0.095000	0.18619	2.045000	0.41250	0.729000	0.32403	0.306000	0.20318	.		0.398	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	Intron	35	122	1	0	1.30998e-17	0.005524	2.23846e-17	35	122				
FCAR	2204	broad.mit.edu	37	19	55401176	55401176	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:55401176C>A	ENST00000355524.3	+	5	821	c.811C>A	c.(811-813)Cag>Aag	p.Q271K	FCAR_ENST00000353758.4_Missense_Mutation_p.Q162K|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000391723.3_3'UTR|FCAR_ENST00000391725.3_Missense_Mutation_p.Q249K|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391726.3_Missense_Mutation_p.Q163K|FCAR_ENST00000359272.4_Missense_Mutation_p.Q259K|FCAR_ENST00000391724.3_Missense_Mutation_p.Q237K|FCAR_ENST00000345937.4_Missense_Mutation_p.Q175K	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	271					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.Q271K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		CTGGAGCCAACAGATGTGTCA	0.552																																							uc002qhr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(811-813)CAG>AAG		Fc alpha receptor isoform a precursor							149.0	150.0	150.0					19																	55401176		2203	4300	6503	SO:0001583	missense	2204				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity	g.chr19:55401176C>A	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.811C>A	19.37:g.55401176C>A	ENSP00000347714:p.Gln271Lys					FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Missense_Mutation_p.Q222K|FCAR_uc010esi.1_Missense_Mutation_p.Q148K|FCAR_uc002qhu.1_Missense_Mutation_p.Q175K|FCAR_uc002qhv.1_Missense_Mutation_p.Q249K|FCAR_uc002qhw.1_Missense_Mutation_p.Q259K|FCAR_uc002qhx.1_Missense_Mutation_p.Q163K|FCAR_uc002qhy.1_Missense_Mutation_p.Q237K|FCAR_uc002qhz.1_3'UTR|FCAR_uc002qia.1_Missense_Mutation_p.Q162K	p.Q271K	NM_002000	NP_001991	P24071	FCAR_HUMAN		GBM - Glioblastoma multiforme(193;0.0443)	5	1008	+			271			Cytoplasmic (Potential).		Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	ENST00000355524.3	37	c.811C>A	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	C	9.471	1.095677	0.20471	.	.	ENSG00000186431	ENST00000391726;ENST00000355524;ENST00000391725;ENST00000345937;ENST00000353758;ENST00000359272;ENST00000391724	T;T;T;T;T;T;T	0.03860	3.78;6.89;6.5;4.8;6.59;6.74;6.36	2.79	1.75	0.24633	.	.	.	.	.	T	0.03305	0.0096	N	0.19112	0.55	0.09310	N	1	P;B;P;B;B;P;B	0.42456	0.78;0.243;0.705;0.399;0.243;0.705;0.215	B;B;B;B;B;B;B	0.38327	0.123;0.097;0.271;0.065;0.097;0.271;0.101	T	0.43065	-0.9414	9	0.59425	D	0.04	.	5.5074	0.16862	0.0:0.8436:0.0:0.1564	.	162;237;163;259;249;175;271	Q92592;Q92593;Q92587;Q9UEK0;Q53X39;P24071-3;P24071	.;.;.;.;.;.;FCAR_HUMAN	K	163;271;249;175;162;259;237	ENSP00000375606:Q163K;ENSP00000347714:Q271K;ENSP00000375605:Q249K;ENSP00000338257:Q175K;ENSP00000338058:Q162K;ENSP00000352218:Q259K;ENSP00000375604:Q237K	ENSP00000338257:Q175K	Q	+	1	0	FCAR	60092988	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.229000	0.17833	0.738000	0.32606	0.557000	0.71058	CAG		0.552	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000		44	120	1	0	2.47872e-24	0.010771	4.58988e-24	44	120				
FIZ1	84922	broad.mit.edu	37	19	56104097	56104097	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:56104097G>A	ENST00000221665.3	-	3	1299	c.1210C>T	c.(1210-1212)Ccg>Tcg	p.P404S		NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	404					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)	p.P404S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GAGCCAGACGGGGGTTCCCCG	0.731																																							uc002qli.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1210-1212)CCG>TCG		FLT3-interacting zinc finger 1							21.0	30.0	27.0					19																	56104097		2188	4279	6467	SO:0001583	missense	84922				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein kinase binding|receptor binding|zinc ion binding	g.chr19:56104097G>A	AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.1210C>T	19.37:g.56104097G>A	ENSP00000221665:p.Pro404Ser					FIZ1_uc002qlj.3_Missense_Mutation_p.P404S	p.P404S	NM_032836	NP_116225	Q96SL8	FIZ1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)	3	1300	-			404					A2RU72|Q6ZMJ7	Missense_Mutation	SNP	ENST00000221665.3	37	c.1210C>T	CCDS12928.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.489837	0.01018	.	.	ENSG00000179943	ENST00000221665	T	0.09817	2.94	3.24	0.734	0.18294	.	.	.	.	.	T	0.07279	0.0184	N	0.14661	0.345	0.21984	N	0.999438	B	0.12013	0.005	B	0.12156	0.007	T	0.35895	-0.9770	9	0.87932	D	0	-3.8369	11.2868	0.49226	0.0:0.3848:0.6152:0.0	.	404	Q96SL8	FIZ1_HUMAN	S	404	ENSP00000221665:P404S	ENSP00000221665:P404S	P	-	1	0	FIZ1	60795909	0.020000	0.18652	0.030000	0.17652	0.173000	0.22820	0.000000	0.12993	0.699000	0.31761	-0.565000	0.04167	CCG		0.731	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453350.1	NM_032836		13	22	0	0	0	0.006122	0	13	22				
U2AF2	11338	broad.mit.edu	37	19	56172460	56172460	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:56172460G>T	ENST00000308924.4	+	5	431	c.391G>T	c.(391-393)Gct>Tct	p.A131S	CTD-2537I9.12_ENST00000585940.1_RNA|CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000590551.1_5'Flank|U2AF2_ENST00000450554.2_Missense_Mutation_p.A131S			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	131					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A131S(1)		biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TGACGGTCTGGCTGTGACCCC	0.597																																							uc002qlu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(391-393)GCT>TCT		U2 (RNU2) small nuclear RNA auxiliary factor 2							71.0	68.0	69.0					19																	56172460		2203	4300	6503	SO:0001583	missense	11338				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding	g.chr19:56172460G>T	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.391G>T	19.37:g.56172460G>T	ENSP00000307863:p.Ala131Ser					U2AF2_uc002qlt.2_Missense_Mutation_p.A131S	p.A131S	NM_007279	NP_009210	P26368	U2AF2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)	5	1446	+		Colorectal(82;0.00244)|Ovarian(87;0.133)	131					Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	37	c.391G>T	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	g	15.55	2.868091	0.51588	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.11169	2.8;2.82	3.49	3.49	0.39957	.	0.000000	0.64402	U	0.000001	T	0.05640	0.0148	N	0.08118	0	0.80722	D	1	B;B	0.12013	0.003;0.005	B;B	0.12156	0.003;0.007	T	0.33292	-0.9874	10	0.12430	T	0.62	-17.1658	14.3446	0.66651	0.0:0.0:1.0:0.0	.	131;131	P26368;P26368-2	U2AF2_HUMAN;.	S	131	ENSP00000307863:A131S;ENSP00000388475:A131S	ENSP00000307863:A131S	A	+	1	0	U2AF2	60864272	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.735000	0.91549	1.950000	0.56595	0.466000	0.42574	GCT		0.597	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279		13	40	1	0	2.48551e-13	0.00499	3.9428e-13	13	40				
ZSCAN5B	342933	broad.mit.edu	37	19	56701551	56701551	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:56701551G>T	ENST00000586855.2	-	5	1446	c.1133C>A	c.(1132-1134)aCa>aAa	p.T378K	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.T378K			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	378					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.T378K(2)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TCTGTCTCCTGTGTGTGACCT	0.537																																							uc010ygh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1132-1134)ACA>AAA		zinc finger and SCAN domain containing 5B							77.0	81.0	79.0					19																	56701551		2177	4283	6460	SO:0001583	missense	342933				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:56701551G>T		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.1133C>A	19.37:g.56701551G>T	ENSP00000466072:p.Thr378Lys						p.T378K	NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN			4	1133	-			378						Missense_Mutation	SNP	ENST00000586855.2	37	c.1133C>A	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866491	0.51588	.	.	ENSG00000197213	ENST00000358992	T	0.24538	1.85	3.15	3.15	0.36227	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.49287	0.1548	M	0.76328	2.33	0.30677	N	0.752735	D	0.76494	0.999	D	0.77557	0.99	T	0.53012	-0.8498	9	0.87932	D	0	.	12.1597	0.54098	0.0:0.0:1.0:0.0	.	378	A6NJL1	ZSA5B_HUMAN	K	378	ENSP00000351883:T378K	ENSP00000351883:T378K	T	-	2	0	ZSCAN5B	61393363	1.000000	0.71417	0.192000	0.23308	0.025000	0.11179	3.863000	0.56016	1.777000	0.52277	0.306000	0.20318	ACA		0.537	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456		11	32	1	0	6.40141e-05	0.010729	7.65967e-05	11	32				
ZSCAN5B	342933	broad.mit.edu	37	19	56701905	56701905	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:56701905C>A	ENST00000586855.2	-	5	1092	c.779G>T	c.(778-780)aGa>aTa	p.R260I	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.R260I			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	260					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R260I(2)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CACAGAGGCTCTTTTCTGGGG	0.493																																							uc010ygh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(778-780)AGA>ATA		zinc finger and SCAN domain containing 5B							97.0	96.0	96.0					19																	56701905		2203	4300	6503	SO:0001583	missense	342933				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:56701905C>A		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.779G>T	19.37:g.56701905C>A	ENSP00000466072:p.Arg260Ile						p.R260I	NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN			4	779	-			260						Missense_Mutation	SNP	ENST00000586855.2	37	c.779G>T	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	C	2.357	-0.347564	0.05208	.	.	ENSG00000197213	ENST00000358992	T	0.06142	3.34	0.97	-1.94	0.07571	.	.	.	.	.	T	0.04407	0.0121	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42189	-0.9466	9	0.34782	T	0.22	.	2.1075	0.03695	0.252:0.3854:0.0:0.3627	.	260	A6NJL1	ZSA5B_HUMAN	I	260	ENSP00000351883:R260I	ENSP00000351883:R260I	R	-	2	0	ZSCAN5B	61393717	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.849000	0.01672	-1.171000	0.02765	-0.676000	0.03789	AGA		0.493	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456		13	111	1	0	9.31168e-06	0.001855	1.16277e-05	13	111				
USP29	57663	broad.mit.edu	37	19	57642636	57642636	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:57642636T>A	ENST00000254181.4	+	4	3047	c.2593T>A	c.(2593-2595)Tca>Aca	p.S865T	USP29_ENST00000598197.1_Missense_Mutation_p.S865T|U3_ENST00000516874.1_RNA	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	865	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.S865T(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCAGAAATCTCAGAGACCAA	0.443																																							uc002qny.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(2593-2595)TCA>ACA		ubiquitin specific peptidase 29							69.0	66.0	67.0					19																	57642636		2203	4300	6503	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57642636T>A		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.2593T>A	19.37:g.57642636T>A	ENSP00000254181:p.Ser865Thr						p.S865T	NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	2949	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	865						Missense_Mutation	SNP	ENST00000254181.4	37	c.2593T>A	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.446797	0.43429	.	.	ENSG00000131864	ENST00000254181	T	0.75260	-0.92	2.56	-5.12	0.02893	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.666890	0.04565	U	0.392183	T	0.59972	0.2233	L	0.29908	0.895	0.20489	N	0.999894	P	0.44877	0.845	P	0.44394	0.448	T	0.55263	-0.8168	10	0.52906	T	0.07	0.7165	1.2072	0.01897	0.1484:0.3691:0.1468:0.3357	.	865	Q9HBJ7	UBP29_HUMAN	T	865	ENSP00000254181:S865T	ENSP00000254181:S865T	S	+	1	0	USP29	62334448	0.998000	0.40836	0.000000	0.03702	0.055000	0.15305	0.649000	0.24843	-1.148000	0.02847	-0.467000	0.05162	TCA		0.443	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			14	39	0	0	0	0.00245	0	14	39				
ZSCAN1	284312	broad.mit.edu	37	19	58565342	58565342	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr19:58565342G>T	ENST00000282326.1	+	6	1397	c.1150G>T	c.(1150-1152)Gtc>Ttc	p.V384F		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	384					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)	p.V384F(1)|p.V384I(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCAGTGTAGCGTCTGCGGGAA	0.692																																							uc002qrc.1		NA																	2	Substitution - Missense(2)	p.V384I(1)	ovary(1)|lung(1)	ovary(2)	2						c.(1150-1152)GTC>TTC		zinc finger and SCAN domain containing 1							24.0	28.0	26.0					19																	58565342		2202	4299	6501	SO:0001583	missense	284312				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58565342G>T	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.1150G>T	19.37:g.58565342G>T	ENSP00000282326:p.Val384Phe						p.V384F	NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)	6	1397	+		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	384			C2H2-type 3.		Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	37	c.1150G>T	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760957	0.49468	.	.	ENSG00000152467	ENST00000282326	T	0.52057	0.68	0.993	0.993	0.19825	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50171	0.1600	L	0.28400	0.85	0.80722	D	1	D	0.64830	0.994	D	0.70227	0.968	T	0.50372	-0.8836	9	0.66056	D	0.02	.	7.8299	0.29336	0.0:0.0:1.0:0.0	.	384	Q8NBB4	ZSCA1_HUMAN	F	384	ENSP00000282326:V384F	ENSP00000282326:V384F	V	+	1	0	ZSCAN1	63257154	0.144000	0.22641	0.022000	0.16811	0.325000	0.28411	1.440000	0.35024	0.835000	0.34877	0.313000	0.20887	GTC		0.692	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572		4	7	1	0	0.00909568	0.009096	0.00973538	4	7				
PXDN	7837	broad.mit.edu	37	2	1653010	1653010	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:1653010T>A	ENST00000252804.4	-	17	2592	c.2542A>T	c.(2542-2544)Agc>Tgc	p.S848C		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	848					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S848C(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CACACGTTGCTGCAGTGCTGT	0.657																																							uc002qxa.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(6)|ovary(2)	8						c.(2542-2544)AGC>TGC		peroxidasin precursor							32.0	34.0	33.0					2																	1653010		2181	4284	6465	SO:0001583	missense	7837				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity	g.chr2:1653010T>A	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2542A>T	2.37:g.1653010T>A	ENSP00000252804:p.Ser848Cys						p.S848C	NM_012293	NP_036425	Q92626	PXDN_HUMAN		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)	17	2606	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	848					A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	c.2542A>T	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	T	17.39	3.377449	0.61735	.	.	ENSG00000130508	ENST00000252804	T	0.70986	-0.53	5.36	4.2	0.49525	.	0.208586	0.50627	D	0.000104	T	0.70902	0.3277	N	0.26092	0.79	0.44570	D	0.997539	D	0.61080	0.989	D	0.64687	0.928	T	0.69624	-0.5095	10	0.37606	T	0.19	-65.1677	10.9254	0.47187	0.0:0.0737:0.0:0.9263	.	848	Q92626	PXDN_HUMAN	C	848	ENSP00000252804:S848C	ENSP00000252804:S848C	S	-	1	0	PXDN	1632017	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	3.213000	0.51153	2.167000	0.68274	0.456000	0.33151	AGC		0.657	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455		4	6	0	0	0	0.001168	0	4	6				
TSSC1	7260	broad.mit.edu	37	2	3200660	3200660	+	Silent	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:3200660C>A	ENST00000382125.4	-	6	837	c.645G>T	c.(643-645)cgG>cgT	p.R215R	TSSC1_ENST00000398659.4_Silent_p.R242R|TSSC1_ENST00000478754.1_5'UTR	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	215								p.R215R(1)		breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		ACCTCATGCTCCGGGTGTCCC	0.627																																					Colon(140;1261 1762 4183 34270 49743)	Colon(140;1261 1762 4183 34270 49743)	uc002qxj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(643-645)CGG>CGT		tumor suppressing subtransferable candidate 1							87.0	60.0	69.0					2																	3200660		2203	4300	6503	SO:0001819	synonymous_variant	7260						protein binding	g.chr2:3200660C>A	AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.645G>T	2.37:g.3200660C>A						TSSC1_uc002qxi.2_RNA	p.R215R	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)	6	838	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)	215			WD 2.		D6W4Y1|O43179|Q53S19|Q53SG2	Silent	SNP	ENST00000382125.4	37	c.645G>T	CCDS1651.1																																																																																				0.627	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206694.2	NM_003310		12	4	1	0	0.00136819	0.013537	0.00153175	12	4				
DRC1	92749	broad.mit.edu	37	2	26652528	26652528	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:26652528G>T	ENST00000288710.2	+	5	647	c.573G>T	c.(571-573)aaG>aaT	p.K191N		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	191					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.K191N(1)									AGTATGTGAAGGATTTGAAGA	0.438																																							uc002rhg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(571-573)AAG>AAT		hypothetical protein LOC92749							122.0	121.0	122.0					2																	26652528		2203	4300	6503	SO:0001583	missense	92749							g.chr2:26652528G>T	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.573G>T	2.37:g.26652528G>T	ENSP00000288710:p.Lys191Asn					C2orf39_uc010eym.1_RNA	p.K191N	NM_145038	NP_659475	Q96MC2	CC164_HUMAN			5	647	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		191			Potential.		A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	ENST00000288710.2	37	c.573G>T	CCDS1723.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048534	0.75846	.	.	ENSG00000157856	ENST00000288710	T	0.17528	2.27	5.35	2.57	0.30868	.	0.049086	0.85682	D	0.000000	T	0.33089	0.0851	L	0.58583	1.82	0.41333	D	0.98725	D	0.89917	1.0	D	0.77004	0.989	T	0.02126	-1.1209	10	0.44086	T	0.13	-40.7833	10.0029	0.41940	0.229:0.0:0.771:0.0	.	191	Q96MC2	CC164_HUMAN	N	191	ENSP00000288710:K191N	ENSP00000288710:K191N	K	+	3	2	CCDC164	26506032	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.524000	0.35942	0.653000	0.30826	0.563000	0.77884	AAG		0.438	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038		41	56	1	0	2.66277e-13	0.006999	4.21028e-13	41	56				
GTF2A1L	11036	broad.mit.edu	37	2	48873798	48873798	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:48873798A>G	ENST00000403751.3	+	6	632	c.595A>G	c.(595-597)Att>Gtt	p.I199V	STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.I856V|LHCGR_ENST00000420913.3_Intron|GTF2A1L_ENST00000430487.2_Missense_Mutation_p.I165V|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.I903V|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.I903V|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.I903V|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.I903V	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	199					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.I903V(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCAACCCGCAATTCTACCTTC	0.403																																							uc010yol.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)|skin(1)	5						c.(2566-2568)ATT>GTT		stonin 1							86.0	83.0	84.0					2																	48873798		2203	4300	6503	SO:0001583	missense	286749				endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex		g.chr2:48873798A>G	AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.595A>G	2.37:g.48873798A>G	ENSP00000384597:p.Ile199Val					STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.I903V|GTF2A1L_uc002rws.1_Missense_Mutation_p.I199V|GTF2A1L_uc010yom.1_Missense_Mutation_p.I165V|GTF2A1L_uc002rwt.2_Missense_Mutation_p.I199V	p.I856V	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		5	2613	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	856					B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	ENST00000403751.3	37	c.2566A>G	CCDS46281.1	.	.	.	.	.	.	.	.	.	.	A	0.244	-1.011694	0.02095	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000437125;ENST00000430487;ENST00000403751	T;T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.29	-7.73	0.01245	.	2.556960	0.01357	N	0.012099	T	0.17789	0.0427	N	0.05383	-0.06	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.0;0.001;0.001;0.001	T	0.26395	-1.0104	10	0.07175	T	0.84	.	7.4327	0.27137	0.5397:0.2137:0.2466:0.0	.	165;856;903;199;903	Q9UNN4-2;A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;.;TF2AY_HUMAN;.	V	903;903;903;903;856;198;208;165;199	ENSP00000385499:I903V;ENSP00000385701:I903V;ENSP00000378236:I903V;ENSP00000311493:I903V;ENSP00000378234:I856V;ENSP00000396702:I208V;ENSP00000387896:I165V;ENSP00000384597:I199V	ENSP00000384597:I199V	I	+	1	0	STON1-GTF2A1L;GTF2A1L	48727302	0.000000	0.05858	0.000000	0.03702	0.653000	0.38743	-2.003000	0.01463	-1.943000	0.01039	-0.202000	0.12741	ATT		0.403	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872		24	45	0	0	0	0.004656	0	24	45				
Unknown	0	broad.mit.edu	37	2	73928033	73928033	+	IGR	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:73928033C>A								ALMS1P (15330 upstream) : TPRKB (28923 downstream)																							AACCGCTTCTCCCTCAAGGTG	0.567																																							uc002sjk.1		NA																	0					0						c.(400-402)GAG>TAG		N-acetyltransferase 8B							80.0	86.0	84.0					2																	73928033		2203	4300	6503	SO:0001628	intergenic_variant	51471				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity	g.chr2:73928033C>A																													2.37:g.73928033C>A							p.E134*	NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN			2	435	-			134			N-acetyltransferase.			Nonsense_Mutation	SNP		37	c.400G>T																																																																																				0	0.567									12	62	1	0	4.3838e-07	0.001855	5.86514e-07	12	62				
Unknown	0	broad.mit.edu	37	2	73928243	73928243	+	IGR	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:73928243G>T								ALMS1P (15540 upstream) : TPRKB (28713 downstream)																							CTGAACACGAGGGCCAGAATC	0.567																																							uc002sjk.1		NA																	0					0						c.(190-192)CTC>ATC		N-acetyltransferase 8B							77.0	86.0	83.0					2																	73928243		2203	4300	6503	SO:0001628	intergenic_variant	51471				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity	g.chr2:73928243G>T																													2.37:g.73928243G>T							p.L64I	NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN			2	225	-			64			N-acetyltransferase.			Missense_Mutation	SNP		37	c.190C>A																																																																																				0	0.567									13	46	1	0	9.05144e-12	0.001855	1.39495e-11	13	46				
TRIM43	129868	broad.mit.edu	37	2	96260875	96260875	+	Silent	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:96260875A>G	ENST00000272395.2	+	3	625	c.489A>G	c.(487-489)agA>agG	p.R163R		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	163						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.R163R(2)		breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						AGGAGGGAAGAACAGCCTTCC	0.393																																							uc002suv.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(487-489)AGA>AGG		tripartite motif-containing 43							71.0	67.0	68.0					2																	96260875		2203	4300	6503	SO:0001819	synonymous_variant	129868					intracellular	zinc ion binding	g.chr2:96260875A>G	BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.489A>G	2.37:g.96260875A>G							p.R163R	NM_138800	NP_620155	Q96BQ3	TRI43_HUMAN			3	625	+			163					Q53TJ7	Silent	SNP	ENST00000272395.2	37	c.489A>G	CCDS2015.1																																																																																				0.393	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252784.1	NM_138800		6	29	0	0	0	0.00308	0	6	29				
ANKRD36B	57730	broad.mit.edu	37	2	98195478	98195478	+	RNA	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:98195478C>T	ENST00000443455.1	-	0	764							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		TCTTTTTCTCCAAGAGTAACA	0.333																																							uc010yvc.1		NA																	0					0						c.(586-588)GGA>AGA		ankyrin repeat domain 36B							47.0	39.0	41.0					2																	98195478		1814	4068	5882			57730							g.chr2:98195478C>T	AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98195478C>T						ANKRD36B_uc010yve.1_RNA|ANKRD36B_uc010fif.2_Intron	p.G196R	NM_025190	NP_079466	Q8N2N9	AN36B_HUMAN			5	866	-			196			ANK 6.		Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	Missense_Mutation	SNP	ENST00000443455.1	37	c.586G>A																																																																																					0.333	ANKRD36B-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000328967.2	NM_025190		4	30	0	0	0	0.009096	0	4	30				
VWA3B	200403	broad.mit.edu	37	2	98887214	98887214	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:98887214G>T	ENST00000477737.1	+	22	3117	c.2913G>T	c.(2911-2913)ttG>ttT	p.L971F	VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	971								p.L971F(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TAGAACGGTTGAATTGGCCCA	0.413																																							uc002syo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|skin(1)	6						c.(2911-2913)TTG>TTT		von Willebrand factor A domain containing 3B							142.0	138.0	139.0					2																	98887214		1845	4095	5940	SO:0001583	missense	200403							g.chr2:98887214G>T	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2913G>T	2.37:g.98887214G>T	ENSP00000417955:p.Leu971Phe					VWA3B_uc002sym.2_Missense_Mutation_p.L971F|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.L628F|VWA3B_uc002syp.1_Missense_Mutation_p.L363F|VWA3B_uc002syq.1_Missense_Mutation_p.L247F|VWA3B_uc002syr.1_Missense_Mutation_p.L288F|VWA3B_uc002sys.2_RNA	p.L971F	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN			22	3177	+			971					B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	c.2913G>T	CCDS42718.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.94|12.94	2.089856|2.089856	0.36855|0.36855	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000473149|ENST00000477737;ENST00000358269	.|T	.|0.07216	.|3.21	4.52|4.52	1.72|1.72	0.24424|0.24424	.|.	.|0.648406	.|0.12427	.|N	.|0.469878	.|T	.|0.19087	.|0.0458	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;P;D	.|0.65815	.|0.995;0.893;0.96	.|D;B;P	.|0.63381	.|0.914;0.383;0.748	.|T	.|0.04551	.|-1.0943	.|10	.|0.62326	.|D	.|0.03	.|.	5.6616|5.6616	0.17672|0.17672	0.3976:0.0:0.6024:0.0|0.3976:0.0:0.6024:0.0	.|.	.|363;971;971	.|Q502W6-5;Q502W6;Q502W6-8	.|.;VWA3B_HUMAN;.	X|F	382|971;93	.|ENSP00000417955:L971F	.|ENSP00000351009:L93F	E|L	+|+	1|3	0|2	VWA3B|VWA3B	98253646|98253646	0.019000|0.019000	0.18553|0.18553	0.994000|0.994000	0.49952|0.49952	0.600000|0.600000	0.36913|0.36913	-0.097000|-0.097000	0.11042|0.11042	0.634000|0.634000	0.30469|0.30469	0.655000|0.655000	0.94253|0.94253	GAA|TTG		0.413	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		65	138	1	0	1.07363e-35	0.01441	2.03447e-35	65	138				
CNGA3	1261	broad.mit.edu	37	2	99012551	99012551	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:99012551G>C	ENST00000272602.2	+	7	957	c.918G>C	c.(916-918)ttG>ttC	p.L306F	CNGA3_ENST00000409937.1_Missense_Mutation_p.L310F|CNGA3_ENST00000436404.2_Missense_Mutation_p.L288F|CNGA3_ENST00000393504.1_Missense_Mutation_p.L306F			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	306					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.L306F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						TTGGGAACTTGGTCTTGTACA	0.463																																							uc002syt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)	6						c.(916-918)TTG>TTC		cyclic nucleotide gated channel alpha 3 isoform							116.0	116.0	116.0					2																	99012551		2203	4300	6503	SO:0001583	missense	1261				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr2:99012551G>C	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.918G>C	2.37:g.99012551G>C	ENSP00000272602:p.Leu306Phe					CNGA3_uc002syu.2_Missense_Mutation_p.L288F|CNGA3_uc010fij.2_Missense_Mutation_p.L310F	p.L306F	NM_001298	NP_001289	Q16281	CNGA3_HUMAN			8	1335	+			306			Helical; (Potential).		E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	c.918G>C	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431475	0.43122	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.99462	-5.94;-5.94;-5.94;-5.94	4.99	1.92	0.25849	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99521	0.9829	H	0.96720	3.87	0.54753	D	0.999986	D;D;D	0.89917	1.0;0.998;0.972	D;D;P	0.85130	0.997;0.995;0.877	D	0.98550	1.0636	10	0.87932	D	0	.	2.8198	0.05468	0.0952:0.1308:0.4548:0.3191	.	310;288;306	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	F	306;288;306;310	ENSP00000377140:L306F;ENSP00000410070:L288F;ENSP00000272602:L306F;ENSP00000386761:L310F	ENSP00000272602:L306F	L	+	3	2	CNGA3	98378983	0.924000	0.31332	1.000000	0.80357	0.952000	0.60782	-0.041000	0.12084	0.688000	0.31529	0.563000	0.77884	TTG		0.463	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		11	61	0	0	0	0.008291	0	11	61				
INPP4A	3631	broad.mit.edu	37	2	99185059	99185059	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:99185059G>T	ENST00000523221.1	+	21	2461	c.2461G>T	c.(2461-2463)Gtc>Ttc	p.V821F	INPP4A_ENST00000074304.5_Missense_Mutation_p.V821F|INPP4A_ENST00000467042.1_3'UTR|INPP4A_ENST00000409540.3_Missense_Mutation_p.V782F|INPP4A_ENST00000409016.4_Missense_Mutation_p.V782F|INPP4A_ENST00000409463.1_Missense_Mutation_p.V150F|INPP4A_ENST00000409851.3_Missense_Mutation_p.V816F|INPP4A_ENST00000545415.1_Missense_Mutation_p.V782F			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	821					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.V821F(1)|p.V782F(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						TTTACAAGAAGTCATCAACGT	0.418																																							uc002syy.2		NA																	2	Substitution - Missense(2)		lung(2)	kidney(1)	1						c.(2461-2463)GTC>TTC		inositol polyphosphate-4-phosphatase, type 1							126.0	120.0	122.0					2																	99185059		1911	4113	6024	SO:0001583	missense	3631				signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity	g.chr2:99185059G>T	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2461G>T	2.37:g.99185059G>T	ENSP00000427722:p.Val821Phe					INPP4A_uc010yvj.1_Missense_Mutation_p.V782F|INPP4A_uc010yvk.1_Missense_Mutation_p.V782F|INPP4A_uc002syx.2_Missense_Mutation_p.V816F|INPP4A_uc010fik.2_Missense_Mutation_p.V150F	p.V821F	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN			23	2854	+			821					O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	37	c.2461G>T	CCDS46369.1	.	.	.	.	.	.	.	.	.	.	G	8.158	0.788783	0.16258	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000409463;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T;T	0.42900	1.95;2.26;0.96;2.26;1.95;1.95;2.26	4.79	2.82	0.32997	.	0.408051	0.24287	N	0.039845	T	0.34978	0.0916	L	0.48642	1.525	0.49389	D	0.999781	B;B;B;B;B	0.31290	0.076;0.191;0.243;0.318;0.318	B;B;B;B;B	0.37601	0.106;0.141;0.254;0.203;0.203	T	0.26503	-1.0101	10	0.56958	D	0.05	-9.7518	4.5589	0.12151	0.2495:0.0:0.5797:0.1708	.	782;782;150;821;816	Q96PE3-2;Q96PE3-4;B8ZZB2;Q96PE3;Q96PE3-3	.;.;.;INP4A_HUMAN;.	F	782;816;150;821;782;782;821	ENSP00000386704:V782F;ENSP00000386777:V816F;ENSP00000386329:V150F;ENSP00000074304:V821F;ENSP00000442149:V782F;ENSP00000387294:V782F;ENSP00000427722:V821F	ENSP00000074304:V821F	V	+	1	0	INPP4A	98551491	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	2.099000	0.41767	1.250000	0.43966	0.561000	0.74099	GTC		0.418	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	NM_001566		5	12	1	0	5.9392e-07	0.001168	7.90271e-07	5	12				
MERTK	10461	broad.mit.edu	37	2	112755053	112755053	+	Splice_Site	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:112755053G>T	ENST00000295408.4	+	10	1861	c.1604G>T	c.(1603-1605)gGg>gTg	p.G535V	MERTK_ENST00000421804.2_Splice_Site_p.G535V|MERTK_ENST00000409780.1_Splice_Site_p.G359V			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	535					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G535V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						ACAAAGTTTGGGTAAGTCTCC	0.423																																							uc002thk.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						c.(1603-1605)GGG>GTG		MER receptor tyrosine kinase precursor							73.0	66.0	68.0					2																	112755053		2203	4300	6503	SO:0001630	splice_region_variant	10461				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:112755053G>T	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.1604+1G>T	2.37:g.112755053G>T						MERTK_uc002thl.1_Missense_Mutation_p.G359V	p.G535V	NM_006343	NP_006334	Q12866	MERTK_HUMAN			10	1726	+			535			Cytoplasmic (Potential).		Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	c.1604G>T	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898543	0.72639	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780	T;T;T	0.76316	-1.01;-1.01;-0.97	5.85	5.85	0.93711	.	0.000000	0.33916	U	0.004430	D	0.86075	0.5846	M	0.72894	2.215	0.80722	D	1	D	0.69078	0.997	P	0.62491	0.903	D	0.86623	0.1880	10	0.72032	D	0.01	-29.3153	16.0324	0.80588	0.0:0.0:1.0:0.0	.	535	Q12866	MERTK_HUMAN	V	535;535;177;359	ENSP00000295408:G535V;ENSP00000389152:G535V;ENSP00000387277:G359V	ENSP00000295408:G535V	G	+	2	0	MERTK	112471524	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	5.966000	0.70395	2.932000	0.99384	0.643000	0.83706	GGG		0.423	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		Missense_Mutation	19	32	1	0	2.54575e-18	0.010504	4.45964e-18	19	32				
POLR1B	84172	broad.mit.edu	37	2	113316941	113316941	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:113316941C>T	ENST00000263331.5	+	9	1982	c.1402C>T	c.(1402-1404)Cat>Tat	p.H468Y	POLR1B_ENST00000409894.3_Intron|POLR1B_ENST00000498054.1_3'UTR|POLR1B_ENST00000537335.1_Missense_Mutation_p.H257Y|POLR1B_ENST00000541869.1_Missense_Mutation_p.H506Y|POLR1B_ENST00000417433.2_Missense_Mutation_p.H412Y	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	468					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.H468N(1)|p.H468Y(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CTACCTCTCCCATTTCCGCTG	0.502																																					Ovarian(16;256 576 9537 23969 41147)	Ovarian(16;256 576 9537 23969 41147)	uc002thw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1402-1404)CAT>TAT		RNA polymerase I polypeptide B isoform 1							164.0	163.0	163.0					2																	113316941		2203	4300	6503	SO:0001583	missense	84172				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding	g.chr2:113316941C>T	AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1402C>T	2.37:g.113316941C>T	ENSP00000263331:p.His468Tyr					POLR1B_uc010fkn.2_Missense_Mutation_p.H412Y|POLR1B_uc002thx.2_Missense_Mutation_p.H329Y|POLR1B_uc010fko.2_Intron|POLR1B_uc010fkp.2_Intron|POLR1B_uc010yxn.1_Missense_Mutation_p.H506Y|POLR1B_uc002thy.2_Missense_Mutation_p.H329Y|POLR1B_uc010yxo.1_Missense_Mutation_p.H245Y	p.H468Y	NM_019014	NP_061887	Q9H9Y6	RPA2_HUMAN			9	1982	+			468					B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	ENST00000263331.5	37	c.1402C>T	CCDS2097.1	.	.	.	.	.	.	.	.	.	.	C	33	5.274472	0.95459	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000537335;ENST00000417433	T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4	5.85	5.85	0.93711	RNA polymerase Rpb2, domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.90851	0.7126	M	0.83692	2.655	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	0.999;0.945;1.0	D	0.91419	0.5157	10	0.87932	D	0	-25.6706	18.949	0.92635	0.0:1.0:0.0:0.0	.	506;412;468	F5GZX4;Q9H9Y6-2;Q9H9Y6	.;.;RPA2_HUMAN	Y	468;506;257;412	ENSP00000263331:H468Y;ENSP00000444136:H506Y;ENSP00000437914:H257Y;ENSP00000405358:H412Y	ENSP00000263331:H468Y	H	+	1	0	POLR1B	113033412	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.437000	0.80417	2.771000	0.95319	0.561000	0.74099	CAT		0.502	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014		67	183	0	0	0	0.01441	0	67	183				
EN1	2019	broad.mit.edu	37	2	119604045	119604045	+	Silent	SNP	C	C	T	rs558210525		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:119604045C>T	ENST00000295206.6	-	1	1209	c.699G>A	c.(697-699)ggG>ggA	p.G233G	EN1_ENST00000546667.1_5'Flank	NM_001426.3	NP_001417.3	Q05925	HME1_HUMAN	engrailed homeobox 1	233					anatomical structure morphogenesis (GO:0009653)|dorsal/ventral pattern formation (GO:0009953)|embryonic forelimb morphogenesis (GO:0035115)|hindbrain development (GO:0030902)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|multicellular organism growth (GO:0035264)|neuron development (GO:0048666)|pigmentation (GO:0043473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|response to cocaine (GO:0042220)|skeletal system development (GO:0001501)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G233G(1)		endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	9						CTCCGGGGCTCCCCGCGCCGC	0.761													C|||	1	0.000199681	0.0	0.0	5008	,	,		6579	0.0		0.0	False		,,,				2504	0.001						uc002tlm.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|lung(1)	2						c.(697-699)GGG>GGA		engrailed homeobox 1							12.0	15.0	14.0					2																	119604045		2191	4297	6488	SO:0001819	synonymous_variant	2019				skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:119604045C>T	L12699	CCDS2123.1	2q14.2	2011-06-20	2007-02-15		ENSG00000163064	ENSG00000163064		"""Homeoboxes / ANTP class : NKL subclass"""	3342	protein-coding gene	gene with protein product		131290				8094370	Standard	NM_001426		Approved		uc002tlm.3	Q05925	OTTHUMG00000131401	ENST00000295206.6:c.699G>A	2.37:g.119604045C>T							p.G233G	NM_001426	NP_001417	Q05925	HME1_HUMAN			1	1715	-			233					Q4ZG44	Silent	SNP	ENST00000295206.6	37	c.699G>A	CCDS2123.1																																																																																				0.761	EN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254191.3			3	8	0	0	0	0.004672	0	3	8				
CNTNAP5	129684	broad.mit.edu	37	2	125204514	125204514	+	Splice_Site	SNP	G	G	T	rs559227827		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:125204514G>T	ENST00000431078.1	+	6	1282	c.918G>T	c.(916-918)gaG>gaT	p.E306D		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	306	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.E306D(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTGACTATGAGGTGAGTTGAT	0.547																																							uc002tno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)	10						c.(916-918)GAG>GAT		contactin associated protein-like 5 precursor							100.0	102.0	101.0					2																	125204514		2163	4263	6426	SO:0001630	splice_region_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125204514G>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.918+1G>T	2.37:g.125204514G>T						CNTNAP5_uc010flu.2_Missense_Mutation_p.E306D	p.E306D	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	6	1282	+			306			Laminin G-like 1.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.918G>T	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.967349	0.92855	.	.	ENSG00000155052	ENST00000431078	T	0.77620	-1.11	5.78	4.89	0.63831	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.119864	0.36338	N	0.002643	D	0.86331	0.5907	M	0.67625	2.065	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.85889	0.1427	10	0.38643	T	0.18	.	15.715	0.77661	0.0:0.0:0.8623:0.1376	.	306	Q8WYK1	CNTP5_HUMAN	D	306	ENSP00000399013:E306D	ENSP00000399013:E306D	E	+	3	2	CNTNAP5	124920984	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.813000	0.86123	1.569000	0.49696	0.655000	0.94253	GAG		0.547	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		Missense_Mutation	18	29	1	0	5.3912e-06	0.006122	6.81952e-06	18	29				
CFC1	55997	broad.mit.edu	37	2	131356256	131356256	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:131356256C>A	ENST00000259216.4	-	3	468	c.206G>T	c.(205-207)gGg>gTg	p.G69V		NM_032545.3	NP_115934.1	P0CG37	CFC1_HUMAN	cripto, FRL-1, cryptic family 1	69					determination of left/right symmetry (GO:0007368)|gastrulation (GO:0007369)|nodal signaling pathway (GO:0038092)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nodal binding (GO:0038100)	p.G69V(1)		endometrium(1)|lung(4)	5	Colorectal(110;0.1)					CTCCTCCGGCCCCCAGCCCTC	0.627																																							uc002tro.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(205-207)GGG>GTG		cripto, FRL-1, cryptic family 1B							31.0	47.0	42.0					2																	131356256		2194	4294	6488	SO:0001583	missense	653275				gastrulation	extracellular region		g.chr2:131356256C>A	AF312769	CCDS2162.1, CCDS74573.1, CCDS74574.1	2q21.2	2014-02-04			ENSG00000136698	ENSG00000136698			18292	protein-coding gene	gene with protein product		605194	"""heterotaxy 2 (autosomal dominant)"""	HTX2		11062482, 10858660	Standard	NM_032545		Approved	CRYPTIC, HTX2	uc002tro.2	P0CG37	OTTHUMG00000131628	ENST00000259216.4:c.206G>T	2.37:g.131356256C>A	ENSP00000259216:p.Gly69Val						p.G69V	NM_001079530	NP_001072998	P0CG36	CFC1B_HUMAN			3	597	-	Colorectal(110;0.1)		69					B2RCY0|B9EJD3|Q53T05|Q9GZR3	Missense_Mutation	SNP	ENST00000259216.4	37	c.206G>T	CCDS2162.1	.	.	.	.	.	.	.	.	.	.	.	9.242	1.038458	0.19669	.	.	ENSG00000136698	ENST00000259216	D	0.89415	-2.51	1.91	1.0	0.19881	.	0.491185	0.17606	N	0.168253	T	0.72851	0.3512	N	0.14661	0.345	0.09310	N	0.999992	P	0.44578	0.838	B	0.36134	0.218	T	0.66408	-0.5931	10	0.44086	T	0.13	-52.2556	4.3867	0.11319	0.0:0.7927:0.0:0.2073	.	69	P0CG37	CFC1_HUMAN	V	69	ENSP00000259216:G69V	ENSP00000259216:G69V	G	-	2	0	CFC1	131072726	0.000000	0.05858	0.085000	0.20634	0.025000	0.11179	-0.645000	0.05409	0.363000	0.24346	0.436000	0.28706	GGG		0.627	CFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333367.1	NM_032545		18	75	1	0	7.53681e-25	0.00632	1.4117e-24	18	75				
GPR148	344561	broad.mit.edu	37	2	131486929	131486929	+	Missense_Mutation	SNP	C	C	A	rs201807263	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:131486929C>A	ENST00000309926.4	+	1	287	c.205C>A	c.(205-207)Ctg>Atg	p.L69M		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L69M(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					TGTCAGCCCCCTGCTGCTGGT	0.627																																							uc002trv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(205-207)CTG>ATG		G protein-coupled receptor 148							55.0	53.0	54.0					2																	131486929		2203	4300	6503	SO:0001583	missense	344561					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr2:131486929C>A	AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.205C>A	2.37:g.131486929C>A	ENSP00000308908:p.Leu69Met						p.L69M	NM_207364	NP_997247	Q8TDV2	GP148_HUMAN			1	207	+	Colorectal(110;0.1)		69			Helical; Name=1; (Potential).		Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	ENST00000309926.4	37	c.205C>A	CCDS2163.1	.	.	.	.	.	.	.	.	.	.	.	11.10	1.538969	0.27475	.	.	ENSG00000173302	ENST00000309926	T	0.78595	-1.19	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.146534	0.27668	U	0.018343	T	0.77545	0.4146	N	0.19112	0.55	0.24949	N	0.991809	D	0.89917	1.0	D	0.75484	0.986	T	0.68599	-0.5366	10	0.87932	D	0	-2.9076	11.0791	0.48049	0.0:1.0:0.0:0.0	.	69	Q8TDV2	GP148_HUMAN	M	69	ENSP00000308908:L69M	ENSP00000308908:L69M	L	+	1	2	GPR148	131203399	0.998000	0.40836	0.967000	0.41034	0.245000	0.25701	3.049000	0.49869	1.318000	0.45170	0.462000	0.41574	CTG		0.627	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092		12	30	1	0	3.07112e-06	0.010729	3.92555e-06	12	30				
LYPD6	130574	broad.mit.edu	37	2	150327362	150327362	+	Nonstop_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:150327362T>C	ENST00000334166.4	+	5	771	c.514T>C	c.(514-516)Tag>Cag	p.*172Q	LYPD6_ENST00000409381.1_Nonstop_Mutation_p.*172Q	NM_194317.3	NP_919298.1	Q86Y78	LYPD6_HUMAN	LY6/PLAUR domain containing 6	0						extracellular region (GO:0005576)		p.*172Q(1)		large_intestine(1)|lung(4)	5				BRCA - Breast invasive adenocarcinoma(221;0.0667)		GCTCATGTTATAGTGGCTCAG	0.488																																							uc002twy.2		NA																	1	Nonstop extension(1)		lung(1)		0						c.(514-516)TAG>CAG		LY6/PLAUR domain containing 6 precursor							291.0	220.0	244.0					2																	150327362		2203	4300	6503	SO:0001578	stop_lost	130574					extracellular region		g.chr2:150327362T>C	BC047013	CCDS2188.1	2q23.2	2008-02-05			ENSG00000187123	ENSG00000187123			28751	protein-coding gene	gene with protein product		613359				12477932	Standard	NM_001195685		Approved	MGC52057	uc021vqt.1	Q86Y78	OTTHUMG00000131852	ENST00000334166.4:c.514T>C	2.37:g.150327362T>C	ENSP00000334463:p.*172Glnext*8					LYPD6_uc010fnt.2_RNA|LYPD6_uc002twz.2_RNA|LYPD6_uc002txa.2_Nonstop_Mutation_p.*172Q	p.*172Q	NM_194317	NP_919298	Q86Y78	LYPD6_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0667)	5	709	+			172					B3KWC0|Q4G121|Q53TR3|Q659B1	Nonstop_Mutation	SNP	ENST00000334166.4	37	c.514T>C	CCDS2188.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314848	0.40996	.	.	ENSG00000187123	ENST00000409381;ENST00000334166	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3287	0.49463	0.0:0.0:0.0:1.0	.	.	.	.	Q	172	.	.	X	+	1	0	LYPD6	150035608	1.000000	0.71417	0.960000	0.40013	0.461000	0.32589	4.070000	0.57548	2.169000	0.68431	0.533000	0.62120	TAG		0.488	LYPD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254800.2	NM_194317		26	71	0	0	0	0.00632	0	26	71				
