#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
KIF1B	23095	broad.mit.edu	37	1	10421830	10421830	+	Silent	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:10421830A>T	ENST00000377086.1	+	40	4453	c.4251A>T	c.(4249-4251)ccA>ccT	p.P1417P	KIF1B_ENST00000263934.6_Silent_p.P1371P|KIF1B_ENST00000465635.1_3'UTR|KIF1B_ENST00000377081.1_Silent_p.P1417P			O60333	KIF1B_HUMAN	kinesin family member 1B	1417					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGATCTCACCACCACGCTCTC	0.502																																							uc001aqx.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(4249-4251)CCA>CCT		kinesin family member 1B isoform b							165.0	142.0	150.0					1																	10421830		2203	4300	6503	SO:0001819	synonymous_variant	23095				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding	g.chr1:10421830A>T	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4251A>T	1.37:g.10421830A>T						KIF1B_uc001aqw.3_Silent_p.P1371P|KIF1B_uc001aqy.2_Silent_p.P1391P|KIF1B_uc001aqz.2_Silent_p.P1417P|KIF1B_uc001ara.2_Silent_p.P1377P|KIF1B_uc001arb.2_Silent_p.P1403P	p.P1417P	NM_015074	NP_055889	O60333	KIF1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	40	4453	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	1417					A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	37	c.4251A>T																																																																																					0.502	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1			86	59	0	0	0	0.01441	0	86	59				
PRAMEF11	440560	broad.mit.edu	37	1	12885059	12885059	+	Missense_Mutation	SNP	C	C	G	rs199623827	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:12885059C>G	ENST00000535591.1	-	4	1247	c.1052G>C	c.(1051-1053)tGc>tCc	p.C351S	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	351					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.C351S(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GGTGGCCATGCAGATGGGATT	0.532													.|||	21	0.00419329	0.003	0.0072	5008	,	,		19682	0.001		0.0089	False		,,,				2504	0.002						uc001auk.2		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(1051-1053)TGC>TCC		PRAME family member 11							36.0	29.0	31.0					1																	12885059		692	1579	2271	SO:0001583	missense	440560							g.chr1:12885059C>G	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1052G>C	1.37:g.12885059C>G	ENSP00000439551:p.Cys351Ser						p.C351S	NM_001146344	NP_001139816	O60813	PRA11_HUMAN			4	1248	-			351			LRR 6.			Missense_Mutation	SNP	ENST00000535591.1	37	c.1052G>C	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.316351	0.00235	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.06371	3.31;3.31	1.52	1.52	0.23074	.	0.067349	0.64402	N	0.000012	T	0.00608	0.0020	N	0.00003	-3.455	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44907	-0.9297	10	0.02654	T	1	.	5.7253	0.18010	0.0:0.3438:0.6562:0.0	.	351	O60813	PRA11_HUMAN	S	351;392;351	ENSP00000439551:C351S;ENSP00000391839:C351S	ENSP00000328783:C392S	C	-	2	0	PRAMEF11	12807646	0.578000	0.26717	0.014000	0.15608	0.005000	0.04900	0.846000	0.27682	0.208000	0.20626	-0.483000	0.04790	TGC		0.532	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341		4	242	0	0	0	0.009096	0	4	242				
AGO3	192669	broad.mit.edu	37	1	36469988	36469988	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:36469988G>T	ENST00000373191.4	+	6	1054	c.705G>T	c.(703-705)atG>atT	p.M235I	RP4-665N4.8_ENST00000466576.2_RNA|AGO3_ENST00000246314.6_Start_Codon_SNP_p.M1I	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	235					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										TTCAGTTCATGTGTGAAGTTC	0.328																																						Colon(144;60 2363 31043 40539)	uc001bzp.2		NA																	0					0						c.(703-705)ATG>ATT		eukaryotic translation initiation factor 2C, 3							130.0	126.0	127.0					1																	36469988		2203	4300	6503	SO:0001583	missense	192669				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding	g.chr1:36469988G>T	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.705G>T	1.37:g.36469988G>T	ENSP00000362287:p.Met235Ile					EIF2C3_uc001bzq.2_Missense_Mutation_p.M1I	p.M235I	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN			6	961	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	235					B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	c.705G>T	CCDS399.