KCNJ3	3760	broad.mit.edu	37	2	155711698	155711698	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:155711698C>A	ENST00000295101.2	+	3	1856	c.1379C>A	c.(1378-1380)tCt>tAt	p.S460Y		NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	460					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.S460Y(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	AAGATGTTATCTGATCCCATG	0.468																																							uc002tyv.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1378-1380)TCT>TAT		potassium inwardly-rectifying channel J3	Halothane(DB01159)						46.0	48.0	47.0					2																	155711698		2203	4300	6503	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155711698C>A	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1379C>A	2.37:g.155711698C>A	ENSP00000295101:p.Ser460Tyr					KCNJ3_uc010zce.1_3'UTR	p.S460Y	NM_002239	NP_002230	P48549	IRK3_HUMAN			3	1574	+			460			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.1379C>A	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068680	0.36470	.	.	ENSG00000162989	ENST00000295101	D	0.89681	-2.55	5.96	5.08	0.68730	.	0.374341	0.28694	N	0.014457	D	0.82706	0.5095	N	0.19112	0.55	0.80722	D	1	B	0.20671	0.047	B	0.18871	0.023	T	0.78879	-0.2030	10	0.66056	D	0.02	.	16.4303	0.83840	0.0:0.8688:0.1312:0.0	.	460	P48549	IRK3_HUMAN	Y	460	ENSP00000295101:S460Y	ENSP00000295101:S460Y	S	+	2	0	KCNJ3	155419944	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.499000	0.60380	1.522000	0.49001	0.655000	0.94253	TCT		0.468	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		21	50	1	0	4.96729e-08	0.008871	6.83353e-08	21	50				
CCDC148	130940	broad.mit.edu	37	2	159195539	159195539	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:159195539T>C	ENST00000283233.5	-	6	858	c.545A>G	c.(544-546)cAg>cGg	p.Q182R	CCDC148_ENST00000536771.1_Missense_Mutation_p.Q96R|CCDC148_ENST00000409889.1_Missense_Mutation_p.Q182R|CCDC148_ENST00000409187.1_Missense_Mutation_p.Q191R	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	182								p.Q182R(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						TTCTATTCTCTGTTGCTCCAG	0.313																																							uc002tzq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(544-546)CAG>CGG		coiled-coil domain containing 148							126.0	126.0	126.0					2																	159195539		2203	4300	6503	SO:0001583	missense	130940							g.chr2:159195539T>C		CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.545A>G	2.37:g.159195539T>C	ENSP00000283233:p.Gln182Arg					CCDC148_uc002tzr.2_Missense_Mutation_p.Q30R|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Missense_Mutation_p.Q129R|CCDC148_uc010foj.1_Missense_Mutation_p.Q30R|CCDC148_uc010fok.1_Missense_Mutation_p.Q96R|CCDC148_uc002tzs.1_Missense_Mutation_p.Q182R	p.Q182R	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN			6	808	-			182			Potential.		F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	ENST00000283233.5	37	c.545A>G	CCDS33304.1	.	.	.	.	.	.	.	.	.	.	T	5.060	0.196697	0.09599	.	.	ENSG00000153237	ENST00000283233;ENST00000375617;ENST00000409187;ENST00000536771;ENST00000409889	T;T;T;T	0.30182	1.97;1.97;1.54;1.54	5.98	3.26	0.37387	.	.	.	.	.	T	0.26666	0.0652	L	0.53249	1.67	0.20926	N	0.999825	P;P;P;P;P	0.51933	0.949;0.949;0.949;0.557;0.557	B;P;P;B;B	0.45881	0.439;0.496;0.496;0.219;0.219	T	0.06734	-1.0810	9	0.07175	T	0.84	-1.2348	6.2258	0.20708	0.1518:0.0837:0.0:0.7644	.	96;30;30;191;182	F5H839;C9JR76;Q8NFR7-2;B8ZZV3;Q8NFR7	.;.;.;.;CC148_HUMAN	R	182;30;191;96;182	ENSP00000283233:Q182R;ENSP00000386674:Q191R;ENSP00000443740:Q96R;ENSP00000386583:Q182R	ENSP00000283233:Q182R	Q	-	2	0	CCDC148	158903785	0.996000	0.38824	1.000000	0.80357	0.987000	0.75469	1.159000	0.31749	1.038000	0.40049	0.528000	0.53228	CAG		0.313	CCDC148-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333270.1	NM_138803		31	70	0	0	0	0.003271	0	31	70				
SCN3A	6328	broad.mit.edu	37	2	165970389	165970389	+	Silent	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:165970389A>G	ENST00000360093.3	-	20	4097	c.3606T>C	c.(3604-3606)atT>atC	p.I1202I	SCN3A_ENST00000409101.3_Silent_p.I1153I|SCN3A_ENST00000283254.7_Silent_p.I1202I	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1202					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.I1202I(1)|p.I1153I(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGTGCTCAACAATACTGTAGC	0.383																																							uc002ucx.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(3604-3606)ATT>ATC		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						200.0	174.0	183.0					2																	165970389		2203	4300	6503	SO:0001819	synonymous_variant	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165970389A>G	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3606T>C	2.37:g.165970389A>G						SCN3A_uc002ucy.2_Silent_p.I1153I|SCN3A_uc002ucz.2_Silent_p.I1153I|SCN3A_uc002uda.1_Silent_p.I1022I|SCN3A_uc002udb.1_Silent_p.I1022I	p.I1202I	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN			20	4098	-			1202			Helical; Name=S1 of repeat III; (Potential).		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37	c.3606T>C																																																																																					0.383	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		43	95	0	0	0	0.013114	0	43	95				
SCN1A	6323	broad.mit.edu	37	2	166898802	166898802	+	Splice_Site	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:166898802C>A	ENST00000303395.4	-	12	2175	c.2176G>T	c.(2176-2178)Gaa>Taa	p.E726*	AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000423058.2_Splice_Site_p.E726*|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Splice_Site_p.E715*|SCN1A_ENST00000409050.1_Splice_Site_p.E698*			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	726					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.E726*(1)|p.E715*(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGTTACCAACCTTCTACTGTA	0.343																																							uc010zcz.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(6)|skin(6)|large_intestine(1)	13						c.(2143-2145)GAA>TAA		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						129.0	122.0	124.0					2																	166898802		2203	4300	6503	SO:0001630	splice_region_variant	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166898802C>A	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2176+1G>T	2.37:g.166898802C>A						SCN1A_uc002udo.3_Nonsense_Mutation_p.E595*|SCN1A_uc010fpk.2_Nonsense_Mutation_p.E567*	p.E715*	NM_006920	NP_008851	P35498	SCN1A_HUMAN			12	2161	-			726					E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Nonsense_Mutation	SNP	ENST00000303395.4	37	c.2143G>T	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	39	7.315031	0.98207	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	.	.	.	5.82	5.82	0.92795	.	0.180873	0.39615	N	0.001309	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1092	0.97906	0.0:1.0:0.0:0.0	.	.	.	.	X	726;726;715;698	.	.	E	-	1	0	SCN1A	166607048	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.773000	0.85462	2.745000	0.94114	0.655000	0.94253	GAA		0.343	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	Nonsense_Mutation	32	81	1	0	2.08457e-15	0.010818	3.4413e-15	32	81				
LRP2	4036	broad.mit.edu	37	2	170145561	170145561	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:170145561G>T	ENST00000263816.3	-	9	1302	c.1017C>A	c.(1015-1017)aaC>aaA	p.N339K	LRP2_ENST00000443831.1_Missense_Mutation_p.N339K	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	339	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.N339K(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGTCATTGTGGTTGATGATAT	0.512																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(1015-1017)AAC>AAA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						109.0	108.0	109.0					2																	170145561		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170145561G>T		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1017C>A	2.37:g.170145561G>T	ENSP00000263816:p.Asn339Lys					LRP2_uc010zdf.1_Missense_Mutation_p.N339K	p.N339K	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	9	1230	-			339			EGF-like 1.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.1017C>A	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846305	0.32606	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.88046	-2.33;-2.33	5.06	4.11	0.48088	Epidermal growth factor-like (1);Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	0.145932	0.64402	D	0.000015	T	0.81749	0.4888	L	0.50333	1.59	0.35745	D	0.819005	P;P	0.45594	0.862;0.862	B;B	0.39185	0.293;0.219	T	0.83168	-0.0095	9	.	.	.	.	10.6211	0.45481	0.1754:0.0:0.8246:0.0	.	339;339	E9PC35;P98164	.;LRP2_HUMAN	K	339	ENSP00000263816:N339K;ENSP00000409813:N339K	.	N	-	3	2	LRP2	169853807	0.681000	0.27614	0.058000	0.19502	0.507000	0.33981	1.138000	0.31491	1.018000	0.39521	0.655000	0.94253	AAC		0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		19	60	1	0	6.33239e-15	0.010504	1.03486e-14	19	60				
WIPF1	7456	broad.mit.edu	37	2	175436881	175436881	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:175436881T>A	ENST00000392547.2	-	5	751	c.652A>T	c.(652-654)Act>Tct	p.T218S	WIPF1_ENST00000272746.5_Missense_Mutation_p.T218S|WIPF1_ENST00000409415.3_Missense_Mutation_p.T218S|WIPF1_ENST00000392546.2_Missense_Mutation_p.T218S|WIPF1_ENST00000359761.3_Missense_Mutation_p.T218S|WIPF1_ENST00000409891.1_Missense_Mutation_p.T218S|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000467149.1_5'Flank|AC018890.6_ENST00000412835.1_RNA	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	218					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.T218S(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GGGGGAGGAGTGGGCCCGGGG	0.652																																							uc002uiy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(652-654)ACT>TCT		WAS/WASL interacting protein family, member 1							28.0	35.0	32.0					2																	175436881		2196	4295	6491	SO:0001583	missense	7456				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding	g.chr2:175436881T>A	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.652A>T	2.37:g.175436881T>A	ENSP00000376330:p.Thr218Ser					uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Missense_Mutation_p.T218S|WIPF1_uc010fqt.1_Missense_Mutation_p.T218S|WIPF1_uc002ujc.1_Missense_Mutation_p.T218S|WIPF1_uc002uiz.2_Missense_Mutation_p.T218S|WIPF1_uc002ujb.1_Missense_Mutation_p.T218S|WIPF1_uc010zep.1_Missense_Mutation_p.T218S	p.T218S	NM_003387	NP_003378	O43516	WIPF1_HUMAN			6	984	-			218					B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	ENST00000392547.2	37	c.652A>T	CCDS2260.1	.	.	.	.	.	.	.	.	.	.	T	0.023	-1.403280	0.01165	.	.	ENSG00000115935	ENST00000392547;ENST00000392548;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891;ENST00000409415	T;T;T;T;T;T	0.43294	1.56;1.56;1.56;1.56;0.99;0.95	4.1	-1.8	0.07907	.	0.328154	0.31734	N	0.007159	T	0.24353	0.0590	L	0.43152	1.355	0.09310	N	0.999992	B;B;B;B	0.09022	0.0;0.002;0.0;0.0	B;B;B;B	0.09377	0.004;0.002;0.004;0.001	T	0.25710	-1.0124	10	0.12103	T	0.63	.	4.8262	0.13417	0.132:0.3137:0.0:0.5544	.	218;218;218;218	O43516-3;E9PB87;O43516-2;O43516	.;.;.;WIPF1_HUMAN	S	218	ENSP00000376330:T218S;ENSP00000272746:T218S;ENSP00000352802:T218S;ENSP00000376329:T218S;ENSP00000386431:T218S;ENSP00000387150:T218S	ENSP00000272746:T218S	T	-	1	0	WIPF1	175145127	0.083000	0.21467	0.000000	0.03702	0.039000	0.13416	0.678000	0.25277	-0.681000	0.05204	-0.558000	0.04189	ACT		0.652	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	NM_003387		21	42	0	0	0	0.010504	0	21	42				
EVX2	344191	broad.mit.edu	37	2	176948097	176948097	+	Silent	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:176948097A>T	ENST00000308618.4	-	1	544	c.408T>A	c.(406-408)ctT>ctA	p.L136L		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	136					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L136L(1)		kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		TGTTTTCCTTAAGCTGAGCGG	0.687																																							uc010zeu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(406-408)CTT>CTA		even-skipped homeobox 2							12.0	16.0	15.0					2																	176948097		2189	4283	6472	SO:0001819	synonymous_variant	344191					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176948097A>T		CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.408T>A	2.37:g.176948097A>T							p.L136L	NM_001080458	NP_001073927	Q03828	EVX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)	1	594	-			136						Silent	SNP	ENST00000308618.4	37	c.408T>A	CCDS33333.1																																																																																				0.687	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1			8	7	0	0	0	0.00308	0	8	7				
TTN	7273	broad.mit.edu	37	2	179458826	179458826	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:179458826G>T	ENST00000591111.1	-	247	53595	c.53371C>A	c.(53371-53373)Cgc>Agc	p.R17791S	TTN_ENST00000342992.6_Missense_Mutation_p.R16864S|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R10559S|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R10492S|TTN_ENST00000460472.2_Missense_Mutation_p.R10367S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R19432S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17791	Ig-like 104.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R10492S(1)|p.R16862S(1)|p.R10559S(1)|p.R16864S(1)|p.R10367S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATGAGTGCGATCATCTTCC	0.463																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(50590-50592)CGC>AGC		titin isoform N2-A							143.0	136.0	139.0					2																	179458826		1993	4187	6180	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179458826G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.53371C>A	2.37:g.179458826G>T	ENSP00000465570:p.Arg17791Ser					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R10559S|TTN_uc010zfi.1_Missense_Mutation_p.R10492S|TTN_uc010zfj.1_Missense_Mutation_p.R10367S	p.R16864S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		246	50814	-			17791					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.50590C>A		.	.	.	.	.	.	.	.	.	.	G	13.49	2.253143	0.39797	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	6.17	5.3	0.74995	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55242	0.1908	M	0.77820	2.39	0.35766	D	0.820555	B;B;B;B	0.32283	0.362;0.362;0.362;0.362	B;B;B;B	0.39379	0.298;0.298;0.298;0.219	T	0.67998	-0.5525	9	0.87932	D	0	.	12.0093	0.53278	0.0633:0.0:0.8152:0.1214	.	10367;10492;10559;17791	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	16864;10367;10559;10492;10365	ENSP00000343764:R16864S;ENSP00000434586:R10367S;ENSP00000340554:R10559S;ENSP00000352154:R10492S	ENSP00000340554:R10559S	R	-	1	0	TTN	179167072	0.991000	0.36638	0.998000	0.56505	0.966000	0.64601	1.821000	0.39041	1.631000	0.50456	0.655000	0.94253	CGC		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		25	74	1	0	8.24728e-16	0.004656	1.36613e-15	25	74				
TTN	7273	broad.mit.edu	37	2	179466637	179466637	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:179466637C>T	ENST00000591111.1	-	235	50575	c.50351G>A	c.(50350-50352)gGa>gAa	p.G16784E	TTN_ENST00000342992.6_Missense_Mutation_p.G15857E|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G9552E|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G9485E|TTN_ENST00000460472.2_Missense_Mutation_p.G9360E|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G18425E|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16784	Ig-like 101.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G15857E(2)|p.G9360E(1)|p.G9552E(1)|p.G9485E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCATGAACTCCATCCTATTA	0.313																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(47569-47571)GGA>GAA		titin isoform N2-A							101.0	93.0	96.0					2																	179466637		1816	4082	5898	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179466637C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50351G>A	2.37:g.179466637C>T	ENSP00000465570:p.Gly16784Glu					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G9552E|TTN_uc010zfi.1_Missense_Mutation_p.G9485E|TTN_uc010zfj.1_Missense_Mutation_p.G9360E	p.G15857E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		234	47794	-			16784					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.47570G>A		.	.	.	.	.	.	.	.	.	.	C	11.22	1.575757	0.28092	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	6.07	5.19	0.71726	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.27524	0.0676	N	0.12182	0.205	0.34919	D	0.748217	B;B;B;B	0.12630	0.006;0.006;0.006;0.006	B;B;B;B	0.17722	0.019;0.019;0.019;0.019	T	0.28299	-1.0048	9	0.87932	D	0	.	11.8917	0.52633	0.0:0.8665:0.0:0.1335	.	9360;9485;9552;16784	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	15857;9360;9552;9485;9360	ENSP00000343764:G15857E;ENSP00000434586:G9360E;ENSP00000340554:G9552E;ENSP00000352154:G9485E	ENSP00000340554:G9552E	G	-	2	0	TTN	179174882	0.075000	0.21258	1.000000	0.80357	0.947000	0.59692	1.962000	0.40442	2.885000	0.99019	0.655000	0.94253	GGA		0.313	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		9	52	0	0	0	0.006214	0	9	52				
TTN	7273	broad.mit.edu	37	2	179614227	179614227	+	Intron	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:179614227T>C	ENST00000591111.1	-	45	10585				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Silent_p.V4300V|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATATTCTTTTACATTTGTCC	0.398																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(12898-12900)GTA>GTG		titin isoform novex-3							57.0	58.0	58.0					2																	179614227		2203	4299	6502	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179614227T>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3623A>G	2.37:g.179614227T>C						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.V4300V	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13124	-			433					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.12900A>G																																																																																					0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		26	72	0	0	0	0.003954	0	26	72				
COL3A1	1281	broad.mit.edu	37	2	189868727	189868727	+	Missense_Mutation	SNP	G	G	C	rs587779589		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:189868727G>C	ENST00000304636.3	+	39	2851	c.2681G>C	c.(2680-2682)gGt>gCt	p.G894A	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	894	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G894A(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGACCCCCAGGTCCCAGCGGT	0.453																																							uc002uqj.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13	GRCh37	CM022338	COL3A1	M		c.(2680-2682)GGT>GCT		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						19.0	22.0	21.0					2																	189868727		2203	4298	6501	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189868727G>C	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2681G>C	2.37:g.189868727G>C	ENSP00000304408:p.Gly894Ala						p.G894A	NM_000090	NP_000081	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		39	2798	+			894			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.2681G>C	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936363	0.73442	.	.	ENSG00000168542	ENST00000304636	D	0.99479	-5.98	5.5	5.5	0.81552	.	0.000000	0.52532	D	0.000077	D	0.99725	0.9893	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97418	1.0007	10	0.72032	D	0.01	.	19.4068	0.94651	0.0:0.0:1.0:0.0	.	894	P02461	CO3A1_HUMAN	A	894	ENSP00000304408:G894A	ENSP00000304408:G894A	G	+	2	0	COL3A1	189576972	1.000000	0.71417	0.932000	0.37286	0.905000	0.53344	9.813000	0.99286	2.590000	0.87494	0.551000	0.68910	GGT		0.453	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		7	15	0	0	0	0.00308	0	7	15				
COL3A1	1281	broad.mit.edu	37	2	189876399	189876399	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:189876399C>A	ENST00000304636.3	+	51	4470	c.4300C>A	c.(4300-4302)Cgc>Agc	p.R1434S	COL3A1_ENST00000317840.5_Missense_Mutation_p.R1131S	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1434	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.		R -> C (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.R1434C(1)|p.R1434S(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	ATATCGAACACGCAAGGCTGT	0.393																																							uc002uqj.1		NA																	2	Substitution - Missense(2)	p.R1434C(1)	large_intestine(1)|lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(4300-4302)CGC>AGC		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						223.0	200.0	208.0					2																	189876399		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189876399C>A	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.4300C>A	2.37:g.189876399C>A	ENSP00000304408:p.Arg1434Ser						p.R1434S	NM_000090	NP_000081	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		51	4417	+			1434		R -> C (in a colorectal cancer sample; somatic mutation).	Fibrillar collagen NC1.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.4300C>A	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298287	0.40694	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.72725	-0.68;-0.68	5.69	5.69	0.88448	Fibrillar collagen, C-terminal (4);	0.000000	0.52532	D	0.000072	T	0.64594	0.2612	L	0.33624	1.015	0.26643	N	0.972241	B	0.31705	0.336	B	0.36666	0.23	T	0.52653	-0.8547	10	0.14252	T	0.57	.	19.8102	0.96543	0.0:1.0:0.0:0.0	.	1434	P02461	CO3A1_HUMAN	S	1434;1131	ENSP00000304408:R1434S;ENSP00000315243:R1131S	ENSP00000304408:R1434S	R	+	1	0	COL3A1	189584644	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	3.180000	0.50895	2.682000	0.91365	0.585000	0.79938	CGC		0.393	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		27	70	1	0	4.87955e-14	0.005443	7.86869e-14	27	70				
FZD7	8324	broad.mit.edu	37	2	202899689	202899689	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:202899689G>T	ENST00000286201.1	+	1	380	c.319G>T	c.(319-321)Gcg>Tcg	p.A107S	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	107	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.A107S(1)		breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CTCCATGTATGCGCCCGTGTG	0.622											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002uyw.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(319-321)GCG>TCG		frizzled 7 precursor							87.0	88.0	87.0					2																	202899689		2203	4300	6503	SO:0001583	missense	8324				axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|mesenchymal to epithelial transition|negative regulation of cell-substrate adhesion|negative regulation of ectodermal cell fate specification|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent|regulation of catenin import into nucleus|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr2:202899689G>T	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.319G>T	2.37:g.202899689G>T	ENSP00000286201:p.Ala107Ser		OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2133		p.A107S	NM_003507	NP_003498	O75084	FZD7_HUMAN			1	380	+			107			FZ.|Extracellular (Potential).		O94816|Q53S59|Q96B74	Missense_Mutation	SNP	ENST00000286201.1	37	c.319G>T	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.393684	0.83011	.	.	ENSG00000155760	ENST00000286201	T	0.77098	-1.07	5.31	5.31	0.75309	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.88518	0.6458	M	0.78637	2.42	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.89208	0.3562	10	0.59425	D	0.04	.	18.9805	0.92754	0.0:0.0:1.0:0.0	.	107	O75084	FZD7_HUMAN	S	107	ENSP00000286201:A107S	ENSP00000286201:A107S	A	+	1	0	FZD7	202607934	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.728000	0.74769	2.485000	0.83878	0.467000	0.42956	GCG		0.622	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507		17	53	1	0	1.99824e-07	0.00499	2.70317e-07	17	53				
ABI2	10152	broad.mit.edu	37	2	204259513	204259513	+	Silent	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:204259513C>G	ENST00000422511.2	+	6	700	c.669C>G	c.(667-669)ccC>ccG	p.P223P	ABI2_ENST00000430574.1_3'UTR|ABI2_ENST00000295851.5_Silent_p.P223P|ABI2_ENST00000261018.7_Intron|ABI2_ENST00000261016.6_Silent_p.P172P|RAPH1_ENST00000457812.1_3'UTR|ABI2_ENST00000430418.1_Intron|ABI2_ENST00000261017.5_Silent_p.P217P|ABI2_ENST00000424558.1_Silent_p.P217P			Q9NYB9	ABI2_HUMAN	abl-interactor 2	223	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cell migration (GO:0016477)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|Rac protein signal transduction (GO:0016601)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	cytoskeletal adaptor activity (GO:0008093)|DNA binding (GO:0003677)|kinase binding (GO:0019900)|proline-rich region binding (GO:0070064)|protein complex binding (GO:0032403)|SH3 domain binding (GO:0017124)|ubiquitin protein ligase binding (GO:0031625)	p.P217P(1)		breast(1)|kidney(3)|large_intestine(1)|liver(2)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	15						ATATGGCTCCCTCGCAGCAGA	0.498																																							uc002vaa.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(667-669)CCC>CCG		abl interactor 2							158.0	144.0	149.0					2																	204259513		2203	4300	6503	SO:0001819	synonymous_variant	10152				actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding	g.chr2:204259513C>G	AF260261	CCDS2358.1, CCDS63093.1, CCDS63094.1, CCDS74634.1	2q33	2010-09-20	2009-07-23		ENSG00000138443	ENSG00000138443			24011	protein-coding gene	gene with protein product		606442				7590236, 10964520	Standard	XM_005246217		Approved	ABI-2, AIP-1, ABI2B, AblBP3, argBPIA, SSH3BP2	uc002uzz.3	Q9NYB9	OTTHUMG00000132879	ENST00000422511.2:c.669C>G	2.37:g.204259513C>G						ABI2_uc010zig.1_Intron|ABI2_uc002uzz.2_Silent_p.P217P|ABI2_uc010zih.1_Intron|ABI2_uc010zii.1_Silent_p.P217P|ABI2_uc010zij.1_Silent_p.P161P|ABI2_uc002vab.2_Silent_p.P172P|ABI2_uc010zik.1_Intron|ABI2_uc010zil.1_Silent_p.P58P|ABI2_uc010zim.1_Intron|ABI2_uc002vac.2_Intron|ABI2_uc010zin.1_5'UTR	p.P223P	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN			6	904	+			223			Pro-rich.		B4DSN1|Q13147|Q13249|Q13801|Q9BV70	Silent	SNP	ENST00000422511.2	37	c.669C>G		.	.	.	.	.	.	.	.	.	.	C	9.149	1.015829	0.19355	.	.	ENSG00000138443	ENST00000451591;ENST00000454023	T;T	0.42513	0.97;1.08	5.9	5.9	0.94986	.	0.315626	0.32736	N	0.005714	T	0.43456	0.1248	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.07908	-1.0748	7	0.12430	T	0.62	-9.1092	17.1793	0.86850	0.0:0.8742:0.1258:0.0	.	.	.	.	R	89;64	ENSP00000413375:P89R;ENSP00000404352:P64R	ENSP00000413375:P89R	P	+	2	0	ABI2	203967758	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.417000	0.44653	2.802000	0.96397	0.650000	0.86243	CCT		0.498	ABI2-007	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000336179.2	NM_005759		41	112	0	0	0	0.00874	0	41	112				
PIKFYVE	200576	broad.mit.edu	37	2	209165672	209165672	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:209165672G>C	ENST00000264380.4	+	9	1220	c.1062G>C	c.(1060-1062)caG>caC	p.Q354H	PIKFYVE_ENST00000407449.1_Missense_Mutation_p.Q354H|PIKFYVE_ENST00000308862.6_Missense_Mutation_p.Q268H|PIKFYVE_ENST00000392202.3_Missense_Mutation_p.Q257H	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	354					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.Q354H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						ACAGTGTGCAGTTAAAAGACC	0.403																																							uc002vcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						c.(1060-1062)CAG>CAC		phosphatidylinositol-3-phosphate 5-kinase type							118.0	108.0	112.0					2																	209165672		2203	4300	6503	SO:0001583	missense	200576				cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding	g.chr2:209165672G>C	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.1062G>C	2.37:g.209165672G>C	ENSP00000264380:p.Gln354His					PIKFYVE_uc010fun.1_Missense_Mutation_p.Q35H|PIKFYVE_uc002vcy.1_Missense_Mutation_p.Q354H|PIKFYVE_uc002vcv.2_Missense_Mutation_p.Q257H|PIKFYVE_uc002vcw.2_Missense_Mutation_p.Q354H|PIKFYVE_uc002vcx.2_Missense_Mutation_p.Q268H	p.Q354H	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN			9	1220	+			354					Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	c.1062G>C	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935793	0.73442	.	.	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000407449;ENST00000308862;ENST00000452564	T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55	5.54	3.73	0.42828	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.076997	0.53938	N	0.000053	T	0.22399	0.0540	L	0.29908	0.895	0.52501	D	0.999957	D;D;D;D;D	0.71674	0.996;0.998;0.994;0.99;0.972	P;D;P;D;P	0.79784	0.862;0.993;0.906;0.969;0.773	T	0.01537	-1.1330	10	0.32370	T	0.25	-12.679	11.5156	0.50520	0.147:0.0:0.853:0.0	.	354;354;268;354;257	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	H	257;354;354;268;354	ENSP00000376038:Q257H;ENSP00000264380:Q354H;ENSP00000384356:Q354H;ENSP00000308715:Q268H;ENSP00000405736:Q354H	ENSP00000264380:Q354H	Q	+	3	2	PIKFYVE	208873917	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.896000	0.63222	1.319000	0.45190	0.563000	0.77884	CAG		0.403	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		11	91	0	0	0	0.00245	0	11	91				
ALPPL2	251	broad.mit.edu	37	2	233274340	233274340	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:233274340G>A	ENST00000295453.3	+	11	1409	c.1357G>A	c.(1357-1359)Ggc>Agc	p.G453S		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	453					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)	p.G453S(1)		breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	GACCCACGCAGGCGAGGACGT	0.657																																							uc002vss.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1357-1359)GGC>AGC		placental-like alkaline phosphatase	Amifostine(DB01143)|Levamisole(DB00848)						29.0	31.0	30.0					2																	233274340		2199	4300	6499	SO:0001583	missense	251				phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding	g.chr2:233274340G>A	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1357G>A	2.37:g.233274340G>A	ENSP00000295453:p.Gly453Ser						p.G453S	NM_031313	NP_112603	P10696	PPBN_HUMAN		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	11	1410	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	453					A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	c.1357G>A	CCDS2491.1	.	.	.	.	.	.	.	.	.	.	g	12.65	2.001114	0.35320	.	.	ENSG00000163286	ENST00000295453	D	0.98164	-4.76	2.32	2.32	0.28847	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.331422	0.31685	N	0.007240	D	0.98698	0.9563	M	0.91406	3.205	0.36202	D	0.850804	D	0.54207	0.965	P	0.58130	0.833	D	0.99946	1.1474	10	0.66056	D	0.02	.	11.9328	0.52855	0.0:0.0:1.0:0.0	.	453	P10696	PPBN_HUMAN	S	453	ENSP00000295453:G453S	ENSP00000295453:G453S	G	+	1	0	ALPPL2	232982584	0.799000	0.28903	0.680000	0.29994	0.084000	0.17831	2.216000	0.42871	1.286000	0.44565	0.205000	0.17691	GGC		0.657	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313		3	13	0	0	0	0.004672	0	3	13				
CHRND	1144	broad.mit.edu	37	2	233391241	233391241	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr2:233391241A>T	ENST00000258385.3	+	2	87	c.55A>T	c.(55-57)Agc>Tgc	p.S19C	CHRND_ENST00000543200.1_Missense_Mutation_p.S19C|CHRND_ENST00000457943.2_5'UTR|CHRND_ENST00000536614.1_Missense_Mutation_p.S19C	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	19					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)	p.S19C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	CTCCCCAGGCAGCTGGGGGCT	0.622																																							uc002vsw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(55-57)AGC>TGC		nicotinic acetylcholine receptor delta							44.0	48.0	46.0					2																	233391241		2203	4300	6503	SO:0001583	missense	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233391241A>T	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.55A>T	2.37:g.233391241A>T	ENSP00000258385:p.Ser19Cys					CHRND_uc010zmg.1_Missense_Mutation_p.S19C|CHRND_uc010fyc.2_5'UTR|CHRND_uc010zmh.1_5'UTR	p.S19C	NM_000751	NP_000742	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	2	59	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	19					A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	37	c.55A>T	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	A	10.76	1.441113	0.25900	.	.	ENSG00000135902	ENST00000449596;ENST00000543200;ENST00000258385;ENST00000536614	T;T;T;T	0.80566	-0.6;-1.39;-1.28;-0.76	4.62	-0.497	0.12023	.	0.415327	0.28072	N	0.016717	T	0.52693	0.1750	N	0.13043	0.29	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45877	-0.9231	10	0.02654	T	1	.	3.322	0.07053	0.3396:0.0:0.4426:0.2178	.	19;19	B4DT92;Q07001	.;ACHD_HUMAN	C	19	ENSP00000404950:S19C;ENSP00000438380:S19C;ENSP00000258385:S19C;ENSP00000437740:S19C	ENSP00000258385:S19C	S	+	1	0	CHRND	233099485	0.001000	0.12720	0.997000	0.53966	0.665000	0.39181	0.328000	0.19681	-0.001000	0.14495	0.533000	0.62120	AGC		0.622	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2			10	62	0	0	0	0.013537	0	10	62				
TRIB3	57761	broad.mit.edu	37	20	368840	368840	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr20:368840G>A	ENST00000217233.3	+	2	739	c.186G>A	c.(184-186)gtG>gtA	p.V62V	TRIB3_ENST00000422053.2_Silent_p.V89V	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	62	Interaction with DDIT3/CHOP.				cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)	p.V62V(1)		breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		CAACTGCTGTGGCCACTGCCT	0.667																																					Melanoma(101;421 2374 19538)	Melanoma(101;421 2374 19538)	uc002wdm.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(184-186)GTG>GTA		tribbles 3							68.0	64.0	65.0					20																	368840		2203	4300	6503	SO:0001819	synonymous_variant	57761				apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity	g.chr20:368840G>A	AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.186G>A	20.37:g.368840G>A						TRIB3_uc002wdn.2_Silent_p.V89V	p.V62V	NM_021158	NP_066981	Q96RU7	TRIB3_HUMAN		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)	2	692	+		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)	62					Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Silent	SNP	ENST00000217233.3	37	c.186G>A	CCDS12997.1																																																																																				0.667	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077441.2	NM_021158		21	67	0	0	0	0.012319	0	21	67				
TMX4	56255	broad.mit.edu	37	20	7963092	7963092	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr20:7963092C>A	ENST00000246024.2	-	8	1071	c.856G>T	c.(856-858)Gct>Tct	p.A286S		NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	286	Glu-rich.				cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)	p.A286S(1)		endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						ACACCAGCAGCCAAGTTGtcc	0.522																																							uc002wmx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(856-858)GCT>TCT		thioredoxin-related transmembrane protein 4							170.0	134.0	146.0					20																	7963092		2203	4300	6503	SO:0001583	missense	56255				cell redox homeostasis|electron transport chain|transport	integral to membrane		g.chr20:7963092C>A		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.856G>T	20.37:g.7963092C>A	ENSP00000246024:p.Ala286Ser						p.A286S	NM_021156	NP_066979	Q9H1E5	TMX4_HUMAN			8	989	-			286			Glu-rich.		Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Missense_Mutation	SNP	ENST00000246024.2	37	c.856G>T	CCDS13101.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888622	0.33348	.	.	ENSG00000125827	ENST00000246024	T	0.09723	2.95	4.98	-0.826	0.10805	.	0.889203	0.09786	N	0.755991	T	0.09423	0.0232	M	0.63428	1.95	0.09310	N	1	B	0.20261	0.043	B	0.16722	0.016	T	0.45160	-0.9280	10	0.12430	T	0.62	-0.0136	4.2504	0.10691	0.0:0.3816:0.1729:0.4454	.	286	Q9H1E5	TMX4_HUMAN	S	286	ENSP00000246024:A286S	ENSP00000246024:A286S	A	-	1	0	TMX4	7911092	0.000000	0.05858	0.000000	0.03702	0.250000	0.25880	-0.077000	0.11394	0.004000	0.14682	0.557000	0.71058	GCT		0.522	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000077928.2	NM_021156		10	43	1	0	0.000442599	0.006214	0.000500106	10	43				
ZNF831	128611	broad.mit.edu	37	20	57768085	57768085	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr20:57768085G>C	ENST00000371030.2	+	1	2011	c.2011G>C	c.(2011-2013)Gtc>Ctc	p.V671L		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	671							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.V671L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CTCAGGCACAGTCCCCACCCA	0.622																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(2011-2013)GTC>CTC		zinc finger protein 831							37.0	47.0	44.0					20																	57768085		2086	4215	6301	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57768085G>C	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2011G>C	20.37:g.57768085G>C	ENSP00000360069:p.Val671Leu						p.V671L	NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN			1	2011	+	all_lung(29;0.0085)		671					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.2011G>C	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648743	0.29336	.	.	ENSG00000124203	ENST00000371030	T	0.04970	3.52	4.26	3.26	0.37387	.	0.769353	0.11315	N	0.576708	T	0.04907	0.0132	N	0.19112	0.55	0.09310	N	1	B	0.22003	0.063	B	0.17098	0.017	T	0.37731	-0.9693	10	0.56958	D	0.05	-3.2782	7.2246	0.26007	0.2422:0.0:0.7578:0.0	.	671	Q5JPB2	ZN831_HUMAN	L	671	ENSP00000360069:V671L	ENSP00000360069:V671L	V	+	1	0	ZNF831	57201480	0.000000	0.05858	0.003000	0.11579	0.191000	0.23601	0.255000	0.18333	0.838000	0.34948	0.313000	0.20887	GTC		0.622	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		6	11	0	0	0	0.001168	0	6	11				
ZNF831	128611	broad.mit.edu	37	20	57829482	57829482	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr20:57829482G>T	ENST00000371030.2	+	5	4718	c.4718G>T	c.(4717-4719)gGa>gTa	p.G1573V		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1573							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.G1573V(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCAGCTTCAGGACCAAGTTCA	0.493																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(4717-4719)GGA>GTA		zinc finger protein 831							61.0	60.0	60.0					20																	57829482		1916	4126	6042	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57829482G>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4718G>T	20.37:g.57829482G>T	ENSP00000360069:p.Gly1573Val						p.G1573V	NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN			5	4718	+	all_lung(29;0.0085)		1573					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.4718G>T	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758794	0.31137	.	.	ENSG00000124203	ENST00000371030	T	0.09911	2.93	5.06	1.99	0.26369	.	0.277637	0.25506	N	0.030203	T	0.08626	0.0214	L	0.47716	1.5	0.09310	N	1	B	0.21821	0.061	B	0.21708	0.036	T	0.29971	-0.9994	10	0.35671	T	0.21	-1.8993	3.8964	0.09141	0.0895:0.1617:0.5815:0.1673	.	1573	Q5JPB2	ZN831_HUMAN	V	1573	ENSP00000360069:G1573V	ENSP00000360069:G1573V	G	+	2	0	ZNF831	57262877	0.004000	0.15560	0.001000	0.08648	0.565000	0.35776	0.630000	0.24553	0.158000	0.19367	0.650000	0.86243	GGA		0.493	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		11	53	1	0	0.000673444	0.008291	0.00075743	11	53				
TAF4	6874	broad.mit.edu	37	20	60584201	60584201	+	Silent	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr20:60584201T>C	ENST00000252996.4	-	5	1790	c.1791A>G	c.(1789-1791)aaA>aaG	p.K597K	TAF4_ENST00000609045.1_5'Flank	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	597	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.K597K(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			ATAGGAAATTTTTACATTTCT	0.353																																							uc002ybs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1789-1791)AAA>AAG		TBP-associated factor 4							79.0	80.0	79.0					20																	60584201		2203	4300	6503	SO:0001819	synonymous_variant	6874				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr20:60584201T>C	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1791A>G	20.37:g.60584201T>C							p.K597K	NM_003185	NP_003176	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)		5	1791	-	Breast(26;1e-08)		597			TAFH.		A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	ENST00000252996.4	37	c.1791A>G	CCDS33500.1																																																																																				0.353	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		23	39	0	0	0	0.014323	0	23	39				
ZGPAT	84619	broad.mit.edu	37	20	62340383	62340383	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr20:62340383A>G	ENST00000328969.5	+	2	578	c.451A>G	c.(451-453)Atg>Gtg	p.M151V	ARFRP1_ENST00000324228.2_5'Flank|ARFRP1_ENST00000440854.1_5'Flank|ZGPAT_ENST00000369967.3_Missense_Mutation_p.M151V|ZGPAT_ENST00000355969.6_Missense_Mutation_p.M151V|ARFRP1_ENST00000359715.5_5'Flank|ZGPAT_ENST00000448100.2_Missense_Mutation_p.M151V|ARFRP1_ENST00000609142.1_5'Flank|ZGPAT_ENST00000357119.4_Missense_Mutation_p.M151V|ZGPAT_ENST00000478385.1_3'UTR|RP4-583P15.15_ENST00000490623.2_Silent_p.P56P|ARFRP1_ENST00000607873.1_5'Flank	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	151					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M151V(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					TCACAACGCCATGGTGGTGGG	0.607																																							uc002ygk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(451-453)ATG>GTG		zinc finger, CCCH-type with G patch domain							89.0	86.0	87.0					20																	62340383		2203	4300	6503	SO:0001583	missense	84619				negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:62340383A>G	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.451A>G	20.37:g.62340383A>G	ENSP00000332013:p.Met151Val					ARFRP1_uc002yga.2_5'Flank|ARFRP1_uc002ygc.2_5'Flank|ARFRP1_uc002ygh.3_5'Flank|ARFRP1_uc011abf.1_5'Flank|ARFRP1_uc011abg.1_5'Flank|ARFRP1_uc002yge.2_5'Flank|ARFRP1_uc002ygd.2_5'Flank|ARFRP1_uc002ygf.2_5'Flank|ARFRP1_uc002ygg.2_5'Flank|ARFRP1_uc011abh.1_5'Flank|ZGPAT_uc002ygi.2_Missense_Mutation_p.M151V|ZGPAT_uc002ygj.2_Missense_Mutation_p.M151V|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Missense_Mutation_p.M151V|ZGPAT_uc002ygm.2_Missense_Mutation_p.M151V|ZGPAT_uc002ygn.3_RNA	p.M151V	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN			2	629	+	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)		151					E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	37	c.451A>G	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.280295	0.80692	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.24723	1.86;1.86;1.84;1.86;1.86	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.41373	0.1156	L	0.47190	1.495	0.54753	D	0.999987	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.78314	0.991;0.986;0.991	T	0.16719	-1.0393	10	0.44086	T	0.13	-10.2132	11.9368	0.52878	1.0:0.0:0.0:0.0	.	151;151;151	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	V	151	ENSP00000391176:M151V;ENSP00000348242:M151V;ENSP00000349634:M151V;ENSP00000358984:M151V;ENSP00000332013:M151V	ENSP00000332013:M151V	M	+	1	0	ZGPAT	61810827	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.167000	0.89668	1.563000	0.49615	0.459000	0.35465	ATG		0.607	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484		28	74	0	0	0	0.010818	0	28	74				
TPTE	7179	broad.mit.edu	37	21	10944750	10944750	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr21:10944750C>A	ENST00000361285.4	-	11	813	c.484G>T	c.(484-486)Gat>Tat	p.D162Y	TPTE_ENST00000342420.5_Missense_Mutation_p.D124Y|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.D144Y	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	162					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.D162Y(2)|p.D144Y(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATGGCAGTATCTAAAATGTTA	0.308																																							uc002yip.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(484-486)GAT>TAT		transmembrane phosphatase with tensin homology							130.0	140.0	137.0					21																	10944750		2203	4297	6500	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10944750C>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.484G>T	21.37:g.10944750C>A	ENSP00000355208:p.Asp162Tyr					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.D144Y|TPTE_uc002yir.1_Missense_Mutation_p.D124Y|TPTE_uc010gkv.1_Missense_Mutation_p.D24Y	p.D162Y	NM_199261	NP_954870	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	11	852	-			162					B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.484G>T	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	10.44	1.351745	0.24512	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.99399	-5.83;-5.83;-5.83	2.31	1.4	0.22301	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.99312	0.9759	M	0.86343	2.81	0.51767	D	0.999937	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.98;0.98;0.988	D	0.99353	1.0915	10	0.87932	D	0	-26.8262	4.9077	0.13806	0.0:0.8169:0.0:0.1831	.	124;144;162	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	Y	144;162;124	ENSP00000298232:D144Y;ENSP00000355208:D162Y;ENSP00000344441:D124Y	ENSP00000298232:D144Y	D	-	1	0	TPTE	9966621	0.997000	0.39634	0.656000	0.29637	0.328000	0.28507	1.411000	0.34702	0.517000	0.28361	0.194000	0.17425	GAT		0.308	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			9	109	1	0	1.33987e-11	0.008291	2.04551e-11	9	109				
C21orf91	54149	broad.mit.edu	37	21	19165870	19165870	+	Silent	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr21:19165870C>T	ENST00000284881.4	-	5	846	c.756G>A	c.(754-756)gtG>gtA	p.V252V	AL109761.5_ENST00000428689.1_RNA|C21orf91_ENST00000400559.3_Silent_p.V251V|C21orf91_ENST00000400558.3_3'UTR|C21orf91-OT1_ENST00000430815.1_lincRNA	NM_001100420.1|NM_017447.3	NP_001093890.1|NP_059143.3			chromosome 21 open reading frame 91									p.V252V(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		CTTTTTCTTGCACTTGGTGAG	0.393																																							uc002yko.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(754-756)GTG>GTA		early undifferentiated retina and lens isoform							83.0	80.0	81.0					21																	19165870		1903	4127	6030	SO:0001819	synonymous_variant	54149							g.chr21:19165870C>T	AF239726	CCDS42907.1, CCDS42908.1, CCDS42909.1	21q21.1	2011-12-12	2003-07-22		ENSG00000154642	ENSG00000154642			16459	protein-coding gene	gene with protein product	"""cold sore susceptibility gene 1"", ""early undifferentiated retina and lens"""		"""chromosome 21 open reading frame 38"""	C21orf38, C21orf14		22039568	Standard	NM_001100421		Approved	YG81, EURL, CSSG1	uc002yko.4	Q9NYK6	OTTHUMG00000074509	ENST00000284881.4:c.756G>A	21.37:g.19165870C>T						C21orf91_uc002ykm.2_5'Flank|C21orf91_uc002ykn.2_5'Flank|C21orf91_uc002ykq.3_Silent_p.V251V|C21orf91_uc002ykp.3_3'UTR	p.V252V	NM_001100420	NP_001093890	Q9NYK6	EURL_HUMAN		Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)	5	847	-			252						Silent	SNP	ENST00000284881.4	37	c.756G>A	CCDS42907.1																																																																																				0.393	C21orf91-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158215.1	NM_017447		4	28	0	0	0	0.000602	0	4	28				
NCAM2	4685	broad.mit.edu	37	21	22849786	22849786	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr21:22849786A>G	ENST00000400546.1	+	15	2320	c.2071A>G	c.(2071-2073)Att>Gtt	p.I691V	NCAM2_ENST00000284894.7_Missense_Mutation_p.I549V	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	691					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I691V(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GCCCAACATTATTAAAGGTAA	0.333																																							uc002yld.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(2071-2073)ATT>GTT		neural cell adhesion molecule 2 precursor							71.0	65.0	67.0					21																	22849786		1846	4102	5948	SO:0001583	missense	4685				neuron cell-cell adhesion	integral to membrane|plasma membrane		g.chr21:22849786A>G		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2071A>G	21.37:g.22849786A>G	ENSP00000383392:p.Ile691Val					NCAM2_uc011acb.1_Missense_Mutation_p.I549V	p.I691V	NM_004540	NP_004531	O15394	NCAM2_HUMAN		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)	15	2320	+		Lung NSC(9;0.195)	691			Extracellular (Potential).		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	c.2071A>G	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	A	14.12	2.440607	0.43326	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.59772	0.24;0.33	5.8	5.8	0.92144	.	0.045182	0.85682	D	0.000000	T	0.54447	0.1859	L	0.50333	1.59	0.80722	D	1	B;B	0.15719	0.014;0.007	B;B	0.17433	0.018;0.018	T	0.52823	-0.8524	10	0.62326	D	0.03	-22.0995	14.9715	0.71238	1.0:0.0:0.0:0.0	.	549;691	B7Z5K2;O15394	.;NCAM2_HUMAN	V	691;549	ENSP00000383392:I691V;ENSP00000284894:I549V	ENSP00000284894:I549V	I	+	1	0	NCAM2	21771657	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.251000	0.89838	2.213000	0.71641	0.528000	0.53228	ATT		0.333	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540		13	55	0	0	0	0.00245	0	13	55				
KRTAP13-2	337959	broad.mit.edu	37	21	31744439	31744439	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr21:31744439G>T	ENST00000399889.2	-	1	118	c.93C>A	c.(91-93)ccC>ccA	p.P31P		NM_181621.3	NP_853652.1	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	31						intermediate filament (GO:0005882)		p.P31P(1)		endometrium(1)|kidney(1)|lung(14)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	21						CCAGATTGCTGGGGTAGGAAA	0.582																																							uc002ynz.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(91-93)CCC>CCA		keratin associated protein 13-2							115.0	104.0	108.0					21																	31744439		2203	4300	6503	SO:0001819	synonymous_variant	337959					intermediate filament		g.chr21:31744439G>T	AP001708	CCDS13589.1	21q22.1	2011-02-10			ENSG00000182816	ENSG00000182816		"""Keratin associated proteins"""	18923	protein-coding gene	gene with protein product						12359730	Standard	NM_181621		Approved	KAP13-2	uc002ynz.4	Q52LG2	OTTHUMG00000057793	ENST00000399889.2:c.93C>A	21.37:g.31744439G>T							p.P31P	NM_181621	NP_853652	Q52LG2	KR132_HUMAN			1	119	-			31						Silent	SNP	ENST00000399889.2	37	c.93C>A	CCDS13589.1																																																																																				0.582	KRTAP13-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128245.1			24	49	1	0	3.5997e-14	0.014323	5.84351e-14	24	49				
MYO18B	84700	broad.mit.edu	37	22	26194047	26194047	+	Missense_Mutation	SNP	C	C	A	rs531972047	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr22:26194047C>A	ENST00000407587.2	+	12	2673	c.2504C>A	c.(2503-2505)gCg>gAg	p.A835E	MYO18B_ENST00000536101.1_Missense_Mutation_p.A835E|MYO18B_ENST00000335473.7_Missense_Mutation_p.A835E			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	835	Myosin motor.		A -> G (in a lung squamous cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:12209013}.			cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A835E(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CACCTGGGTGCGGCGGGGGCC	0.662																																							uc003abz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(2503-2505)GCG>GAG		myosin XVIIIB							23.0	26.0	25.0					22																	26194047		1944	4123	6067	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26194047C>A	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2504C>A	22.37:g.26194047C>A	ENSP00000386096:p.Ala835Glu					MYO18B_uc003aca.1_Missense_Mutation_p.A716E|MYO18B_uc010guy.1_Missense_Mutation_p.A716E|MYO18B_uc010guz.1_Missense_Mutation_p.A716E|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Missense_Mutation_p.A348E	p.A835E	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN			12	2754	+			835		A -> G (in a lung squamous cell carcinoma sample; somatic mutation).	Myosin head-like.		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.2504C>A		.	.	.	.	.	.	.	.	.	.	c	13.26	2.183154	0.38511	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86432	-2.12;-2.12;-2.12	5.43	2.25	0.28309	Myosin head, motor domain (2);	0.124292	0.53938	D	0.000057	D	0.89287	0.6672	L	0.48642	1.525	0.34274	D	0.681327	D;D;D;D	0.89917	0.989;1.0;0.998;1.0	D;D;D;D	0.79784	0.922;0.993;0.969;0.988	D	0.89982	0.4101	10	0.62326	D	0.03	.	9.1665	0.37054	0.0:0.7606:0.0:0.2394	.	348;835;835;835	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	E	835	ENSP00000441229:A835E;ENSP00000334563:A835E;ENSP00000386096:A835E	ENSP00000334563:A835E	A	+	2	0	MYO18B	24524047	0.989000	0.36119	0.002000	0.10522	0.059000	0.15707	2.854000	0.48325	0.296000	0.22592	-0.119000	0.15052	GCG		0.662	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		8	27	1	0	9.70103e-10	0.008291	1.41449e-09	8	27				
INPP5J	27124	broad.mit.edu	37	22	31522949	31522949	+	Missense_Mutation	SNP	G	G	A	rs201909885		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr22:31522949G>A	ENST00000331075.5	+	5	1586	c.1537G>A	c.(1537-1539)Gcc>Acc	p.A513T	INPP5J_ENST00000405300.1_Missense_Mutation_p.A146T|INPP5J_ENST00000402238.1_5'Flank|INPP5J_ENST00000401755.1_5'Flank|INPP5J_ENST00000412277.2_Missense_Mutation_p.A446T|INPP5J_ENST00000400294.2_Missense_Mutation_p.A146T|INPP5J_ENST00000404453.1_5'Flank|INPP5J_ENST00000404390.3_Missense_Mutation_p.A145T	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	513	Catalytic. {ECO:0000255}.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)	p.A146T(1)|p.A513T(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						GCTGCTGTTCGCCAAGTACTA	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		16349	0.0		0.001	False		,,,				2504	0.0						uc003aju.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1537-1539)GCC>ACC		phosphatidylinositol (4,5) bisphosphate		G	THR/ALA	1,4353		0,1,2176	55.0	57.0	56.0		433	3.4	1.0	22		56	4,8512		0,4,4254	yes	missense	INPP5J	NM_001002837.1	58	0,5,6430	AA,AG,GG		0.047,0.023,0.0389	probably-damaging	145/639	31522949	5,12865	2177	4258	6435	SO:0001583	missense	27124					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding	g.chr22:31522949G>A	U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.1537G>A	22.37:g.31522949G>A	ENSP00000333262:p.Ala513Thr					INPP5J_uc010gwf.2_Missense_Mutation_p.A513T|INPP5J_uc003ajv.3_Missense_Mutation_p.A146T|INPP5J_uc003ajs.3_Missense_Mutation_p.A146T|INPP5J_uc011alk.1_Missense_Mutation_p.A446T|INPP5J_uc010gwg.2_Missense_Mutation_p.A78T|INPP5J_uc003ajw.2_5'UTR|INPP5J_uc003ajt.3_Missense_Mutation_p.A145T|INPP5J_uc003ajx.2_5'Flank|INPP5J_uc003ajy.2_5'Flank|INPP5J_uc003ajz.2_5'Flank	p.A513T	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN			5	1629	+			513			Catalytic (Potential).		B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Missense_Mutation	SNP	ENST00000331075.5	37	c.1537G>A		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	24.3	4.521493	0.85600	2.3E-4	4.7E-4	ENSG00000185133	ENST00000331075;ENST00000412277;ENST00000420017;ENST00000400294;ENST00000405300;ENST00000404390	T;T;D;T;T;T	0.95171	-1.42;-1.42;-3.63;-1.42;-1.42;-1.42	4.46	3.43	0.39272	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.129275	0.51477	D	0.000092	D	0.94361	0.8187	M	0.72479	2.2	0.48087	D	0.999583	P;B	0.51240	0.943;0.086	P;B	0.48770	0.589;0.093	D	0.93855	0.7148	10	0.62326	D	0.03	.	11.9783	0.53105	0.0:0.0:0.6499:0.3501	.	513;145	Q15735;Q15735-3	PI5PA_HUMAN;.	T	513;446;78;146;146;145	ENSP00000333262:A513T;ENSP00000392924:A446T;ENSP00000406570:A78T;ENSP00000383150:A146T;ENSP00000384596:A146T;ENSP00000384534:A145T	ENSP00000333262:A513T	A	+	1	0	INPP5J	29852949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.298000	0.43602	1.123000	0.41961	0.561000	0.74099	GCC		0.662	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000321784.1	NM_001002837		4	7	0	0	0	0.009096	0	4	7				
MEI1	150365	broad.mit.edu	37	22	42174740	42174740	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr22:42174740C>G	ENST00000401548.3	+	22	2779	c.2739C>G	c.(2737-2739)agC>agG	p.S913R	MEI1_ENST00000540880.1_Missense_Mutation_p.P238A|MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000400107.1_Intron	NM_152513.3	NP_689726.3			meiosis inhibitor 1									p.S919R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TGCTGCTGAGCCTCCTCTCCC	0.577																																							uc003baz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(2737-2739)AGC>AGG		meiosis defective 1							63.0	65.0	64.0					22																	42174740		2122	4239	6361	SO:0001583	missense	150365						binding	g.chr22:42174740C>G	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.2739C>G	22.37:g.42174740C>G	ENSP00000384115:p.Ser913Arg					WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_RNA|MEI1_uc003bbb.1_Missense_Mutation_p.S299R|MEI1_uc003bbc.1_Missense_Mutation_p.S281R|MEI1_uc010gym.1_Intron|MEI1_uc003bbd.1_Missense_Mutation_p.S156R|MEI1_uc010gyn.1_RNA|MEI1_uc003bbe.1_RNA|MEI1_uc011apf.1_5'Flank|MEI1_uc010gyo.1_5'Flank|MEI1_uc003bbf.2_5'Flank|MEI1_uc003bbg.2_5'Flank	p.S913R	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN			22	2764	+			913						Missense_Mutation	SNP	ENST00000401548.3	37	c.2739C>G	CCDS46718.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.01|12.01	1.811112|1.811112	0.32053|0.32053	.|.	.|.	ENSG00000167077|ENSG00000167077	ENST00000540880|ENST00000401548;ENST00000419798	T|T	0.54866|0.64991	0.55|-0.13	5.11|5.11	4.01|4.01	0.46588|0.46588	.|.	.|0.367766	.|0.36778	.|N	.|0.002413	T|T	0.50000|0.50000	0.1590|0.1590	L|L	0.33485|0.33485	1.01|1.01	0.80722|0.80722	D|D	1|1	.|B;P;B	.|0.36535	.|0.403;0.557;0.275	.|B;B;B	.|0.36418	.|0.224;0.224;0.224	T|T	0.55490|0.55490	-0.8133|-0.8133	7|10	0.87932|0.52906	D|T	0|0.07	-17.4786|-17.4786	11.9199|11.9199	0.52785|0.52785	0.1739:0.8261:0.0:0.0|0.1739:0.8261:0.0:0.0	.|.	.|156;281;913	.|Q5TIA1-5;Q5TIA1-2;Q5TIA1	.|.;.;MEI1_HUMAN	A|R	238|913;23	ENSP00000437436:P238A|ENSP00000384115:S913R	ENSP00000437436:P238A|ENSP00000384115:S913R	P|S	+|+	1|3	0|2	MEI1|MEI1	40504686|40504686	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	0.677000|0.677000	0.25262|0.25262	2.546000|2.546000	0.85860|0.85860	0.561000|0.561000	0.74099|0.74099	CCT|AGC		0.577	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513		3	9	0	0	0	0.004672	0	3	9				
PPARA	5465	broad.mit.edu	37	22	46615710	46615710	+	Splice_Site	SNP	G	G	A	rs571736420		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr22:46615710G>A	ENST00000396000.2	+	6	775	c.510G>A	c.(508-510)gcG>gcA	p.A170A	PPARA_ENST00000434345.2_Intron|PPARA_ENST00000402126.1_Splice_Site_p.A170A|PPARA_ENST00000407236.1_Splice_Site_p.A170A|PPARA_ENST00000262735.5_Splice_Site_p.A170A			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	170					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.A170A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	AAACCCTAGCGATTCGTTTTG	0.493													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20967	0.0		0.0	False		,,,				2504	0.0						uc003bgw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(508-510)GCG>GCA		peroxisome proliferative activated receptor,	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Simvastatin(DB00641)						69.0	64.0	65.0					22																	46615710		2203	4300	6503	SO:0001630	splice_region_variant	5465				fatty acid metabolic process|fatty acid transport|negative regulation of appetite|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fatty acid beta-oxidation|regulation of cellular ketone metabolic process by positive regulation of transcription from an RNA polymerase II promoter|regulation of glycolysis by positive regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|ligand-regulated transcription factor activity|lipid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|ubiquitin conjugating enzyme binding|zinc ion binding	g.chr22:46615710G>A	L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.509-1G>A	22.37:g.46615710G>A						PPARA_uc003bgx.1_Silent_p.A170A|PPARA_uc010hab.1_Silent_p.A170A|PPARA_uc003bha.2_Silent_p.A170A|PPARA_uc003bhb.1_Silent_p.A170A|PPARA_uc010hac.1_Intron	p.A170A	NM_005036	NP_005027	Q07869	PPARA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	7	776	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	170			Nuclear receptor.		B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Silent	SNP	ENST00000396000.2	37	c.510G>A	CCDS33669.1																																																																																				0.493	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318129.3	NM_001001928	Silent	8	53	0	0	0	0.006214	0	8	53				
MOV10L1	54456	broad.mit.edu	37	22	50572451	50572451	+	Silent	SNP	G	G	T	rs148444495		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr22:50572451G>T	ENST00000262794.5	+	14	2009	c.1926G>T	c.(1924-1926)cgG>cgT	p.R642R	MOV10L1_ENST00000540615.1_Silent_p.R622R|MOV10L1_ENST00000545383.1_Silent_p.R642R|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000395858.3_Silent_p.R642R	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	642					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.R622R(1)|p.R642R(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CAAGCAGACGGTGTCACTTTG	0.343																																							uc003bjj.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(1924-1926)CGG>CGT		MOV10-like 1 isoform 1							125.0	114.0	118.0					22																	50572451		2203	4300	6503	SO:0001819	synonymous_variant	54456				germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding	g.chr22:50572451G>T	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1926G>T	22.37:g.50572451G>T						MOV10L1_uc003bjk.3_Silent_p.R642R|MOV10L1_uc011arp.1_Silent_p.R622R|MOV10L1_uc011arq.1_Silent_p.R403R|MOV10L1_uc010hao.1_RNA	p.R642R	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)	14	2009	+		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)	642					A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	37	c.1926G>T	CCDS14084.1																																																																																				0.343	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995		9	57	1	0	7.48243e-07	0.006214	9.87518e-07	9	57				
GRIP2	80852	broad.mit.edu	37	3	14552931	14552931	+	RNA	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr3:14552931C>A	ENST00000273083.3	-	0	1841							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.V594L(1)		endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						CTGTGTGCCACGCTGCCTTTC	0.602																																							uc011avi.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2071-2073)GTG>TTG		glutamate receptor interacting protein 2							110.0	111.0	111.0					3																	14552931		2165	4267	6432			80852				synaptic transmission	cytosol|plasma membrane	protein binding	g.chr3:14552931C>A	AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14552931C>A						GRIP2_uc010heh.2_RNA|GRIP2_uc011avh.1_Missense_Mutation_p.V222L	p.V691L	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN			16	2071	-			593			PDZ 5.		Q8TEH9|Q9H7H3	Missense_Mutation	SNP	ENST00000273083.3	37	c.2071G>T																																																																																					0.602	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423		11	27	1	0	0.000151284	0.001855	0.00017668	11	27				
TTC21A	199223	broad.mit.edu	37	3	39174562	39174562	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr3:39174562G>T	ENST00000431162.2	+	20	2737	c.2603G>T	c.(2602-2604)cGg>cTg	p.R868L	TTC21A_ENST00000301819.6_Missense_Mutation_p.R869L|TTC21A_ENST00000493856.1_3'UTR|TTC21A_ENST00000440121.1_Missense_Mutation_p.R820L			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	868								p.R869L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTCCAGTCTCGGATACTGAAG	0.488																																							uc003cjc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2602-2604)CGG>CTG		tetratricopeptide repeat domain 21A isoform 2							73.0	71.0	72.0					3																	39174562		1897	4134	6031	SO:0001583	missense	199223						binding	g.chr3:39174562G>T	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.2603G>T	3.37:g.39174562G>T	ENSP00000398211:p.Arg868Leu					TTC21A_uc003cje.2_Missense_Mutation_p.R869L|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.R820L|TTC21A_uc011ayy.1_5'UTR|TTC21A_uc003cjf.2_5'UTR	p.R868L	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)	20	2780	+			868			TPR 12.		A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	c.2603G>T	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755690	0.69648	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.65549	-0.16;-0.15;-0.03	4.12	2.33	0.28932	Tetratricopeptide repeat-containing (1);	0.289558	0.24815	N	0.035364	T	0.68568	0.3015	M	0.82323	2.585	0.33701	D	0.614569	P;P;P	0.48998	0.918;0.897;0.835	P;P;B	0.49561	0.615;0.59;0.385	T	0.76721	-0.2855	10	0.44086	T	0.13	-10.2754	9.8617	0.41118	0.1764:0.0:0.8236:0.0	.	820;869;868	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	L	869;851;868;820	ENSP00000301819:R869L;ENSP00000398211:R868L;ENSP00000410882:R820L	ENSP00000301819:R869L	R	+	2	0	TTC21A	39149566	1.000000	0.71417	0.995000	0.50966	0.961000	0.63080	5.352000	0.66028	0.686000	0.31488	0.655000	0.94253	CGG		0.488	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755		8	31	1	0	0.000274275	0.004482	0.000313549	8	31				
ZBTB38	253461	broad.mit.edu	37	3	141163939	141163939	+	Silent	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr3:141163939C>T	ENST00000514251.1	+	4	2988	c.2709C>T	c.(2707-2709)ttC>ttT	p.F903F	ZBTB38_ENST00000441582.2_Silent_p.F903F|ZBTB38_ENST00000321464.5_Silent_p.F904F					zinc finger and BTB domain containing 38									p.F903F(1)		breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						GTGAAGTGTTCGATGACGCAA	0.507																																							uc003etw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(2707-2709)TTC>TTT		zinc finger and BTB domain containing 38							57.0	59.0	58.0					3																	141163939		1994	4167	6161	SO:0001819	synonymous_variant	253461				positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:141163939C>T	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.2709C>T	3.37:g.141163939C>T						ZBTB38_uc010hun.2_Silent_p.F900F|ZBTB38_uc010huo.2_Silent_p.F903F|ZBTB38_uc003ety.2_Silent_p.F903F|ZBTB38_uc010hup.2_Silent_p.F904F	p.F903F	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN			8	3691	+			903						Silent	SNP	ENST00000514251.1	37	c.2709C>T	CCDS43157.1																																																																																				0.507	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			3	16	0	0	0	0.004672	0	3	16				
WDR49	151790	broad.mit.edu	37	3	167246862	167246862	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr3:167246862C>A	ENST00000308378.3	-	10	1633	c.1328G>T	c.(1327-1329)tGg>tTg	p.W443L	WDR49_ENST00000453925.2_Missense_Mutation_p.W507L|WDR49_ENST00000479765.1_Intron|WDR49_ENST00000476376.1_Missense_Mutation_p.W268L	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	443								p.W443L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						GATTTTCAACCATCCATCAAG	0.358																																							uc003fev.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(1327-1329)TGG>TTG		WD repeat domain 49							80.0	76.0	78.0					3																	167246862		2203	4300	6503	SO:0001583	missense	151790							g.chr3:167246862C>A	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.1328G>T	3.37:g.167246862C>A	ENSP00000311343:p.Trp443Leu					WDR49_uc003feu.1_Missense_Mutation_p.W268L|WDR49_uc011bpd.1_Missense_Mutation_p.W507L|WDR49_uc003few.1_Intron	p.W443L	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN			10	1634	-			443			WD 7.		Q8N297	Missense_Mutation	SNP	ENST00000308378.3	37	c.1328G>T	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.680|3.680	-0.065721|-0.065721	0.07273|0.07273	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600;ENST00000493061|ENST00000308378;ENST00000476376;ENST00000453925	.|T;T;T	.|0.33654	.|1.68;1.4;2.36	5.52|5.52	4.62|4.62	0.57501|0.57501	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	.|1.013860	.|0.07836	.|N	.|0.962190	T|T	0.24661|0.24661	0.0598|0.0598	N|N	0.12611|0.12611	0.24|0.24	0.25806|0.25806	N|N	0.984456|0.984456	.|B;B	.|0.13594	.|0.008;0.003	.|B;B	.|0.06405	.|0.002;0.002	T|T	0.20371|0.20371	-1.0277|-1.0277	5|10	.|0.27785	.|T	.|0.31	.|.	12.4801|12.4801	0.55837|0.55837	0.0:0.9145:0.0:0.0855|0.0:0.9145:0.0:0.0855	.|.	.|507;443	.|E7EQK3;Q8IV35	.|.;WDR49_HUMAN	C|L	519;81|443;268;507	.|ENSP00000311343:W443L;ENSP00000420508:W268L;ENSP00000410863:W507L	.|ENSP00000311343:W443L	G|W	-|-	1|2	0|0	WDR49|WDR49	168729556|168729556	0.735000|0.735000	0.28153|0.28153	0.480000|0.480000	0.27341|0.27341	0.556000|0.556000	0.35491|0.35491	1.822000|1.822000	0.39052|0.39052	1.269000|1.269000	0.44280|0.44280	0.563000|0.563000	0.77884|0.77884	GGT|TGG		0.358	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824		14	32	1	0	0.000151284	0.001855	0.00017668	14	32				
SAMD7	344658	broad.mit.edu	37	3	169646344	169646344	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr3:169646344C>T	ENST00000428432.2	+	7	1408	c.1019C>T	c.(1018-1020)cCa>cTa	p.P340L	SAMD7_ENST00000335556.3_Missense_Mutation_p.P340L	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	340	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.							p.P340L(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			CGCAGCCTTCCAGGTTGTTCA	0.398																																							uc003fgd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1018-1020)CCA>CTA		sterile alpha motif domain containing 7							149.0	143.0	145.0					3																	169646344		2203	4300	6503	SO:0001583	missense	344658							g.chr3:169646344C>T	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.1019C>T	3.37:g.169646344C>T	ENSP00000391299:p.Pro340Leu					SAMD7_uc003fge.2_Missense_Mutation_p.P340L|SAMD7_uc011bpo.1_Missense_Mutation_p.P241L	p.P340L	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)		7	1286	+	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		340			SAM.			Missense_Mutation	SNP	ENST00000428432.2	37	c.1019C>T	CCDS3209.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.368623	0.61624	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.42513	0.97;0.97	5.55	5.55	0.83447	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.60508	0.2274	L	0.51853	1.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57189	-0.7854	10	0.44086	T	0.13	-16.5888	18.2791	0.90092	0.0:1.0:0.0:0.0	.	340	Q7Z3H4	SAMD7_HUMAN	L	340	ENSP00000391299:P340L;ENSP00000334668:P340L	ENSP00000334668:P340L	P	+	2	0	SAMD7	171129038	1.000000	0.71417	0.769000	0.31535	0.009000	0.06853	7.196000	0.77805	2.611000	0.88343	0.655000	0.94253	CCA		0.398	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610		45	85	0	0	0	0.01441	0	45	85				
PCDH7	5099	broad.mit.edu	37	4	30724495	30724495	+	Missense_Mutation	SNP	A	A	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:30724495A>C	ENST00000361762.2	+	1	2459	c.1451A>C	c.(1450-1452)aAg>aCg	p.K484T	PCDH7_ENST00000543491.1_Missense_Mutation_p.K484T	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	484	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K484T(1)|p.K437T(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AACAAGAAAAAGTACTTCTTG	0.632																																							uc003gsk.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						c.(1450-1452)AAG>ACG		protocadherin 7 isoform a precursor							96.0	72.0	80.0					4																	30724495		2203	4300	6503	SO:0001583	missense	5099				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chr4:30724495A>C	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1451A>C	4.37:g.30724495A>C	ENSP00000355243:p.Lys484Thr					PCDH7_uc011bxw.1_Missense_Mutation_p.K437T|PCDH7_uc011bxx.1_Missense_Mutation_p.K484T	p.K484T	NM_002589	NP_002580	O60245	PCDH7_HUMAN			1	2459	+			484			Extracellular (Potential).|Cadherin 4.		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	c.1451A>C	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.46|17.46	3.396293|3.396293	0.62177|0.62177	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	T|T;T	0.19394|0.15017	2.15|2.46;2.46	5.16|5.16	5.16|5.16	0.70880|0.70880	.|Cadherin (4);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.25344|0.25344	0.0616|0.0616	N|N	0.12422|0.12422	0.21|0.21	0.54753|0.54753	D|D	0.999981|0.999981	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	T|T	0.20505|0.20505	-1.0273|-1.0273	7|9	0.02654|0.87932	T|D	1|0	.|.	15.1585|15.1585	0.72761|0.72761	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|484;437;484	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	N|T	173|484;484;437	ENSP00000427066:K173N|ENSP00000355243:K484T;ENSP00000441802:K484T	ENSP00000427066:K173N|ENSP00000330302:K437T	K|K	+|+	3|2	2|0	PCDH7|PCDH7	30333593|30333593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.848000|0.848000	0.48234|0.48234	9.139000|9.139000	0.94554|0.94554	2.164000|2.164000	0.68074|0.68074	0.533000|0.533000	0.62120|0.62120	AAA|AAG		0.632	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		3	9	0	0	0	0.009096	0	3	9				
SRD5A3	79644	broad.mit.edu	37	4	56212671	56212671	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:56212671G>A	ENST00000264228.4	+	1	396	c.168G>A	c.(166-168)aaG>aaA	p.K56K		NM_024592.4	NP_078868.1	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	56					androgen biosynthetic process (GO:0006702)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|polyprenol catabolic process (GO:0016095)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)	p.K56K(1)		cervix(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)		Spironolactone(DB00421)	GGAAAACCAAGTGTGGGGAGC	0.697																																							uc003hau.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(166-168)AAG>AAA		steroid 5 alpha-reductase 3							11.0	14.0	13.0					4																	56212671		2174	4246	6420	SO:0001819	synonymous_variant	79644				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor	g.chr4:56212671G>A	AK023414	CCDS3498.1	4q12	2009-07-21			ENSG00000128039	ENSG00000128039			25812	protein-coding gene	gene with protein product		611715				17986282	Standard	NM_024592		Approved	FLJ13352, SRD5A2L, SRD5A2L1	uc003hau.3	Q9H8P0	OTTHUMG00000128733	ENST00000264228.4:c.168G>A	4.37:g.56212671G>A							p.K56K	NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	Epithelial(7;0.0179)		1	263	+	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		56			Lumenal (Potential).		Q4W5Q6	Silent	SNP	ENST00000264228.4	37	c.168G>A	CCDS3498.1																																																																																				0.697	SRD5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250644.2	NM_024592		3	8	0	0	0	0.004672	0	3	8				
CCDC158	339965	broad.mit.edu	37	4	77288728	77288728	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:77288728C>A	ENST00000388914.3	-	11	1701	c.1549G>T	c.(1549-1551)Gca>Tca	p.A517S		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	517								p.A517S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						GTGATCTCTGCATTGGTAGCC	0.483																																							uc003hkb.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|pancreas(1)	6						c.(1549-1551)GCA>TCA		coiled-coil domain containing 158							101.0	94.0	96.0					4																	77288728		1887	4114	6001	SO:0001583	missense	339965							g.chr4:77288728C>A	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1549G>T	4.37:g.77288728C>A	ENSP00000373566:p.Ala517Ser						p.A517S	NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN			11	1702	-			517			Potential.		Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	c.1549G>T	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.355509	0.24598	.	.	ENSG00000163749	ENST00000388914	T	0.77358	-1.09	5.95	4.2	0.49525	.	0.109175	0.40818	N	0.001005	T	0.58949	0.2158	N	0.19112	0.55	0.19775	N	0.999956	B	0.02656	0.0	B	0.06405	0.002	T	0.36261	-0.9755	10	0.07644	T	0.81	.	10.2858	0.43566	0.2853:0.5877:0.127:0.0	.	517	Q5M9N0	CD158_HUMAN	S	517	ENSP00000373566:A517S	ENSP00000373566:A517S	A	-	1	0	CCDC158	77507752	0.000000	0.05858	0.599000	0.28851	0.855000	0.48748	-0.111000	0.10807	0.820000	0.34516	0.563000	0.77884	GCA		0.483	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784		10	49	1	0	0.000442599	0.006214	0.000500106	10	49				
PKD2	5311	broad.mit.edu	37	4	88959554	88959554	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:88959554C>G	ENST00000237596.2	+	4	1061	c.995C>G	c.(994-996)tCt>tGt	p.S332C		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.S332C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GGATCCTGCTCTATCCCCCAG	0.488																																							uc003hre.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(994-996)TCT>TGT		polycystin 2							80.0	79.0	79.0					4																	88959554		2203	4300	6503	SO:0001583	missense	5311					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity	g.chr4:88959554C>G	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.995C>G	4.37:g.88959554C>G	ENSP00000237596:p.Ser332Cys						p.S332C	NM_000297	NP_000288	Q13563	PKD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)	4	1061	+		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)	332			Extracellular (Potential).		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000237596.2	37	c.995C>G	CCDS3627.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045405	0.75846	.	.	ENSG00000118762	ENST00000237596	T	0.70631	-0.5	5.62	5.62	0.85841	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	T	0.69205	0.3085	M	0.61703	1.905	0.80722	D	1	B	0.15719	0.014	B	0.22152	0.038	T	0.66728	-0.5850	10	0.56958	D	0.05	-15.8444	13.8867	0.63712	0.0:0.9274:0.0:0.0726	.	332	Q13563	PKD2_HUMAN	C	332	ENSP00000237596:S332C	ENSP00000237596:S332C	S	+	2	0	PKD2	89178578	0.941000	0.31946	0.975000	0.42487	0.783000	0.44284	3.149000	0.50655	2.648000	0.89879	0.561000	0.74099	TCT		0.488	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253042.4	NM_000297		18	27	0	0	0	0.007413	0	18	27				
SCLT1	132320	broad.mit.edu	37	4	129867262	129867262	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:129867262C>A	ENST00000281142.5	-	16	1842	c.1339G>T	c.(1339-1341)Gaa>Taa	p.E447*	SCLT1_ENST00000434680.1_Intron|SCLT1_ENST00000503215.1_Intron|SCLT1_ENST00000502495.1_5'UTR|SCLT1_ENST00000439369.2_Intron	NM_144643.2	NP_653244.2	Q96NL6	SCLT1_HUMAN	sodium channel and clathrin linker 1	447					cilium assembly (GO:0042384)|clustering of voltage-gated sodium channels (GO:0045162)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|clathrin complex (GO:0071439)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)	sodium channel regulator activity (GO:0017080)	p.E447*(2)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	29						TGCATTTCTTCCAGTTTTCTG	0.348																																							uc003igp.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|lung(1)|central_nervous_system(1)	5						c.(1339-1341)GAA>TAA		sodium channel associated protein 1							108.0	100.0	103.0					4																	129867262		2202	4298	6500	SO:0001587	stop_gained	132320					centrosome		g.chr4:129867262C>A	AK055217	CCDS3740.1	4q28.2	2008-05-02			ENSG00000151466	ENSG00000151466			26406	protein-coding gene	gene with protein product		611399				15797711	Standard	XM_005262732		Approved	hCAP-1A, FLJ30655	uc003igp.2	Q96NL6	OTTHUMG00000133346	ENST00000281142.5:c.1339G>T	4.37:g.129867262C>A	ENSP00000281142:p.Glu447*					SCLT1_uc003ign.2_Nonsense_Mutation_p.E111*|SCLT1_uc003igo.2_Nonsense_Mutation_p.E57*|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	p.E447*	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN			16	1845	-			447			Potential.		A4QN04|Q0VAH2|Q6P2M4	Nonsense_Mutation	SNP	ENST00000281142.5	37	c.1339G>T	CCDS3740.1	.	.	.	.	.	.	.	.	.	.	C	42	9.795293	0.99266	.	.	ENSG00000151466	ENST00000281142	.	.	.	4.39	3.54	0.40534	.	0.054546	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.2933	11.2475	0.49006	0.0:0.9079:0.0:0.0921	.	.	.	.	X	447	.	.	E	-	1	0	SCLT1	130086712	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	6.056000	0.71111	0.953000	0.37825	0.555000	0.69702	GAA		0.348	SCLT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257176.2	NM_144643		15	21	1	0	1.05317e-09	0.00245	1.53103e-09	15	21				
RBM46	166863	broad.mit.edu	37	4	155720237	155720237	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:155720237C>T	ENST00000281722.3	+	4	1158	c.923C>T	c.(922-924)cCa>cTa	p.P308L	RBM46_ENST00000514866.1_Missense_Mutation_p.P308L|RBM46_ENST00000510397.1_Missense_Mutation_p.P308L	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	308	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.P308L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				CTAGCTAAACCAGTAAATAAA	0.383																																							uc003ioo.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(922-924)CCA>CTA		RNA binding motif protein 46							80.0	78.0	79.0					4																	155720237		2203	4300	6503	SO:0001583	missense	166863						nucleotide binding|RNA binding	g.chr4:155720237C>T	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.923C>T	4.37:g.155720237C>T	ENSP00000281722:p.Pro308Leu					RBM46_uc011cim.1_Missense_Mutation_p.P308L|RBM46_uc003iop.1_Missense_Mutation_p.P308L	p.P308L	NM_144979	NP_659416	Q8TBY0	RBM46_HUMAN			4	1096	+	all_hematologic(180;0.24)	Renal(120;0.0854)	308			RRM 3.		B3KWU8|B4DZ27	Missense_Mutation	SNP	ENST00000281722.3	37	c.923C>T	CCDS3790.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.007286	0.75046	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397	T;T;T	0.76968	-1.06;-1.06;-1.06	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	D	0.92215	0.7531	H	0.94462	3.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.93022	0.6441	10	0.87932	D	0	-9.214	20.8794	0.99867	0.0:1.0:0.0:0.0	.	308;308;308	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	L	308	ENSP00000424500:P308L;ENSP00000281722:P308L;ENSP00000422813:P308L	ENSP00000281722:P308L	P	+	2	0	RBM46	155939687	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.325000	0.79124	2.941000	0.99782	0.655000	0.94253	CCA		0.383	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979		12	26	0	0	0	0.010729	0	12	26				
NEK1	4750	broad.mit.edu	37	4	170384541	170384541	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:170384541T>A	ENST00000439128.2	-	25	2996	c.2356A>T	c.(2356-2358)Aca>Tca	p.T786S	NEK1_ENST00000512193.1_Missense_Mutation_p.T717S|NEK1_ENST00000507142.1_Missense_Mutation_p.T814S|NEK1_ENST00000511633.1_Missense_Mutation_p.T770S|NEK1_ENST00000510533.1_Missense_Mutation_p.T742S	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	786					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.T814S(2)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TCTCCCACTGTATGTCCTATA	0.353																																							uc003isb.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(2)|large_intestine(1)	6						c.(2356-2358)ACA>TCA		NIMA-related kinase 1							62.0	59.0	60.0					4																	170384541		1792	4067	5859	SO:0001583	missense	4750				cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr4:170384541T>A	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.2356A>T	4.37:g.170384541T>A	ENSP00000408020:p.Thr786Ser					NEK1_uc003isc.1_Missense_Mutation_p.T742S|NEK1_uc003isd.1_Missense_Mutation_p.T814S|NEK1_uc003ise.1_Missense_Mutation_p.T770S|NEK1_uc003isf.1_Missense_Mutation_p.T717S	p.T786S	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)	25	2848	-		Prostate(90;0.00601)|Renal(120;0.0183)	786					G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	c.2356A>T	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	T	12.34	1.909716	0.33721	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.78126	-1.14;-1.08;-1.15;-1.12;-1.13	4.53	4.53	0.55603	.	0.112187	0.39407	N	0.001361	D	0.84188	0.5417	M	0.64997	1.995	0.20403	N	0.9999	D;D;D;D;D	0.58620	0.97;0.983;0.983;0.983;0.971	D;P;D;P;P	0.62955	0.909;0.879;0.909;0.879;0.813	T	0.76889	-0.2792	10	0.49607	T	0.09	.	13.5192	0.61557	0.0:0.0:0.0:1.0	.	717;770;814;742;786	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	S	786;770;742;814;717	ENSP00000408020:T786S;ENSP00000423332:T770S;ENSP00000427653:T742S;ENSP00000424757:T814S;ENSP00000424938:T717S	ENSP00000408020:T786S	T	-	1	0	NEK1	170621116	1.000000	0.71417	0.026000	0.17262	0.002000	0.02628	5.212000	0.65225	1.665000	0.50811	0.528000	0.53228	ACA		0.353	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3			28	30	0	0	0	0.009535	0	28	30				
SLC6A19	340024	broad.mit.edu	37	5	1201769	1201769	+	Missense_Mutation	SNP	G	G	T	rs367576369	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:1201769G>T	ENST00000304460.10	+	1	60	c.4G>T	c.(4-6)Gtg>Ttg	p.V2L		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	2					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.V2L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GACCACCATGGTGAGGCTCGT	0.682													G|||	4	0.000798722	0.003	0.0	5008	,	,		13288	0.0		0.0	False		,,,				2504	0.0						uc003jbw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4-6)GTG>TTG		solute carrier family 6, member 19		G	LEU/VAL	3,4379		0,3,2188	18.0	20.0	20.0		4	4.0	1.0	5		20	0,8568		0,0,4284	no	missense	SLC6A19	NM_001003841.2	32	0,3,6472	TT,TG,GG		0.0,0.0685,0.0232	benign	2/635	1201769	3,12947	2191	4284	6475	SO:0001583	missense	340024				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr5:1201769G>T	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.4G>T	5.37:g.1201769G>T	ENSP00000305302:p.Val2Leu						p.V2L	NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		1	60	+	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		2			Cytoplasmic (Potential).		A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	c.4G>T	CCDS34130.1	.	.	.	.	.	.	.	.	.	.	G	7.832	0.720031	0.15372	6.85E-4	0.0	ENSG00000174358	ENST00000304460	T	0.73363	-0.74	3.95	3.95	0.45737	.	0.446106	0.21955	N	0.066664	T	0.59059	0.2166	N	0.24115	0.695	0.28272	N	0.924377	B	0.09022	0.002	B	0.09377	0.004	T	0.49495	-0.8934	10	0.25106	T	0.35	.	12.274	0.54724	0.0:0.0:0.8297:0.1703	.	2	Q695T7	S6A19_HUMAN	L	2	ENSP00000305302:V2L	ENSP00000305302:V2L	V	+	1	0	SLC6A19	1254769	1.000000	0.71417	0.995000	0.50966	0.719000	0.41307	3.671000	0.54576	2.024000	0.59613	0.555000	0.69702	GTG		0.682	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120		3	13	1	0	2.56e-06	0.009096	3.28084e-06	3	13				
TRIO	7204	broad.mit.edu	37	5	14507306	14507306	+	Silent	SNP	G	G	T	rs376350332		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:14507306G>T	ENST00000344204.4	+	56	8712	c.8688G>T	c.(8686-8688)ctG>ctT	p.L2896L	TRIO_ENST00000344135.5_Silent_p.L395L|TRIO_ENST00000537187.1_Silent_p.L2720L	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2896	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L2896L(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GGGCGCACCTGGGGGAGGTTC	0.632																																							uc003jff.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(8686-8688)CTG>CTT		triple functional domain (PTPRF interacting)							73.0	64.0	67.0					5																	14507306		2203	4300	6503	SO:0001819	synonymous_variant	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14507306G>T	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8688G>T	5.37:g.14507306G>T						TRIO_uc003jfg.2_RNA	p.L2896L	NM_007118	NP_009049	O75962	TRIO_HUMAN			56	8694	+	Lung NSC(4;0.000742)		2896			Protein kinase.		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	c.8688G>T	CCDS3883.1																																																																																				0.632	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		10	23	1	0	2.80697e-09	0.010729	3.96231e-09	10	23				
DAB2	1601	broad.mit.edu	37	5	39390615	39390615	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:39390615G>A	ENST00000320816.6	-	5	860	c.393C>T	c.(391-393)aaC>aaT	p.N131N	DAB2_ENST00000509337.1_Silent_p.N131N|DAB2_ENST00000339788.6_Silent_p.N131N|DAB2_ENST00000545653.1_Silent_p.N131N|DAB2_ENST00000512525.1_5'UTR	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	131	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)	p.N131N(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CAAATGCCCGGTTGTCTGTCA	0.408																																							uc003jlx.2		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(2)|skin(1)	3						c.(391-393)AAC>AAT		disabled homolog 2							89.0	91.0	91.0					5																	39390615		2203	4300	6503	SO:0001819	synonymous_variant	1601				cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding	g.chr5:39390615G>A	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.393C>T	5.37:g.39390615G>A						DAB2_uc003jlw.2_Silent_p.N131N	p.N131N	NM_001343	NP_001334	P98082	DAB2_HUMAN	Epithelial(62;0.137)		5	924	-	all_lung(31;0.000197)		131			PID.		A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	37	c.393C>T	CCDS34149.1																																																																																				0.408	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343		23	60	0	0	0	0.00333	0	23	60				
GHR	2690	broad.mit.edu	37	5	42718832	42718832	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:42718832C>T	ENST00000230882.4	+	10	1413	c.1223C>T	c.(1222-1224)aCc>aTc	p.T408I	GHR_ENST00000357703.3_Missense_Mutation_p.T386I|GHR_ENST00000537449.1_Missense_Mutation_p.T221I|GHR_ENST00000513625.1_3'UTR	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	408					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.T408I(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CATGAGGGTACCTCAGAGGTT	0.468																																							uc003jmt.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|kidney(1)|skin(1)	6						c.(1222-1224)ACC>ATC		growth hormone receptor precursor	Pegvisomant(DB00082)|Somatropin recombinant(DB00052)						107.0	89.0	95.0					5																	42718832		2203	4300	6503	SO:0001583	missense	2690				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding	g.chr5:42718832C>T		CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1223C>T	5.37:g.42718832C>T	ENSP00000230882:p.Thr408Ile					GHR_uc011cpq.1_Missense_Mutation_p.T221I	p.T408I	NM_000163	NP_000154	P10912	GHR_HUMAN			10	1266	+		Myeloproliferative disorder(839;0.00878)	408			Cytoplasmic (Potential).		Q9HCX2	Missense_Mutation	SNP	ENST00000230882.4	37	c.1223C>T	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.802642	0.31869	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000537449	D;D;T	0.85088	-1.94;-1.76;-0.76	6.02	4.23	0.50019	.	0.422305	0.28268	N	0.015971	D	0.86251	0.5888	M	0.72118	2.19	0.42406	D	0.992581	B	0.22983	0.078	B	0.39419	0.299	T	0.82454	-0.0449	10	0.46703	T	0.11	-4.0952	8.9487	0.35776	0.123:0.7469:0.0:0.1301	.	408	P10912	GHR_HUMAN	I	408;386;221	ENSP00000230882:T408I;ENSP00000350335:T386I;ENSP00000442206:T221I	ENSP00000230882:T408I	T	+	2	0	GHR	42754589	0.999000	0.42202	1.000000	0.80357	0.770000	0.43624	1.083000	0.30815	0.863000	0.35553	0.591000	0.81541	ACC		0.468	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163		10	64	0	0	0	0.013537	0	10	64				
HMGCR	3156	broad.mit.edu	37	5	74652176	74652176	+	Missense_Mutation	SNP	G	G	T	rs375866343		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:74652176G>T	ENST00000287936.4	+	15	2045	c.1889G>T	c.(1888-1890)cGt>cTt	p.R630L	HMGCR_ENST00000511206.1_Missense_Mutation_p.R630L|HMGCR_ENST00000343975.5_Missense_Mutation_p.R577L	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	630	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)	p.R630L(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	AGATTTGCACGTCTACAGAAA	0.353																																							uc003kdp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1888-1890)CGT>CTT		3-hydroxy-3-methylglutaryl-Coenzyme A reductase	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Cerivastatin(DB00439)|Fluvastatin(DB01095)|Lovastatin(DB00227)|NADH(DB00157)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)						82.0	84.0	83.0					5																	74652176		2203	4300	6503	SO:0001583	missense	3156				cholesterol biosynthetic process|coenzyme A metabolic process|germ cell migration|gonad development|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal membrane	hydroxymethylglutaryl-CoA reductase (NADPH) activity|NADP binding	g.chr5:74652176G>T		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.1889G>T	5.37:g.74652176G>T	ENSP00000287936:p.Arg630Leu					HMGCR_uc011cst.1_Missense_Mutation_p.R650L|HMGCR_uc003kdq.2_Missense_Mutation_p.R577L|HMGCR_uc010izo.2_5'Flank|HMGCR_uc010izp.2_5'Flank	p.R630L	NM_000859	NP_000850	P04035	HMDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	15	2045	+		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)	630			Catalytic.		B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	37	c.1889G>T	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.045494	0.93685	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	T;T;T	0.51071	0.72;0.72;0.72	5.86	5.0	0.66597	Hydroxymethylglutaryl-CoA reductase, class I/II, NAD/NADP-binding (2);Hydroxymethylglutaryl-CoA reductase, class I/II, substrate-binding (1);	0.000000	0.85682	D	0.000000	T	0.77519	0.4142	H	0.95816	3.725	0.80722	D	1	D;D;D	0.89917	0.977;1.0;0.998	D;D;D	0.79784	0.938;0.993;0.966	D	0.84940	0.0865	10	0.87932	D	0	-15.3043	14.8187	0.70055	0.0687:0.0:0.9313:0.0	.	630;577;630	B2R649;P04035-2;P04035	.;.;HMDH_HUMAN	L	630;561;630;577	ENSP00000426745:R630L;ENSP00000287936:R630L;ENSP00000340816:R577L	ENSP00000287936:R630L	R	+	2	0	HMGCR	74687932	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.828000	0.99408	1.507000	0.48752	0.650000	0.86243	CGT		0.353	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2			19	46	1	0	1.01871e-10	0.008871	1.5265e-10	19	46				
YTHDC2	64848	broad.mit.edu	37	5	112927872	112927872	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:112927872G>T	ENST00000161863.4	+	28	4422	c.4209G>T	c.(4207-4209)ggG>ggT	p.G1403G		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	1403	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)	p.G1403G(1)		NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GCAGGGATGGGCAGGTATACA	0.353																																							uc003kqn.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(4207-4209)GGG>GGT		YTH domain containing 2							71.0	70.0	71.0					5																	112927872		2202	4300	6502	SO:0001819	synonymous_variant	64848						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr5:112927872G>T	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.4209G>T	5.37:g.112927872G>T							p.G1403G	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)	28	4392	+		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)	1403			YTH.		B2RP66	Silent	SNP	ENST00000161863.4	37	c.4209G>T	CCDS4113.1																																																																																				0.353	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828		13	11	1	0	2.23348e-06	0.004007	2.87753e-06	13	11				
FBN2	2201	broad.mit.edu	37	5	127641204	127641204	+	Splice_Site	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:127641204T>C	ENST00000508053.1	-	50	6647	c.5673A>G	c.(5671-5673)gtA>gtG	p.V1891V	FBN2_ENST00000262464.4_Splice_Site_p.V1891V			P35556	FBN2_HUMAN	fibrillin 2	1891	EGF-like 30; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.V1891V(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTTTCTTACCTACACAGGCCC	0.428																																							uc003kuu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(5671-5673)GTA>GTG		fibrillin 2 precursor							70.0	71.0	71.0					5																	127641204		2203	4300	6503	SO:0001630	splice_region_variant	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127641204T>C	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5674+1A>G	5.37:g.127641204T>C							p.V1891V	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	44	6112	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1891			EGF-like 30; calcium-binding.		B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	c.5673A>G	CCDS34222.1																																																																																				0.428	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	Silent	16	27	0	0	0	0.004007	0	16	27				
PCDHA2	56146	broad.mit.edu	37	5	140175015	140175015	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:140175015G>T	ENST00000526136.1	+	1	466	c.466G>T	c.(466-468)Gga>Tga	p.G156*	PCDHA2_ENST00000520672.2_Nonsense_Mutation_p.G156*|PCDHA2_ENST00000378132.1_Nonsense_Mutation_p.G156*|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	156					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G156*(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTCTAGAGGGAGCATCTGA	0.438																																							uc003lhd.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)	4						c.(466-468)GGA>TGA		protocadherin alpha 2 isoform 1 precursor							86.0	90.0	88.0					5																	140175015		2203	4300	6503	SO:0001587	stop_gained	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140175015G>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.466G>T	5.37:g.140175015G>T	ENSP00000431748:p.Gly156*					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Nonsense_Mutation_p.G156*|PCDHA2_uc011czy.1_Nonsense_Mutation_p.G156*	p.G156*	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	572	+			156			Extracellular (Potential).		O75287|Q9BTV3	Nonsense_Mutation	SNP	ENST00000526136.1	37	c.466G>T	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	g	27.6	4.849157	0.91277	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	.	.	.	3.81	3.81	0.43845	.	0.000000	0.37304	U	0.002145	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	9.9155	0.41432	0.1551:0.0:0.8449:0.0	.	.	.	.	X	156	.	ENSP00000367372:G156X	G	+	1	0	PCDHA2	140155199	0.624000	0.27102	1.000000	0.80357	0.996000	0.88848	0.398000	0.20899	2.124000	0.65301	0.644000	0.83932	GGA		0.438	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		29	33	1	0	4.59853e-10	0.005443	6.76581e-10	29	33				
PCDHB2	56133	broad.mit.edu	37	5	140474663	140474663	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:140474663C>A	ENST00000194155.4	+	1	437	c.289C>A	c.(289-291)Ctg>Atg	p.L97M		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L97M(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGGGAGGAGCTGTGCGGCCC	0.502																																							uc003lil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(289-291)CTG>ATG		protocadherin beta 2 precursor							63.0	69.0	67.0					5																	140474663		2203	4300	6503	SO:0001583	missense	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140474663C>A	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.289C>A	5.37:g.140474663C>A	ENSP00000194155:p.Leu97Met					PCDHB2_uc003lim.1_Intron	p.L97M	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	427	+			97			Extracellular (Potential).|Cadherin 1.		Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	c.289C>A	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481706	0.44147	.	.	ENSG00000112852	ENST00000194155	T	0.42900	0.96	5.22	1.38	0.22167	Cadherin, N-terminal (1);Cadherin (2);	.	.	.	.	T	0.64136	0.2571	M	0.92738	3.34	0.27685	N	0.946313	P	0.51351	0.944	P	0.60345	0.873	T	0.55237	-0.8172	9	0.62326	D	0.03	.	6.0073	0.19553	0.1239:0.5205:0.0:0.3556	.	97	Q9Y5E7	PCDB2_HUMAN	M	97	ENSP00000194155:L97M	ENSP00000194155:L97M	L	+	1	2	PCDHB2	140454847	0.000000	0.05858	0.982000	0.44146	0.984000	0.73092	-0.216000	0.09266	0.301000	0.22738	-0.140000	0.14226	CTG		0.502	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		14	27	1	0	4.14922e-12	0.004007	6.41482e-12	14	27				
PCDHB12	56124	broad.mit.edu	37	5	140589646	140589646	+	Silent	SNP	C	C	T	rs267600438		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:140589646C>T	ENST00000239450.2	+	1	1356	c.1167C>T	c.(1165-1167)atC>atT	p.I389I	PCDHB12_ENST00000541609.1_Silent_p.I52I	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	389	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.I389I(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAGGACATCCCATTCGTGC	0.473																																							uc003liz.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(1165-1167)ATC>ATT		protocadherin beta 12 precursor							68.0	67.0	67.0					5																	140589646		2203	4300	6503	SO:0001819	synonymous_variant	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589646C>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1167C>T	5.37:g.140589646C>T						PCDHB12_uc011dak.1_Silent_p.I52I	p.I389I	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1356	+			389			Extracellular (Potential).|Cadherin 4.		B4DDU1	Silent	SNP	ENST00000239450.2	37	c.1167C>T	CCDS4254.1																																																																																				0.473	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		6	20	0	0	0	0.001168	0	6	20				
PCDHB12	56124	broad.mit.edu	37	5	140589974	140589974	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:140589974C>T	ENST00000239450.2	+	1	1684	c.1495C>T	c.(1495-1497)Ccc>Tcc	p.P499S	PCDHB12_ENST00000541609.1_Missense_Mutation_p.P162S	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	499	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P499S(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCGCACCTGCCCCTCGCCTC	0.677																																							uc003liz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1495-1497)CCC>TCC		protocadherin beta 12 precursor							83.0	84.0	84.0					5																	140589974		2203	4300	6503	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589974C>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1495C>T	5.37:g.140589974C>T	ENSP00000239450:p.Pro499Ser					PCDHB12_uc011dak.1_Missense_Mutation_p.P162S	p.P499S	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1684	+			499			Extracellular (Potential).|Cadherin 5.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.1495C>T	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	C	9.286	1.049380	0.19827	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.55760	0.5;0.66	3.53	-0.034	0.13898	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35128	0.0921	L	0.37507	1.11	0.09310	N	1	B	0.32382	0.368	B	0.29267	0.1	T	0.22277	-1.0221	9	0.49607	T	0.09	.	3.2791	0.06908	0.1283:0.2054:0.4933:0.173	.	499	Q9Y5F1	PCDBC_HUMAN	S	162;499;119	ENSP00000440199:P162S;ENSP00000239450:P499S	ENSP00000239450:P499S	P	+	1	0	PCDHB12	140570158	0.000000	0.05858	0.004000	0.12327	0.936000	0.57629	0.137000	0.15995	-0.012000	0.14223	0.485000	0.47835	CCC		0.677	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		14	34	0	0	0	0.00499	0	14	34				
PCDHGA6	56109	broad.mit.edu	37	5	140753949	140753949	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:140753949C>T	ENST00000517434.1	+	1	299	c.299C>T	c.(298-300)cCg>cTg	p.P100L	PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P100Q(1)|p.P100L(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCAGAGCCCGCGGTGTCTG	0.512																																							uc003ljy.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(298-300)CCG>CTG		protocadherin gamma subfamily A, 6 isoform 1							49.0	56.0	54.0					5																	140753949		2165	4287	6452	SO:0001583	missense	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140753949C>T	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.299C>T	5.37:g.140753949C>T	ENSP00000429601:p.Pro100Leu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.P100L	p.P100L	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	299	+			100			Cadherin 1.|Extracellular (Potential).		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	c.299C>T	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	8.025	0.760557	0.15914	.	.	ENSG00000253731	ENST00000517434	T	0.27256	1.68	5.23	0.385	0.16249	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.735356	0.10219	U	0.701092	T	0.20740	0.0499	L	0.53561	1.675	0.09310	N	1	B;B	0.18166	0.005;0.026	B;B	0.13407	0.005;0.009	T	0.30475	-0.9977	10	0.26408	T	0.33	.	5.3148	0.15850	0.4511:0.3538:0.0:0.1951	.	100;100	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	L	100	ENSP00000429601:P100L	ENSP00000429601:P100L	P	+	2	0	PCDHGA6	140734133	0.000000	0.05858	0.000000	0.03702	0.687000	0.40016	-1.249000	0.02888	-0.048000	0.13401	0.655000	0.94253	CCG		0.512	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		14	46	0	0	0	0.001855	0	14	46				
C5orf58	133874	broad.mit.edu	37	5	169673105	169673105	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:169673105T>A	ENST00000521850.1	+	3	1986	c.297T>A	c.(295-297)agT>agA	p.S99R	C5orf58_ENST00000517575.1_Intron|C5orf58_ENST00000593851.1_Missense_Mutation_p.S99R			C9J3I9	CE058_HUMAN	chromosome 5 open reading frame 58	99								p.S99R(1)		large_intestine(1)|lung(4)|urinary_tract(1)	6						TTTCTAACAGTTTTTCTATCT	0.299																																							uc010jjn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(295-297)AGT>AGA		hypothetical protein LOC133874							98.0	97.0	97.0					5																	169673105		1792	4071	5863	SO:0001583	missense	133874							g.chr5:169673105T>A	BC030767	CCDS47338.1	5q35.1	2009-09-30			ENSG00000234511	ENSG00000234511			37272	protein-coding gene	gene with protein product							Standard	NM_001102609		Approved		uc010jjn.3	C9J3I9	OTTHUMG00000163122	ENST00000521850.1:c.297T>A	5.37:g.169673105T>A	ENSP00000428956:p.Ser99Arg					C5orf58_uc003mal.2_Intron	p.S99R	NM_001102609	NP_001096079	C9J3I9	CE058_HUMAN			4	380	+			99						Missense_Mutation	SNP	ENST00000521850.1	37	c.297T>A	CCDS47338.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.113390	0.37339	.	.	ENSG00000234511	ENST00000521850	.	.	.	5.1	-2.2	0.06994	.	.	.	.	.	T	0.22437	0.0541	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.20840	-1.0263	8	0.87932	D	0	.	2.6313	0.04945	0.4992:0.0752:0.1286:0.297	.	99	C9J3I9	CE058_HUMAN	R	99	.	ENSP00000428956:S99R	S	+	3	2	C5orf58	169605683	0.003000	0.15002	0.001000	0.08648	0.688000	0.40055	-0.175000	0.09825	-0.518000	0.06452	-0.258000	0.10820	AGT		0.299	C5orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371739.1	NM_001102609		6	27	0	0	0	0.001984	0	6	27				
LCP2	3937	broad.mit.edu	37	5	169680125	169680125	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:169680125C>G	ENST00000046794.5	-	18	1858	c.1243G>C	c.(1243-1245)Gag>Cag	p.E415Q	LCP2_ENST00000521416.1_Missense_Mutation_p.E210Q	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	415					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)		p.E415Q(2)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TCTCTTACCTCTTCCTCCGCG	0.463																																							uc003man.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1243-1245)GAG>CAG		lymphocyte cytosolic protein 2							34.0	33.0	34.0					5																	169680125		1824	4079	5903	SO:0001583	missense	3937				immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding	g.chr5:169680125C>G		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.1243G>C	5.37:g.169680125C>G	ENSP00000046794:p.Glu415Gln					LCP2_uc011des.1_Missense_Mutation_p.E210Q|LCP2_uc011det.1_Missense_Mutation_p.E244Q	p.E415Q	NM_005565	NP_005556	Q13094	LCP2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)	18	1450	-	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	415					A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	c.1243G>C	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.616952	0.66672	.	.	ENSG00000043462	ENST00000046794;ENST00000521416	D;D	0.92752	-3.1;-3.1	5.74	5.74	0.90152	.	0.179749	0.48767	D	0.000172	D	0.94258	0.8156	M	0.63843	1.955	0.45662	D	0.998588	D;D	0.65815	0.995;0.985	P;P	0.59487	0.858;0.858	D	0.93256	0.6639	9	.	.	.	-26.2124	15.7886	0.78332	0.0:1.0:0.0:0.0	.	210;415	E7ESF6;Q13094	.;LCP2_HUMAN	Q	415;210	ENSP00000046794:E415Q;ENSP00000428871:E210Q	.	E	-	1	0	LCP2	169612703	0.854000	0.29725	0.960000	0.40013	0.243000	0.25628	1.329000	0.33770	2.873000	0.98535	0.563000	0.77884	GAG		0.463	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565		3	11	0	0	0	0.004672	0	3	11				
SLC34A1	6569	broad.mit.edu	37	5	176820729	176820729	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr5:176820729C>A	ENST00000324417.5	+	9	1062	c.971C>A	c.(970-972)tCc>tAc	p.S324Y	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	324					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.S324Y(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGGCCAACTCCAGCCAGACC	0.567																																							uc003mgk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(970-972)TCC>TAC		solute carrier family 34 (sodium phosphate),							99.0	89.0	93.0					5																	176820729		2203	4300	6503	SO:0001583	missense	6569				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity	g.chr5:176820729C>A	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.971C>A	5.37:g.176820729C>A	ENSP00000321424:p.Ser324Tyr						p.S324Y	NM_003052	NP_003043	Q06495	NPT2A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		9	1072	+	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	324			Extracellular (Potential).		B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	c.971C>A	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.350671	0.00219	.	.	ENSG00000131183	ENST00000324417	T	0.30981	1.51	5.48	-3.48	0.04739	.	1.847910	0.02128	N	0.056176	T	0.14614	0.0353	N	0.12961	0.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	10	0.02654	T	1	-5.1476	6.777	0.23624	0.0:0.3573:0.3239:0.3188	.	324	Q06495	NPT2A_HUMAN	Y	324	ENSP00000321424:S324Y	ENSP00000321424:S324Y	S	+	2	0	SLC34A1	176753335	0.000000	0.05858	0.001000	0.08648	0.092000	0.18411	-0.914000	0.04038	-0.586000	0.05898	-0.355000	0.07637	TCC		0.567	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052		3	22	1	0	2.56e-06	0.009096	3.28084e-06	3	22				
RIOK1	83732	broad.mit.edu	37	6	7393347	7393347	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:7393347G>T	ENST00000379834.2	+	2	594	c.87G>T	c.(85-87)ttG>ttT	p.L29F		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	29							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L22F(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					ACAGAGACTTGAAGACAGTCA	0.333																																							uc003mxn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|stomach(1)|skin(1)	4						c.(85-87)TTG>TTT		RIO kinase 1 isoform 1							99.0	94.0	95.0					6																	7393347		2203	4300	6503	SO:0001583	missense	83732						ATP binding|protein serine/threonine kinase activity	g.chr6:7393347G>T	BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.87G>T	6.37:g.7393347G>T	ENSP00000369162:p.Leu29Phe					RIOK1_uc003mxm.1_5'UTR	p.L29F	NM_031480	NP_113668	Q9BRS2	RIOK1_HUMAN			2	261	+	Ovarian(93;0.0418)		29					B2RB28|Q8NDC8|Q96NV9	Missense_Mutation	SNP	ENST00000379834.2	37	c.87G>T	CCDS4500.1	.	.	.	.	.	.	.	.	.	.	G	9.424	1.083871	0.20309	.	.	ENSG00000124784	ENST00000379834	T	0.05925	3.37	4.77	3.89	0.44902	.	0.899723	0.09272	N	0.825042	T	0.01523	0.0049	N	0.13043	0.29	0.09310	N	1	B	0.29716	0.255	B	0.27796	0.083	T	0.47774	-0.9091	10	0.49607	T	0.09	0.0	9.2529	0.37566	0.1024:0.0:0.8976:0.0	.	29	Q9BRS2	RIOK1_HUMAN	F	29	ENSP00000369162:L29F	ENSP00000369162:L29F	L	+	3	2	RIOK1	7338346	0.958000	0.32768	0.007000	0.13788	0.009000	0.06853	1.608000	0.36847	1.123000	0.41961	0.655000	0.94253	TTG		0.333	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039780.2	NM_031480		14	49	1	0	7.93312e-07	0.00245	1.04417e-06	14	49				
JARID2	3720	broad.mit.edu	37	6	15496943	15496943	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:15496943G>A	ENST00000341776.2	+	7	1731	c.1487G>A	c.(1486-1488)aGg>aAg	p.R496K	JARID2_ENST00000541660.1_Missense_Mutation_p.R458K|JARID2_ENST00000397311.3_Missense_Mutation_p.R324K	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	496					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R496K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGTCTGGAGAGGAATCGGCCG	0.657																																							uc003nbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|pancreas(1)	4						c.(1486-1488)AGG>AAG		jumonji, AT rich interactive domain 2 protein							31.0	38.0	35.0					6																	15496943		2201	4299	6500	SO:0001583	missense	3720				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding	g.chr6:15496943G>A	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1487G>A	6.37:g.15496943G>A	ENSP00000341280:p.Arg496Lys					JARID2_uc011diu.1_Missense_Mutation_p.R360K|JARID2_uc011div.1_Missense_Mutation_p.R324K|JARID2_uc011diw.1_Missense_Mutation_p.R458K	p.R496K	NM_004973	NP_004964	Q92833	JARD2_HUMAN			7	1731	+	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)	496					A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	c.1487G>A	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741882	0.69304	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.88896	-1.78;-1.77;-2.44	5.4	5.4	0.78164	.	0.092360	0.64402	D	0.000001	D	0.84023	0.5381	L	0.32530	0.975	0.37386	D	0.912242	D;D;P	0.55605	0.971;0.972;0.951	P;P;B	0.50659	0.647;0.6;0.444	T	0.82024	-0.0662	10	0.20046	T	0.44	-18.1677	19.166	0.93557	0.0:0.0:1.0:0.0	.	458;360;496	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	K	360;496;324;458	ENSP00000341280:R496K;ENSP00000380478:R324K;ENSP00000444623:R458K	ENSP00000341280:R496K	R	+	2	0	JARID2	15604922	1.000000	0.71417	0.985000	0.45067	0.911000	0.54048	6.651000	0.74372	2.523000	0.85059	0.561000	0.74099	AGG		0.657	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973		3	29	0	0	0	0.009096	0	3	29				
CAP2	10486	broad.mit.edu	37	6	17539605	17539605	+	Nonsense_Mutation	SNP	G	G	T	rs147812744		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:17539605G>T	ENST00000229922.2	+	8	1274	c.742G>T	c.(742-744)Gag>Tag	p.E248*	CAP2_ENST00000489374.1_Nonsense_Mutation_p.E136*|CAP2_ENST00000493172.1_Intron|CAP2_ENST00000465994.1_Nonsense_Mutation_p.E184*|CAP2_ENST00000378990.2_Nonsense_Mutation_p.E222*	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	248					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)		p.E248*(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			TCCACTTTTCGAGAATGAAGG	0.502																																							uc003ncb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(742-744)GAG>TAG		adenylyl cyclase-associated protein 2							152.0	133.0	139.0					6																	17539605		2203	4300	6503	SO:0001587	stop_gained	10486				activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding	g.chr6:17539605G>T	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.742G>T	6.37:g.17539605G>T	ENSP00000229922:p.Glu248*					CAP2_uc010jpk.1_RNA|CAP2_uc011dja.1_Nonsense_Mutation_p.E222*|CAP2_uc011djb.1_Nonsense_Mutation_p.E184*|CAP2_uc011djc.1_Nonsense_Mutation_p.E136*|CAP2_uc011djd.1_Intron	p.E248*	NM_006366	NP_006357	P40123	CAP2_HUMAN	all cancers(50;0.194)|Epithelial(50;0.227)		8	985	+	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	248					B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Nonsense_Mutation	SNP	ENST00000229922.2	37	c.742G>T	CCDS4539.1	.	.	.	.	.	.	.	.	.	.	g	20.8	4.051143	0.75960	.	.	ENSG00000112186	ENST00000229922;ENST00000378994;ENST00000489374;ENST00000378990;ENST00000465994	.	.	.	5.53	3.72	0.42706	.	0.533636	0.22536	N	0.058789	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-7.3563	9.6683	0.39998	0.0735:0.0:0.7855:0.1409	.	.	.	.	X	248;165;136;222;184	.	ENSP00000229922:E248X	E	+	1	0	CAP2	17647584	1.000000	0.71417	0.533000	0.28001	0.971000	0.66376	6.596000	0.74113	0.654000	0.30846	0.655000	0.94253	GAG		0.502	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2			27	77	1	0	1.2476e-16	0.00632	2.10965e-16	27	77				
BTN3A3	10384	broad.mit.edu	37	6	26448954	26448954	+	Splice_Site	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:26448954A>T	ENST00000244519.2	+	8	1180		c.e8-1		BTN3A3_ENST00000361232.3_Splice_Site|BTN3A3_ENST00000339789.4_Splice_Site	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3						T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.?(1)		cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						ATTCCATTGCAGAGTGGAGGA	0.443																																							uc003nhz.2		NA																	1	Unknown(1)		lung(1)		0						c.e8-2		butyrophilin, subfamily 3, member A3 isoform a							218.0	215.0	216.0					6																	26448954		2203	4300	6503	SO:0001630	splice_region_variant	10384					integral to membrane		g.chr6:26448954A>T	U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.938-1A>T	6.37:g.26448954A>T						BTN3A3_uc003nia.2_Splice_Site_p.K271_splice|BTN3A3_uc011dkn.1_Splice_Site_p.E264_splice	p.K313_splice	NM_006994	NP_008925	O00478	BT3A3_HUMAN			8	1118	+								B4DWI7|E9PCP5	Splice_Site	SNP	ENST00000244519.2	37	c.938_splice	CCDS4611.1	.	.	.	.	.	.	.	.	.	.	A	8.737	0.918012	0.17982	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232;ENST00000490254	.	.	.	3.13	3.13	0.36017	.	.	.	.	.	.	.	.	.	.	.	0.50171	D	0.999853	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2848	0.31922	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BTN3A3	26556933	0.999000	0.42202	0.051000	0.19133	0.068000	0.16541	3.395000	0.52558	1.386000	0.46466	0.374000	0.22700	.		0.443	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040116.2	NM_006994	Intron	32	101	0	0	0	0.004289	0	32	101				
OR10C1	442194	broad.mit.edu	37	6	29408195	29408195	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:29408195C>A	ENST00000444197.2	+	1	1113	c.403C>A	c.(403-405)Ctg>Atg	p.L135M	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L135M(1)		NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CCCACTGCTGCTGAGCCACCG	0.627																																							uc011dlp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(403-405)CTG>ATG		olfactory receptor, family 10, subfamily C,							65.0	71.0	69.0					6																	29408195		1508	2708	4216	SO:0001583	missense	442194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29408195C>A		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.403C>A	6.37:g.29408195C>A	ENSP00000419119:p.Leu135Met					OR11A1_uc010jrh.1_Intron	p.L135M	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN			1	403	+			135			Cytoplasmic (Potential).		Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	c.403C>A	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.065488	0.00382	.	.	ENSG00000206474	ENST00000444197	T	0.01133	5.29	3.23	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31507	N	0.007536	T	0.00073	0.0002	N	0.00082	-2.215	0.25519	N	0.98739	B	0.25667	0.131	B	0.27887	0.084	T	0.10268	-1.0637	10	0.02654	T	1	.	3.5181	0.07732	0.3464:0.4516:0.0:0.2019	.	135	Q96KK4	O10C1_HUMAN	M	135	ENSP00000419119:L135M	ENSP00000419119:L135M	L	+	1	2	OR10C1	29516174	0.176000	0.23096	0.089000	0.20774	0.400000	0.30750	0.707000	0.25704	0.192000	0.20272	0.508000	0.49915	CTG		0.627	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2			9	48	1	0	3.09899e-07	0.004482	4.16908e-07	9	48				
OR2H1	26716	broad.mit.edu	37	6	29430207	29430207	+	Nonsense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:29430207C>T	ENST00000377136.1	+	4	1126	c.661C>T	c.(661-663)Cag>Tag	p.Q221*	OR2H1_ENST00000377132.1_Nonsense_Mutation_p.Q221*|OR2H1_ENST00000442615.1_Nonsense_Mutation_p.Q221*|OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000377133.1_Nonsense_Mutation_p.Q221*|OR2H1_ENST00000396792.2_Nonsense_Mutation_p.Q221*			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q221*(1)		large_intestine(5)|lung(12)	17						AGCCACTGCCCAGGCAGTGCT	0.532																																							uc003nmi.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(661-663)CAG>TAG		olfactory receptor, family 2, subfamily H,							187.0	176.0	180.0					6																	29430207		1511	2709	4220	SO:0001587	stop_gained	26716				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29430207C>T	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.661C>T	6.37:g.29430207C>T	ENSP00000366340:p.Gln221*					OR2H1_uc003nmj.1_Nonsense_Mutation_p.Q221*|OR2H1_uc010jri.1_Nonsense_Mutation_p.Q143*	p.Q221*	NM_030883	NP_112145	Q9GZK4	OR2H1_HUMAN			3	1104	+			221			Cytoplasmic (Potential).		B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Nonsense_Mutation	SNP	ENST00000377136.1	37	c.661C>T	CCDS4660.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252745	0.59212	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	.	.	.	3.09	-2.49	0.06403	.	0.650577	0.12584	N	0.456158	.	.	.	.	.	.	0.50313	D	0.999868	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	0.7382	0.00969	0.3667:0.1621:0.1151:0.3561	.	.	.	.	X	221	.	ENSP00000366336:Q221X	Q	+	1	0	OR2H1	29538186	0.001000	0.12720	0.001000	0.08648	0.014000	0.08584	0.878000	0.28126	-0.633000	0.05545	-0.199000	0.12753	CAG		0.532	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3			12	97	0	0	0	0.001855	0	12	97				
HLA-A	3105	broad.mit.edu	37	6	29910607	29910607	+	Silent	SNP	G	G	C	rs72555397		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:29910607G>C	ENST00000396634.1	+	4	488	c.147G>C	c.(145-147)gtG>gtC	p.V49V	HLA-A_ENST00000376802.2_Silent_p.V49V|HLA-A_ENST00000376809.5_Silent_p.V49V|HLA-A_ENST00000376806.5_Silent_p.V49V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	49	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.V49V(2)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TCATCGCCGTGGGCTACGTGG	0.692									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																													uc003nol.2		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(145-147)GTG>GTC		major histocompatibility complex, class I, A																																				SO:0001819	synonymous_variant	3105	Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity	g.chr6:29910607G>C	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.147G>C	6.37:g.29910607G>C		Multiple Myeloma(9;0.094)				HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_Intron|HLA-A_uc010jrq.2_5'UTR|HLA-A_uc003nok.2_5'UTR|HLA-A_uc003non.2_Silent_p.V49V|HLA-A_uc003noo.2_Silent_p.V49V|HLA-A_uc010jrr.2_Silent_p.V49V|HLA-A_uc003nom.2_5'UTR|HLA-A_uc010klp.2_Silent_p.V21V|HLA-A_uc011dmc.1_5'UTR|HLA-A_uc011dmd.1_5'Flank	p.V49V	NM_002116	NP_002107	P30443	1A01_HUMAN			2	147	+			49			Extracellular (Potential).|Alpha-1.		O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	37	c.147G>C	CCDS34373.1																																																																																				0.692	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116		3	18	0	0	0	0.004672	0	3	18				
GPR115	221393	broad.mit.edu	37	6	47682320	47682320	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:47682320G>T	ENST00000283303.2	+	6	1597	c.1339G>T	c.(1339-1341)Gca>Tca	p.A447S	RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000327753.3_Missense_Mutation_p.A447S|GPR115_ENST00000371220.1_Missense_Mutation_p.A504S	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	447					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A447S(1)		NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						CGTGAATATAGCAGTGTCCCT	0.468																																					GBM(22;431 510 9010 26644 32828)	GBM(22;431 510 9010 26644 32828)	uc003oza.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						c.(1339-1341)GCA>TCA		G-protein coupled receptor 115 precursor							246.0	222.0	230.0					6																	47682320		2203	4300	6503	SO:0001583	missense	221393				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:47682320G>T	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.1339G>T	6.37:g.47682320G>T	ENSP00000283303:p.Ala447Ser					GPR115_uc003oyz.1_Missense_Mutation_p.A504S|GPR115_uc003ozb.1_Missense_Mutation_p.A445S	p.A447S	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN			6	1597	+			447			Helical; Name=2; (Potential).		B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	c.1339G>T	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518519	0.44763	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.44881	0.91;0.91;0.91	5.45	5.45	0.79879	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000001	T	0.50582	0.1624	L	0.56396	1.775	0.42232	D	0.991893	D	0.53312	0.959	P	0.57371	0.819	T	0.51826	-0.8656	10	0.72032	D	0.01	-19.2324	18.6292	0.91354	0.0:0.0:1.0:0.0	.	447	Q8IZF3	GP115_HUMAN	S	504;447;447	ENSP00000360264:A504S;ENSP00000328319:A447S;ENSP00000283303:A447S	ENSP00000283303:A447S	A	+	1	0	GPR115	47790279	1.000000	0.71417	0.997000	0.53966	0.523000	0.34469	5.535000	0.67173	2.721000	0.93114	0.655000	0.94253	GCA		0.468	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		24	115	1	0	1.10923e-09	0.00278	1.60773e-09	24	115				
TFAP2D	83741	broad.mit.edu	37	6	50683135	50683135	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:50683135C>A	ENST00000008391.3	+	2	574	c.346C>A	c.(346-348)Ctg>Atg	p.L116M		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.L116M(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CTTTATTAACCTGCACAATGC	0.637																																							uc003paf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(1)	7						c.(346-348)CTG>ATG		transcription factor AP-2 beta-like 1							93.0	89.0	90.0					6																	50683135		2203	4300	6503	SO:0001583	missense	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50683135C>A	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.346C>A	6.37:g.50683135C>A	ENSP00000008391:p.Leu116Met					TFAP2D_uc011dwt.1_RNA	p.L116M	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN			2	858	+	Lung NSC(77;0.0334)		116						Missense_Mutation	SNP	ENST00000008391.3	37	c.346C>A	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721317	0.48728	.	.	ENSG00000008197	ENST00000008391	D	0.97529	-4.42	5.21	5.21	0.72293	.	0.812482	0.11257	N	0.582984	D	0.95680	0.8595	N	0.08118	0	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	D	0.95561	0.8629	10	0.44086	T	0.13	-3.6558	19.1268	0.93388	0.0:1.0:0.0:0.0	.	116	Q7Z6R9	AP2D_HUMAN	M	116	ENSP00000008391:L116M	ENSP00000008391:L116M	L	+	1	2	TFAP2D	50791094	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.864000	0.69575	2.590000	0.87494	0.655000	0.94253	CTG		0.637	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		12	38	1	0	2.32078e-09	0.003163	3.29511e-09	12	38				
TFAP2D	83741	broad.mit.edu	37	6	50696702	50696702	+	Silent	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:50696702C>T	ENST00000008391.3	+	4	960	c.732C>T	c.(730-732)ctC>ctT	p.L244L	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.L244L(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CTGAGTGCCTCAATGCTTCAC	0.468																																							uc003paf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|breast(1)	7						c.(730-732)CTC>CTT		transcription factor AP-2 beta-like 1							97.0	97.0	97.0					6																	50696702		2203	4300	6503	SO:0001819	synonymous_variant	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50696702C>T	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.732C>T	6.37:g.50696702C>T						TFAP2D_uc011dwt.1_RNA	p.L244L	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN			4	1244	+	Lung NSC(77;0.0334)		244						Silent	SNP	ENST00000008391.3	37	c.732C>T	CCDS4933.1																																																																																				0.468	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		6	58	0	0	0	0.001168	0	6	58				
HMGCLL1	54511	broad.mit.edu	37	6	55406914	55406914	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:55406914G>A	ENST00000398661.2	-	3	354	c.223C>T	c.(223-225)Cct>Tct	p.P75S	HMGCLL1_ENST00000274901.4_Missense_Mutation_p.P45S|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.P45S|HMGCLL1_ENST00000508459.1_Missense_Mutation_p.P45S|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.P45S|HMGCLL1_ENST00000428842.1_Missense_Mutation_p.P45S	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	75					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)	p.P75S(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACAAACTCAGGGAGTCCAGAT	0.323																																					Ovarian(35;840 893 7837 15538 42887)	Ovarian(35;840 893 7837 15538 42887)	uc003pcn.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|pancreas(1)	4						c.(223-225)CCT>TCT		3-hydroxymethyl-3-methylglutaryl-Coenzyme A							78.0	72.0	74.0					6																	55406914		1817	4077	5894	SO:0001583	missense	54511						hydroxymethylglutaryl-CoA lyase activity|metal ion binding	g.chr6:55406914G>A	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.223C>T	6.37:g.55406914G>A	ENSP00000381654:p.Pro75Ser					HMGCLL1_uc003pco.2_Missense_Mutation_p.P45S|HMGCLL1_uc010jzx.2_5'UTR|HMGCLL1_uc011dxc.1_Missense_Mutation_p.P45S|HMGCLL1_uc011dxd.1_Missense_Mutation_p.P45S|HMGCLL1_uc011dxe.1_Missense_Mutation_p.P45S|HMGCLL1_uc003pcp.2_Missense_Mutation_p.P45S	p.P75S	NM_019036	NP_061909	Q8TB92	HMGC2_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		3	382	-	Lung NSC(77;0.0875)		75					B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	37	c.223C>T	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475886	0.63737	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000508459;ENST00000308161;ENST00000428842	D;D;D;D;D;D	0.98207	-4.79;-4.79;-4.6;-4.0;-4.79;-3.72	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.97300	0.9117	N	0.12746	0.255	0.80722	D	1	D;P;D;D;D;D	0.89917	1.0;0.533;0.985;0.994;0.994;0.99	D;B;P;P;P;P	0.83275	0.996;0.205;0.868;0.828;0.884;0.768	D	0.98254	1.0495	10	0.46703	T	0.11	-15.0784	19.9525	0.97208	0.0:0.0:1.0:0.0	.	45;45;45;45;45;75	B7Z4D4;B7Z212;F8W793;G5E9S9;Q8TB92-2;Q8TB92	.;.;.;.;.;HMGC2_HUMAN	S	45;75;45;45;45;45	ENSP00000274901:P45S;ENSP00000381654:P75S;ENSP00000359887:P45S;ENSP00000424309:P45S;ENSP00000309737:P45S;ENSP00000412924:P45S	ENSP00000274901:P45S	P	-	1	0	HMGCLL1	55514873	1.000000	0.71417	0.999000	0.59377	0.282000	0.26991	6.482000	0.73613	2.719000	0.93026	0.655000	0.94253	CCT		0.323	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383		9	25	0	0	0	0.006214	0	9	25				
COL19A1	1310	broad.mit.edu	37	6	70890390	70890390	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:70890390G>T	ENST00000322773.4	+	44	2852	c.2750G>T	c.(2749-2751)gGa>gTa	p.G917V	COL19A1_ENST00000393344.1_Missense_Mutation_p.G539V	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	917	Collagen-like 10.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.G917V(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GGTTTCCCTGGACCAGAAGGA	0.408																																							uc003pfc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(2749-2751)GGA>GTA		alpha 1 type XIX collagen precursor							151.0	150.0	150.0					6																	70890390		2203	4300	6503	SO:0001583	missense	1310				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging	g.chr6:70890390G>T		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2750G>T	6.37:g.70890390G>T	ENSP00000316030:p.Gly917Val						p.G917V	NM_001858	NP_001849	Q14993	COJA1_HUMAN			44	2867	+			917			Triple-helical region 5 (COL5).		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	c.2750G>T	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371308	0.61624	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.99186	-5.15;-5.53	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000001	D	0.99641	0.9868	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97664	1.0162	10	0.87932	D	0	.	17.591	0.87997	0.0:0.0:1.0:0.0	.	917	Q14993	COJA1_HUMAN	V	917;539	ENSP00000316030:G917V;ENSP00000377013:G539V	ENSP00000316030:G917V	G	+	2	0	COL19A1	70947111	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.728000	0.84847	2.590000	0.87494	0.484000	0.47621	GGA		0.408	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			27	60	1	0	1.80694e-10	0.009535	2.69933e-10	27	60				
MTO1	25821	broad.mit.edu	37	6	74183111	74183111	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:74183111G>T	ENST00000370300.4	+	4	649	c.559G>T	c.(559-561)Gag>Tag	p.E187*	MTO1_ENST00000498286.1_Nonsense_Mutation_p.E187*|MTO1_ENST00000415954.2_Nonsense_Mutation_p.E187*|MTO1_ENST00000370305.1_Nonsense_Mutation_p.E113*|MTO1_ENST00000518210.1_3'UTR	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	187					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)	p.E187*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						AGTATATGCAGAGAGTGTGAT	0.368																																							uc003pgy.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)	6						c.(559-561)GAG>TAG		mitochondrial translation optimization 1 homolog							127.0	113.0	118.0					6																	74183111		2203	4300	6503	SO:0001587	stop_gained	25821				tRNA processing	mitochondrion	flavin adenine dinucleotide binding	g.chr6:74183111G>T	AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.559G>T	6.37:g.74183111G>T	ENSP00000359323:p.Glu187*					MTO1_uc010kav.2_Nonsense_Mutation_p.E187*|MTO1_uc003pgz.3_Nonsense_Mutation_p.E187*|MTO1_uc003pha.3_Intron|MTO1_uc003phb.3_Nonsense_Mutation_p.E113*	p.E187*	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN			4	683	+			187					B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Nonsense_Mutation	SNP	ENST00000370300.4	37	c.559G>T	CCDS4979.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722465	0.89298	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000370305;ENST00000370300	.	.	.	5.46	5.46	0.80206	.	0.476225	0.25166	N	0.032627	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.2651	17.4694	0.87641	0.0:0.0:1.0:0.0	.	.	.	.	X	187;187;113;187	.	ENSP00000359323:E187X	E	+	1	0	MTO1	74239832	1.000000	0.71417	0.929000	0.37066	0.677000	0.39632	3.685000	0.54678	2.564000	0.86499	0.511000	0.50034	GAG		0.368	MTO1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041215.2	NM_012123		22	37	1	0	1.42536e-11	0.004656	2.16246e-11	22	37				
SENP6	26054	broad.mit.edu	37	6	76405596	76405596	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:76405596C>G	ENST00000447266.2	+	17	2630	c.2152C>G	c.(2152-2154)Ctt>Gtt	p.L718V	SENP6_ENST00000541192.1_Missense_Mutation_p.L314V|SENP6_ENST00000370010.2_Missense_Mutation_p.L711V|SENP6_ENST00000370014.3_Missense_Mutation_p.L718V	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	718	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)	p.L718V(2)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				CTATAAACGCCTTAATCAGAG	0.318																																							uc003pid.3		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|urinary_tract(1)|ovary(1)|lung(1)|skin(1)	6						c.(2152-2154)CTT>GTT		SUMO1/sentrin specific peptidase 6 isoform 1							74.0	74.0	74.0					6																	76405596		1826	4079	5905	SO:0001583	missense	26054				proteolysis	cytoplasm|nucleus	cysteine-type peptidase activity	g.chr6:76405596C>G		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.2152C>G	6.37:g.76405596C>G	ENSP00000402527:p.Leu718Val					SENP6_uc003pie.3_Missense_Mutation_p.L711V|SENP6_uc010kbf.2_RNA	p.L718V	NM_015571	NP_056386	Q9GZR1	SENP6_HUMAN			17	2771	+		all_hematologic(105;0.189)	718			Protease.		A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	37	c.2152C>G	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.632558	0.87660	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000447266;ENST00000541192	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.76856	0.4046	M	0.90252	3.1	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.85130	0.995;0.997	T	0.80365	-0.1413	10	0.87932	D	0	-17.1912	20.3552	0.98837	0.0:1.0:0.0:0.0	.	711;718	Q9GZR1-2;Q9GZR1	.;SENP6_HUMAN	V	711;718;718;314	ENSP00000359027:L711V;ENSP00000359031:L718V;ENSP00000402527:L718V;ENSP00000441715:L314V	ENSP00000359027:L711V	L	+	1	0	SENP6	76462316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.556000	0.73932	2.812000	0.96745	0.557000	0.71058	CTT		0.318	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571		15	90	0	0	0	0.004007	0	15	90				
C6orf165	154313	broad.mit.edu	37	6	88123581	88123581	+	Missense_Mutation	SNP	G	G	T	rs140621996		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:88123581G>T	ENST00000507897.1	+	4	329	c.246G>T	c.(244-246)aaG>aaT	p.K82N	C6ORF165_ENST00000369562.4_Missense_Mutation_p.K82N			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	82								p.K82N(2)		NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		ACACTATTAAGATGCAAGTCT	0.333																																							uc003plv.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(244-246)AAG>AAT		hypothetical protein LOC154313 isoform 1							94.0	90.0	91.0					6																	88123581		2203	4297	6500	SO:0001583	missense	154313							g.chr6:88123581G>T	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.246G>T	6.37:g.88123581G>T	ENSP00000426769:p.Lys82Asn					C6orf165_uc003plw.2_5'UTR|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Missense_Mutation_p.K82N	p.K82N	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0419)	4	338	+		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	82					A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	ENST00000507897.1	37	c.246G>T	CCDS34498.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.670812	0.67814	.	.	ENSG00000213204	ENST00000369562;ENST00000480123	T;T	0.26810	1.71;1.71	5.32	1.45	0.22620	.	0.048779	0.85682	D	0.000000	T	0.39517	0.1081	M	0.85542	2.76	0.51482	D	0.999923	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.981	T	0.43410	-0.9393	10	0.72032	D	0.01	.	10.1434	0.42749	0.2831:0.0:0.7169:0.0	.	82;82	Q8IYR0;E1P509	CF165_HUMAN;.	N	82	ENSP00000358575:K82N;ENSP00000422494:K82N	ENSP00000358575:K82N	K	+	3	2	C6orf165	88180300	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.539000	0.36104	0.223000	0.20920	0.484000	0.47621	AAG		0.333	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823		13	50	1	0	7.05477e-17	0.00499	1.1971e-16	13	50				
PM20D2	135293	broad.mit.edu	37	6	89871553	89871553	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:89871553A>G	ENST00000275072.4	+	6	1195	c.1100A>G	c.(1099-1101)tAt>tGt	p.Y367C		NM_001010853.1	NP_001010853.1	Q8IYS1	P20D2_HUMAN	peptidase M20 domain containing 2	367						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.Y367C(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|skin(1)	12		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		ATTCATCCATATTTTCACATT	0.368																																							uc003pmz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1099-1101)TAT>TGT		aminoacylase 1-like 2							210.0	191.0	197.0					6																	89871553		2203	4300	6503	SO:0001583	missense	135293						hydrolase activity	g.chr6:89871553A>G	BC035036	CCDS34499.1	6q15	2014-07-14	2007-11-14	2007-11-14	ENSG00000146281	ENSG00000146281			21408	protein-coding gene	gene with protein product	"""&#946;-alanyl-lysine dipeptidase"""	615913	"""aminoacylase 1-like 2"""	ACY1L2		24891507	Standard	NM_001010853		Approved	bA63L7.3	uc003pmz.4	Q8IYS1	OTTHUMG00000015193	ENST00000275072.4:c.1100A>G	6.37:g.89871553A>G	ENSP00000275072:p.Tyr367Cys						p.Y367C	NM_001010853	NP_001010853	Q8IYS1	P20D2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.00813)	6	1195	+		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)	367					B4DYJ2|Q5T7J9|Q6MZV2|Q86XD9	Missense_Mutation	SNP	ENST00000275072.4	37	c.1100A>G	CCDS34499.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.558910	0.65538	.	.	ENSG00000146281	ENST00000275072	T	0.50277	0.75	5.61	5.61	0.85477	.	0.056338	0.64402	D	0.000001	T	0.50343	0.1610	M	0.91768	3.24	0.49299	D	0.999776	B	0.30114	0.269	B	0.36464	0.225	T	0.57573	-0.7788	10	0.39692	T	0.17	-10.6338	14.9828	0.71324	1.0:0.0:0.0:0.0	.	367	Q8IYS1	P20D2_HUMAN	C	367	ENSP00000275072:Y367C	ENSP00000275072:Y367C	Y	+	2	0	PM20D2	89928272	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.126000	0.71635	2.139000	0.66308	0.454000	0.30748	TAT		0.368	PM20D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041477.1	NM_001010853		25	67	0	0	0	0.008361	0	25	67				
COL10A1	1300	broad.mit.edu	37	6	116441292	116441292	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:116441292A>G	ENST00000327673.4	-	2	2394	c.1987T>C	c.(1987-1989)Tac>Cac	p.Y663H	AL121963.1_ENST00000430695.1_5'Flank|NT5DC1_ENST00000319550.4_Intron|COL10A1_ENST00000243222.4_Missense_Mutation_p.Y663H			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	663	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Nonhelical region (NC1).				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)	p.Y663H(1)		central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		TCAGAGGAGTATAGGCCATTT	0.478																																							uc003pwm.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1987-1989)TAC>CAC		type X collagen alpha 1 precursor							128.0	127.0	127.0					6																	116441292		2203	4300	6503	SO:0001583	missense	1300				skeletal system development	collagen	metal ion binding	g.chr6:116441292A>G		CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.1987T>C	6.37:g.116441292A>G	ENSP00000327368:p.Tyr663His					NT5DC1_uc003pwj.2_Intron|NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	p.Y663H	NM_000493	NP_000484	Q03692	COAA1_HUMAN		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)	3	2083	-		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)	663			Nonhelical region (NC1).|C1q.		A1L4P2	Missense_Mutation	SNP	ENST00000327673.4	37	c.1987T>C	CCDS5105.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.459943	0.43736	.	.	ENSG00000123500	ENST00000243222;ENST00000327673	T;T	0.76316	-1.01;-1.01	5.08	3.92	0.45320	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.119406	0.64402	N	0.000015	T	0.66896	0.2836	M	0.80183	2.485	0.47862	D	0.999534	B	0.22211	0.066	B	0.28465	0.09	T	0.65557	-0.6139	10	0.33940	T	0.23	.	10.6947	0.45892	0.9245:0.0:0.0755:0.0	.	663	Q03692	COAA1_HUMAN	H	663	ENSP00000243222:Y663H;ENSP00000327368:Y663H	ENSP00000243222:Y663H	Y	-	1	0	COL10A1	116547985	1.000000	0.71417	0.994000	0.49952	0.916000	0.54674	7.480000	0.81109	0.901000	0.36495	0.374000	0.22700	TAC		0.478	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041926.1			14	68	0	0	0	0.001855	0	14	68				
BCLAF1	9774	broad.mit.edu	37	6	136599090	136599090	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:136599090G>T	ENST00000531224.1	-	4	1181	c.929C>A	c.(928-930)gCt>gAt	p.A310D	BCLAF1_ENST00000530767.1_Missense_Mutation_p.A310D|BCLAF1_ENST00000392348.2_Missense_Mutation_p.A308D|BCLAF1_ENST00000527759.1_Missense_Mutation_p.A308D|BCLAF1_ENST00000527536.1_Missense_Mutation_p.A310D|BCLAF1_ENST00000353331.4_Missense_Mutation_p.A308D	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	310					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A310D(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ATCTCTTGGAGCATTCTGTGG	0.433																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(928-930)GCT>GAT		BCL2-associated transcription factor 1 isoform							85.0	82.0	83.0					6																	136599090		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599090G>T	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.929C>A	6.37:g.136599090G>T	ENSP00000435210:p.Ala310Asp					BCLAF1_uc003qgw.1_Missense_Mutation_p.A310D|BCLAF1_uc003qgy.1_Missense_Mutation_p.A308D|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.A308D	p.A310D	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	1182	-	Colorectal(23;0.24)		310					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.929C>A	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245774	0.39697	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54;2.54;2.54	5.82	3.81	0.43845	.	0.277119	0.31301	N	0.007898	T	0.02649	0.0080	N	0.03608	-0.345	0.80722	D	1	B;P;B;B	0.35656	0.226;0.514;0.226;0.077	B;B;B;B	0.34242	0.178;0.178;0.178;0.058	T	0.40627	-0.9553	10	0.72032	D	0.01	-10.3031	11.5335	0.50624	0.1888:0.0:0.8112:0.0	.	308;308;310;310	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	D	310;308;310;310;308;308;310	ENSP00000435210:A310D;ENSP00000229446:A308D;ENSP00000435441:A310D;ENSP00000436501:A310D;ENSP00000434826:A308D;ENSP00000376159:A308D;ENSP00000431734:A310D	ENSP00000229446:A308D	A	-	2	0	BCLAF1	136640783	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.942000	0.40243	1.469000	0.48083	0.650000	0.86243	GCT		0.433	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		19	88	1	0	7.41877e-09	0.012319	1.03523e-08	19	88				
TIAM2	26230	broad.mit.edu	37	6	155458398	155458398	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:155458398G>T	ENST00000461783.3	+	7	2555	c.1282G>T	c.(1282-1284)Gct>Tct	p.A428S	TIAM2_ENST00000318981.5_Missense_Mutation_p.A428S|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000456144.1_Missense_Mutation_p.A428S|TIAM2_ENST00000529824.2_Missense_Mutation_p.A428S|TIAM2_ENST00000360366.4_Missense_Mutation_p.A428S			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	428					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A428S(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CCAGGCATCTGCTTTTCTGTG	0.527																																							uc003qqb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1282-1284)GCT>TCT		T-cell lymphoma invasion and metastasis 2							89.0	91.0	90.0					6																	155458398		2203	4300	6503	SO:0001583	missense	26230				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr6:155458398G>T		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1282G>T	6.37:g.155458398G>T	ENSP00000437188:p.Ala428Ser					TIAM2_uc003qqe.2_Missense_Mutation_p.A428S|TIAM2_uc010kjj.2_5'UTR	p.A428S	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)	7	2555	+		Ovarian(120;0.196)	428					B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	c.1282G>T	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.882286	0.00532	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.04317	3.77;3.65;3.71;3.77;3.75;3.71	5.81	2.66	0.31614	.	0.397092	0.28322	N	0.015770	T	0.00468	0.0015	N	0.04508	-0.205	0.26078	N	0.981138	B	0.06786	0.001	B	0.04013	0.001	T	0.46048	-0.9219	10	0.02654	T	1	.	3.7715	0.08643	0.3077:0.0:0.5097:0.1826	.	428	Q8IVF5	TIAM2_HUMAN	S	428;674;428;428;428;428;428	ENSP00000437188:A428S;ENSP00000434901:A428S;ENSP00000407746:A428S;ENSP00000327315:A428S;ENSP00000353528:A428S;ENSP00000433348:A428S	ENSP00000327315:A428S	A	+	1	0	TIAM2	155500090	0.015000	0.18098	0.005000	0.12908	0.013000	0.08279	0.790000	0.26900	0.786000	0.33708	0.655000	0.94253	GCT		0.527	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454		11	69	1	0	2.80697e-09	0.010729	3.96231e-09	11	69				
IGF2R	3482	broad.mit.edu	37	6	160499257	160499257	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:160499257A>T	ENST00000356956.1	+	37	5489	c.5341A>T	c.(5341-5343)Agc>Tgc	p.S1781C		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1781					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.S1781C(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GTTAAGGACCAGCGAGTGCGA	0.532																																							uc003qta.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(5341-5343)AGC>TGC		insulin-like growth factor 2 receptor precursor							198.0	161.0	174.0					6																	160499257		2203	4300	6503	SO:0001583	missense	3482				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity	g.chr6:160499257A>T	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5341A>T	6.37:g.160499257A>T	ENSP00000349437:p.Ser1781Cys						p.S1781C	NM_000876	NP_000867	P11717	MPRI_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	37	5489	+		Breast(66;0.000777)|Ovarian(120;0.0305)	1781			Lumenal (Potential).|12.		Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	c.5341A>T	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.581186	0.65992	.	.	ENSG00000197081	ENST00000356956	T	0.13089	2.62	5.36	5.36	0.76844	Mannose-6-phosphate receptor, binding (1);	0.398010	0.31167	N	0.008132	T	0.12561	0.0305	M	0.76002	2.32	0.09310	N	1	P	0.49253	0.921	P	0.52598	0.703	T	0.34900	-0.9810	10	0.66056	D	0.02	-9.6419	3.6192	0.08089	0.6558:0.1376:0.0745:0.132	.	1781	P11717	MPRI_HUMAN	C	1781	ENSP00000349437:S1781C	ENSP00000349437:S1781C	S	+	1	0	IGF2R	160419247	0.009000	0.17119	0.696000	0.30242	0.910000	0.53928	1.039000	0.30266	2.050000	0.60909	0.459000	0.35465	AGC		0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876		8	87	0	0	0	0.008291	0	8	87				
AGPAT4	56895	broad.mit.edu	37	6	161575192	161575192	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr6:161575192C>A	ENST00000320285.4	-	4	711	c.499G>T	c.(499-501)Gag>Tag	p.E167*	AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000457520.2_Intron|AGPAT4_ENST00000366906.5_Nonsense_Mutation_p.E105*|AGPAT4_ENST00000366911.5_Missense_Mutation_p.R110L	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	167					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.E167*(1)		endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		AAATACTTCTCGGGGTAGTCC	0.577																																							uc003qtr.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(499-501)GAG>TAG		1-acylglycerol-3-phosphate O-acyltransferase 4							88.0	81.0	84.0					6																	161575192		2203	4300	6503	SO:0001587	stop_gained	56895				phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding	g.chr6:161575192C>A	AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.499G>T	6.37:g.161575192C>A	ENSP00000314036:p.Glu167*					AGPAT4_uc003qts.1_Nonsense_Mutation_p.E27*|AGPAT4_uc011egb.1_Intron|AGPAT4_uc003qtt.1_RNA|AGPAT4_uc011egc.1_Nonsense_Mutation_p.E167*|AGPAT4_uc011egd.1_Nonsense_Mutation_p.E105*|AGPAT4_uc011ege.1_Missense_Mutation_p.R110L	p.E167*	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)	4	726	-		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)	167					B4DSF9|Q5TEF0	Nonsense_Mutation	SNP	ENST00000320285.4	37	c.499G>T	CCDS5280.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.27|14.27	2.484419|2.484419	0.44147|0.44147	.|.	.|.	ENSG00000026652|ENSG00000026652	ENST00000320285;ENST00000366906|ENST00000366911	.|.	.|.	.|.	4.17|4.17	4.17|4.17	0.49024|0.49024	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76321	.|0.3971	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	.|T	.|0.81167	.|-0.1056	.|7	0.46703|0.87932	T|D	0.11|0	-27.1299|-27.1299	16.6872|16.6872	0.85311|0.85311	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|110	.|B4DIY1	.|.	X|L	167;105|110	.|.	ENSP00000314036:E167X|ENSP00000355878:R110L	E|R	-|-	1|2	0|0	AGPAT4|AGPAT4	161495182|161495182	1.000000|1.000000	0.71417|0.71417	0.857000|0.857000	0.33713|0.33713	0.012000|0.012000	0.07955|0.07955	7.433000|7.433000	0.80362|0.80362	2.172000|2.172000	0.68678|0.68678	0.651000|0.651000	0.88453|0.88453	GAG|CGA		0.577	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133		7	36	1	0	0.00307968	0.00308	0.00339322	7	36				
PRPS1L1	221823	broad.mit.edu	37	7	18067064	18067064	+	Silent	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:18067064A>G	ENST00000506618.2	-	1	422	c.342T>C	c.(340-342)aaT>aaC	p.N114N		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	114					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.N114N(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					TAGAGAGCATATTTGCAACAA	0.473																																							uc003stz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(340-342)AAT>AAC		phosphoribosyl pyrophosphate synthetase 1-like							146.0	147.0	147.0					7																	18067064		2203	4300	6503	SO:0001819	synonymous_variant	221823				nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity	g.chr7:18067064A>G	M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.342T>C	7.37:g.18067064A>G							p.N114N	NM_175886	NP_787082	P21108	PRPS3_HUMAN			1	423	-	Lung NSC(10;0.0385)|all_lung(11;0.0736)		114					Q6P5P6	Silent	SNP	ENST00000506618.2	37	c.342T>C	CCDS47552.1																																																																																				0.473	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886		20	63	0	0	0	0.010504	0	20	63				
GPR141	353345	broad.mit.edu	37	7	37780793	37780793	+	Missense_Mutation	SNP	C	C	A	rs146749644	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:37780793C>A	ENST00000447769.1	+	4	1087	c.798C>A	c.(796-798)aaC>aaA	p.N266K	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.N266K			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.N266K(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CATTTTATAACGAAATCTTCT	0.383																																							uc003tfm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(796-798)AAC>AAA		G protein-coupled receptor 141							157.0	151.0	153.0					7																	37780793		2203	4300	6503	SO:0001583	missense	353345					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr7:37780793C>A	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.798C>A	7.37:g.37780793C>A	ENSP00000390410:p.Asn266Lys					uc003tfl.2_Intron	p.N266K	NM_181791	NP_861456	Q7Z602	GP141_HUMAN			1	798	+			266			Extracellular (Potential).		A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	ENST00000447769.1	37	c.798C>A	CCDS5451.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.073900	0.55646	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.37584	1.19;1.19	5.2	-0.326	0.12698	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.51261	0.1664	M	0.73962	2.25	0.35872	D	0.828304	D	0.89917	1.0	D	0.87578	0.998	T	0.56159	-0.8025	10	0.21540	T	0.41	-29.3403	9.4016	0.38435	0.0:0.2916:0.0:0.7084	.	266	Q7Z602	GP141_HUMAN	K	266	ENSP00000390410:N266K;ENSP00000334540:N266K	ENSP00000334540:N266K	N	+	3	2	GPR141	37747318	0.751000	0.28327	0.998000	0.56505	0.845000	0.48019	-0.193000	0.09573	-0.066000	0.12998	-0.290000	0.09829	AAC		0.383	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791		12	221	1	0	5.50884e-06	0.013537	6.93231e-06	12	221				
CDK13	8621	broad.mit.edu	37	7	40127867	40127867	+	Missense_Mutation	SNP	A	A	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:40127867A>G	ENST00000181839.4	+	12	3777	c.3172A>G	c.(3172-3174)Aca>Gca	p.T1058A	CDK13_ENST00000340829.5_Missense_Mutation_p.T1058A	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1058					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.T1058A(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						CAGAACCAACACACCCCAGGG	0.502																																							uc003thh.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|ovary(1)	5						c.(3172-3174)ACA>GCA		cell division cycle 2-like 5 isoform 1							86.0	77.0	80.0					7																	40127867		2203	4300	6503	SO:0001583	missense	8621				alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr7:40127867A>G	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3172A>G	7.37:g.40127867A>G	ENSP00000181839:p.Thr1058Ala					CDK13_uc003thi.3_Missense_Mutation_p.T1058A|CDK13_uc003thj.2_Missense_Mutation_p.T109A	p.T1058A	NM_003718	NP_003709	Q14004	CDK13_HUMAN			12	3454	+			1058					Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	ENST00000181839.4	37	c.3172A>G	CCDS5461.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.397550	0.62177	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.45276	0.9;1.59	5.25	5.25	0.73442	.	.	.	.	.	T	0.57315	0.2045	L	0.48642	1.525	0.80722	D	1	D;B	0.71674	0.998;0.04	D;B	0.80764	0.994;0.024	T	0.54344	-0.8308	8	.	.	.	-11.4812	15.8818	0.79208	1.0:0.0:0.0:0.0	.	1058;1058	Q14004-2;Q14004	.;CDK13_HUMAN	A	1058	ENSP00000181839:T1058A;ENSP00000340557:T1058A	.	T	+	1	0	CDK13	40094392	1.000000	0.71417	0.961000	0.40146	0.972000	0.66771	9.177000	0.94849	2.288000	0.76882	0.528000	0.53228	ACA		0.502	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718		5	54	0	0	0	0.00308	0	5	54				
POLM	27434	broad.mit.edu	37	7	44119252	44119252	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:44119252T>C	ENST00000242248.5	-	4	661	c.560A>G	c.(559-561)aAg>aGg	p.K187R	POLM_ENST00000492971.1_5'Flank|POLM_ENST00000395831.3_Missense_Mutation_p.K187R|POLM_ENST00000335195.6_Missense_Mutation_p.K187R	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	187					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.K187R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GGGAAGGGCCTTGAGCACCGA	0.622								DNA polymerases (catalytic subunits)																															uc003tjt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(559-561)AAG>AGG	DNA_polymerases_(catalytic_subunits)	DNA-directed DNA polymerase mu							57.0	61.0	60.0					7																	44119252		2203	4300	6503	SO:0001583	missense	27434				DNA recombination|DNA repair	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding	g.chr7:44119252T>C	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.560A>G	7.37:g.44119252T>C	ENSP00000242248:p.Lys187Arg					POLM_uc003tju.2_Missense_Mutation_p.K187R|POLM_uc003tjx.2_Missense_Mutation_p.K187R|POLM_uc003tjv.2_RNA|POLM_uc011kbt.1_Intron|POLM_uc003tka.1_5'Flank|POLM_uc003tjz.3_Missense_Mutation_p.K187R|POLM_uc011kbu.1_Missense_Mutation_p.K154R|POLM_uc010kxy.2_Missense_Mutation_p.K187R	p.K187R	NM_013284	NP_037416	Q9NP87	DPOLM_HUMAN			4	652	-			187					D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	37	c.560A>G	CCDS34625.1	.	.	.	.	.	.	.	.	.	.	T	14.98	2.698797	0.48307	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831;ENST00000414235	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.49	-1.84	0.07809	DNA-directed DNA polymerase X (1);DNA-directed DNA polymerase, family X, beta-like, N-terminal (2);	0.187355	0.56097	N	0.000039	T	0.42877	0.1222	M	0.79123	2.44	0.39711	D	0.971332	B;B;B;B;P;P	0.43826	0.197;0.144;0.096;0.096;0.818;0.526	B;B;B;B;B;B	0.38020	0.119;0.074;0.038;0.038;0.263;0.146	T	0.51888	-0.8648	10	0.66056	D	0.02	-32.1097	10.4222	0.44356	0.0:0.2378:0.0:0.7622	.	154;187;187;187;187;187	B4DG75;Q6PIY2;Q9H980;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;.;DPOLM_HUMAN	R	187;187;187;154	ENSP00000335141:K187R;ENSP00000242248:K187R;ENSP00000379174:K187R;ENSP00000390899:K154R	ENSP00000242248:K187R	K	-	2	0	POLM	44085777	1.000000	0.71417	0.990000	0.47175	0.631000	0.37964	0.591000	0.23969	-0.263000	0.09378	-0.408000	0.06270	AAG		0.622	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284		31	44	0	0	0	0.003271	0	31	44				
NPC1L1	29881	broad.mit.edu	37	7	44560666	44560666	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:44560666C>A	ENST00000289547.4	-	13	3060	c.3005G>T	c.(3004-3006)aGg>aTg	p.R1002M	NPC1L1_ENST00000381160.3_Missense_Mutation_p.R1002M|NPC1L1_ENST00000546276.1_Missense_Mutation_p.R956M	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1002					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.R1002M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CACCGAGGGCCTCACAGAGCC	0.567																																							uc003tlb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(3004-3006)AGG>ATG		Niemann-Pick C1-like protein 1 isoform 1	Ezetimibe(DB00973)						146.0	145.0	145.0					7																	44560666		2203	4300	6503	SO:0001583	missense	29881				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding	g.chr7:44560666C>A		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3005G>T	7.37:g.44560666C>A	ENSP00000289547:p.Arg1002Met					NPC1L1_uc003tlc.2_Missense_Mutation_p.R1002M|NPC1L1_uc011kbw.1_Missense_Mutation_p.R956M|NPC1L1_uc003tla.2_Missense_Mutation_p.R5M	p.R1002M	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN			13	3061	-			1002			Cytoplasmic (Potential).		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	c.3005G>T	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128939	0.77549	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.94280	-3.3;-3.3;-3.39	5.26	5.26	0.73747	.	0.064020	0.64402	D	0.000020	D	0.95579	0.8563	L	0.55103	1.725	0.47153	D	0.999335	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.989;0.996;0.986;0.99	D	0.95410	0.8497	10	0.51188	T	0.08	-31.3461	16.3366	0.83064	0.0:1.0:0.0:0.0	.	956;1002;1002;1002	B7ZLE6;Q17RV5;D3DVK9;Q9UHC9	.;.;.;NPCL1_HUMAN	M	1002;1002;956	ENSP00000289547:R1002M;ENSP00000370552:R1002M;ENSP00000438033:R956M	ENSP00000289547:R1002M	R	-	2	0	NPC1L1	44527191	0.720000	0.27996	0.901000	0.35422	0.868000	0.49771	4.048000	0.57390	2.476000	0.83614	0.585000	0.79938	AGG		0.567	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		35	215	1	0	5.71845e-15	0.005524	9.37672e-15	35	215				
WBSCR17	64409	broad.mit.edu	37	7	71142242	71142242	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:71142242T>A	ENST00000333538.5	+	9	2085	c.1451T>A	c.(1450-1452)cTg>cAg	p.L484Q	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	484	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L484Q(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CAGGGGCCGCTGGAGAACCAC	0.537																																							uc003tvy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7						c.(1450-1452)CTG>CAG		UDP-GalNAc:polypeptide							223.0	222.0	222.0					7																	71142242		2203	4300	6503	SO:0001583	missense	64409					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr7:71142242T>A	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1451T>A	7.37:g.71142242T>A	ENSP00000329654:p.Leu484Gln					WBSCR17_uc003tvz.2_Missense_Mutation_p.L183Q	p.L484Q	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN			9	1451	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)	484			Ricin B-type lectin.|Lumenal (Potential).		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	c.1451T>A	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	T	12.39	1.924366	0.34002	.	.	ENSG00000185274	ENST00000333538	T	0.25414	1.8	5.2	3.99	0.46301	Ricin B-related lectin (1);Ricin B lectin (3);	0.312863	0.29707	N	0.011419	T	0.12817	0.0311	N	0.14661	0.345	0.34048	D	0.655756	B	0.10296	0.003	B	0.19946	0.027	T	0.18461	-1.0336	10	0.12766	T	0.61	.	8.0113	0.30355	0.3164:0.0:0.0:0.6836	.	484	Q6IS24	GLTL3_HUMAN	Q	484	ENSP00000329654:L484Q	ENSP00000329654:L484Q	L	+	2	0	WBSCR17	70780178	1.000000	0.71417	0.954000	0.39281	0.935000	0.57460	4.112000	0.57845	2.175000	0.68902	0.528000	0.53228	CTG		0.537	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		19	179	0	0	0	0.007413	0	19	179				
PTPN12	5782	broad.mit.edu	37	7	77261701	77261701	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:77261701C>T	ENST00000248594.6	+	14	2305	c.2033C>T	c.(2032-2034)cCt>cTt	p.P678L	PTPN12_ENST00000435495.2_Missense_Mutation_p.P548L|PTPN12_ENST00000415482.2_Missense_Mutation_p.P559L	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	678					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.P678L(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						CCTCCCCTACCTGAAAGAACT	0.318																																							uc003ugh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(2032-2034)CCT>CTT		protein tyrosine phosphatase, non-receptor type							179.0	166.0	170.0					7																	77261701		2203	4300	6503	SO:0001583	missense	5782					soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding	g.chr7:77261701C>T		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.2033C>T	7.37:g.77261701C>T	ENSP00000248594:p.Pro678Leu					PTPN12_uc011kgp.1_Missense_Mutation_p.P559L|PTPN12_uc011kgq.1_Missense_Mutation_p.P548L|PTPN12_uc010lds.2_Missense_Mutation_p.P410L	p.P678L	NM_002835	NP_002826	Q05209	PTN12_HUMAN			14	2124	+			678					A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	37	c.2033C>T	CCDS5592.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672985	0.88445	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000435495	T;T;T	0.23950	2.45;1.88;1.88	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.54175	0.1842	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.54443	-0.8293	10	0.87932	D	0	.	18.4626	0.90745	0.0:1.0:0.0:0.0	.	678	Q05209	PTN12_HUMAN	L	678;559;548	ENSP00000248594:P678L;ENSP00000392429:P559L;ENSP00000397991:P548L	ENSP00000248594:P678L	P	+	2	0	PTPN12	77099637	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.381000	0.66208	2.786000	0.95864	0.563000	0.77884	CCT		0.318	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3			57	104	0	0	0	0.01441	0	57	104				
RSBN1L	222194	broad.mit.edu	37	7	77378976	77378976	+	Silent	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:77378976T>C	ENST00000334955.8	+	3	966	c.939T>C	c.(937-939)taT>taC	p.Y313Y	RSBN1L_ENST00000445288.1_Silent_p.Y43Y	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	313						nucleus (GO:0005634)		p.Y313Y(1)		central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCAAGAACTATGATTCCAAAA	0.378																																							uc010ldt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(937-939)TAT>TAC		round spermatid basic protein 1-like							75.0	70.0	71.0					7																	77378976		1849	4100	5949	SO:0001819	synonymous_variant	222194					nucleus		g.chr7:77378976T>C	AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.939T>C	7.37:g.77378976T>C						RSBN1L_uc003ugm.2_Silent_p.Y95Y	p.Y313Y	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN			3	983	+			313					C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Silent	SNP	ENST00000334955.8	37	c.939T>C	CCDS43607.1																																																																																				0.378	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340455.3	NM_198467		39	57	0	0	0	0.006999	0	39	57				
PCLO	27445	broad.mit.edu	37	7	82791757	82791757	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:82791757T>C	ENST00000333891.9	-	1	489	c.152A>G	c.(151-153)gAg>gGg	p.E51G	PCLO_ENST00000423517.2_Missense_Mutation_p.E51G	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E51G(3)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCTCCTCTCCTCTTCGCTCAG	0.701																																							uc003uhx.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(7)	7						c.(151-153)GAG>GGG		piccolo isoform 1							23.0	28.0	26.0					7																	82791757		2071	4192	6263	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82791757T>C	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.152A>G	7.37:g.82791757T>C	ENSP00000334319:p.Glu51Gly					PCLO_uc003uhv.2_Missense_Mutation_p.E51G	p.E51G	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			1	441	-			51						Missense_Mutation	SNP	ENST00000333891.9	37	c.152A>G	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380132	0.61845	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.24723	1.84;1.85	4.33	4.33	0.51752	.	.	.	.	.	T	0.25082	0.0609	N	0.24115	0.695	0.80722	D	1	P;P	0.50272	0.933;0.933	P;P	0.48654	0.461;0.585	T	0.05733	-1.0867	9	0.87932	D	0	.	13.6687	0.62412	0.0:0.0:0.0:1.0	.	51;51	Q9Y6V0-5;Q9Y6V0-6	.;.	G	51	ENSP00000334319:E51G;ENSP00000388393:E51G	ENSP00000334319:E51G	E	-	2	0	PCLO	82629693	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.851000	0.62896	1.808000	0.52836	0.454000	0.30748	GAG		0.701	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		2	3	0	0	0	0.004672	0	2	3				
MUC17	140453	broad.mit.edu	37	7	100676470	100676470	+	Silent	SNP	A	A	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:100676470A>C	ENST00000306151.4	+	3	1837	c.1773A>C	c.(1771-1773)tcA>tcC	p.S591S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	591	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S591S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCACCACTTCAACAACTCCTG	0.483																																							uc003uxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(1771-1773)TCA>TCC		mucin 17 precursor							244.0	247.0	246.0					7																	100676470		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100676470A>C	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1773A>C	7.37:g.100676470A>C						MUC17_uc010lho.1_RNA	p.S591S	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	1826	+	Lung NSC(181;0.136)|all_lung(186;0.182)		591			Extracellular (Potential).|7.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.1773A>C	CCDS34711.1																																																																																				0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		22	183	0	0	0	0.00333	0	22	183				
DOCK4	9732	broad.mit.edu	37	7	111368560	111368560	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:111368560C>A	ENST00000437633.1	-	52	5927	c.5671G>T	c.(5671-5673)Gag>Tag	p.E1891*	DOCK4_ENST00000428084.1_Nonsense_Mutation_p.E1900*|DOCK4_ENST00000494651.2_Nonsense_Mutation_p.E774*	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1891	Pro-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.E1891*(1)|p.E1850*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CGCACTGGCTCCTCCCCGCCG	0.667																																							uc003vfx.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(5671-5673)GAG>TAG		dedicator of cytokinesis 4							23.0	29.0	27.0					7																	111368560		2058	4178	6236	SO:0001587	stop_gained	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111368560C>A		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5671G>T	7.37:g.111368560C>A	ENSP00000404179:p.Glu1891*					DOCK4_uc011kml.1_Nonsense_Mutation_p.E772*|DOCK4_uc011kmm.1_Nonsense_Mutation_p.E760*|DOCK4_uc003vfw.2_Nonsense_Mutation_p.E1303*|DOCK4_uc003vfy.2_Nonsense_Mutation_p.E1936*|DOCK4_uc003vfv.2_Nonsense_Mutation_p.E204*	p.E1891*	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN			52	5940	-		Acute lymphoblastic leukemia(1;0.0441)	1891			Pro-rich.		O14584|O94824|Q8NB45	Nonsense_Mutation	SNP	ENST00000437633.1	37	c.5671G>T	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	45|45	12.010565|12.010565	0.99627|0.99627	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288|ENST00000423057;ENST00000445943	.|.	.|.	.|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.149652|.	0.64402|.	D|.	0.000014|.	.|T	.|0.76256	.|0.3962	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74321	.|-0.3703	.|4	0.48119|.	T|.	0.1|.	.|.	19.5919|19.5919	0.95518|0.95518	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|S	1879;1900;774;1891;1850|1313;1923	.|.	ENSP00000345432:E1850X|.	E|R	-|-	1|3	0|2	DOCK4|DOCK4	111155796|111155796	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	5.520000|5.520000	0.67080|0.67080	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	GAG|AGG		0.667	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705		9	28	1	0	1.58986e-06	0.008291	2.08135e-06	9	28				
TMEM209	84928	broad.mit.edu	37	7	129842495	129842495	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:129842495G>A	ENST00000397622.2	-	4	330	c.208C>T	c.(208-210)Ctt>Ttt	p.L70F	TMEM209_ENST00000473456.1_Missense_Mutation_p.L70F|TMEM209_ENST00000462753.1_Missense_Mutation_p.L69F|TMEM209_ENST00000336804.8_Missense_Mutation_p.L69F|RP11-775D22.3_ENST00000483283.1_RNA	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	70						integral component of membrane (GO:0016021)		p.L69F(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					AGAGATGCAAGGGCAAGCTCT	0.388																																							uc003vpn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(208-210)CTT>TTT		transmembrane protein 209							52.0	49.0	50.0					7																	129842495		1835	4082	5917	SO:0001583	missense	84928					integral to membrane		g.chr7:129842495G>A		CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.208C>T	7.37:g.129842495G>A	ENSP00000380747:p.Leu70Phe					TMEM209_uc010lmc.1_Missense_Mutation_p.L70F|TMEM209_uc003vpo.2_Missense_Mutation_p.L70F	p.L70F	NM_032842	NP_116231	Q96SK2	TM209_HUMAN			4	331	-	Melanoma(18;0.0435)		70			Helical; (Potential).		A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	ENST00000397622.2	37	c.208C>T	CCDS47712.1	.	.	.	.	.	.	.	.	.	.	G	9.930	1.214695	0.22289	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804;ENST00000484249;ENST00000471985	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	5.24	1.41	0.22369	.	0.329961	0.33057	N	0.005338	T	0.19208	0.0461	N	0.16066	0.365	0.38025	D	0.934979	B;B;B	0.15719	0.011;0.002;0.014	B;B;B	0.17098	0.01;0.007;0.017	T	0.08722	-1.0708	10	0.25751	T	0.34	-12.5238	9.4967	0.38993	0.368:0.0:0.632:0.0	.	70;70;70	Q96SK2-3;Q96SK2-4;Q96SK2	.;.;TM209_HUMAN	F	70;69;70;69;70;113	ENSP00000380747:L70F;ENSP00000419697:L69F;ENSP00000417258:L70F;ENSP00000338388:L69F;ENSP00000419852:L113F	ENSP00000338388:L69F	L	-	1	0	TMEM209	129629731	0.997000	0.39634	0.947000	0.38551	0.746000	0.42486	1.801000	0.38843	0.317000	0.23160	0.591000	0.81541	CTT		0.388	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349339.1	NM_032842		17	24	0	0	0	0.004007	0	17	24				
CPA4	51200	broad.mit.edu	37	7	129950739	129950739	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:129950739G>A	ENST00000222482.4	+	9	934	c.906G>A	c.(904-906)aaG>aaA	p.K302K	CPA4_ENST00000493259.1_Silent_p.K198K|CPA4_ENST00000445470.2_Silent_p.K269K	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	302					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.K302K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					GGAATTTCAAGGGCTTCATCG	0.512																																							uc003vpr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(904-906)AAG>AAA		carboxypeptidase A4 preproprotein							148.0	142.0	144.0					7																	129950739		2203	4300	6503	SO:0001819	synonymous_variant	51200				histone acetylation|proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129950739G>A	AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.906G>A	7.37:g.129950739G>A						CPA4_uc011kpd.1_Silent_p.K269K|CPA4_uc011kpe.1_Silent_p.K198K	p.K302K	NM_016352	NP_057436	Q9UI42	CBPA4_HUMAN			9	953	+	Melanoma(18;0.0435)		302					B7Z576|Q86UY9	Silent	SNP	ENST00000222482.4	37	c.906G>A	CCDS5818.1																																																																																				0.512	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352		25	163	0	0	0	0.010818	0	25	163				
KCNH2	3757	broad.mit.edu	37	7	150649748	150649748	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:150649748G>T	ENST00000262186.5	-	6	1723	c.1322C>A	c.(1321-1323)cCt>cAt	p.P441H	KCNH2_ENST00000392968.2_Missense_Mutation_p.P345H|KCNH2_ENST00000330883.4_Missense_Mutation_p.P101H|KCNH2_ENST00000430723.3_Missense_Mutation_p.P441H	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	441					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.P441H(2)		NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CTCGGTAGCAGGCGGGCCTTC	0.602																																					GBM(137;110 1844 13671 20123 45161)	GBM(137;110 1844 13671 20123 45161)	uc003wic.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(1)	4						c.(1321-1323)CCT>CAT		voltage-gated potassium channel, subfamily H,	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)						128.0	120.0	123.0					7																	150649748		2203	4300	6503	SO:0001583	missense	3757				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity	g.chr7:150649748G>T	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.1322C>A	7.37:g.150649748G>T	ENSP00000262186:p.Pro441His					KCNH2_uc003wib.2_Missense_Mutation_p.P101H|KCNH2_uc011kux.1_Missense_Mutation_p.P345H|KCNH2_uc003wid.2_Missense_Mutation_p.P101H|KCNH2_uc003wie.2_Missense_Mutation_p.P441H	p.P441H	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	6	1335	-	all_neural(206;0.219)		441			Extracellular (Potential).		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	c.1322C>A	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	G	3.742	-0.053378	0.07362	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186;ENST00000350328;ENST00000430723	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	4.59	1.65	0.23941	.	0.771994	0.12280	N	0.482953	D	0.90003	0.6879	N	0.24115	0.695	0.09310	N	1	B;P;P;B;P	0.45474	0.015;0.837;0.553;0.235;0.859	B;P;B;B;P	0.53401	0.033;0.605;0.321;0.139;0.725	T	0.81057	-0.1105	10	0.59425	D	0.04	.	3.6787	0.08302	0.2213:0.0:0.5429:0.2358	.	345;441;101;441;101	C4PFH9;G5E9I0;Q708S9;Q12809;Q12809-2	.;.;.;KCNH2_HUMAN;.	H	101;345;441;101;441	ENSP00000328531:P101H;ENSP00000376695:P345H;ENSP00000262186:P441H;ENSP00000387657:P441H	ENSP00000262186:P441H	P	-	2	0	KCNH2	150280681	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.119000	0.10676	0.021000	0.15133	0.549000	0.68633	CCT		0.602	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238		40	59	1	0	1.49673e-21	0.00623	2.7097e-21	40	59				
ESYT2	57488	broad.mit.edu	37	7	158534254	158534254	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr7:158534254C>A	ENST00000251527.5	-	17	2274	c.2209G>T	c.(2209-2211)Gcc>Tcc	p.A737S	ESYT2_ENST00000435514.2_Missense_Mutation_p.A172S	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	765	Poly-Ser.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)	p.A737S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						TCCTGGGTGGCGATGGGCAGC	0.637																																							uc003wob.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|kidney(1)	3						c.(2209-2211)GCC>TCC		family with sequence similarity 62 (C2 domain							53.0	51.0	52.0					7																	158534254		2203	4300	6503	SO:0001583	missense	57488					integral to membrane|plasma membrane		g.chr7:158534254C>A	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2209G>T	7.37:g.158534254C>A	ENSP00000251527:p.Ala737Ser					ESYT2_uc003woc.1_Missense_Mutation_p.A561S|ESYT2_uc003wny.1_RNA|ESYT2_uc003wnz.1_Missense_Mutation_p.A176S|ESYT2_uc003woa.1_Missense_Mutation_p.A314S	p.A737S	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN			17	2275	-			765					A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	37	c.2209G>T	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995862	0.54147	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000435514;ENST00000377650	T;T;T	0.21191	2.02;2.04;2.45	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	M	0.68952	2.095	0.80722	D	1	D;P	0.63046	0.992;0.818	P;B	0.59012	0.85;0.399	T	0.20107	-1.0285	10	0.02654	T	1	-11.5094	17.885	0.88851	0.0:1.0:0.0:0.0	.	737;765	A0FGR8-2;A0FGR8	.;ESYT2_HUMAN	S	737;786;728;172;172	ENSP00000251527:A737S;ENSP00000275418:A728S;ENSP00000411488:A172S	ENSP00000251527:A737S	A	-	1	0	ESYT2	158227015	1.000000	0.71417	0.996000	0.52242	0.898000	0.52572	4.467000	0.60155	2.541000	0.85698	0.655000	0.94253	GCC		0.637	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728		5	39	1	0	0.00116845	0.001168	0.00131114	5	39				
RP1L1	94137	broad.mit.edu	37	8	10470795	10470795	+	Silent	SNP	C	C	G	rs368591131		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:10470795C>G	ENST00000382483.3	-	4	1036	c.813G>C	c.(811-813)acG>acC	p.T271T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	271					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.T271T(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCAGCCGTGGCGTGCTGCCTG	0.647																																							uc003wtc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(811-813)ACG>ACC		retinitis pigmentosa 1-like 1							53.0	59.0	57.0					8																	10470795		1992	4173	6165	SO:0001819	synonymous_variant	94137				intracellular signal transduction			g.chr8:10470795C>G	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.813G>C	8.37:g.10470795C>G							p.T271T	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1042	-			271					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	c.813G>C	CCDS43708.1																																																																																				0.647	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			25	49	0	0	0	0.004656	0	25	49				
CSGALNACT1	55790	broad.mit.edu	37	8	19297443	19297443	+	Splice_Site	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:19297443C>G	ENST00000454498.2	-	6	1865		c.e6-1		CSGALNACT1_ENST00000311540.4_Splice_Site|CSGALNACT1_ENST00000518542.1_Splice_Site|CSGALNACT1_ENST00000522854.1_Splice_Site|CSGALNACT1_ENST00000332246.6_Splice_Site|CSGALNACT1_ENST00000544602.1_Splice_Site	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1						anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)	p.?(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		GCACATCTCCCTGGAAAACAA	0.413																																							uc011kyn.1		NA																	1	Unknown(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.e6-1		chondroitin sulfate							104.0	87.0	93.0					8																	19297443		2203	4300	6503	SO:0001630	splice_region_variant	55790				anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity	g.chr8:19297443C>G	AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.852-1G>C	8.37:g.19297443C>G						CSGALNACT1_uc011kyo.1_Splice_Site_p.R284_splice|CSGALNACT1_uc003wzg.2_Splice_Site|CSGALNACT1_uc011kyp.1_Splice_Site_p.R283_splice|CSGALNACT1_uc003wzh.2_Intron	p.R284_splice	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN		Colorectal(111;0.182)	6	1916	-								B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	Splice_Site	SNP	ENST00000454498.2	37	c.852_splice	CCDS6010.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452574	0.63290	.	.	ENSG00000147408	ENST00000454498;ENST00000332246;ENST00000311540;ENST00000522854;ENST00000544602	.	.	.	5.8	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6477	0.56744	0.0:0.9204:0.0:0.0796	.	.	.	.	.	-1	.	.	.	-	.	.	CSGALNACT1	19341723	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.204000	0.72143	1.467000	0.48044	-0.136000	0.14681	.		0.413	CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375204.1	NM_018371	Intron	10	32	0	0	0	0.010729	0	10	32				
STC1	6781	broad.mit.edu	37	8	23711941	23711941	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:23711941G>T	ENST00000290271.2	-	1	379	c.96C>A	c.(94-96)tcC>tcA	p.S32S	STC1_ENST00000524323.1_5'Flank	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	32					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.S32S(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		CCGCCACTCGGGATTTCCTGG	0.532																																							uc003xdw.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|upper_aerodigestive_tract(1)	4						c.(94-96)TCC>TCA		stanniocalcin 1 precursor							70.0	72.0	72.0					8																	23711941		2203	4300	6503	SO:0001819	synonymous_variant	6781				cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity	g.chr8:23711941G>T		CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.96C>A	8.37:g.23711941G>T							p.S32S	NM_003155	NP_003146	P52823	STC1_HUMAN		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)	1	380	-		Prostate(55;0.055)|Breast(100;0.116)	32					B4DN22|Q71UE5	Silent	SNP	ENST00000290271.2	37	c.96C>A	CCDS6043.1																																																																																				0.532	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215143.1			10	46	1	0	7.48243e-07	0.006214	9.87518e-07	10	46				
NUGGC	389643	broad.mit.edu	37	8	27886883	27886883	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:27886883C>A	ENST00000413272.2	-	17	2196	c.2054G>T	c.(2053-2055)cGg>cTg	p.R685L	NUGGC_ENST00000341513.6_Missense_Mutation_p.R685L	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	685					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R685L(2)									ATCTTTCATCCGCTCACACGC	0.522																																							uc003xgm.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(2053-2055)CGG>CTG		speckled-like pattern in the germinal center							63.0	65.0	64.0					8																	27886883		2014	4179	6193	SO:0001583	missense	389643					nucleus	GTP binding|GTPase activity	g.chr8:27886883C>A	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.2054G>T	8.37:g.27886883C>A	ENSP00000408697:p.Arg685Leu						p.R685L	NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)	17	2197	-		Ovarian(32;0.0218)	685					Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	c.2054G>T	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.213150	0.58452	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.27720	1.65;1.65	5.56	5.56	0.83823	.	0.108390	0.64402	D	0.000007	T	0.28067	0.0692	L	0.32530	0.975	0.43819	D	0.99638	P	0.40515	0.719	B	0.40199	0.322	T	0.05053	-1.0909	10	0.72032	D	0.01	-21.866	15.0246	0.71659	0.0:1.0:0.0:0.0	.	685	Q68CJ6	SLIP_HUMAN	L	685	ENSP00000408697:R685L;ENSP00000345031:R685L	ENSP00000345031:R685L	R	-	2	0	C8orf80	27942802	0.977000	0.34250	0.975000	0.42487	0.258000	0.26162	2.774000	0.47694	2.608000	0.88229	0.655000	0.94253	CGG		0.522	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906		3	16	1	0	6.4e-05	0.004672	7.65967e-05	3	16				
TEX15	56154	broad.mit.edu	37	8	30705647	30705647	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:30705647C>T	ENST00000256246.2	-	1	961	c.887G>A	c.(886-888)tGt>tAt	p.C296Y	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	296					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.C296Y(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TATTTTATCACAGCTTTTCCC	0.303																																							uc003xil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(886-888)TGT>TAT		testis expressed 15							49.0	53.0	52.0					8																	30705647		2202	4298	6500	SO:0001583	missense	56154							g.chr8:30705647C>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.887G>A	8.37:g.30705647C>T	ENSP00000256246:p.Cys296Tyr						p.C296Y	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	887	-			296						Missense_Mutation	SNP	ENST00000256246.2	37	c.887G>A	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	1.281	-0.610381	0.03690	.	.	ENSG00000133863	ENST00000256246	T	0.14266	2.52	5.08	-0.995	0.10222	.	0.736785	0.12671	N	0.448795	T	0.08891	0.0220	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.29671	-1.0004	10	0.87932	D	0	.	5.2513	0.15522	0.0:0.3695:0.1488:0.4817	.	296	Q9BXT5	TEX15_HUMAN	Y	296	ENSP00000256246:C296Y	ENSP00000256246:C296Y	C	-	2	0	TEX15	30825189	0.000000	0.05858	0.002000	0.10522	0.035000	0.12851	-0.247000	0.08866	-0.090000	0.12462	-0.145000	0.13849	TGT		0.303	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			22	35	0	0	0	0.012319	0	22	35				
KCNU1	157855	broad.mit.edu	37	8	36694348	36694348	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:36694348C>A	ENST00000399881.3	+	14	1440	c.1403C>A	c.(1402-1404)aCc>aAc	p.T468N		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	468	RCK N-terminal.				multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.T468N(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AACTGGGACACCGGAGACAAC	0.443																																							uc010lvw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1402-1404)ACC>AAC		potassium channel, subfamily U, member 1							126.0	126.0	126.0					8																	36694348		1866	4122	5988	SO:0001583	missense	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36694348C>A	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1403C>A	8.37:g.36694348C>A	ENSP00000382770:p.Thr468Asn					KCNU1_uc003xjw.2_RNA	p.T468N	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	14	1490	+			468			RCK N-terminal.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000399881.3	37	c.1403C>A	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	C	1.198	-0.633345	0.03584	.	.	ENSG00000215262	ENST00000399881	T	0.42131	0.98	5.34	-2.73	0.05950	Potassium channel, calcium-activated, BK, alpha subunit (1);NAD(P)-binding domain (1);	1.231740	0.06440	U	0.725764	T	0.20333	0.0489	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.13442	-1.0509	10	0.39692	T	0.17	-6.7658	0.3726	0.00382	0.3826:0.1746:0.1894:0.2535	.	468	A8MYU2	KCNU1_HUMAN	N	468	ENSP00000382770:T468N	ENSP00000382770:T468N	T	+	2	0	KCNU1	36813506	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.129000	0.15830	-0.848000	0.04163	0.585000	0.79938	ACC		0.443	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		27	43	1	0	3.73988e-18	0.00632	6.48158e-18	27	43				
SNTG1	54212	broad.mit.edu	37	8	51621516	51621516	+	Missense_Mutation	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:51621516T>C	ENST00000522124.1	+	17	1923	c.1262T>C	c.(1261-1263)aTc>aCc	p.I421T	SNTG1_ENST00000518864.1_Missense_Mutation_p.I421T|SNTG1_ENST00000517473.1_Missense_Mutation_p.I421T|SNTG1_ENST00000276467.5_Missense_Mutation_p.I421T	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	421					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.I421T(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				ACAGGATTTATCTGCTTTGAT	0.373																																							uc010lxy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)	5						c.(1261-1263)ATC>ACC		syntrophin, gamma 1							176.0	151.0	160.0					8																	51621516		2203	4300	6503	SO:0001583	missense	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51621516T>C	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1262T>C	8.37:g.51621516T>C	ENSP00000429842:p.Ile421Thr					SNTG1_uc003xqs.1_Missense_Mutation_p.I421T|SNTG1_uc010lxz.1_Missense_Mutation_p.I421T|SNTG1_uc011ldl.1_RNA	p.I421T	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			18	1633	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	421					Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	c.1262T>C	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.712477	0.30322	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92	5.69	5.69	0.88448	.	0.099939	0.64402	D	0.000002	T	0.46308	0.1386	N	0.02539	-0.55	0.47862	D	0.999534	B;B	0.27559	0.001;0.181	B;B	0.21708	0.002;0.036	T	0.55003	-0.8208	10	0.02654	T	1	-23.7823	15.1379	0.72583	0.0:0.0:0.0:1.0	.	421;421	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	T	421	ENSP00000429276:I421T;ENSP00000429842:I421T;ENSP00000431123:I421T;ENSP00000276467:I421T	ENSP00000276467:I421T	I	+	2	0	SNTG1	51784069	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.159000	0.77483	2.168000	0.68352	0.528000	0.53228	ATC		0.373	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			13	53	0	0	0	0.001855	0	13	53				
SOX17	64321	broad.mit.edu	37	8	55370910	55370910	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:55370910C>A	ENST00000297316.4	+	1	416	c.212C>A	c.(211-213)cCg>cAg	p.P71Q		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	71					angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P71Q(1)		endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			ATCCGGCGGCCGATGAACGCT	0.677																																							uc003xsb.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(211-213)CCG>CAG		SRY-box 17							20.0	24.0	23.0					8																	55370910		2201	4296	6497	SO:0001583	missense	64321				angiogenesis|cardiac cell fate determination|endocardial cell differentiation|endocardium formation|endoderm formation|heart formation|heart looping|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|outflow tract morphogenesis|positive regulation of transcription, DNA-dependent|protein destabilization|protein stabilization|regulation of embryonic development|renal system development|vasculogenesis|Wnt receptor signaling pathway	transcription factor complex	beta-catenin binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding	g.chr8:55370910C>A	AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.212C>A	8.37:g.55370910C>A	ENSP00000297316:p.Pro71Gln						p.P71Q	NM_022454	NP_071899	Q9H6I2	SOX17_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)		1	416	+		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	71			HMG box.			Missense_Mutation	SNP	ENST00000297316.4	37	c.212C>A	CCDS6159.1	.	.	.	.	.	.	.	.	.	.	C	34	5.313588	0.95655	.	.	ENSG00000164736	ENST00000297316	D	0.99207	-5.56	4.45	4.45	0.53987	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	H	0.99545	4.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96758	0.9559	10	0.87932	D	0	.	17.2655	0.87085	0.0:1.0:0.0:0.0	.	71	Q9H6I2	SOX17_HUMAN	Q	71	ENSP00000297316:P71Q	ENSP00000297316:P71Q	P	+	2	0	SOX17	55533463	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.149000	0.77396	2.464000	0.83262	0.561000	0.74099	CCG		0.677	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378526.2			6	15	1	0	3.59834e-05	0.001168	4.39195e-05	6	15				
RP1	6101	broad.mit.edu	37	8	55537445	55537445	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:55537445A>T	ENST00000220676.1	+	4	1151	c.1003A>T	c.(1003-1005)Atg>Ttg	p.M335L		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	335					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.M335L(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GACAGTTGAGATGAAAGTTCG	0.318																																					Colon(91;1014 1389 7634 14542 40420)	Colon(91;1014 1389 7634 14542 40420)	uc003xsd.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(4)|pancreas(1)	12						c.(1003-1005)ATG>TTG		retinitis pigmentosa RP1 protein							67.0	67.0	67.0					8																	55537445		2203	4300	6503	SO:0001583	missense	6101				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding	g.chr8:55537445A>T	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.1003A>T	8.37:g.55537445A>T	ENSP00000220676:p.Met335Leu					RP1_uc011ldy.1_Intron	p.M335L	NM_006269	NP_006260	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)		4	1151	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	335						Missense_Mutation	SNP	ENST00000220676.1	37	c.1003A>T	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.146612	0.57044	.	.	ENSG00000104237	ENST00000220676	T	0.36699	1.24	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000001	T	0.63177	0.2489	M	0.82323	2.585	0.46874	D	0.999237	D	0.76494	0.999	D	0.76071	0.987	T	0.69935	-0.5010	10	0.87932	D	0	.	14.8752	0.70488	1.0:0.0:0.0:0.0	.	335	P56715	RP1_HUMAN	L	335	ENSP00000220676:M335L	ENSP00000220676:M335L	M	+	1	0	RP1	55699998	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.518000	0.81795	1.914000	0.55421	0.533000	0.62120	ATG		0.318	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		12	29	0	0	0	0.010729	0	12	29				
GGH	8836	broad.mit.edu	37	8	63927974	63927974	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:63927974C>A	ENST00000260118.6	-	9	1276	c.874G>T	c.(874-876)Gag>Tag	p.E292*	RP11-659E9.2_ENST00000524309.1_RNA	NM_003878.2	NP_003869.1	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)	292	Gamma-glutamyl hydrolase. {ECO:0000255|PROSITE-ProRule:PRU00607}.				glutamine metabolic process (GO:0006541)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	exopeptidase activity (GO:0008238)|gamma-glutamyl-peptidase activity (GO:0034722)|omega peptidase activity (GO:0008242)	p.E292*(1)		breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(6)|stomach(1)	11	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|Methotrexate(DB00563)	GCTTTCTCCTCTTCAGATTCA	0.279																																							uc003xuw.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(874-876)GAG>TAG		gamma-glutamyl hydrolase precursor	Folic Acid(DB00158)|L-Glutamic Acid(DB00142)						80.0	79.0	79.0					8																	63927974		2199	4294	6493	SO:0001587	stop_gained	8836				glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity	g.chr8:63927974C>A	U55206	CCDS6177.1	8q12.3	2008-02-05			ENSG00000137563	ENSG00000137563	3.4.19.9		4248	protein-coding gene	gene with protein product		601509				8816764, 10570974	Standard	NM_003878		Approved		uc003xuw.3	Q92820	OTTHUMG00000164365	ENST00000260118.6:c.874G>T	8.37:g.63927974C>A	ENSP00000260118:p.Glu292*						p.E292*	NM_003878	NP_003869	Q92820	GGH_HUMAN			9	1157	-	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)	292			Gamma-glutamyl hydrolase.			Nonsense_Mutation	SNP	ENST00000260118.6	37	c.874G>T	CCDS6177.1	.	.	.	.	.	.	.	.	.	.	C	37	6.276921	0.97435	.	.	ENSG00000137563	ENST00000260118	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-25.1928	18.3101	0.90195	0.0:1.0:0.0:0.0	.	.	.	.	X	292	.	ENSP00000260118:E292X	E	-	1	0	GGH	64090528	1.000000	0.71417	0.528000	0.27938	0.561000	0.35649	4.763000	0.62257	2.610000	0.88304	0.650000	0.86243	GAG		0.279	GGH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378453.1			4	26	1	0	0.00909568	0.009096	0.00973538	4	26				
KCNB2	9312	broad.mit.edu	37	8	73848769	73848769	+	Silent	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:73848769A>T	ENST00000523207.1	+	3	1767	c.1179A>T	c.(1177-1179)ctA>ctT	p.L393L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	393					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.L393L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AAACATTACTAGGGAAAATTG	0.438																																							uc003xzb.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(1177-1179)CTA>CTT		potassium voltage-gated channel, Shab-related							96.0	95.0	95.0					8																	73848769		2203	4300	6503	SO:0001819	synonymous_variant	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73848769A>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1179A>T	8.37:g.73848769A>T							p.L393L	NM_004770	NP_004761	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		3	1767	+	Breast(64;0.137)		393					Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	c.1179A>T	CCDS6209.1																																																																																				0.438	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		27	58	0	0	0	0.005443	0	27	58				
KCNB2	9312	broad.mit.edu	37	8	73850219	73850219	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:73850219G>T	ENST00000523207.1	+	3	3217	c.2629G>T	c.(2629-2631)Gac>Tac	p.D877Y		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	877					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.D877Y(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AGTCAAAAAGGACAGTAGTCA	0.488																																							uc003xzb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(2629-2631)GAC>TAC		potassium voltage-gated channel, Shab-related							94.0	91.0	92.0					8																	73850219		2203	4300	6503	SO:0001583	missense	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73850219G>T	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2629G>T	8.37:g.73850219G>T	ENSP00000430846:p.Asp877Tyr						p.D877Y	NM_004770	NP_004761	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		3	3217	+	Breast(64;0.137)		877			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	c.2629G>T	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445521	0.63178	.	.	ENSG00000182674	ENST00000523207	D	0.97480	-4.4	5.46	5.46	0.80206	.	1.667940	0.04077	U	0.309058	D	0.95516	0.8543	L	0.27053	0.805	0.58432	D	0.999997	P	0.49961	0.93	B	0.40982	0.345	D	0.87208	0.2245	10	0.72032	D	0.01	.	19.4868	0.95032	0.0:0.0:1.0:0.0	.	877	Q92953	KCNB2_HUMAN	Y	877	ENSP00000430846:D877Y	ENSP00000430846:D877Y	D	+	1	0	KCNB2	74012773	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	9.122000	0.94380	2.838000	0.97847	0.591000	0.81541	GAC		0.488	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		11	64	1	0	5.16669e-11	0.010729	7.76598e-11	11	64				
FABP9	646480	broad.mit.edu	37	8	82370629	82370629	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:82370629C>T	ENST00000379071.2	-	4	443	c.388G>A	c.(388-390)Gaa>Aaa	p.E130K	RP11-157I4.4_ENST00000524085.2_RNA	NM_001080526.1	NP_001073995.1	Q0Z7S8	FABP9_HUMAN	fatty acid binding protein 9, testis	130					acrosome assembly (GO:0001675)	acrosomal vesicle (GO:0001669)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.E130K(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6			Epithelial(68;0.186)			CACACCTTTTCGTAGATTCTG	0.398																																							uc011lfo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(388-390)GAA>AAA		fatty acid binding protein 9, testis							118.0	109.0	112.0					8																	82370629		2203	4299	6502	SO:0001583	missense	646480						lipid binding|transporter activity	g.chr8:82370629C>T			8q21.13	2013-03-01			ENSG00000205186	ENSG00000205186		"""Fatty acid binding protein family"""	3563	protein-coding gene	gene with protein product						7958448	Standard	NM_001080526		Approved	PERF, T-FABP, PERF15	uc011lfo.2	Q0Z7S8	OTTHUMG00000164601	ENST00000379071.2:c.388G>A	8.37:g.82370629C>T	ENSP00000368362:p.Glu130Lys						p.E130K	NM_001080526	NP_001073995	Q0Z7S8	FABP9_HUMAN	Epithelial(68;0.186)		4	388	-			130						Missense_Mutation	SNP	ENST00000379071.2	37	c.388G>A		.	.	.	.	.	.	.	.	.	.	C	12.93	2.085803	0.36758	.	.	ENSG00000205186	ENST00000379071	T	0.06528	3.29	4.57	-0.544	0.11847	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.305062	0.33144	N	0.005240	T	0.03263	0.0095	N	0.20807	0.61	0.09310	N	0.999999	P	0.45428	0.858	B	0.35607	0.206	T	0.44772	-0.9306	10	0.52906	T	0.07	.	7.9863	0.30213	0.0:0.2836:0.5498:0.1666	.	130	Q0Z7S8	FABP9_HUMAN	K	130	ENSP00000368362:E130K	ENSP00000368362:E130K	E	-	1	0	FABP9	82533184	0.000000	0.05858	0.001000	0.08648	0.960000	0.62799	-0.644000	0.05415	-0.104000	0.12154	0.655000	0.94253	GAA		0.398	FABP9-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379367.2	NM_001080526		10	79	0	0	0	0.001855	0	10	79				
RMDN1	51115	broad.mit.edu	37	8	87498840	87498840	+	Missense_Mutation	SNP	C	C	A	rs567301087		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:87498840C>A	ENST00000406452.3	-	4	527	c.368G>T	c.(367-369)cGg>cTg	p.R123L	CPNE3_ENST00000198765.4_Intron|RMDN1_ENST00000430676.2_Missense_Mutation_p.R123L|RMDN1_ENST00000523911.1_Missense_Mutation_p.R79L|RMDN1_ENST00000519966.1_Missense_Mutation_p.R123L	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	123						microtubule (GO:0005874)|mitochondrion (GO:0005739)		p.R123L(1)									ACGTGATGCCCGTGCCAAACG	0.373																																							uc003ydu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(367-369)CGG>CTG		regulator of microtubule dynamics 1							113.0	102.0	106.0					8																	87498840		2203	4300	6503	SO:0001583	missense	51115					microtubule|spindle pole	binding	g.chr8:87498840C>A	AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.368G>T	8.37:g.87498840C>A	ENSP00000385927:p.Arg123Leu					FAM82B_uc011lfz.1_Missense_Mutation_p.R123L|FAM82B_uc011lga.1_Missense_Mutation_p.R123L	p.R123L	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN			4	528	-			123					A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Missense_Mutation	SNP	ENST00000406452.3	37	c.368G>T	CCDS34918.1	.	.	.	.	.	.	.	.	.	.	C	35	5.414134	0.96092	.	.	ENSG00000176623	ENST00000406452;ENST00000523911;ENST00000519966;ENST00000430676;ENST00000521045	T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43	5.88	5.88	0.94601	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.80819	0.4696	M	0.92970	3.365	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.999	D	0.84428	0.0575	10	0.87932	D	0	-14.8789	20.2381	0.98363	0.0:1.0:0.0:0.0	.	123;123;123	B4DZW6;E7EVI2;Q96DB5	.;.;RMD1_HUMAN	L	123;79;123;123;79	ENSP00000385927:R123L;ENSP00000429899:R79L;ENSP00000428661:R123L;ENSP00000409661:R123L;ENSP00000428743:R79L	ENSP00000385927:R123L	R	-	2	0	FAM82B	87567956	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.924000	0.75823	2.779000	0.95612	0.650000	0.86243	CGG		0.373	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033		33	41	1	0	4.4194e-11	0.013726	6.684e-11	33	41				
CNBD1	168975	broad.mit.edu	37	8	88249219	88249220	+	Missense_Mutation	DNP	TG	TG	GA	rs375254057		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:88249219_88249220TG>GA	ENST00000518476.1	+	6	701_702	c.650_651TG>GA	c.(649-651)cTG>cGA	p.L217R	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	217								p.L217R(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						TATAAAAATCTGATTGAAGGAA	0.361																																							uc003ydy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(649-651)CTG>CGA		cyclic nucleotide binding domain containing 1																																				SO:0001583	missense	168975							g.chr8:88249219_88249220TG>GA	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		Exception_encountered	8.37:g.88249219_88249220delinsGA	ENSP00000430073:p.Leu217Arg						p.L217R	NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN			6	698_699	+			217						Missense_Mutation	DNP	ENST00000518476.1	37	c.650_651TG>GA	CCDS55259.1																																																																																				0.361	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538		62	67	0	0	0	0.004672	0	62	67				
TMEM67	91147	broad.mit.edu	37	8	94808196	94808196	+	Missense_Mutation	SNP	G	G	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:94808196G>C	ENST00000453321.3	+	18	1899	c.1841G>C	c.(1840-1842)gGa>gCa	p.G614A	TMEM67_ENST00000409623.3_Missense_Mutation_p.G533A	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	614					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)	p.G614A(1)|p.G604A(1)		breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ACTTATGTTGGATGTGCCTTT	0.328																																							uc011lgk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1840-1842)GGA>GCA		meckelin isoform 1							140.0	140.0	140.0					8																	94808196		2202	4300	6502	SO:0001583	missense	91147				cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding	g.chr8:94808196G>C	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.1841G>C	8.37:g.94808196G>C	ENSP00000389998:p.Gly614Ala					TMEM67_uc010maw.2_Missense_Mutation_p.G320A|TMEM67_uc003yga.3_Missense_Mutation_p.G533A|TMEM67_uc011lgl.1_Missense_Mutation_p.G13A	p.G614A	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00896)		18	1912	+	Breast(36;4.14e-07)		614			Helical; (Potential).		B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	ENST00000453321.3	37	c.1841G>C	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	G	3.762	-0.049398	0.07407	.	.	ENSG00000164953	ENST00000453321;ENST00000409623	D;D	0.97016	-4.21;-4.21	5.28	5.28	0.74379	.	0.178537	0.48767	D	0.000171	D	0.89938	0.6860	N	0.12569	0.235	0.40037	D	0.975607	B;B;B	0.15930	0.007;0.015;0.005	B;B;B	0.18561	0.015;0.022;0.006	D	0.85135	0.0977	10	0.02654	T	1	-21.8941	15.8494	0.78916	0.0:0.145:0.855:0.0	.	614;533;533	Q5HYA8;B3KRU5;G5E9H2	MKS3_HUMAN;.;.	A	614;533	ENSP00000389998:G614A;ENSP00000386966:G533A	ENSP00000314488:G604A	G	+	2	0	TMEM67	94877372	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.968000	0.70413	2.637000	0.89404	0.557000	0.71058	GGA		0.328	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704		26	154	0	0	0	0.008361	0	26	154				
FBXO43	286151	broad.mit.edu	37	8	101153696	101153696	+	Silent	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:101153696G>A	ENST00000428847.2	-	2	1102	c.786C>T	c.(784-786)atC>atT	p.I262I		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	262					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.I228I(2)|p.I262I(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			AGTCATGTGTGATAGAGTCTT	0.378																																							uc003yjd.2		NA																	3	Substitution - coding silent(3)		lung(3)	kidney(1)|skin(1)	2						c.(784-786)ATC>ATT		F-box protein 43 isoform b							30.0	31.0	31.0					8																	101153696		1853	4077	5930	SO:0001819	synonymous_variant	286151				meiosis		zinc ion binding	g.chr8:101153696G>A	BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.786C>T	8.37:g.101153696G>A						FBXO43_uc003yje.2_Silent_p.I228I|FBXO43_uc010mbp.1_Silent_p.I262I	p.I262I	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)		2	1499	-	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		262						Silent	SNP	ENST00000428847.2	37	c.786C>T	CCDS47904.1																																																																																				0.378	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	XM_209918		26	33	0	0	0	0.00333	0	26	33				
DCSTAMP	81501	broad.mit.edu	37	8	105360984	105360984	+	Silent	SNP	G	G	A	rs201545994		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:105360984G>A	ENST00000297581.2	+	2	253	c.204G>A	c.(202-204)acG>acA	p.T68T	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Silent_p.T68T	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	68					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)		p.T68T(1)									GGATTATCACGTGTGTTCTGC	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		18522	0.001		0.0	False		,,,				2504	0.0						uc003ylx.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|large_intestine(1)|ovary(1)	4						c.(202-204)ACG>ACA		dendritic cell-specific transmembrane protein							132.0	120.0	124.0					8																	105360984		2203	4300	6503	SO:0001819	synonymous_variant	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105360984G>A	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.204G>A	8.37:g.105360984G>A							p.T68T	NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	253	+			68			Helical; (Potential).		B7ZVW2|E7ESG0|Q2M2D5	Silent	SNP	ENST00000297581.2	37	c.204G>A	CCDS6301.1																																																																																				0.507	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		7	88	0	0	0	0.00308	0	7	88				
PKHD1L1	93035	broad.mit.edu	37	8	110487490	110487490	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:110487490G>A	ENST00000378402.5	+	51	8853	c.8749G>A	c.(8749-8751)Gga>Aga	p.G2917R		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2917					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G2919R(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GACATTCTATGGATTCAAGGT	0.353										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(8749-8751)GGA>AGA		fibrocystin L precursor							68.0	63.0	64.0					8																	110487490		1837	4095	5932	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110487490G>A	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8749G>A	8.37:g.110487490G>A	ENSP00000367655:p.Gly2917Arg	HNSCC(38;0.096)					p.G2917R	NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		51	8853	+			2917			Extracellular (Potential).		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.8749G>A	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637968	0.87760	.	.	ENSG00000205038	ENST00000378402	D	0.85702	-2.02	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.82254	0.4997	L	0.47716	1.5	0.47153	D	0.99933	P	0.38395	0.629	B	0.37239	0.244	T	0.82701	-0.0327	10	0.48119	T	0.1	.	17.3018	0.87184	0.0:0.0:1.0:0.0	.	2917	Q86WI1	PKHL1_HUMAN	R	2917	ENSP00000367655:G2917R	ENSP00000367655:G2917R	G	+	1	0	PKHD1L1	110556666	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.740000	0.62087	2.671000	0.90904	0.655000	0.94253	GGA		0.353	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		6	34	0	0	0	0.001168	0	6	34				
PKHD1L1	93035	broad.mit.edu	37	8	110520355	110520355	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:110520355C>T	ENST00000378402.5	+	70	11361	c.11257C>T	c.(11257-11259)Ctt>Ttt	p.L3753F		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3753					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.L3757F(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTGTAAGTACCTTCCAGAGTG	0.353										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(11257-11259)CTT>TTT		fibrocystin L precursor							141.0	132.0	135.0					8																	110520355		1836	4092	5928	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110520355C>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11257C>T	8.37:g.110520355C>T	ENSP00000367655:p.Leu3753Phe	HNSCC(38;0.096)					p.L3753F	NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		70	11361	+			3753			Extracellular (Potential).		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.11257C>T	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.787479	0.31593	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85556	-2.0;-1.81	5.71	2.08	0.27032	.	0.108903	0.64402	D	0.000010	T	0.63546	0.2520	N	0.08118	0	0.26024	N	0.981833	B	0.06786	0.001	B	0.10450	0.005	T	0.47898	-0.9081	10	0.09338	T	0.73	.	5.637	0.17542	0.6982:0.147:0.1548:0.0	.	3753	Q86WI1	PKHL1_HUMAN	F	3753;681	ENSP00000367655:L3753F;ENSP00000437376:L681F	ENSP00000367655:L3753F	L	+	1	0	PKHD1L1	110589531	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	3.851000	0.55926	0.427000	0.26145	-1.154000	0.01816	CTT		0.353	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		14	84	0	0	0	0.004007	0	14	84				
CSMD3	114788	broad.mit.edu	37	8	113246614	113246614	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:113246614T>A	ENST00000297405.5	-	68	10964	c.10720A>T	c.(10720-10722)Aat>Tat	p.N3574Y	CSMD3_ENST00000343508.3_Missense_Mutation_p.N3534Y|CSMD3_ENST00000455883.2_Missense_Mutation_p.N3405Y|CSMD3_ENST00000352409.3_Missense_Mutation_p.N3504Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3574						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N3574Y(1)|p.N3534Y(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATTGCCCAATTTTCTTCCTTC	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(10720-10722)AAT>TAT		CUB and Sushi multiple domains 3 isoform 1							145.0	143.0	143.0					8																	113246614		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113246614T>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10720A>T	8.37:g.113246614T>A	ENSP00000297405:p.Asn3574Tyr	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.N2776Y|CSMD3_uc003ynt.2_Missense_Mutation_p.N3534Y|CSMD3_uc011lhx.1_Missense_Mutation_p.N3405Y	p.N3574Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			68	10879	-			3574			Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.10720A>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.221786	0.58560	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.26373	2.05;2.05;2.07;1.74;2.06	5.16	5.16	0.70880	.	0.358612	0.26528	N	0.023880	T	0.25158	0.0611	L	0.36672	1.1	0.26737	N	0.970477	B;B;B	0.33073	0.396;0.13;0.315	B;B;B	0.35655	0.087;0.024;0.207	T	0.23226	-1.0194	10	0.72032	D	0.01	.	15.1664	0.72828	0.0:0.0:0.0:1.0	.	3405;3574;3534	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Y	3534;3574;2844;3405;3504	ENSP00000345799:N3534Y;ENSP00000297405:N3574Y;ENSP00000341558:N2844Y;ENSP00000412263:N3405Y;ENSP00000343124:N3504Y	ENSP00000297405:N3574Y	N	-	1	0	CSMD3	113315790	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.361000	0.44160	2.173000	0.68751	0.533000	0.62120	AAT		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		16	148	0	0	0	0.00499	0	16	148				
TRPS1	7227	broad.mit.edu	37	8	116632271	116632271	+	Silent	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:116632271C>T	ENST00000220888.5	-	2	174	c.15G>A	c.(13-15)aaG>aaA	p.K5K	TRPS1_ENST00000520276.1_Silent_p.K9K|TRPS1_ENST00000395715.3_Silent_p.K18K|TRPS1_ENST00000519076.1_Silent_p.K5K|TRPS1_ENST00000519674.1_Silent_p.K5K			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	5					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.K5N(1)|p.K5K(1)|p.K18K(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GAGGGGGGTTCTTTTTCCGGA	0.413									Langer-Giedion syndrome																														uc003ynz.2		NA																	3	Substitution - coding silent(2)|Substitution - Missense(1)		lung(2)|large_intestine(1)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(13-15)AAG>AAA		zinc finger transcription factor TRPS1							57.0	54.0	55.0					8																	116632271		1836	4086	5922	SO:0001819	synonymous_variant	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116632271C>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.15G>A	8.37:g.116632271C>T						TRPS1_uc011lhy.1_Silent_p.K9K|TRPS1_uc003yny.2_Silent_p.K18K|TRPS1_uc010mcy.2_Silent_p.K5K	p.K5K	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		2	474	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		5					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37	c.15G>A																																																																																					0.413	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		3	51	0	0	0	0.009096	0	3	51				
COL14A1	7373	broad.mit.edu	37	8	121259871	121259871	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr8:121259871G>T	ENST00000297848.3	+	21	2769	c.2499G>T	c.(2497-2499)caG>caT	p.Q833H	COL14A1_ENST00000309791.4_Missense_Mutation_p.Q833H|COL14A1_ENST00000247781.3_Missense_Mutation_p.Q738H|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.Q833H(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CGGGGCCCCAGAACTTGCGGG	0.463																																							uc003yox.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(2497-2499)CAG>CAT		collagen, type XIV, alpha 1 precursor							66.0	60.0	62.0					8																	121259871		2203	4300	6503	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121259871G>T		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2499G>T	8.37:g.121259871G>T	ENSP00000297848:p.Gln833His					COL14A1_uc003yoy.2_Missense_Mutation_p.Q511H	p.Q833H	NM_021110	NP_066933	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		21	2764	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		833			Fibronectin type-III 7.			Missense_Mutation	SNP	ENST00000297848.3	37	c.2499G>T	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708574	0.30322	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.2	0.203	0.15195	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.768164	0.12695	N	0.446898	T	0.46776	0.1410	L	0.29908	0.895	0.80722	D	1	P;P	0.49696	0.663;0.927	B;P	0.49140	0.413;0.601	T	0.44360	-0.9333	10	0.62326	D	0.03	.	10.8334	0.46673	0.5667:0.0:0.4333:0.0	.	833;833	Q05707-2;Q05707	.;COEA1_HUMAN	H	833;833;738;646	ENSP00000311809:Q833H;ENSP00000297848:Q833H;ENSP00000247781:Q738H;ENSP00000409461:Q646H	ENSP00000247781:Q738H	Q	+	3	2	COL14A1	121329052	0.893000	0.30496	0.994000	0.49952	0.262000	0.26303	1.070000	0.30653	-0.047000	0.13423	-0.471000	0.05019	CAG		0.463	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		8	64	1	0	5.4927e-09	0.004482	7.68663e-09	8	64				
CCDC171	203238	broad.mit.edu	37	9	15784564	15784564	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:15784564C>T	ENST00000380701.3	+	21	3467	c.3139C>T	c.(3139-3141)Ctt>Ttt	p.L1047F	CCDC171_ENST00000297641.3_Missense_Mutation_p.L1047F	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	1047								p.L1047F(1)|p.L314F(1)									TAATGCATTACTTCGGGAAGA	0.383																																							uc003zmd.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3139-3141)CTT>TTT		hypothetical protein LOC203238							93.0	82.0	86.0					9																	15784564		2203	4300	6503	SO:0001583	missense	203238							g.chr9:15784564C>T	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.3139C>T	9.37:g.15784564C>T	ENSP00000370077:p.Leu1047Phe					C9orf93_uc003zme.2_Missense_Mutation_p.L962F|C9orf93_uc011lmu.1_Missense_Mutation_p.L1055F|C9orf93_uc003zmf.1_Missense_Mutation_p.L355F	p.L1047F	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN		GBM - Glioblastoma multiforme(50;4.84e-07)	21	3454	+			1047			Potential.		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	c.3139C>T	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	C	6.392	0.440359	0.12104	.	.	ENSG00000164989	ENST00000297641;ENST00000380689;ENST00000380701	T;T	0.69435	-0.4;-0.4	5.04	4.13	0.48395	.	0.303991	0.31450	N	0.007640	T	0.66655	0.2811	L	0.27053	0.805	0.80722	D	1	D;D;D	0.71674	0.998;0.987;0.994	P;P;P	0.62649	0.905;0.648;0.865	T	0.68209	-0.5469	10	0.62326	D	0.03	-4.8411	9.6083	0.39648	0.0:0.8426:0.0:0.1574	.	1055;314;1047	B7ZM22;A6NK04;Q6TFL3	.;.;CI093_HUMAN	F	1047;314;1047	ENSP00000297641:L1047F;ENSP00000370077:L1047F	ENSP00000297641:L1047F	L	+	1	0	C9orf93	15774564	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.874000	0.39568	2.500000	0.84329	0.655000	0.94253	CTT		0.383	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550		18	28	0	0	0	0.006122	0	18	28				
PTENP1	11191	broad.mit.edu	37	9	33676393	33676393	+	RNA	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:33676393G>A	ENST00000532280.1	-	0	1104					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		AGGATATTGCGCAACTCTGTA	0.368																																							uc003zth.3		NA																	0					0						c.(154-156)GCG>GTG		SubName: Full=Phosphatase and tensin homolog 2; Flags: Fragment;																																						11191							g.chr9:33676393G>A	AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33676393G>A							p.A52V	NR_023917						1	1026	-									Missense_Mutation	SNP	ENST00000532280.1	37	c.155C>T																																																																																					0.368	PTENP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395145.1	NR_023917		23	43	0	0	0	0.00278	0	23	43				
ANKRD20A4	728747	broad.mit.edu	37	9	69420299	69420299	+	Missense_Mutation	SNP	A	A	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:69420299A>C	ENST00000357336.3	+	13	1470	c.1189A>C	c.(1189-1191)Ata>Cta	p.I397L		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	397								p.I397L(1)		breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						AAGTGAAAAAATACAACTTTC	0.289																																							uc004afn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1189-1191)ATA>CTA		ankyrin repeat domain 20 family, member A4							22.0	39.0	33.0					9																	69420299		1287	2237	3524	SO:0001583	missense	728747							g.chr9:69420299A>C		CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.1189A>C	9.37:g.69420299A>C	ENSP00000349891:p.Ile397Leu						p.I397L	NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN			13	1301	+			397						Missense_Mutation	SNP	ENST00000357336.3	37	c.1189A>C	CCDS43828.1	.	.	.	.	.	.	.	.	.	.	A	3.062	-0.193096	0.06259	.	.	ENSG00000172014	ENST00000357336	T	0.35421	1.31	1.95	-3.91	0.04168	.	.	.	.	.	T	0.12220	0.0297	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.28554	-1.0040	9	0.09843	T	0.71	.	2.2572	0.04058	0.4062:0.0:0.3511:0.2427	.	397	Q4UJ75	A20A4_HUMAN	L	397	ENSP00000349891:I397L	ENSP00000349891:I397L	I	+	1	0	ANKRD20A4	68710119	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.095000	0.11077	-1.074000	0.03132	0.155000	0.16302	ATA		0.289	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143287.3	NM_001098805		4	59	0	0	0	0.001984	0	4	59				
PAPPA	5069	broad.mit.edu	37	9	119065156	119065156	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:119065156C>A	ENST00000328252.3	+	10	3443	c.3074C>A	c.(3073-3075)tCc>tAc	p.S1025Y	PAPPA_ENST00000534838.1_Missense_Mutation_p.S63Y|RP11-45A16.4_ENST00000451100.1_RNA	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1025					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S1025Y(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CAGTGGGCATCCAATGCTTCA	0.502																																							uc004bjn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|pancreas(1)	9						c.(3073-3075)TCC>TAC		pregnancy-associated plasma protein A							129.0	111.0	117.0					9																	119065156		2203	4300	6503	SO:0001583	missense	5069				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding	g.chr9:119065156C>A		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3074C>A	9.37:g.119065156C>A	ENSP00000330658:p.Ser1025Tyr					PAPPA_uc011lxp.1_Missense_Mutation_p.S720Y|PAPPA_uc011lxq.1_Missense_Mutation_p.S400Y	p.S1025Y	NM_002581	NP_002572	Q13219	PAPP1_HUMAN			10	3455	+			1025					B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	c.3074C>A	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.906570	0.92107	.	.	ENSG00000182752	ENST00000328252;ENST00000443904;ENST00000534838	T;T	0.50813	0.73;0.73	5.82	5.82	0.92795	.	0.100937	0.64402	D	0.000001	T	0.70622	0.3245	M	0.76328	2.33	0.58432	D	0.999995	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70487	0.961;0.969;0.909	T	0.72316	-0.4330	10	0.87932	D	0	-27.8244	20.0989	0.97860	0.0:1.0:0.0:0.0	.	63;469;1025	F5GZ19;E7EMD3;Q13219	.;.;PAPP1_HUMAN	Y	1025;469;63	ENSP00000330658:S1025Y;ENSP00000441461:S63Y	ENSP00000330658:S1025Y	S	+	2	0	PAPPA	118104977	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.696000	0.84270	2.764000	0.94973	0.650000	0.86243	TCC		0.502	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		12	39	1	0	6.40141e-05	0.010729	7.65967e-05	12	39				
ASTN2	23245	broad.mit.edu	37	9	119625875	119625875	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:119625875G>T	ENST00000313400.4	-	11	2127	c.2027C>A	c.(2026-2028)tCc>tAc	p.S676Y	ASTN2_ENST00000361209.2_Missense_Mutation_p.S625Y|ASTN2_ENST00000373996.3_Missense_Mutation_p.S672Y|ASTN2_ENST00000361477.3_5'UTR			O75129	ASTN2_HUMAN	astrotactin 2	676	EGF-like 2.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.S625Y(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACATCCCGAGGAATCCACCTG	0.607																																							uc004bjs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(2026-2028)TCC>TAC		astrotactin 2 isoform c							95.0	83.0	87.0					9																	119625875		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:119625875G>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.2027C>A	9.37:g.119625875G>T	ENSP00000314038:p.Ser676Tyr					ASTN2_uc004bjr.1_Missense_Mutation_p.S672Y|ASTN2_uc004bjt.1_Missense_Mutation_p.S625Y	p.S676Y	NM_198187	NP_937830	O75129	ASTN2_HUMAN			11	2128	-			676			Extracellular (Potential).|EGF-like 2.		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.2027C>A		.	.	.	.	.	.	.	.	.	.	G	18.53	3.643094	0.67244	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.16073	2.53;2.53;2.37;2.58	5.71	5.71	0.89125	.	0.141721	0.49305	D	0.000155	T	0.33469	0.0864	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.87578	0.998;0.991;0.986	T	0.01081	-1.1458	9	.	.	.	-22.5956	19.8381	0.96666	0.0:0.0:1.0:0.0	.	625;676;672	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	Y	676;672;399;625	ENSP00000314038:S676Y;ENSP00000363108:S672Y;ENSP00000363098:S399Y;ENSP00000354504:S625Y	.	S	-	2	0	ASTN2	118665696	1.000000	0.71417	0.996000	0.52242	0.839000	0.47603	9.429000	0.97481	2.690000	0.91761	0.655000	0.94253	TCC		0.607	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		6	22	1	0	8.12818e-05	0.001984	9.60783e-05	6	22				
TLR4	7099	broad.mit.edu	37	9	120476448	120476448	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:120476448C>A	ENST00000355622.6	+	3	2143	c.2042C>A	c.(2041-2043)tCa>tAa	p.S681*	TLR4_ENST00000394487.4_Nonsense_Mutation_p.S641*|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	681	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S681*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GTTATCTACTCAAGCCAGGAT	0.428																																							uc004bjz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(2041-2043)TCA>TAA		toll-like receptor 4 precursor							111.0	102.0	105.0					9																	120476448		2203	4300	6503	SO:0001587	stop_gained	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476448C>A	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2042C>A	9.37:g.120476448C>A	ENSP00000363089:p.Ser681*					TLR4_uc004bka.2_Nonsense_Mutation_p.S641*|TLR4_uc004bkb.2_Nonsense_Mutation_p.S481*	p.S681*	NM_138554	NP_612564	O00206	TLR4_HUMAN			3	2333	+			681			Cytoplasmic (Potential).|TIR.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Nonsense_Mutation	SNP	ENST00000355622.6	37	c.2042C>A	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	C	39	7.594996	0.98381	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	.	.	.	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	X	641;681	.	ENSP00000363089:S681X	S	+	2	0	TLR4	119516269	0.990000	0.36364	0.996000	0.52242	0.997000	0.91878	2.809000	0.47971	2.861000	0.98227	0.655000	0.94253	TCA		0.428	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		23	40	1	0	1.64293e-13	0.00333	2.61473e-13	23	40				
OR1N1	138883	broad.mit.edu	37	9	125288841	125288841	+	Silent	SNP	G	G	A	rs372806915		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:125288841G>A	ENST00000304880.2	-	1	731	c.732C>T	c.(730-732)tgC>tgT	p.C244C		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C244C(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						CACAAACAACGCAGAGGTGGG	0.552																																							uc004bmn.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|breast(1)|skin(1)	3						c.(730-732)TGC>TGT		olfactory receptor, family 1, subfamily N,		G		1,4405	2.1+/-5.4	0,1,2202	114.0	99.0	104.0		732	-0.8	0.0	9		104	0,8600		0,0,4300	no	coding-synonymous	OR1N1	NM_012363.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		244/312	125288841	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	138883				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125288841G>A	U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.732C>T	9.37:g.125288841G>A							p.C244C	NM_012363	NP_036495	Q8NGS0	OR1N1_HUMAN			1	732	-			244			Helical; Name=6; (Potential).		A3KFM1|O43870|Q6IF16|Q96R93	Silent	SNP	ENST00000304880.2	37	c.732C>T	CCDS6844.1																																																																																				0.552	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053938.1			5	21	0	0	0	0.001168	0	5	21				
TSC1	7248	broad.mit.edu	37	9	135797349	135797349	+	Nonsense_Mutation	SNP	C	C	A	rs118203392		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:135797349C>A	ENST00000298552.3	-	7	741	c.520G>T	c.(520-522)Gaa>Taa	p.E174*	TSC1_ENST00000403810.1_Nonsense_Mutation_p.E174*|TSC1_ENST00000440111.2_Nonsense_Mutation_p.E174*|TSC1_ENST00000545250.1_Nonsense_Mutation_p.E123*|TSC1_ENST00000475903.1_5'UTR	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	174					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.E174*(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		AGATAGACTTCCGCCACGTGG	0.483			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														uc004cca.2		NA	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	D|Mis|N|F|S	tuberous sclerosis 1 gene			"""E, O"""		hamartoma|renal cell			2	Substitution - Nonsense(1)|Unknown(1)		lung(1)|bone(1)	lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14	GRCh37	CM090913	TSC1	M	rs118203392	c.(520-522)GAA>TAA		tuberous sclerosis 1 protein isoform 1							104.0	98.0	100.0					9																	135797349		2203	4300	6503	SO:0001587	stop_gained	7248	Tuberous_Sclerosis	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	g.chr9:135797349C>A	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.520G>T	9.37:g.135797349C>A	ENSP00000298552:p.Glu174*					TSC1_uc004ccb.3_Nonsense_Mutation_p.E174*|TSC1_uc011mcq.1_Nonsense_Mutation_p.E123*|TSC1_uc011mcr.1_Nonsense_Mutation_p.E53*|TSC1_uc011mcs.1_Nonsense_Mutation_p.E53*|TSC1_uc004ccc.1_Nonsense_Mutation_p.E174*|TSC1_uc004ccd.2_Nonsense_Mutation_p.E174*|TSC1_uc004cce.1_Nonsense_Mutation_p.E174*	p.E174*	NM_000368	NP_000359	Q92574	TSC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)	7	754	-			174					B7Z897|Q5VVN5	Nonsense_Mutation	SNP	ENST00000298552.3	37	c.520G>T	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	C	36	5.679471	0.96774	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000537172;ENST00000424271;ENST00000403810	.	.	.	6.08	6.08	0.98989	.	0.043247	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-18.4772	12.9023	0.58133	0.0:0.9267:0.0:0.0733	.	.	.	.	X	174;174;123;53;53;174	.	ENSP00000298552:E174X	E	-	1	0	TSC1	134787170	1.000000	0.71417	0.971000	0.41717	0.769000	0.43574	6.091000	0.71406	2.894000	0.99253	0.591000	0.81541	GAA		0.483	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1			15	47	1	0	2.32078e-09	0.003163	3.29511e-09	15	47				
KCNT1	57582	broad.mit.edu	37	9	138670655	138670655	+	Nonsense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:138670655C>T	ENST00000263604.3	+	23	2659	c.2659C>T	c.(2659-2661)Cag>Tag	p.Q887*	KCNT1_ENST00000490355.2_Nonsense_Mutation_p.Q885*|KCNT1_ENST00000487664.1_Nonsense_Mutation_p.Q861*|KCNT1_ENST00000488444.2_Nonsense_Mutation_p.Q887*|KCNT1_ENST00000486577.2_Nonsense_Mutation_p.Q865*|KCNT1_ENST00000371757.2_Nonsense_Mutation_p.Q906*|KCNT1_ENST00000491806.2_Nonsense_Mutation_p.Q873*|KCNT1_ENST00000298480.5_Nonsense_Mutation_p.Q906*			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	887					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.Q906*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CGTCAACGTGCAGACCATGTT	0.637																																							uc011mdq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(2)|ovary(1)|pancreas(1)	4						c.(2716-2718)CAG>TAG		potassium channel, subfamily T, member 1							158.0	116.0	131.0					9																	138670655		2203	4300	6503	SO:0001587	stop_gained	57582					membrane	binding|calcium-activated potassium channel activity	g.chr9:138670655C>T	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2659C>T	9.37:g.138670655C>T	ENSP00000263604:p.Gln887*					KCNT1_uc011mdr.1_Nonsense_Mutation_p.Q733*|KCNT1_uc010nbf.2_Nonsense_Mutation_p.Q861*|KCNT1_uc004cgo.1_Nonsense_Mutation_p.Q655*	p.Q906*	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)	23	2790	+		Myeloproliferative disorder(178;0.0821)	906					B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Nonsense_Mutation	SNP	ENST00000263604.3	37	c.2716C>T		.	.	.	.	.	.	.	.	.	.	C	42	9.230636	0.99108	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	.	.	.	4.5	4.5	0.54988	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-33.1036	17.1945	0.86888	0.0:1.0:0.0:0.0	.	.	.	.	X	861;906;906;865;873;887;885;887	.	ENSP00000263604:Q887X	Q	+	1	0	KCNT1	137810476	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.586000	0.82596	2.024000	0.59613	0.557000	0.71058	CAG		0.637	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822		4	19	0	0	0	0.009096	0	4	19				
TUBBP5	643224	broad.mit.edu	37	9	141070116	141070116	+	RNA	SNP	G	G	A	rs376870088		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:141070116G>A	ENST00000503395.1	+	0	1196									tubulin, beta pseudogene 5									p.R77H(1)									GACTCTGTGCGCTCGGGGCCC	0.687																																							uc004com.2		NA																	1	Substitution - Missense(1)		urinary_tract(1)		0						c.(13-15)CGC>CAC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141070116G>A	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070116G>A						TUBBP5_uc010ncq.2_Missense_Mutation_p.R119H	p.R5H							3	275	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.14G>A																																																																																					0.687	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		4	45	0	0	0	0.009096	0	4	45				
TUBBP5	643224	broad.mit.edu	37	9	141070139	141070139	+	RNA	SNP	C	C	T	rs143443709		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:141070139C>T	ENST00000503395.1	+	0	1219									tubulin, beta pseudogene 5									p.L85F(2)									CGGGCAGGTCCTCAGGCCAGA	0.667																																							uc004com.2		NA																	2	Substitution - Missense(2)		urinary_tract(1)|prostate(1)		0						c.(37-39)CTC>TTC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141070139C>T	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070139C>T						TUBBP5_uc010ncq.2_Missense_Mutation_p.L127F	p.L13F							3	298	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.37C>T																																																																																					0.667	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		4	48	0	0	0	0.009096	0	4	48				
BEND2	139105	broad.mit.edu	37	X	18183163	18183163	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:18183163G>A	ENST00000380033.4	-	14	2498	c.2366C>T	c.(2365-2367)cCa>cTa	p.P789L		NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	789								p.P789L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						GGGATCTCCTGGCTTTGACTC	0.498																																							uc004cyj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(2365-2367)CCA>CTA		BEN domain containing 2							130.0	122.0	125.0					X																	18183163		2203	4300	6503	SO:0001583	missense	139105							g.chrX:18183163G>A	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2366C>T	X.37:g.18183163G>A	ENSP00000369372:p.Pro789Leu						p.P789L	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN			14	2520	-			789					E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	37	c.2366C>T	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.712763	0.30413	.	.	ENSG00000177324	ENST00000380033	T	0.36878	1.23	5.07	2.08	0.27032	.	2.693580	0.01707	N	0.027486	T	0.21761	0.0524	N	0.08118	0	0.09310	N	1	B	0.26363	0.147	B	0.22152	0.038	T	0.24154	-1.0168	10	0.87932	D	0	-1.1683	4.7864	0.13227	0.1056:0.0:0.5158:0.3786	.	789	Q8NDZ0	BEND2_HUMAN	L	789	ENSP00000369372:P789L	ENSP00000369372:P789L	P	-	2	0	BEND2	18093084	0.004000	0.15560	0.000000	0.03702	0.011000	0.07611	0.802000	0.27069	0.447000	0.26695	0.544000	0.68410	CCA		0.498	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346		33	129	0	0	0	0.004289	0	33	129				
SCML2	10389	broad.mit.edu	37	X	18260586	18260587	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:18260586_18260587GC>TT	ENST00000251900.4	-	14	2105_2106	c.1946_1947GC>AA	c.(1945-1947)gGC>gAA	p.G649E	SCML2_ENST00000398048.3_Intron|SCML2_ENST00000491988.1_5'Flank	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	649	SAM.				anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G649E(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CGGCGAGGGGGCCTGATATCTG	0.475																																					Esophageal Squamous(100;1252 1965 19021 35517)	Esophageal Squamous(100;1252 1965 19021 35517)	uc004cyl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1945-1947)GGC>GAA		sex comb on midleg-like 2																																				SO:0001583	missense	10389				anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:18260586_18260587GC>TT	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1946_1947delinsTT	X.37:g.18260586_18260587delinsTT	ENSP00000251900:p.Gly649Glu					SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Intron|SCML2_uc011miz.1_Intron|SCML2_uc010nfc.2_Intron	p.G649E	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN			14	2103_2104	-	Hepatocellular(33;0.183)		649			SAM.		Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	DNP	ENST00000251900.4	37	c.1946_1947GC>AA	CCDS14185.1																																																																																				0.475	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089		16	42	0	0	0	0.004672	0	16	42				
CDKL5	6792	broad.mit.edu	37	X	18622582	18622582	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:18622582C>T	ENST00000379989.3	+	13	1823	c.1538C>T	c.(1537-1539)aCc>aTc	p.T513I	CDKL5_ENST00000379996.3_Missense_Mutation_p.T513I|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	513					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.T513I(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GAGCCCAGTACCAGTAGGTAC	0.552																																							uc004cym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6						c.(1537-1539)ACC>ATC		cyclin-dependent kinase-like 5							148.0	139.0	142.0					X																	18622582		2203	4300	6503	SO:0001583	missense	6792				neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding	g.chrX:18622582C>T	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.1538C>T	X.37:g.18622582C>T	ENSP00000369325:p.Thr513Ile					CDKL5_uc004cyn.2_Missense_Mutation_p.T513I	p.T513I	NM_003159	NP_003150	O76039	CDKL5_HUMAN			12	1791	+	Hepatocellular(33;0.183)		513					G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	c.1538C>T	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	C	3.273	-0.148758	0.06627	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.71222	-0.55;-0.55	6.06	2.12	0.27331	.	0.255650	0.46442	D	0.000281	T	0.47525	0.1450	N	0.08118	0	0.09310	N	0.999999	B	0.29805	0.257	B	0.26969	0.075	T	0.43212	-0.9405	10	0.62326	D	0.03	-11.8078	10.3295	0.43814	0.1963:0.3674:0.4363:0.0	.	513	O76039	CDKL5_HUMAN	I	513	ENSP00000369332:T513I;ENSP00000369325:T513I	ENSP00000369325:T513I	T	+	2	0	CDKL5	18532503	1.000000	0.71417	0.158000	0.22627	0.425000	0.31504	1.249000	0.32839	0.256000	0.21614	-0.202000	0.12741	ACC		0.552	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159		22	114	0	0	0	0.00278	0	22	114				
MAP3K15	389840	broad.mit.edu	37	X	19379644	19379644	+	Silent	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:19379644C>A	ENST00000338883.4	-	27	3746	c.3747G>T	c.(3745-3747)cgG>cgT	p.R1249R	MAP3K15_ENST00000518578.1_5'UTR|PDHA1_ENST00000379806.5_3'UTR|PDHA1_ENST00000545074.1_3'UTR|PDHA1_ENST00000422285.2_3'UTR|MAP3K15_ENST00000469203.2_Silent_p.R1081R|MAP3K15_ENST00000359173.3_Silent_p.R684R|PDHA1_ENST00000540249.1_3'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1249							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.R1296R(1)|p.R724R(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					CTCCTTGCAGCCGCAACCAGT	0.413																																							uc004czk.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(2)|stomach(1)|skin(1)	7						c.(2170-2172)CGG>CGT		mitogen-activated protein kinase kinase kinase							109.0	108.0	108.0					X																	19379644		2203	4300	6503	SO:0001819	synonymous_variant	389840						ATP binding|MAP kinase kinase kinase activity|metal ion binding	g.chrX:19379644C>A	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3747G>T	X.37:g.19379644C>A						MAP3K15_uc004czj.1_Silent_p.R684R|PDHA1_uc004czg.3_3'UTR|PDHA1_uc004czh.3_3'UTR|PDHA1_uc011mjc.1_3'UTR|PDHA1_uc011mjd.1_3'UTR|PDHA1_uc010nfk.2_3'UTR|PDHA1_uc010nfl.2_3'UTR|MAP3K15_uc004czi.1_Silent_p.R183R	p.R724R	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN			28	3809	-	Hepatocellular(33;0.183)		1249					A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	ENST00000338883.4	37	c.2172G>T																																																																																					0.413	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671		39	143	1	0	1.34996e-11	0.009718	2.05448e-11	39	143				
ZNF645	158506	broad.mit.edu	37	X	22292161	22292161	+	Silent	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:22292161T>A	ENST00000323684.1	+	1	1097	c.1053T>A	c.(1051-1053)tcT>tcA	p.S351S		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	351					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S351S(1)		cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						GTAATCCATCTGCAAGTGAAT	0.408																																							uc004dai.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|pancreas(1)	2						c.(1051-1053)TCT>TCA		zinc finger protein 645							129.0	108.0	115.0					X																	22292161		2203	4300	6503	SO:0001819	synonymous_variant	158506					intracellular	zinc ion binding	g.chrX:22292161T>A	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.1053T>A	X.37:g.22292161T>A							p.S351S	NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN			1	1102	+			351					A0AV29|A0AV31|E3SBK4|Q6DJY9	Silent	SNP	ENST00000323684.1	37	c.1053T>A	CCDS14205.1																																																																																				0.408	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577		26	63	0	0	0	0.004656	0	26	63				
MAGEB2	4113	broad.mit.edu	37	X	30237051	30237051	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:30237051G>T	ENST00000378988.4	+	2	455	c.354G>T	c.(352-354)ttG>ttT	p.L118F		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	118	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L118F(2)		breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						CAGGGTCGTTGGTGCAGTTCC	0.463																																							uc004dbz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(352-354)TTG>TTT		melanoma antigen family B, 2							55.0	54.0	54.0					X																	30237051		2202	4300	6502	SO:0001583	missense	4113						protein binding	g.chrX:30237051G>T	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.354G>T	X.37:g.30237051G>T	ENSP00000368273:p.Leu118Phe						p.L118F	NM_002364	NP_002355	O15479	MAGB2_HUMAN			2	457	+			118			MAGE.		O75860	Missense_Mutation	SNP	ENST00000378988.4	37	c.354G>T	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900832	0.33535	.	.	ENSG00000099399	ENST00000378988	T	0.10288	2.89	3.27	0.456	0.16655	.	0.079031	0.48767	D	0.000163	T	0.36771	0.0979	H	0.95187	3.635	0.09310	N	1	D	0.76494	0.999	D	0.75484	0.986	T	0.16778	-1.0391	10	0.87932	D	0	.	5.6143	0.17422	0.4037:0.0:0.5963:0.0	.	118	O15479	MAGB2_HUMAN	F	118	ENSP00000368273:L118F	ENSP00000368273:L118F	L	+	3	2	MAGEB2	30146972	0.013000	0.17824	0.001000	0.08648	0.004000	0.04260	0.345000	0.19979	-0.024000	0.13941	-0.494000	0.04653	TTG		0.463	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364		3	19	1	0	0.004672	0.004672	0.00507871	3	19				
MAGEB1	4112	broad.mit.edu	37	X	30268940	30268940	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:30268940G>T	ENST00000378981.3	+	4	651	c.330G>T	c.(328-330)tgG>tgT	p.W110C	MAGEB1_ENST00000397548.2_Missense_Mutation_p.W110C|MAGEB1_ENST00000397550.1_Missense_Mutation_p.W110C	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	110	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.W110C(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						CTGTAGCCTGGGAGGCAGGAA	0.463																																							uc004dcc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(328-330)TGG>TGT		melanoma antigen family B, 1							56.0	42.0	47.0					X																	30268940		2202	4300	6502	SO:0001583	missense	4112							g.chrX:30268940G>T		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.330G>T	X.37:g.30268940G>T	ENSP00000368264:p.Trp110Cys					MAGEB1_uc004dcd.2_Missense_Mutation_p.W110C|MAGEB1_uc004dce.2_Missense_Mutation_p.W110C	p.W110C	NM_002363	NP_002354	P43366	MAGB1_HUMAN			4	650	+			110			MAGE.		B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	ENST00000378981.3	37	c.330G>T	CCDS14222.1	.	.	.	.	.	.	.	.	.	.	G	6.242	0.412689	0.11812	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.01516	4.81;4.81;4.81	3.75	0.0416	0.14213	.	0.775937	0.12218	N	0.488625	T	0.00875	0.0029	N	0.08118	0	0.09310	N	1	P	0.46952	0.887	B	0.31751	0.135	T	0.53265	-0.8463	10	0.72032	D	0.01	.	6.266	0.20928	0.4896:0.0:0.5104:0.0	.	110	P43366	MAGB1_HUMAN	C	110	ENSP00000368264:W110C;ENSP00000380683:W110C;ENSP00000380681:W110C	ENSP00000368264:W110C	W	+	3	0	MAGEB1	30178861	0.600000	0.26899	0.000000	0.03702	0.000000	0.00434	1.601000	0.36773	-0.136000	0.11475	-1.013000	0.02462	TGG		0.463	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363		8	23	1	0	1.06961e-07	0.00308	1.45911e-07	8	23				
NR0B1	190	broad.mit.edu	37	X	30326434	30326434	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:30326434G>T	ENST00000378970.4	-	1	1281	c.1047C>A	c.(1045-1047)gcC>gcA	p.A349A	NR0B1_ENST00000378963.1_Silent_p.A54A|NR0B1_ENST00000453287.1_Silent_p.A349A	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	349	Ligand-binding. {ECO:0000250}.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.A349A(1)		central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GCACCTTCCTGGCCTCCGCCG	0.627											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004dcf.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(1045-1047)GCC>GCA		nuclear receptor subfamily 0, group B, member 1	Dexamethasone(DB01234)|Tretinoin(DB00755)						37.0	34.0	35.0					X																	30326434		2202	4300	6502	SO:0001819	synonymous_variant	190				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding	g.chrX:30326434G>T	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.1047C>A	X.37:g.30326434G>T			OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	816		p.A349A	NM_000475	NP_000466	P51843	NR0B1_HUMAN			1	1062	-			349			Ligand-binding (By similarity).		Q96F69	Silent	SNP	ENST00000378970.4	37	c.1047C>A	CCDS14223.1																																																																																				0.627	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475		7	14	1	0	2.0095e-06	0.001984	2.59582e-06	7	14				
DMD	1756	broad.mit.edu	37	X	31200972	31200972	+	Missense_Mutation	SNP	C	C	T	rs398124105		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:31200972C>T	ENST00000357033.4	-	68	10063	c.9857G>A	c.(9856-9858)aGa>aAa	p.R3286K	DMD_ENST00000541735.1_Missense_Mutation_p.R826K|DMD_ENST00000343523.2_Missense_Mutation_p.R826K|DMD_ENST00000378677.2_Missense_Mutation_p.R3282K|DMD_ENST00000378680.2_Missense_Mutation_p.R218K|DMD_ENST00000474231.1_Missense_Mutation_p.R826K|DMD_ENST00000378723.3_Missense_Mutation_p.R218K|DMD_ENST00000361471.4_Missense_Mutation_p.R218K|DMD_ENST00000378702.4_Missense_Mutation_p.R218K|DMD_ENST00000359836.1_Missense_Mutation_p.R826K|DMD_ENST00000378707.3_Missense_Mutation_p.R826K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3286	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R1945K(1)|p.R826K(1)|p.R3282K(1)|p.R218K(1)|p.R3281K(1)|p.R3286K(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGGTTCCAGTCTCATCCAGTC	0.522																																							uc004dda.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(9856-9858)AGA>AAA		dystrophin Dp427m isoform							96.0	73.0	81.0					X																	31200972		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:31200972C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9857G>A	X.37:g.31200972C>T	ENSP00000354923:p.Arg3286Lys					DMD_uc004dcq.1_Missense_Mutation_p.R557K|DMD_uc004dcr.1_Missense_Mutation_p.R826K|DMD_uc004dcs.1_Missense_Mutation_p.R826K|DMD_uc004dct.1_Missense_Mutation_p.R826K|DMD_uc004dcu.1_Missense_Mutation_p.R826K|DMD_uc004dcv.1_Missense_Mutation_p.R826K|DMD_uc004dcw.2_Missense_Mutation_p.R1942K|DMD_uc004dcx.2_Missense_Mutation_p.R1945K|DMD_uc004dcz.2_Missense_Mutation_p.R3163K|DMD_uc004dcy.1_Missense_Mutation_p.R3282K|DMD_uc004ddb.1_Missense_Mutation_p.R3278K|DMD_uc004dcm.1_Missense_Mutation_p.R218K|DMD_uc004dcn.1_Missense_Mutation_p.R218K|DMD_uc004dco.1_Missense_Mutation_p.R218K|DMD_uc004dcp.1_Missense_Mutation_p.R218K|DMD_uc011mkb.1_Missense_Mutation_p.R218K|DMD_uc010ngm.2_Missense_Mutation_p.R218K	p.R3286K	NM_004006	NP_003997	P11532	DMD_HUMAN			68	10101	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	3286			Interaction with SYNM (By similarity).		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.9857G>A	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265317	0.80358	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680;ENST00000378705	D;D;D;D;D;D;D;D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.41	5.41	0.78517	EF-hand domain, type 2 (1);	0.000000	0.34725	U	0.003735	D	0.86539	0.5957	N	0.04335	-0.225	0.80722	D	1	P;B;P;D;D;D;B;B;B;D;D;B;P;B;B;P	0.55385	0.538;0.002;0.924;0.971;0.971;0.971;0.005;0.031;0.031;0.971;0.964;0.095;0.482;0.004;0.0;0.924	P;B;D;D;D;D;B;B;B;D;D;B;P;B;B;D	0.72625	0.747;0.021;0.953;0.97;0.97;0.97;0.016;0.018;0.028;0.978;0.962;0.093;0.721;0.013;0.002;0.953	T	0.83304	-0.0026	10	0.09843	T	0.71	.	18.2593	0.90030	0.0:1.0:0.0:0.0	.	218;3278;3286;3282;1945;1942;826;826;826;826;826;3163;218;218;218;218	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.	K	3278;1945;1942;218;982;3282;3286;826;826;3286;3163;826;826;218;826;218;218;76	ENSP00000367997:R218K;ENSP00000350765:R982K;ENSP00000367948:R3282K;ENSP00000354923:R3286K;ENSP00000352894:R826K;ENSP00000340057:R826K;ENSP00000367979:R826K;ENSP00000444119:R826K;ENSP00000367974:R218K;ENSP00000417123:R826K;ENSP00000354464:R218K;ENSP00000367951:R218K;ENSP00000367977:R76K	ENSP00000340057:R826K	R	-	2	0	DMD	31110893	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.651000	0.83577	2.506000	0.84524	0.600000	0.82982	AGA		0.522	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		22	39	0	0	0	0.012319	0	22	39				
DMD	1756	broad.mit.edu	37	X	32305735	32305735	+	Silent	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:32305735C>A	ENST00000357033.4	-	43	6407	c.6201G>T	c.(6199-6201)acG>acT	p.T2067T	DMD_ENST00000378677.2_Silent_p.T2063T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2067					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.T726T(1)|p.T2067T(1)|p.T2062T(1)|p.T2063T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTCCACAGGCGTTGCACTTT	0.398																																							uc004dda.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(6199-6201)ACG>ACT		dystrophin Dp427m isoform							151.0	123.0	132.0					X																	32305735		2202	4300	6502	SO:0001819	synonymous_variant	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32305735C>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6201G>T	X.37:g.32305735C>A						DMD_uc004dcw.2_Silent_p.T723T|DMD_uc004dcx.2_Silent_p.T726T|DMD_uc004dcz.2_Silent_p.T1944T|DMD_uc004dcy.1_Silent_p.T2063T|DMD_uc004ddb.1_Silent_p.T2059T|DMD_uc010ngo.1_Intron|DMD_uc010ngn.1_RNA	p.T2067T	NM_004006	NP_003997	P11532	DMD_HUMAN			43	6445	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	2067			Spectrin 14.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	c.6201G>T	CCDS14233.1																																																																																				0.398	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		26	50	1	0	2.50493e-22	0.004656	4.5861e-22	26	50				
DMD	1756	broad.mit.edu	37	X	32407765	32407765	+	Silent	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:32407765C>T	ENST00000357033.4	-	32	4577	c.4371G>A	c.(4369-4371)aaG>aaA	p.K1457K	DMD_ENST00000378677.2_Silent_p.K1453K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1457	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.K1457K(1)|p.K1452K(1)|p.K1453K(1)|p.K116K(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATAATCGAAACTTCATGGAGA	0.343																																							uc004dda.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(4369-4371)AAG>AAA		dystrophin Dp427m isoform							98.0	87.0	91.0					X																	32407765		2202	4300	6502	SO:0001819	synonymous_variant	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32407765C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4371G>A	X.37:g.32407765C>T						DMD_uc004dcw.2_Silent_p.K113K|DMD_uc004dcx.2_Silent_p.K116K|DMD_uc004dcz.2_Silent_p.K1334K|DMD_uc004dcy.1_Silent_p.K1453K|DMD_uc004ddb.1_Silent_p.K1449K|DMD_uc010ngo.1_Intron	p.K1457K	NM_004006	NP_003997	P11532	DMD_HUMAN			32	4615	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1457			Interaction with SYNM (By similarity).		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	c.4371G>A	CCDS14233.1																																																																																				0.343	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		12	94	0	0	0	0.003163	0	12	94				
FAM47B	170062	broad.mit.edu	37	X	34962613	34962613	+	Silent	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:34962613T>A	ENST00000329357.5	+	1	1701	c.1665T>A	c.(1663-1665)ccT>ccA	p.P555P		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	555								p.P555P(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						ACTTCGAGCCTAAGTTGGGGA	0.493																																							uc004ddi.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)	4						c.(1663-1665)CCT>CCA		hypothetical protein LOC170062							106.0	95.0	99.0					X																	34962613		2202	4300	6502	SO:0001819	synonymous_variant	170062							g.chrX:34962613T>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1665T>A	X.37:g.34962613T>A							p.P555P	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	1683	+			555					Q5JQN5|Q6PIG3	Silent	SNP	ENST00000329357.5	37	c.1665T>A	CCDS14236.1																																																																																				0.493	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		46	51	0	0	0	0.013114	0	46	51				
CHDC2	286464	broad.mit.edu	37	X	36122645	36122645	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:36122645C>A	ENST00000313548.4	+	8	1068	c.882C>A	c.(880-882)taC>taA	p.Y294*		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	294						integral component of membrane (GO:0016021)		p.Y294*(1)									TAGTGCCATACTGCAGCAATA	0.343																																							uc004ddk.1		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(880-882)TAC>TAA		hypothetical protein LOC286464							122.0	104.0	111.0					X																	36122645		2202	4300	6502	SO:0001587	stop_gained	286464					integral to membrane		g.chrX:36122645C>A	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.882C>A	X.37:g.36122645C>A	ENSP00000324767:p.Tyr294*						p.Y294*	NM_173695	NP_775966	Q8N9S7	CX059_HUMAN			8	1068	+			294						Nonsense_Mutation	SNP	ENST00000313548.4	37	c.882C>A	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702324	0.68501	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.53	-7.73	0.01245	.	1.551920	0.04049	N	0.304407	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.2997	10.2376	0.43292	0.0:0.4364:0.4164:0.1472	.	.	.	.	X	294	.	ENSP00000324767:Y294X	Y	+	3	2	CXorf59	36032566	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.461000	0.06712	-1.136000	0.02892	-0.340000	0.08031	TAC		0.343	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695		34	92	1	0	1.60099e-16	0.004878	2.67014e-16	34	92				
CHST7	56548	broad.mit.edu	37	X	46433945	46433945	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:46433945C>A	ENST00000276055.3	+	1	727	c.579C>A	c.(577-579)ttC>ttA	p.F193L		NM_019886.2	NP_063939.2	Q9NS84	CHST7_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7	193					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|N-acetylglucosamine metabolic process (GO:0006044)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)	p.F193L(1)		breast(3)|endometrium(2)|kidney(1)|lung(2)	8						CCGCCCTCTTCCGCTGGCGGA	0.726																																							uc004dgt.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(577-579)TTC>TTA		chondroitin 6-sulfotransferase 7							7.0	8.0	8.0					X																	46433945		2095	4097	6192	SO:0001583	missense	56548				chondroitin sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity|N-acetylglucosamine 6-O-sulfotransferase activity	g.chrX:46433945C>A	AB040711	CCDS14268.1	Xp11.3	2008-02-05			ENSG00000147119	ENSG00000147119		"""Sulfotransferases, membrane-bound"""	13817	protein-coding gene	gene with protein product		300375				10781596	Standard	NM_019886		Approved	C6ST-2, C6ST2	uc004dgt.3	Q9NS84	OTTHUMG00000021423	ENST00000276055.3:c.579C>A	X.37:g.46433945C>A	ENSP00000276055:p.Phe193Leu						p.F193L	NM_019886	NP_063939	Q9NS84	CHST7_HUMAN			1	754	+			193			Lumenal (Potential).		O75667	Missense_Mutation	SNP	ENST00000276055.3	37	c.579C>A	CCDS14268.1	.	.	.	.	.	.	.	.	.	.	c	19.97	3.925663	0.73213	.	.	ENSG00000147119	ENST00000276055	D	0.98105	-4.72	4.04	-0.522	0.11928	Sulfotransferase domain (1);	0.000000	0.85682	U	0.000000	D	0.98413	0.9472	M	0.86343	2.81	0.43462	D	0.995661	D	0.89917	1.0	D	0.87578	0.998	D	0.97467	1.0038	10	0.54805	T	0.06	.	11.5697	0.50826	0.0:0.8316:0.0:0.1684	.	193	Q9NS84	CHST7_HUMAN	L	193	ENSP00000276055:F193L	ENSP00000276055:F193L	F	+	3	2	CHST7	46318889	1.000000	0.71417	0.925000	0.36789	0.987000	0.75469	0.768000	0.26590	-0.467000	0.06932	0.431000	0.28591	TTC		0.726	CHST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056362.1	NM_019886		4	7	1	0	0.00024832	0.009096	0.000285217	4	7				
SSX6	280657	broad.mit.edu	37	X	47976475	47976475	+	RNA	SNP	A	A	C	rs17327911	byFrequency	TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:47976475A>C	ENST00000509958.1	+	0	10							Q7RTT6	SSX6_HUMAN	synovial sarcoma, X breakpoint 6 (pseudogene)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.K138Q(1)		large_intestine(6)|lung(4)|skin(2)|stomach(1)	13						CGATGGGAAAAAGCTGTGCCC	0.507																																							uc004dix.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(412-414)AAG>CAG		SubName: Full=Putative uncharacterized protein SSX1;							129.0	123.0	125.0					X																	47976475		2196	4290	6486			280657							g.chrX:47976475A>C	BK000686		Xp11.23	2009-09-11	2009-08-26		ENSG00000171483	ENSG00000171483			19652	pseudogene	pseudogene		300541	"""SSX family pseudogene 2"", ""synovial sarcoma, X breakpoint 6"""	SSXP2		12216073	Standard	NR_028366		Approved	psiSSX2	uc011mlv.2	Q7RTT6	OTTHUMG00000021464		X.37:g.47976475A>C							p.K138Q	NM_173357	NP_775493					6	534	+									Missense_Mutation	SNP	ENST00000509958.1	37	c.412A>C		.	.	.	.	.	.	.	.	.	.	.	0.004	-2.247221	0.00271	.	.	ENSG00000171483	ENST00000376932;ENST00000319275	T;T	0.40225	3.17;1.04	2.19	-4.38	0.03622	.	2.119790	0.02654	N	0.106826	T	0.18130	0.0435	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37361	-0.9709	9	0.02654	T	1	.	7.4697	0.27342	0.2826:0.1729:0.5445:0.0	rs17327911	138	Q7RTT6	SSX6_HUMAN	Q	138;40	ENSP00000366131:K138Q;ENSP00000325176:K40Q	ENSP00000325176:K40Q	K	+	1	0	SSX6	47861419	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.783000	0.00367	-2.354000	0.00614	-1.820000	0.00599	AAG		0.507	SSX6-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000362117.1	NR_028366		21	154	0	0	0	0.014323	0	21	154				
APEX2	27301	broad.mit.edu	37	X	55033653	55033653	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:55033653G>T	ENST00000374987.3	+	6	1408	c.1342G>T	c.(1342-1344)Gag>Tag	p.E448*	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	448					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)	p.E448*(1)		breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						AGCCAAAGATGAGAAGGAGTT	0.587								Other BER factors																															uc004dtz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(1)	1						c.(1342-1344)GAG>TAG	Other_BER_factors	apurinic/apyrimidinic endonuclease 2							57.0	44.0	48.0					X																	55033653		2203	4300	6503	SO:0001587	stop_gained	27301				cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding	g.chrX:55033653G>T	AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.1342G>T	X.37:g.55033653G>T	ENSP00000364126:p.Glu448*					APEX2_uc011mom.1_Nonsense_Mutation_p.E277*	p.E448*	NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN			6	1418	+			448					Q9Y5X7	Nonsense_Mutation	SNP	ENST00000374987.3	37	c.1342G>T	CCDS14365.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.868930	0.91587	.	.	ENSG00000169188	ENST00000374987	.	.	.	4.02	4.02	0.46733	.	0.498508	0.22117	N	0.064398	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-14.3528	12.8314	0.57748	0.0:0.0:1.0:0.0	.	.	.	.	X	448	.	ENSP00000364126:E448X	E	+	1	0	APEX2	55050378	0.057000	0.20700	0.988000	0.46212	0.784000	0.44337	0.628000	0.24522	2.254000	0.74563	0.513000	0.50165	GAG		0.587	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056845.1			7	33	1	0	0.00307968	0.00308	0.00339322	7	33				
SPIN3	169981	broad.mit.edu	37	X	57021331	57021331	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:57021331C>T	ENST00000374919.3	-	2	372	c.50G>A	c.(49-51)gGc>gAc	p.G17D		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	17					gamete generation (GO:0007276)			p.G17D(2)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						GTGGCCAGCGCCCGTCCTGGA	0.587																																							uc010nkj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(49-51)GGC>GAC		spindlin family, member 3							46.0	47.0	47.0					X																	57021331		2080	4182	6262	SO:0001583	missense	169981				gamete generation			g.chrX:57021331C>T	AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.50G>A	X.37:g.57021331C>T	ENSP00000364054:p.Gly17Asp					SPIN3_uc004duu.3_RNA|SPIN3_uc004duw.3_RNA|SPIN3_uc004duv.3_RNA|SPIN3_uc004dux.1_Missense_Mutation_p.G17D	p.G17D	NM_001010862	NP_001010862	Q5JUX0	SPIN3_HUMAN			2	336	-			17					B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	ENST00000374919.3	37	c.50G>A	CCDS43963.1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.453104	0.01071	.	.	ENSG00000204271	ENST00000374919;ENST00000374915	T	0.39787	1.06	2.45	-1.41	0.08941	.	.	.	.	.	T	0.10294	0.0252	N	0.00347	-1.61	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35251	-0.9796	9	0.14656	T	0.56	0.613	7.593	0.28031	0.0:0.3635:0.0:0.6365	.	17	Q5JUX0	SPIN3_HUMAN	D	17	ENSP00000364054:G17D	ENSP00000364050:G17D	G	-	2	0	SPIN3	57038056	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.325000	0.07976	-0.588000	0.05882	-0.881000	0.02953	GGC		0.587	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056908.1	XM_093024		9	29	0	0	0	0.004482	0	9	29				
ATRX	546	broad.mit.edu	37	X	76920220	76920220	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:76920220G>T	ENST00000373344.5	-	11	4071	c.3857C>A	c.(3856-3858)tCt>tAt	p.S1286Y	ATRX_ENST00000395603.3_Missense_Mutation_p.S1248Y|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1286	Interaction with DAXX.			S -> P (in Ref. 4; BAD92165). {ECO:0000305}.	ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.S1286Y(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATCCTCATCAGAGGAAAGATT	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		3	Substitution - Missense(2)|Unknown(1)		lung(2)|bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(3856-3858)TCT>TAT		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						122.0	110.0	114.0					X																	76920220		2203	4296	6499	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76920220G>T	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3857C>A	X.37:g.76920220G>T	ENSP00000362441:p.Ser1286Tyr					ATRX_uc004ecq.3_Missense_Mutation_p.S1248Y|ATRX_uc004eco.3_Missense_Mutation_p.S1071Y|ATRX_uc004ecr.2_Missense_Mutation_p.S1218Y	p.S1286Y	NM_000489	NP_000480	P46100	ATRX_HUMAN			11	4089	-			1286	S -> P (in Ref. 4; BAD92165).				D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.3857C>A	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222859	0.58668	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.93247	-3.19;-3.19	4.89	4.89	0.63831	.	0.166876	0.40469	U	0.001093	D	0.94019	0.8084	L	0.27053	0.805	0.80722	D	1	D;D;D	0.76494	0.999;0.993;0.989	D;P;P	0.69479	0.964;0.884;0.768	D	0.95302	0.8404	10	0.87932	D	0	-6.181	17.4739	0.87655	0.0:0.0:1.0:0.0	.	1218;1248;1286	P46100-6;P46100-4;P46100	.;.;ATRX_HUMAN	Y	1286;1248;1213	ENSP00000362441:S1286Y;ENSP00000378967:S1248Y	ENSP00000362441:S1286Y	S	-	2	0	ATRX	76806876	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.537000	0.90631	2.140000	0.66376	0.600000	0.82982	TCT		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		18	84	1	0	9.16793e-09	0.00499	1.27565e-08	18	84				
MAGT1	84061	broad.mit.edu	37	X	77112246	77112246	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:77112246C>A	ENST00000358075.6	-	5	838	c.752G>T	c.(751-753)tGg>tTg	p.W251L		NM_032121.5	NP_115497.4	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	219					cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.W219L(1)		cervix(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	17						TGCAAAAGCCCATCCAGTTTT	0.328																																							uc004fof.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(751-753)TGG>TTG		magnesium transporter 1							61.0	65.0	64.0					X																	77112246		2203	4296	6499	SO:0001583	missense	84061				protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex		g.chrX:77112246C>A		CCDS14436.2	Xq21.1	2014-09-17			ENSG00000102158	ENSG00000102158			28880	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog B (S. cerevisiae)"""	300715				15804357	Standard	NM_032121		Approved	DKFZp564K142, IAP, OST3B, MRX95	uc004fof.3	Q9H0U3	OTTHUMG00000021882	ENST00000358075.6:c.752G>T	X.37:g.77112246C>A	ENSP00000354649:p.Trp251Leu					MAGT1_uc004fog.3_Intron	p.W251L	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN			5	814	-			219			Helical; (Potential).		B2RAR4|D3DTE3|Q53G00|Q6P577|Q8NBN6	Missense_Mutation	SNP	ENST00000358075.6	37	c.752G>T	CCDS14436.2	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211218	0.79240	.	.	ENSG00000102158	ENST00000358075;ENST00000453109	D	0.82984	-1.67	4.42	4.42	0.53409	.	0.000000	0.85682	U	0.000000	D	0.91703	0.7377	M	0.86651	2.83	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.92585	0.6078	10	0.48119	T	0.1	-4.2221	15.9804	0.80105	0.0:1.0:0.0:0.0	.	219	Q9H0U3	MAGT1_HUMAN	L	251;102	ENSP00000354649:W251L	ENSP00000354649:W251L	W	-	2	0	MAGT1	76998902	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.358000	0.79466	1.772000	0.52199	0.600000	0.82982	TGG		0.328	MAGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057301.2	NM_032121		24	85	1	0	6.32553e-13	0.004656	9.90525e-13	24	85				
ATP7A	538	broad.mit.edu	37	X	77275806	77275806	+	Missense_Mutation	SNP	G	G	T	rs199888395		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:77275806G>T	ENST00000341514.6	+	13	2847	c.2692G>T	c.(2692-2694)Ggg>Tgg	p.G898W	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Missense_Mutation_p.G820W	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	898					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)	p.G898W(2)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TAACCAGAACGGGTCACTGCT	0.448																																							uc004ecx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2692-2694)GGG>TGG		ATPase, Cu++ transporting, alpha polypeptide							122.0	104.0	110.0					X																	77275806		2203	4296	6499	SO:0001583	missense	538				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity	g.chrX:77275806G>T	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.2692G>T	X.37:g.77275806G>T	ENSP00000345728:p.Gly898Trp						p.G898W	NM_000052	NP_000043	Q04656	ATP7A_HUMAN			13	2852	+			898			Cytoplasmic (Potential).		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	c.2692G>T	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.915794	0.73098	.	.	ENSG00000165240	ENST00000343533;ENST00000341514	D;D	0.94862	-3.54;-3.54	5.83	5.83	0.93111	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.98538	0.9512	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99616	1.0982	10	0.87932	D	0	1.1291	19.0714	0.93138	0.0:0.0:1.0:0.0	.	898	Q04656	ATP7A_HUMAN	W	820;898	ENSP00000343026:G820W;ENSP00000345728:G898W	ENSP00000345728:G898W	G	+	1	0	ATP7A	77162462	1.000000	0.71417	1.000000	0.80357	0.294000	0.27393	9.869000	0.99810	2.454000	0.82982	0.544000	0.68410	GGG		0.448	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052		13	81	1	0	9.31168e-06	0.001855	1.16277e-05	13	81				
ZCCHC5	203430	broad.mit.edu	37	X	77912628	77912628	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:77912628G>T	ENST00000321110.1	-	2	1585	c.1290C>A	c.(1288-1290)caC>caA	p.H430Q		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	430							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.H430Q(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						CTTCACTGATGTGTGGGCAGT	0.517																																							uc004edc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1288-1290)CAC>CAA		zinc finger, CCHC domain containing 5							148.0	115.0	126.0					X																	77912628		2203	4300	6503	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77912628G>T	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1290C>A	X.37:g.77912628G>T	ENSP00000316794:p.His430Gln						p.H430Q	NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN			2	1586	-			430					B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.1290C>A	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	1.092	-0.663711	0.03428	.	.	ENSG00000179300	ENST00000321110	T	0.17370	2.28	3.2	-0.796	0.10912	.	.	.	.	.	T	0.09686	0.0238	L	0.40543	1.245	0.09310	N	1	P	0.50943	0.94	B	0.36244	0.22	T	0.21314	-1.0249	9	0.40728	T	0.16	.	3.6123	0.08065	0.3769:0.1906:0.4326:0.0	.	430	Q8N8U3	ZCHC5_HUMAN	Q	430	ENSP00000316794:H430Q	ENSP00000316794:H430Q	H	-	3	2	ZCCHC5	77799284	0.989000	0.36119	0.199000	0.23439	0.005000	0.04900	0.058000	0.14301	-0.359000	0.08150	-0.322000	0.08575	CAC		0.517	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		18	54	1	0	5.35267e-07	0.007413	7.14178e-07	18	54				
P2RY10	27334	broad.mit.edu	37	X	78216521	78216521	+	Silent	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:78216521C>A	ENST00000171757.2	+	4	784	c.504C>A	c.(502-504)ccC>ccA	p.P168P	P2RY10_ENST00000475374.1_3'UTR|P2RY10_ENST00000544091.1_Silent_p.P168P	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.P168P(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TGCCATTTCCCATCCTGAGAA	0.502																																							uc004ede.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(2)|breast(1)	5						c.(502-504)CCC>CCA		G-protein coupled purinergic receptor P2Y10							118.0	98.0	105.0					X																	78216521		2203	4300	6503	SO:0001819	synonymous_variant	27334					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78216521C>A	AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.504C>A	X.37:g.78216521C>A						P2RY10_uc004edf.2_Silent_p.P168P	p.P168P	NM_014499	NP_055314	O00398	P2Y10_HUMAN			4	873	+			168			Helical; Name=4; (Potential).		D3DTE5|Q4VBN7|Q86V16	Silent	SNP	ENST00000171757.2	37	c.504C>A	CCDS14442.1																																																																																				0.502	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1			24	29	1	0	1.9806e-07	0.014323	2.68677e-07	24	29				
BTK	695	broad.mit.edu	37	X	100615743	100615743	+	Splice_Site	SNP	T	T	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:100615743T>C	ENST00000308731.7	-	8	752	c.589A>G	c.(589-591)Atc>Gtc	p.I197V	BTK_ENST00000372880.1_Splice_Site_p.I197V	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	197					adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)	p.I197V(1)		breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TTTTTCAAGATCTATGTAGTT	0.473									Agammaglobulinemia, X-linked																														uc004ehg.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|central_nervous_system(2)|ovary(1)	6						c.(589-591)ATC>GTC		Bruton agammaglobulinemia tyrosine kinase							91.0	83.0	85.0					X																	100615743		2203	4300	6503	SO:0001630	splice_region_variant	695	Agammaglobulinemia_X-linked	Familial Cancer Database	Bruton Type Agammaglobulinemia	calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding	g.chrX:100615743T>C	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.589-1A>G	X.37:g.100615743T>C						BTK_uc004ehf.2_5'Flank|BTK_uc010nnh.2_5'Flank|BTK_uc010nni.2_5'Flank|BTK_uc004ehe.2_5'Flank|BTK_uc010nnj.2_5'Flank|BTK_uc010nnk.2_5'Flank|BTK_uc010nnl.2_5'Flank|BTK_uc010nnm.2_5'Flank|BTK_uc010nnn.2_Missense_Mutation_p.I197V|BTK_uc010nno.2_Missense_Mutation_p.I231V|BTK_uc004ehh.1_5'Flank|BTK_uc004ehi.2_Missense_Mutation_p.I197V	p.I197V	NM_000061	NP_000052	Q06187	BTK_HUMAN			8	782	-			197					B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	c.589A>G	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	T	7.705	0.694000	0.15039	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	T;T	0.81163	-1.46;-0.88	5.85	4.65	0.58169	Src homology-3 domain (1);	0.814983	0.11891	N	0.519646	T	0.61862	0.2381	N	0.08118	0	0.24408	N	0.99467	B;B;B	0.13594	0.003;0.008;0.008	B;B;B	0.14578	0.001;0.011;0.005	T	0.40308	-0.9570	10	0.08599	T	0.76	.	11.3874	0.49793	0.1377:0.0:0.0:0.8623	.	197;197;197	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	V	197	ENSP00000361971:I197V;ENSP00000308176:I197V	ENSP00000308176:I197V	I	-	1	0	BTK	100502399	1.000000	0.71417	0.999000	0.59377	0.797000	0.45037	3.148000	0.50647	0.794000	0.33899	0.478000	0.44815	ATC		0.473	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061	Missense_Mutation	28	38	0	0	0	0.004656	0	28	38				
BTK	695	broad.mit.edu	37	X	100617635	100617635	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:100617635C>G	ENST00000308731.7	-	6	597	c.434G>C	c.(433-435)tGc>tCc	p.C145S	BTK_ENST00000372880.1_Missense_Mutation_p.C145S	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	145					adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)	p.C145S(1)		breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GATCCAGAAGCAAGGGTGATA	0.458									Agammaglobulinemia, X-linked																														uc004ehg.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|central_nervous_system(2)|ovary(1)	6						c.(433-435)TGC>TCC		Bruton agammaglobulinemia tyrosine kinase							170.0	156.0	161.0					X																	100617635		2203	4300	6503	SO:0001583	missense	695	Agammaglobulinemia_X-linked	Familial Cancer Database	Bruton Type Agammaglobulinemia	calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding	g.chrX:100617635C>G	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.434G>C	X.37:g.100617635C>G	ENSP00000308176:p.Cys145Ser					BTK_uc010nnn.2_Missense_Mutation_p.C145S|BTK_uc010nno.2_Missense_Mutation_p.C179S|BTK_uc004ehi.2_Missense_Mutation_p.C145S	p.C145S	NM_000061	NP_000052	Q06187	BTK_HUMAN			6	627	-			145			Btk-type.		B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	c.434G>C	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499854	0.64298	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	D;D	0.92249	-3.0;-3.0	5.49	5.49	0.81192	Pleckstrin homology-type (1);Zinc finger, Btk motif (3);	0.000000	0.85682	D	0.000000	D	0.88844	0.6547	N	0.12502	0.225	0.80722	D	1	D;P;D	0.57571	0.979;0.799;0.98	P;B;P	0.51974	0.631;0.217;0.686	D	0.87518	0.2444	10	0.20519	T	0.43	.	18.4742	0.90786	0.0:1.0:0.0:0.0	.	145;145;145	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	S	145	ENSP00000361971:C145S;ENSP00000308176:C145S	ENSP00000308176:C145S	C	-	2	0	BTK	100504291	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.487000	0.81328	2.305000	0.77605	0.529000	0.55759	TGC		0.458	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061		23	126	0	0	0	0.005443	0	23	126				
BTK	695	broad.mit.edu	37	X	100630266	100630266	+	Missense_Mutation	SNP	C	C	A	rs368549990		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:100630266C>A	ENST00000308731.7	-	2	170	c.7G>T	c.(7-9)Gca>Tca	p.A3S	BTK_ENST00000372880.1_Missense_Mutation_p.A3S|BTK_ENST00000464567.1_5'UTR	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	3	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)	p.A3S(3)		breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						AGAATCACTGCGGCCATAGCT	0.468									Agammaglobulinemia, X-linked																														uc004ehg.2		NA																	3	Substitution - Missense(3)		prostate(2)|lung(1)	lung(3)|central_nervous_system(2)|ovary(1)	6						c.(7-9)GCA>TCA		Bruton agammaglobulinemia tyrosine kinase							137.0	124.0	128.0					X																	100630266		2203	4300	6503	SO:0001583	missense	695	Agammaglobulinemia_X-linked	Familial Cancer Database	Bruton Type Agammaglobulinemia	calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding	g.chrX:100630266C>A	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.7G>T	X.37:g.100630266C>A	ENSP00000308176:p.Ala3Ser					BTK_uc010nnn.2_Missense_Mutation_p.A3S|BTK_uc010nno.2_Missense_Mutation_p.A37S|BTK_uc004ehi.2_Missense_Mutation_p.A3S	p.A3S	NM_000061	NP_000052	Q06187	BTK_HUMAN			2	200	-			3			PH.		B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	c.7G>T	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	C	9.546	1.114781	0.20795	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	D;T	0.81659	-1.52;-0.94	5.35	0.533	0.17121	Pleckstrin homology domain (1);	0.572708	0.19420	N	0.114718	T	0.54240	0.1846	N	0.08118	0	0.21652	N	0.999609	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.36311	-0.9753	10	0.10636	T	0.68	.	5.5259	0.16957	0.1282:0.4389:0.0:0.4328	.	3;3;3	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	S	3	ENSP00000361971:A3S;ENSP00000308176:A3S	ENSP00000308176:A3S	A	-	1	0	BTK	100516922	0.001000	0.12720	0.943000	0.38184	0.513000	0.34164	-0.042000	0.12063	-0.364000	0.08088	-0.192000	0.12808	GCA		0.468	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061		15	125	1	0	3.41278e-10	0.00499	5.06715e-10	15	125				
NXF2	56001	broad.mit.edu	37	X	101576802	101576802	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:101576802C>A	ENST00000372758.1	+	20	2148	c.1298C>A	c.(1297-1299)gCc>gAc	p.A433D	NXF2_ENST00000472029.1_3'UTR|NXF2_ENST00000330252.5_Missense_Mutation_p.A433D|NXF2_ENST00000395088.2_Missense_Mutation_p.A433D|NXF2_ENST00000372757.1_Missense_Mutation_p.A433D|NXF2_ENST00000372763.1_Missense_Mutation_p.A345D			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2	433	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.A433D(1)		endometrium(2)|lung(2)	4						AAGGACTCAGCCCCGTGAGTA	0.597																																							uc004eiv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1297-1299)GCC>GAC		nuclear RNA export factor 2B							101.0	95.0	97.0					X																	101576802		2007	3747	5754	SO:0001583	missense	728343				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|RNA binding	g.chrX:101576802C>A	AJ277526	CCDS14497.1	Xq22.1	2011-05-25			ENSG00000185554				8072	protein-coding gene	gene with protein product	"""cancer/testis antigen 39"", ""TAP like protein 2"""	300315				11073998, 11279525	Standard	NM_022053		Approved	CT39, TAPL-2	uc004eix.4	Q9GZY0		ENST00000372758.1:c.1298C>A	X.37:g.101576802C>A	ENSP00000361844:p.Ala433Asp					NXF2B_uc004eiu.3_Missense_Mutation_p.A433D|NXF2B_uc004eiw.3_Missense_Mutation_p.A345D|NXF2_uc004eix.3_Missense_Mutation_p.A433D	p.A433D	NM_001099686	NP_001093156	Q9GZY0	NXF2_HUMAN			27	3170	+			433			NTF2.		Q9BXU4|Q9NSS1|Q9NX66	Missense_Mutation	SNP	ENST00000372758.1	37	c.1298C>A	CCDS14497.1	.	.	.	.	.	.	.	.	.	.	.	3.894	-0.023370	0.07634	.	.	ENSG00000185554	ENST00000395088;ENST00000330252;ENST00000372763;ENST00000372758;ENST00000372757	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	2.51	-5.01	0.02991	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.465916	0.22088	N	0.064790	T	0.34745	0.0908	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.12156	0.007;0.003	T	0.36286	-0.9754	10	0.10636	T	0.68	0.8659	3.2033	0.06657	0.4026:0.2245:0.0:0.3729	.	345;433	Q5JRM6;Q9GZY0	.;NXF2_HUMAN	D	433;433;345;433;433	ENSP00000378523:A433D;ENSP00000331471:A433D;ENSP00000361849:A345D;ENSP00000361844:A433D;ENSP00000361843:A433D	ENSP00000331471:A433D	A	+	2	0	NXF2	101463458	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.092000	0.11129	-1.866000	0.01145	-0.492000	0.04666	GCC		0.597	NXF2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057618.1	NM_017809		6	89	1	0	0.00448238	0.004482	0.00491649	6	89				
NCBP2L	392517	broad.mit.edu	37	X	107018416	107018416	+	5'Flank	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:107018416C>A	ENST00000509000.2	+	0	0				TSC22D3_ENST00000514426.1_Silent_p.L10L|TSC22D3_ENST00000372384.2_Silent_p.L78L|TSC22D3_ENST00000315660.4_Silent_p.L78L|TSC22D3_ENST00000506081.1_Silent_p.L78L|TSC22D3_ENST00000372383.4_Silent_p.L78L			A6PVI3	NCB2L_HUMAN	nuclear cap binding protein subunit 2-like						mRNA cis splicing, via spliceosome (GO:0045292)	nuclear cap binding complex (GO:0005846)	nucleotide binding (GO:0000166)|RNA cap binding (GO:0000339)	p.L78L(1)		large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	5						AGGGGTCCCGCAGCACCGGCT	0.567																																							uc004enh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(232-234)CTG>CTT		TSC22 domain family, member 3 isoform 1							143.0	103.0	117.0					X																	107018416		2203	4300	6503	SO:0001631	upstream_gene_variant	1831						sequence-specific DNA binding transcription factor activity	g.chrX:107018416C>A			Xq22.3	2013-02-12			ENSG00000170935	ENSG00000170935		"""RNA binding motif (RRM) containing"""	31795	protein-coding gene	gene with protein product							Standard	NG_011409		Approved			A6PVI3	OTTHUMG00000022169		X.37:g.107018416C>A	Exception_encountered					TSC22D3_uc004eni.2_Silent_p.L78L|TSC22D3_uc004enj.2_Silent_p.L78L	p.L78L	NM_198057	NP_932174	Q99576	T22D3_HUMAN			1	602	-			Error:Variant_position_missing_in_Q99576_after_alignment						Silent	SNP	ENST00000509000.2	37	c.234G>T																																																																																					0.567	NCBP2L-001	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000057850.2	XM_373362		11	53	1	0	4.3838e-07	0.001855	5.86514e-07	11	53				
ZCCHC16	340595	broad.mit.edu	37	X	111698402	111698402	+	Missense_Mutation	SNP	A	A	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:111698402A>T	ENST00000340433.2	+	1	676	c.446A>T	c.(445-447)aAt>aTt	p.N149I		NM_001004308.2	NP_001004308.2	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	149							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.N149I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27						CCTCTGATGAATGCTAAGTTT	0.423																																							uc004epo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(445-447)AAT>ATT		zinc finger, CCHC domain containing 16							82.0	78.0	79.0					X																	111698402		2203	4300	6503	SO:0001583	missense	340595						nucleic acid binding|zinc ion binding	g.chrX:111698402A>T	AK128465	CCDS35369.1	Xq23	2008-05-02			ENSG00000187823	ENSG00000187823		"""Zinc fingers, CCHC domain containing"""	25214	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_001004308		Approved	Mart4, Mar4, FLJ46608	uc004epo.1	Q6ZR62	OTTHUMG00000159706	ENST00000340433.2:c.446A>T	X.37:g.111698402A>T	ENSP00000340590:p.Asn149Ile						p.N149I	NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN			3	887	+			149					B2RPG1	Missense_Mutation	SNP	ENST00000340433.2	37	c.446A>T	CCDS35369.1	.	.	.	.	.	.	.	.	.	.	A	1.557	-0.537572	0.04082	.	.	ENSG00000187823	ENST00000340433	T	0.29917	1.55	3.76	2.54	0.30619	.	0.157107	0.27105	U	0.020909	T	0.28896	0.0717	N	0.24115	0.695	0.09310	N	1	D	0.63046	0.992	P	0.60541	0.876	T	0.08785	-1.0705	10	0.21014	T	0.42	-0.5285	5.4925	0.16785	0.7496:0.0:0.0:0.2503	.	149	Q6ZR62	ZCH16_HUMAN	I	149	ENSP00000340590:N149I	ENSP00000340590:N149I	N	+	2	0	ZCCHC16	111585058	0.105000	0.21958	0.002000	0.10522	0.047000	0.14425	1.039000	0.30266	0.582000	0.29556	0.430000	0.28490	AAT		0.423	ZCCHC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356964.1	NM_001004308		16	103	0	0	0	0.006122	0	16	103				
WDR44	54521	broad.mit.edu	37	X	117526694	117526694	+	Missense_Mutation	SNP	A	A	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:117526694A>C	ENST00000254029.3	+	4	681	c.286A>C	c.(286-288)Agt>Cgt	p.S96R	WDR44_ENST00000493448.1_3'UTR|WDR44_ENST00000371825.3_Missense_Mutation_p.S96R|WDR44_ENST00000371822.5_Missense_Mutation_p.S71R	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	96	Binding activity.			S -> G (in Ref. 2; CAL38210). {ECO:0000305}.		endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.S96R(2)		breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AGCTACTGCCAGTCCTATTGT	0.413																																							uc004eqn.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						c.(286-288)AGT>CGT		WD repeat domain 44 protein							91.0	84.0	86.0					X																	117526694		2203	4300	6503	SO:0001583	missense	54521					cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm		g.chrX:117526694A>C	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.286A>C	X.37:g.117526694A>C	ENSP00000254029:p.Ser96Arg					WDR44_uc004eqo.2_Missense_Mutation_p.S96R|WDR44_uc011mtr.1_Missense_Mutation_p.S71R|WDR44_uc010nqi.2_5'UTR	p.S96R	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN			4	711	+			96	S -> G (in Ref. 2; CAL38210).		Binding activity.		B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	c.286A>C	CCDS14572.1	.	.	.	.	.	.	.	.	.	.	a	6.327	0.428384	0.11987	.	.	ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825	T;T;T	0.73469	-0.75;-0.16;-0.03	5.84	-1.05	0.10036	.	0.944288	0.09085	N	0.850715	T	0.55305	0.1912	N	0.19112	0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.36089	-0.9762	10	0.44086	T	0.13	-26.2129	5.4167	0.16378	0.4872:0.2456:0.2672:0.0	.	71;96;96	F8W913;Q5JSH3-2;Q5JSH3	.;.;WDR44_HUMAN	R	71;96;96	ENSP00000360887:S71R;ENSP00000254029:S96R;ENSP00000360890:S96R	ENSP00000254029:S96R	S	+	1	0	WDR44	117410722	0.004000	0.15560	0.290000	0.24890	0.342000	0.28953	0.735000	0.26115	-0.575000	0.05982	-1.092000	0.02172	AGT		0.413	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045		18	97	0	0	0	0.010504	0	18	97				
LAMP2	3920	broad.mit.edu	37	X	119576490	119576490	+	Missense_Mutation	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:119576490C>G	ENST00000200639.4	-	7	1028	c.892G>C	c.(892-894)Gaa>Caa	p.E298Q	LAMP2_ENST00000538785.1_Missense_Mutation_p.E187Q|LAMP2_ENST00000371335.4_Missense_Mutation_p.E298Q|LAMP2_ENST00000434600.2_Missense_Mutation_p.E298Q|LAMP2_ENST00000540603.1_Missense_Mutation_p.E251Q			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	298	Second lumenal domain.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)	p.E298Q(3)		endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						ATGTTCACTTCCTTCAGATAA	0.373																																							uc004est.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(892-894)GAA>CAA		lysosomal-associated membrane protein 2 isoform							219.0	208.0	212.0					X																	119576490		2203	4300	6503	SO:0001583	missense	3920				platelet activation|platelet degranulation	endosome membrane|integral to membrane|late endosome|lysosomal membrane|membrane fraction|plasma membrane|platelet dense granule membrane		g.chrX:119576490C>G	X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.892G>C	X.37:g.119576490C>G	ENSP00000200639:p.Glu298Gln					LAMP2_uc004ess.3_Missense_Mutation_p.E298Q|LAMP2_uc011mtz.1_Missense_Mutation_p.E187Q|LAMP2_uc011mua.1_Missense_Mutation_p.E251Q|LAMP2_uc010nqp.1_Missense_Mutation_p.E298Q	p.E298Q	NM_002294	NP_002285	P13473	LAMP2_HUMAN			7	1072	-			298			Lumenal (Potential).|Second lumenal domain.		A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Missense_Mutation	SNP	ENST00000200639.4	37	c.892G>C	CCDS14599.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543098	0.65198	.	.	ENSG00000005893	ENST00000434600;ENST00000538785;ENST00000200639;ENST00000371335;ENST00000540603	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.34	5.34	0.76211	.	0.185638	0.47093	D	0.000257	T	0.60586	0.2280	M	0.77820	2.39	0.37646	D	0.922211	D;D;D;D;D	0.89917	0.995;0.995;1.0;0.998;0.995	D;D;D;D;D	0.75020	0.972;0.943;0.979;0.985;0.972	T	0.64630	-0.6362	10	0.32370	T	0.25	-9.0539	16.4763	0.84133	0.0:1.0:0.0:0.0	.	251;187;298;298;298	B4E2S7;B7Z2R9;P13473-2;P13473;Q6Q3G8	.;.;.;LAMP2_HUMAN;.	Q	298;187;298;298;251	ENSP00000408411:E298Q;ENSP00000440506:E187Q;ENSP00000200639:E298Q;ENSP00000360386:E298Q;ENSP00000440479:E251Q	ENSP00000200639:E298Q	E	-	1	0	LAMP2	119460518	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	4.445000	0.60007	2.202000	0.70862	0.594000	0.82650	GAA		0.373	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058099.1			52	305	0	0	0	0.01441	0	52	305				
GRIA3	2892	broad.mit.edu	37	X	122616858	122616858	+	Missense_Mutation	SNP	G	G	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:122616858G>A	ENST00000371251.1	+	15	2700	c.2648G>A	c.(2647-2649)gGc>gAc	p.G883D	GRIA3_ENST00000371256.5_Missense_Mutation_p.G883D|GRIA3_ENST00000264357.5_Missense_Mutation_p.G883D|GRIA3_ENST00000542149.1_3'UTR			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	883					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.G883D(3)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TACAGAGAAGGCTACAACGTG	0.413																																							uc004etq.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(2647-2649)GGC>GAC		glutamate receptor, ionotrophic, AMPA 3 isoform	L-Glutamic Acid(DB00142)						119.0	104.0	109.0					X																	122616858		2203	4300	6503	SO:0001583	missense	2892				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity	g.chrX:122616858G>A	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2648G>A	X.37:g.122616858G>A	ENSP00000360297:p.Gly883Asp					GRIA3_uc004etr.3_Missense_Mutation_p.G883D|GRIA3_uc004ets.3_RNA	p.G883D	NM_007325	NP_015564	P42263	GRIA3_HUMAN			16	2941	+			883			Cytoplasmic (Potential).		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	c.2648G>A	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356375	0.82243	.	.	ENSG00000125675	ENST00000264357;ENST00000371256;ENST00000371251	T;T;T	0.13538	2.58;2.58;2.58	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.23691	-1.0181	10	0.59425	D	0.04	.	17.8613	0.88781	0.0:0.0:1.0:0.0	.	883;883	P42263;P42263-2	GRIA3_HUMAN;.	D	883	ENSP00000264357:G883D;ENSP00000360302:G883D;ENSP00000360297:G883D	ENSP00000264357:G883D	G	+	2	0	GRIA3	122444539	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.436000	0.82500	0.600000	0.82982	GGC		0.413	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828		15	104	0	0	0	0.004007	0	15	104				
TENM1	10178	broad.mit.edu	37	X	123556416	123556416	+	Missense_Mutation	SNP	T	T	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:123556416T>A	ENST00000371130.3	-	23	4219	c.4156A>T	c.(4156-4158)Att>Ttt	p.I1386F	TENM1_ENST00000422452.2_Missense_Mutation_p.I1393F|STAG2_ENST00000469481.1_3'UTR	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1386					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.I1388F(1)									TGCAGCACAATGTTGTTATCC	0.473																																							uc004euj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(4156-4158)ATT>TTT		odz, odd Oz/ten-m homolog 1 isoform 3							151.0	125.0	134.0					X																	123556416		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123556416T>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4156A>T	X.37:g.123556416T>A	ENSP00000360171:p.Ile1386Phe					ODZ1_uc011muj.1_Missense_Mutation_p.I1392F|ODZ1_uc010nqy.2_Missense_Mutation_p.I1393F	p.I1386F	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			23	4220	-			1386			NHL 3.|Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.4156A>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.210117	0.79240	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85861	-2.04;-2.01	5.68	5.68	0.88126	Six-bladed beta-propeller, TolB-like (1);	0.058266	0.64402	D	0.000002	D	0.85957	0.5818	L	0.49126	1.545	0.58432	D	0.999999	D;P;D	0.56521	0.976;0.949;0.967	B;B;P	0.50136	0.386;0.443;0.632	D	0.86805	0.1994	10	0.54805	T	0.06	.	14.9601	0.71151	0.0:0.0:0.0:1.0	.	1392;1393;1386	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	F	1386;1393	ENSP00000360171:I1386F;ENSP00000403954:I1393F	ENSP00000360171:I1386F	I	-	1	0	ODZ1	123384097	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.156000	0.50708	1.915000	0.55452	0.481000	0.45027	ATT		0.473	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		15	102	0	0	0	0.00245	0	15	102				
XPNPEP2	7512	broad.mit.edu	37	X	128890490	128890490	+	Silent	SNP	C	C	G			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:128890490C>G	ENST00000371106.3	+	14	1518	c.1326C>G	c.(1324-1326)tcC>tcG	p.S442S		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	442						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.S442S(1)		endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GCAAGCTGTCCTCAGATGAGA	0.602																																							uc004eut.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1324-1326)TCC>TCG		X-prolyl aminopeptidase 2, membrane-bound							139.0	98.0	112.0					X																	128890490		2203	4300	6503	SO:0001819	synonymous_variant	7512				cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity	g.chrX:128890490C>G	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1326C>G	X.37:g.128890490C>G							p.S442S	NM_003399	NP_003390	O43895	XPP2_HUMAN			14	1570	+			442					A0AV16|O75994	Silent	SNP	ENST00000371106.3	37	c.1326C>G	CCDS14613.1																																																																																				0.602	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399		6	37	0	0	0	0.001168	0	6	37				
AIFM1	9131	broad.mit.edu	37	X	129290567	129290567	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:129290567G>T	ENST00000287295.3	-	2	347	c.117C>A	c.(115-117)ttC>ttA	p.F39L	AIFM1_ENST00000535724.1_Intron|AIFM1_ENST00000346424.2_Intron|AIFM1_ENST00000319908.3_Intron	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	39					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.F39L(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	GCCATCGCTGGAACAAGTTGC	0.358																																							uc004evg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(115-117)TTC>TTA		programmed cell death 8 isoform 1							175.0	155.0	162.0					X																	129290567		2203	4300	6503	SO:0001583	missense	9131				activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding	g.chrX:129290567G>T	AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.117C>A	X.37:g.129290567G>T	ENSP00000287295:p.Phe39Leu					AIFM1_uc011mus.1_Missense_Mutation_p.F39L|AIFM1_uc004evh.2_Intron|AIFM1_uc004evi.2_Intron|AIFM1_uc004evk.2_Intron	p.F39L	NM_004208	NP_004199	O95831	AIFM1_HUMAN			2	295	-			39					A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	ENST00000287295.3	37	c.117C>A	CCDS14618.1	.	.	.	.	.	.	.	.	.	.	G	1.427	-0.571304	0.03882	.	.	ENSG00000156709	ENST00000287295	T	0.19394	2.15	5.49	4.61	0.57282	.	0.432182	0.24700	N	0.036309	T	0.07863	0.0197	N	0.05441	-0.05	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19811	-1.0294	10	0.02654	T	1	-4.6833	6.4978	0.22152	0.1121:0.3136:0.5742:0.0	.	39;39	Q1L6K6;O95831	.;AIFM1_HUMAN	L	39	ENSP00000287295:F39L	ENSP00000287295:F39L	F	-	3	2	AIFM1	129118248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.757000	0.47557	2.296000	0.77279	0.538000	0.68166	TTC		0.358	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2			35	200	1	0	1.04594e-18	0.00623	1.83889e-18	35	200				
RP1-274L7.1	0	broad.mit.edu	37	X	129629173	129629173	+	lincRNA	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:129629173G>T	ENST00000458525.1	-	0	1022				FAM45B_ENST00000592932.1_RNA														p.G14V(1)									CTGATGCTTGGAGTCGGGCTG	0.542																																							uc010nrh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(40-42)GGA>GTA		hypothetical protein LOC404636							83.0	79.0	81.0					X																	129629173		2203	4300	6503			55855							g.chrX:129629173G>T																													X.37:g.129629173G>T						uc004evu.2_RNA	p.G14V	NM_207009	NP_996892				all cancers(201;0.0293)	1	259	+									Missense_Mutation	SNP	ENST00000458525.1	37	c.41G>T																																																																																					0.542	RP1-274L7.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058271.1			18	19	1	0	3.52763e-06	0.00499	4.49727e-06	18	19				
OR13H1	347468	broad.mit.edu	37	X	130678918	130678918	+	Missense_Mutation	SNP	C	C	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:130678918C>A	ENST00000338616.3	+	1	969	c.871C>A	c.(871-873)Ctg>Atg	p.L291M		NM_001004486.1	NP_001004486.1	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H, member 1	291						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L291M(1)		endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15	Acute lymphoblastic leukemia(192;0.000636)					GATATATAGCCTGAGAAAAAA	0.398																																							uc011muw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(871-873)CTG>ATG		olfactory receptor, family 13, subfamily H,							86.0	83.0	84.0					X																	130678918		2203	4299	6502	SO:0001583	missense	347468				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chrX:130678918C>A		CCDS35396.1	Xq26.2	2012-08-23			ENSG00000171054	ENSG00000171054		"""GPCR / Class A : Olfactory receptors"""	14755	protein-coding gene	gene with protein product							Standard	NM_001004486		Approved		uc011muw.2	Q8NG92	OTTHUMG00000022411	ENST00000338616.3:c.871C>A	X.37:g.130678918C>A	ENSP00000340748:p.Leu291Met					IGSF1_uc004ewf.2_Intron	p.L291M	NM_001004486	NP_001004486	Q8NG92	O13H1_HUMAN			1	871	+	Acute lymphoblastic leukemia(192;0.000636)		291			Helical; Name=7; (Potential).		B2RNQ3|Q6IET8|Q96R12	Missense_Mutation	SNP	ENST00000338616.3	37	c.871C>A	CCDS35396.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364326	0.24684	.	.	ENSG00000171054	ENST00000338616	T	0.48836	0.8	4.87	2.12	0.27331	.	0.000000	0.31381	U	0.007746	T	0.68769	0.3037	M	0.90759	3.145	0.31966	N	0.607796	D	0.89917	1.0	D	0.80764	0.994	T	0.72187	-0.4366	10	0.87932	D	0	.	7.2415	0.26100	0.0:0.6896:0.0:0.3104	.	291	Q8NG92	O13H1_HUMAN	M	291	ENSP00000340748:L291M	ENSP00000340748:L291M	L	+	1	2	OR13H1	130506599	0.001000	0.12720	0.007000	0.13788	0.171000	0.22731	-0.181000	0.09740	0.124000	0.18369	0.594000	0.82650	CTG		0.398	OR13H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058297.1			45	100	1	0	4.18559e-23	0.01441	7.692e-23	45	100				
GPC3	2719	broad.mit.edu	37	X	132887866	132887866	+	Silent	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:132887866G>T	ENST00000370818.3	-	3	1120	c.675C>A	c.(673-675)gtC>gtA	p.V225V	GPC3_ENST00000543339.1_Silent_p.V171V|GPC3_ENST00000394299.2_Silent_p.V225V	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	225					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)	p.V225V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					AGATCCTAGTGACTTGCAGTG	0.463			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																														uc004exe.1		NA	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	T|D|Mis|N|F|S	glypican 3			O		Wilms tumour			1	Substitution - coding silent(1)		lung(1)	lung(2)|prostate(1)|breast(1)|skin(1)	5						c.(673-675)GTC>GTA		glypican 3 isoform 2 precursor							392.0	277.0	316.0					X																	132887866		2203	4300	6503	SO:0001819	synonymous_variant	2719	Simpson-Golabi-Behmel_syndrome	Familial Cancer Database	SGBS		extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity	g.chrX:132887866G>T	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.675C>A	X.37:g.132887866G>T						GPC3_uc004exd.1_Silent_p.V97V|GPC3_uc010nrn.1_Silent_p.V225V|GPC3_uc011mvh.1_Silent_p.V209V|GPC3_uc010nro.1_Silent_p.V171V|GPC3_uc010nrp.1_Silent_p.V97V	p.V225V	NM_004484	NP_004475	P51654	GPC3_HUMAN			3	865	-	Acute lymphoblastic leukemia(192;0.000127)		225					C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	c.675C>A	CCDS14638.1																																																																																				0.463	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484		18	95	1	0	4.96729e-08	0.008871	6.83353e-08	18	95				
FAM122C	159091	broad.mit.edu	37	X	133988158	133988158	+	Missense_Mutation	SNP	G	G	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:133988158G>T	ENST00000370784.4	+	7	886	c.480G>T	c.(478-480)atG>atT	p.M160I	FAM122C_ENST00000445123.1_Missense_Mutation_p.A157S|FAM122C_ENST00000370785.3_3'UTR	NM_001170779.1	NP_001164250.1	Q6P4D5	F222C_HUMAN	family with sequence similarity 122C	160								p.M160I(1)		endometrium(2)|kidney(1)|lung(2)	5	Acute lymphoblastic leukemia(192;0.000127)					CGACAGCAATGCTGGATCTTC	0.418																																							uc004exz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(478-480)ATG>ATT		hypothetical protein LOC159091							186.0	154.0	165.0					X																	133988158		2203	4300	6503	SO:0001583	missense	159091							g.chrX:133988158G>T	BC017868	CCDS14644.1, CCDS55500.1, CCDS55501.1, CCDS76028.1	Xq26.3	2008-02-05	2006-07-11		ENSG00000156500	ENSG00000156500			25202	protein-coding gene	gene with protein product						12477932	Standard	NM_138819		Approved	RP3-473B4.1	uc004exz.2	Q6P4D5	OTTHUMG00000022716	ENST00000370784.4:c.480G>T	X.37:g.133988158G>T	ENSP00000359820:p.Met160Ile					FAM122C_uc011mvq.1_RNA|FAM122C_uc004exy.1_3'UTR	p.M160I	NM_138819	NP_620174	Q6P4D5	F222C_HUMAN			7	885	+	Acute lymphoblastic leukemia(192;0.000127)		160					F5H036|Q8WVK9	Missense_Mutation	SNP	ENST00000370784.4	37	c.480G>T	CCDS55501.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.30|16.30	3.084446|3.084446	0.55861|0.55861	.|.	.|.	ENSG00000156500|ENSG00000156500	ENST00000445123|ENST00000370784	T|.	0.55234|.	0.53|.	4.28|4.28	-0.774|-0.774	0.10991|0.10991	.|.	.|1.000540	.|0.08064	.|N	.|0.998801	T|T	0.25901|0.25901	0.0631|0.0631	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B	.|0.14012	.|0.009	.|B	.|0.06405	.|0.002	T|T	0.24728|0.24728	-1.0152|-1.0152	7|9	0.10111|0.87932	T|D	0.7|0	.|.	3.8026|3.8026	0.08764|0.08764	0.4052:0.0:0.43:0.1649|0.4052:0.0:0.43:0.1649	.|.	.|160	.|Q6P4D5	.|F222C_HUMAN	S|I	157|160	ENSP00000389955:A157S|.	ENSP00000389955:A157S|ENSP00000359820:M160I	A|M	+|+	1|3	0|0	FAM122C|FAM122C	133815824|133815824	0.013000|0.013000	0.17824|0.17824	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.559000|0.559000	0.23485|0.23485	-0.661000|-0.661000	0.05345|0.05345	-0.198000|-0.198000	0.12761|0.12761	GCT|ATG		0.418	FAM122C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_138819		19	92	1	0	1.33834e-09	0.007413	1.92263e-09	19	92				
GPR112	139378	broad.mit.edu	37	X	135431279	135431279	+	Missense_Mutation	SNP	C	C	T			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:135431279C>T	ENST00000394143.1	+	6	5705	c.5414C>T	c.(5413-5415)aCt>aTt	p.T1805I	GPR112_ENST00000412101.1_Missense_Mutation_p.T1600I|GPR112_ENST00000370652.1_Missense_Mutation_p.T1805I|GPR112_ENST00000287534.4_Missense_Mutation_p.T1742I|GPR112_ENST00000394141.1_Missense_Mutation_p.T1600I	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1805					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T1805I(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTAGAAAAGACTTCCTTAACA	0.383																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(5413-5415)ACT>ATT		G-protein coupled receptor 112							131.0	126.0	128.0					X																	135431279		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135431279C>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5414C>T	X.37:g.135431279C>T	ENSP00000377699:p.Thr1805Ile					GPR112_uc010nsb.1_Missense_Mutation_p.T1600I|GPR112_uc010nsc.1_Missense_Mutation_p.T1572I	p.T1805I	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	5705	+	Acute lymphoblastic leukemia(192;0.000127)		1805			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.5414C>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	10.69	1.421710	0.25639	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.35789	1.33;1.33;1.29;1.41;1.29	3.7	1.55	0.23275	.	.	.	.	.	T	0.23014	0.0556	N	0.24115	0.695	0.09310	N	1	B;B;B	0.23891	0.093;0.035;0.01	B;B;B	0.25987	0.065;0.021;0.004	T	0.24693	-1.0153	9	0.56958	D	0.05	.	5.0348	0.14428	0.0:0.6252:0.0:0.3748	.	1742;1600;1805	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	I	1805;1805;1600;1742;1600	ENSP00000377699:T1805I;ENSP00000359686:T1805I;ENSP00000416526:T1600I;ENSP00000287534:T1742I;ENSP00000377697:T1600I	ENSP00000287534:T1742I	T	+	2	0	GPR112	135258945	0.154000	0.22792	0.001000	0.08648	0.323000	0.28346	0.600000	0.24104	0.004000	0.14682	0.458000	0.33432	ACT		0.383	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			35	88	0	0	0	0.013726	0	35	88				
SPANXN3	139067	broad.mit.edu	37	X	142596980	142596980	+	Silent	SNP	T	T	A	rs373998743		TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:142596980T>A	ENST00000370503.2	-	2	173	c.90A>T	c.(88-90)gtA>gtT	p.V30V	GS1-256O22.5_ENST00000431432.1_RNA	NM_001009609.2	NP_001009609.1	Q5MJ09	SPXN3_HUMAN	SPANX family, member N3	30								p.V30V(1)		endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					CTCTGTTTGGTACCTCTTGCA	0.393																																							uc004fbw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(88-90)GTA>GTT		SPANX-N3 protein							72.0	67.0	68.0					X																	142596980		2203	4300	6503	SO:0001819	synonymous_variant	139067							g.chrX:142596980T>A		CCDS35418.1	Xq27.3	2012-06-12			ENSG00000189252	ENSG00000189252			33176	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 8"""	300666				14973187, 17012309	Standard	NM_001009609		Approved	SPANX-N3, CT11.8	uc004fbw.3	Q5MJ09	OTTHUMG00000022582	ENST00000370503.2:c.90A>T	X.37:g.142596980T>A							p.V30V	NM_001009609	NP_001009609	Q5MJ09	SPXN3_HUMAN			2	178	-	Acute lymphoblastic leukemia(192;6.56e-05)		30					Q0ZNK4	Silent	SNP	ENST00000370503.2	37	c.90A>T	CCDS35418.1																																																																																				0.393	SPANXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058620.2	NM_001009609		11	87	0	0	0	0.010729	0	11	87				
CCKBR	887	broad.mit.edu	37	11	6291420	6291420	+	Frame_Shift_Del	DEL	C	C	-			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr11:6291420delC	ENST00000334619.2	+	3	699	c.506delC	c.(505-507)tccfs	p.S169fs	CCKBR_ENST00000525462.1_Frame_Shift_Del_p.S169fs|CCKBR_ENST00000532715.1_Frame_Shift_Del_p.S85fs|CCKBR_ENST00000525014.1_3'UTR	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	169					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CAGACGCGCTCCCACGCGGCT	0.642																																							uc001mcp.2		NA																	0				lung(5)|ovary(2)|breast(1)	8						c.(505-507)TCCfs		cholecystokinin B receptor	Pentagastrin(DB00183)						46.0	38.0	41.0					11																	6291420		2198	4290	6488	SO:0001589	frameshift_variant	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6291420delC	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.506delC	11.37:g.6291420delC	ENSP00000335544:p.Ser169fs					CCKBR_uc001mcq.2_Frame_Shift_Del_p.S97fs|CCKBR_uc001mcr.2_Frame_Shift_Del_p.S169fs|CCKBR_uc001mcs.2_Frame_Shift_Del_p.S169fs	p.S169fs	NM_176875	NP_795344	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	3	699	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	169			Cytoplasmic (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Frame_Shift_Del	DEL	ENST00000334619.2	37	c.506delC	CCDS7761.1																																																																																				0.642	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		11	16	NA	NA	NA	NA	NA	11	16	---	---	---	---
RNF219	79596	broad.mit.edu	37	13	79190706	79190707	+	Frame_Shift_Ins	INS	-	-	A			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr13:79190706_79190707insA	ENST00000282003.6	-	6	1247_1248	c.1189_1190insT	c.(1189-1191)tgcfs	p.C397fs	RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	397							zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		GAGCTGAAGGCAACTAAGGGAC	0.426																																							uc001vkw.1		NA																	0				large_intestine(2)	2						c.(1189-1191)TGCfs		ring finger protein 219																																				SO:0001589	frameshift_variant	79596						zinc ion binding	g.chr13:79190706_79190707insA	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1190dupT	13.37:g.79190708_79190708dupA	ENSP00000282003:p.Cys397fs					uc001vku.1_RNA|RNF219_uc010afb.1_Frame_Shift_Ins_p.C207fs|RNF219_uc010afc.2_Intron	p.C397fs	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN		GBM - Glioblastoma multiforme(99;0.0414)	6	1248_1249	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)	397					B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Frame_Shift_Ins	INS	ENST00000282003.6	37	c.1189_1190insT	CCDS31997.1																																																																																				0.426	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546		22	125	NA	NA	NA	NA	NA	22	125	---	---	---	---
TP53	7157	broad.mit.edu	37	17	7579481	7579482	+	Frame_Shift_Ins	INS	-	-	C			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr17:7579481_7579482insC	ENST00000269305.4	-	4	394_395	c.205_206insG	c.(205-207)gctfs	p.A69fs	TP53_ENST00000359597.4_Frame_Shift_Ins_p.A69fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Ins_p.A69fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.A69fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.A69fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.A69fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	69	Interaction with HRMT1L2.|Interaction with WWOX.		A -> D (in a sporadic cancer; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> T (in a sporadic cancer; somatic mutation).|A -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G59fs*23(3)|p.A69G(3)|p.A69fs*54(1)|p.E68fs*76(1)|p.A69fs*79(1)|p.D48fs*55(1)|p.R65_P71delRMPEAAP(1)|p.A69V(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGGGAGCAGCCTCTGGCATT	0.609		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		24	Deletion - Frameshift(9)|Whole gene deletion(8)|Substitution - Missense(4)|Deletion - In frame(2)|Complex - frameshift(1)	p.0?(7)|p.G59fs*23(3)|p.A69G(3)|p.A69fs*54(1)|p.E68fs*76(1)|p.A69fs*79(1)|p.D48fs*55(1)|p.R65_P71delRMPEAAP(1)|p.A69V(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)	central_nervous_system(4)|bone(4)|upper_aerodigestive_tract(3)|lung(3)|breast(3)|prostate(2)|stomach(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)|oesophagus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(205-207)GCTfs	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a																																				SO:0001589	frameshift_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579481_7579482insC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.206dupG	17.37:g.7579483_7579483dupC	ENSP00000269305:p.Ala69fs	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Frame_Shift_Ins_p.A69fs|TP53_uc002gih.2_Frame_Shift_Ins_p.A69fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Frame_Shift_Ins_p.A69fs|TP53_uc010cni.1_Frame_Shift_Ins_p.A69fs|TP53_uc002gij.2_Frame_Shift_Ins_p.A69fs|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Frame_Shift_Ins_p.A30fs|TP53_uc010cnk.1_Frame_Shift_Ins_p.A84fs	p.A69fs	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	399_400	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	69		A -> D (in a sporadic cancer; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> T (in a sporadic cancer; somatic mutation).|A -> V (in a sporadic cancer; somatic mutation).	Interaction with WWOX.|Interaction with HRMT1L2.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	c.205_206insG	CCDS11118.1																																																																																				0.609	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		102	86	NA	NA	NA	NA	NA	102	86	---	---	---	---
MANBA	4126	broad.mit.edu	37	4	103644031	103644031	+	Frame_Shift_Del	DEL	C	C	-			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr4:103644031delC	ENST00000226578.4	-	4	645	c.546delG	c.(544-546)cggfs	p.R182fs	MANBA_ENST00000505239.1_Intron	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	182					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		CCATTACCTTCCGAACAAAGT	0.488																																							uc003hwg.2		NA																	0				ovary(1)	1						c.(544-546)CGGfs		mannosidase, beta A, lysosomal precursor							112.0	103.0	106.0					4																	103644031		2203	4300	6503	SO:0001589	frameshift_variant	4126				carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding	g.chr4:103644031delC		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.546delG	4.37:g.103644031delC	ENSP00000226578:p.Arg182fs					MANBA_uc011ces.1_Intron	p.R182fs	NM_005908	NP_005899	O00462	MANBA_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)	4	646	-		Hepatocellular(203;0.217)	182					Q96BC3|Q9NYX9	Frame_Shift_Del	DEL	ENST00000226578.4	37	c.546delG	CCDS3658.1																																																																																				0.488	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2			14	37	NA	NA	NA	NA	NA	14	37	---	---	---	---
OR13C4	138804	broad.mit.edu	37	9	107288787	107288787	+	Frame_Shift_Del	DEL	T	T	-			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chr9:107288787delT	ENST00000277216.3	-	1	703	c.704delA	c.(703-705)cacfs	p.H235fs		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						AAATGCCTTGTGTCTTCCTGT	0.423																																							uc011lvn.1		NA																	0				skin(1)	1						c.(703-705)CACfs		olfactory receptor, family 13, subfamily C,							134.0	131.0	132.0					9																	107288787		2203	4300	6503	SO:0001589	frameshift_variant	138804				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107288787delT		CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.704delA	9.37:g.107288787delT	ENSP00000277216:p.His235fs						p.H235fs	NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN			1	704	-			235			Cytoplasmic (Potential).		Q6IF51|Q96R41	Frame_Shift_Del	DEL	ENST00000277216.3	37	c.704delA	CCDS35088.1																																																																																				0.423	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053478.1			42	66	NA	NA	NA	NA	NA	42	66	---	---	---	---
CYBB	1536	broad.mit.edu	37	X	37664382	37664382	+	Frame_Shift_Del	DEL	C	C	-			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:37664382delC	ENST00000378588.4	+	10	1342	c.1275delC	c.(1273-1275)tacfs	p.Y425fs	CYBB_ENST00000536160.1_Frame_Shift_Del_p.Y158fs|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Frame_Shift_Del_p.Y393fs	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	425					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	CAGTCTGGTACAAATATTGCA	0.483																																							uc004ddr.2		NA																	0				central_nervous_system(1)|skin(1)	2	GRCh37	CM015930	CYBB	M		c.(1273-1275)TACfs		cytochrome b-245 beta polypeptide							186.0	124.0	145.0					X																	37664382		2202	4300	6502	SO:0001589	frameshift_variant	1536				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity	g.chrX:37664382delC	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.1275delC	X.37:g.37664382delC	ENSP00000367851:p.Tyr425fs					CYBB_uc011mkf.1_Frame_Shift_Del_p.Y393fs|CYBB_uc011mkg.1_Frame_Shift_Del_p.Y158fs	p.Y425fs	NM_000397	NP_000388	P04839	CY24B_HUMAN			10	1336	+			425			Cytoplasmic (Potential).		A8K138|Q2PP16	Frame_Shift_Del	DEL	ENST00000378588.4	37	c.1275delC	CCDS14242.1																																																																																				0.483	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080881.1			13	33	NA	NA	NA	NA	NA	13	33	---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67937113	67937113	+	Frame_Shift_Del	DEL	G	G	-			TCGA-75-6211-01A-11D-1753-08	TCGA-75-6211-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d8c9abbe-b112-4019-a6a3-f582df1379ed	766b14bf-ca3c-429d-83f0-b01190caceb3	g.chrX:67937113delG	ENST00000252336.6	+	5	489	c.117delG	c.(115-117)cagfs	p.Q39fs	STARD8_ENST00000374597.3_Frame_Shift_Del_p.Q39fs|STARD8_ENST00000374599.3_Frame_Shift_Del_p.Q119fs	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	39					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						CCTTCCAGCAGGAAAGTAAGT	0.587																																							uc004dxa.2		NA																	0				breast(3)|ovary(2)|pancreas(1)	6						c.(115-117)CAGfs		StAR-related lipid transfer (START) domain							70.0	41.0	51.0					X																	67937113		2202	4300	6502	SO:0001589	frameshift_variant	9754				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity	g.chrX:67937113delG	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.117delG	X.37:g.67937113delG	ENSP00000252336:p.Gln39fs					STARD8_uc004dxb.2_Frame_Shift_Del_p.Q119fs|STARD8_uc004dxc.3_Frame_Shift_Del_p.Q39fs	p.Q39fs	NM_014725	NP_055540	Q92502	STAR8_HUMAN			5	489	+			39					A8K6T2|D3DVT9|Q5JST0|Q68DG7	Frame_Shift_Del	DEL	ENST00000252336.6	37	c.117delG	CCDS14390.1																																																																																				0.587	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		7	7	NA	NA	NA	NA	NA	7	7	---	---	---	---