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.028903	0.54790	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.09538	2.99;2.97	5.35	4.43	0.53597	Argonaute/Dicer protein, PAZ (1);	0.000000	0.85682	D	0.000000	T	0.11707	0.0285	L	0.41492	1.28	0.80722	D	1	B	0.06786	0.001	B	0.17433	0.018	T	0.04191	-1.0970	10	0.41790	T	0.15	-14.9394	15.4536	0.75297	0.0:0.0:0.8601:0.1399	.	235	Q9H9G7	AGO3_HUMAN	I	235;1	ENSP00000362287:M235I;ENSP00000246314:M1I	ENSP00000246314:M1I	M	+	3	0	EIF2C3	36242575	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.835000	0.99442	1.245000	0.43885	0.460000	0.39030	ATG		0.328	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852		47	29	1	0	1.00776e-21	0.01441	2.19724e-21	47	29				
SNIP1	79753	broad.mit.edu	37	1	38019710	38019710	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:38019710G>A	ENST00000296215.6	-	1	193	c.121C>T	c.(121-123)Ccc>Tcc	p.P41S	DNALI1_ENST00000541606.1_5'Flank|DNALI1_ENST00000296218.7_5'Flank|SNIP1_ENST00000468040.1_Intron	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	41					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				CGGTGGGCGGGAGGTGCGACT	0.741																																							uc001cbi.2		NA																	0				upper_aerodigestive_tract(1)|lung(1)	2						c.(121-123)CCC>TCC		Smad nuclear interacting protein							23.0	23.0	23.0					1																	38019710		2197	4299	6496	SO:0001583	missense	79753				production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding	g.chr1:38019710G>A		CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.121C>T	1.37:g.38019710G>A	ENSP00000296215:p.Pro41Ser					SNIP1_uc010oid.1_RNA|DNALI1_uc001cbj.2_5'Flank|DNALI1_uc010oie.1_5'Flank	p.P41S	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN			1	194	-		Myeloproliferative disorder(586;0.0393)	41					Q96SP9|Q9H9T7	Missense_Mutation	SNP	ENST00000296215.6	37	c.121C>T	CCDS419.1	.	.	.	.	.	.	.	.	.	.	G	8.848	0.943829	0.18281	.	.	ENSG00000163877	ENST00000296215;ENST00000436196	T	0.14766	2.48	4.6	3.66	0.41972	.	0.669254	0.12670	N	0.448880	T	0.06962	0.0177	N	0.14661	0.345	0.24510	N	0.99422	B	0.27823	0.19	B	0.21360	0.034	T	0.28554	-1.0040	10	0.07030	T	0.85	-0.9785	10.6139	0.45439	0.0:0.1951:0.8049:0.0	.	41	Q8TAD8	SNIP1_HUMAN	S	41;25	ENSP00000296215:P41S	ENSP00000296215:P41S	P	-	1	0	SNIP1	37792297	1.000000	0.71417	0.859000	0.33776	0.108000	0.19459	2.569000	0.45973	1.244000	0.43870	0.655000	0.94253	CCC		0.741	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012169.2	NM_024700		8	16	0	0	0	0.00308	0	8	16				
PTCH2	8643	broad.mit.edu	37	1	45294203	45294203	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:45294203G>A	ENST00000372192.3	-	12	1695	c.1565C>T	c.(1564-1566)cCt>cTt	p.P522L	PTCH2_ENST00000447098.2_Missense_Mutation_p.P522L	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	522	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					TCGCAGCGCAGGGATGGGAAC	0.632									Basal Cell Nevus syndrome																														uc010olf.1		NA																	0				lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18						c.(1564-1566)CCT>CTT		patched 2							87.0	66.0	73.0					1																	45294203		2203	4299	6502	SO:0001583	missense	8643	Basal_Cell_Nevus_syndrome	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity	g.chr1:45294203G>A	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.1565C>T	1.37:g.45294203G>A	ENSP00000361266:p.Pro522Leu					PTCH2_uc010olg.1_Missense_Mutation_p.P220L	p.P522L	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN			12	1577	-	Acute lymphoblastic leukemia(166;0.155)		522			SSD.|Helical; (Potential).		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	c.1565C>T	CCDS516.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558013	0.86231	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.96830	-4.14;-4.14	5.2	5.2	0.72013	Sterol-sensing domain (1);	0.000000	0.64402	D	0.000001	D	0.98764	0.9584	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.99744	1.1016	10	0.87932	D	0	-32.0952	18.3472	0.90326	0.0:0.0:1.0:0.0	.	522;522	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	L	522	ENSP00000389703:P522L;ENSP00000361266:P522L	ENSP00000361266:P522L	P	-	2	0	PTCH2	45066790	1.000000	0.71417	0.999000	0.59377	0.569000	0.35902	9.677000	0.98645	2.434000	0.82447	0.462000	0.41574	CCT		0.632	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738		26	14	0	0	0	0.004656	0	26	14				
LRRC7	57554	broad.mit.edu	37	1	70518799	70518799	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:70518799G>A	ENST00000035383.5	+	21	4117	c.4087G>A	c.(4087-4089)Gat>Aat	p.D1363N	LRRC7_ENST00000310961.5_Missense_Mutation_p.D1321N|LRRC7_ENST00000415775.2_Missense_Mutation_p.D647N	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1363						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TGGGAGGCGGGATGTACCTCC	0.393																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(4087-4089)GAT>AAT		leucine rich repeat containing 7							89.0	86.0	87.0					1																	70518799		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70518799G>A		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4087G>A	1.37:g.70518799G>A	ENSP00000035383:p.Asp1363Asn					LRRC7_uc009wbg.2_Missense_Mutation_p.D647N|LRRC7_uc001deq.2_Missense_Mutation_p.D557N	p.D1363N	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN			21	4117	+			1363					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.4087G>A	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336209	0.81801	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.48836	0.81;0.8;1.94	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.48589	0.1508	L	0.27053	0.805	0.58432	D	0.999992	P;D;D	0.67145	0.668;0.996;0.993	B;D;D	0.79784	0.314;0.993;0.984	T	0.42275	-0.9461	10	0.35671	T	0.21	.	18.5344	0.91004	0.0:0.0:1.0:0.0	.	647;1316;1363	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	N	1321;1363;647;1139	ENSP00000309245:D1321N;ENSP00000035383:D1363N;ENSP00000394867:D647N	ENSP00000035383:D1363N	D	+	1	0	LRRC7	70291387	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.270000	0.89880	2.616000	0.88540	0.655000	0.94253	GAT		0.393	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		46	12	0	0	0	0.011902	0	46	12				
ACADM	34	broad.mit.edu	37	1	76205782	76205782	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:76205782G>A	ENST00000370841.4	+	7	1023	c.586G>A	c.(586-588)Gga>Aga	p.G196R	ACADM_ENST00000370834.5_Missense_Mutation_p.G229R|ACADM_ENST00000543667.1_Missense_Mutation_p.G7R|ACADM_ENST00000541113.1_Missense_Mutation_p.G160R|ACADM_ENST00000420607.2_Missense_Mutation_p.G200R	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	196					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	AACCAACGGAGGAAAAGCTAA	0.328																																							uc001dgw.3		NA																	0				breast(2)|ovary(1)|skin(1)	4						c.(586-588)GGA>AGA		medium-chain acyl-CoA dehydrogenase isoform a							104.0	107.0	106.0					1																	76205782		2203	4299	6502	SO:0001583	missense	34				carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity	g.chr1:76205782G>A	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.586G>A	1.37:g.76205782G>A	ENSP00000359878:p.Gly196Arg					ACADM_uc010orc.1_3'UTR|ACADM_uc010ord.1_Missense_Mutation_p.G110R|ACADM_uc009wbp.2_Missense_Mutation_p.G200R|ACADM_uc009wbr.2_Missense_Mutation_p.G229R|ACADM_uc010ore.1_Missense_Mutation_p.G160R|ACADM_uc010orf.1_Missense_Mutation_p.G7R|ACADM_uc001dgx.3_Missense_Mutation_p.G110R|ACADM_uc010org.1_Missense_Mutation_p.G66R	p.G196R	NM_000016	NP_000007	P11310	ACADM_HUMAN			7	1016	+			196					Q5T4U4|Q9NYF1	Missense_Mutation	SNP	ENST00000370841.4	37	c.586G>A	CCDS668.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530517	0.85706	.	.	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000543667;ENST00000420607	D;D;D;D;D	0.99042	-3.76;-3.76;-3.76;-5.36;-3.76	5.47	5.47	0.80525	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.000000	0.85682	D	0.000000	D	0.99061	0.9678	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.995	D;D;D;D;D	0.91635	0.999;0.995;0.996;0.995;0.974	D	0.99922	1.1261	10	0.87932	D	0	.	18.9411	0.92605	0.0:0.0:1.0:0.0	.	160;110;229;200;196	B7Z9I1;B4DVE0;Q5T4U5;P11310-2;P11310	.;.;.;.;ACADM_HUMAN	R	196;229;160;7;200	ENSP00000359878:G196R;ENSP00000359871:G229R;ENSP00000442324:G160R;ENSP00000446176:G7R;ENSP00000409612:G200R	ENSP00000359871:G229R	G	+	1	0	ACADM	75978370	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.590000	0.98238	2.550000	0.86006	0.655000	0.94253	GGA		0.328	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1			29	29	0	0	0	0.013726	0	29	29				
CDC14A	8556	broad.mit.edu	37	1	100928316	100928316	+	Silent	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:100928316C>T	ENST00000336454.3	+	9	1072	c.717C>T	c.(715-717)gaC>gaT	p.D239D	RP5-837M10.4_ENST00000432210.1_RNA|CDC14A_ENST00000542213.1_Silent_p.D181D|CDC14A_ENST00000370125.2_3'UTR|CDC14A_ENST00000361544.6_Silent_p.D239D|CDC14A_ENST00000370124.3_Silent_p.D239D|CDC14A_ENST00000544534.1_Silent_p.D239D	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	239	B.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		GCTTCACAGACGCTGGCTTCG	0.473																																							uc001dtg.3		NA																	0				large_intestine(1)	1						c.(715-717)GAC>GAT		CDC14 homolog A isoform 1							90.0	82.0	85.0					1																	100928316		2203	4300	6503	SO:0001819	synonymous_variant	8556				cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr1:100928316C>T	AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.717C>T	1.37:g.100928316C>T						CDC14A_uc009web.2_RNA|CDC14A_uc010oui.1_Silent_p.D181D|CDC14A_uc001dte.3_Silent_p.D239D|CDC14A_uc001dtf.2_Silent_p.D239D|CDC14A_uc009wed.1_Translation_Start_Site|CDC14A_uc009wee.2_Silent_p.D239D	p.D239D	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)	9	1205	+		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)	239			B.		A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Silent	SNP	ENST00000336454.3	37	c.717C>T	CCDS769.1																																																																																				0.473	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000030220.1	NM_033312		19	46	0	0	0	0.007413	0	19	46				
SORT1	6272	broad.mit.edu	37	1	109867652	109867652	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:109867652T>C	ENST00000256637.6	-	14	1761	c.1703A>G	c.(1702-1704)tAt>tGt	p.Y568C	SORT1_ENST00000538502.1_Missense_Mutation_p.Y431C	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	568					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		GCCAGTGAAATAGATGGGGTC	0.488																																							uc001dxm.1		NA																	0				ovary(1)	1						c.(1702-1704)TAT>TGT		sortilin 1 preproprotein							99.0	96.0	97.0					1																	109867652		2203	4300	6503	SO:0001583	missense	6272				endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled	g.chr1:109867652T>C	BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1703A>G	1.37:g.109867652T>C	ENSP00000256637:p.Tyr568Cys					SORT1_uc010ovi.1_Missense_Mutation_p.Y431C	p.Y568C	NM_002959	NP_002950	Q99523	SORT_HUMAN		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)	14	1752	-		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)	568			Extracellular (Potential).		B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	ENST00000256637.6	37	c.1703A>G	CCDS798.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.390571	0.62066	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.32515	1.45;1.45	5.73	5.73	0.89815	VPS10 (1);	0.462777	0.25535	N	0.030018	T	0.24198	0.0586	L	0.43152	1.355	0.41875	D	0.990297	D;D	0.65815	0.985;0.995	P;P	0.55667	0.781;0.748	T	0.09885	-1.0654	10	0.40728	T	0.16	-16.3933	6.9255	0.24412	0.1474:0.0:0.1536:0.699	.	431;568	B4DWI3;Q99523	.;SORT_HUMAN	C	568;431	ENSP00000256637:Y568C;ENSP00000438597:Y431C	ENSP00000256637:Y568C	Y	-	2	0	SORT1	109669175	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.627000	0.37050	2.186000	0.69663	0.459000	0.35465	TAT		0.488	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959		37	26	0	0	0	0.004878	0	37	26				
FLG	2312	broad.mit.edu	37	1	152280380	152280380	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:152280380C>T	ENST00000368799.1	-	3	7017	c.6982G>A	c.(6982-6984)Gag>Aag	p.E2328K	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2328	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCGTGTCTCTCTCCTGCACTT	0.552									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(6982-6984)GAG>AAG		filaggrin							273.0	373.0	339.0					1																	152280380		2203	4297	6500	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152280380C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6982G>A	1.37:g.152280380C>T	ENSP00000357789:p.Glu2328Lys						p.E2328K	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	7018	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2328			Ser-rich.|Filaggrin 14.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.6982G>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	8.293	0.818158	0.16607	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01685	4.69	4.01	-0.516	0.11950	.	.	.	.	.	T	0.00724	0.0024	L	0.51422	1.61	0.09310	N	1	B	0.31485	0.325	B	0.31390	0.129	T	0.42207	-0.9465	9	0.40728	T	0.16	.	7.3841	0.26872	0.0:0.3909:0.507:0.1021	.	2328	P20930	FILA_HUMAN	K	2328;238	ENSP00000357789:E2328K	ENSP00000271820:E238K	E	-	1	0	FLG	150547004	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.982000	0.03762	-0.161000	0.10983	-0.690000	0.03725	GAG		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		378	489	0	0	0	0.01441	0	378	489				
IQGAP3	128239	broad.mit.edu	37	1	156532985	156532985	+	Missense_Mutation	SNP	C	C	T	rs375168150		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:156532985C>T	ENST00000361170.2	-	8	749	c.739G>A	c.(739-741)Gtc>Atc	p.V247I		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	247					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCTTGGTAGACGGCTGCCAGA	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18407	0.001		0.0	False		,,,				2504	0.0						uc001fpf.2		NA																	0				ovary(5)|skin(1)	6						c.(739-741)GTC>ATC		IQ motif containing GTPase activating protein 3		C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	103.0	106.0	105.0		739	1.8	1.0	1		105	2,8598	2.2+/-6.3	0,2,4298	no	missense	IQGAP3	NM_178229.4	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign	247/1632	156532985	3,13003	2203	4300	6503	SO:0001583	missense	128239				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity	g.chr1:156532985C>T	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.739G>A	1.37:g.156532985C>T	ENSP00000354451:p.Val247Ile					IQGAP3_uc009wsb.1_Missense_Mutation_p.V204I	p.V247I	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN			8	814	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		247					Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	c.739G>A	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935477	0.34189	2.27E-4	2.33E-4	ENSG00000183856	ENST00000361170	T	0.06371	3.31	5.79	1.83	0.25207	.	0.315434	0.29046	N	0.013319	T	0.01592	0.0051	L	0.42245	1.32	0.22001	N	0.999422	B	0.02656	0.0	B	0.01281	0.0	T	0.47446	-0.9117	10	0.20519	T	0.43	-13.3025	7.5264	0.27658	0.0:0.4228:0.0:0.5772	.	247	Q86VI3	IQGA3_HUMAN	I	247	ENSP00000354451:V247I	ENSP00000354451:V247I	V	-	1	0	IQGAP3	154799609	0.196000	0.23350	0.999000	0.59377	0.960000	0.62799	0.351000	0.20096	0.479000	0.27511	-0.238000	0.12139	GTC		0.567	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229		47	290	0	0	0	0.013114	0	47	290				
NES	10763	broad.mit.edu	37	1	156639506	156639506	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:156639506T>A	ENST00000368223.3	-	4	4606	c.4474A>T	c.(4474-4476)Agt>Tgt	p.S1492C		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1492	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTCAGCACTGTCCTGGGAC	0.592																																							uc001fpq.2		NA																	0				ovary(6)	6						c.(4474-4476)AGT>TGT		nestin							51.0	53.0	52.0					1																	156639506		2203	4300	6503	SO:0001583	missense	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156639506T>A	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.4474A>T	1.37:g.156639506T>A	ENSP00000357206:p.Ser1492Cys						p.S1492C	NM_006617	NP_006608	P48681	NEST_HUMAN			4	4607	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		1492			Tail.		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	c.4474A>T	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	T	17.84	3.486744	0.63962	.	.	ENSG00000132688	ENST00000368223	D	0.91011	-2.77	4.82	4.82	0.62117	.	0.000000	0.38837	N	0.001554	D	0.91310	0.7260	M	0.65498	2.005	0.27517	N	0.95153	D	0.76494	0.999	D	0.73380	0.98	D	0.86374	0.1725	10	0.87932	D	0	.	8.7405	0.34554	0.0:0.091:0.0:0.909	.	1492	P48681	NEST_HUMAN	C	1492	ENSP00000357206:S1492C	ENSP00000357206:S1492C	S	-	1	0	NES	154906130	0.092000	0.21681	0.967000	0.41034	0.871000	0.50021	2.182000	0.42556	1.795000	0.52594	0.455000	0.32223	AGT		0.592	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		38	89	0	0	0	0.006999	0	38	89				
ADCY10	55811	broad.mit.edu	37	1	167830185	167830185	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:167830185G>A	ENST00000367851.4	-	15	1917	c.1733C>T	c.(1732-1734)aCc>aTc	p.T578I	ADCY10_ENST00000367848.1_Missense_Mutation_p.T486I|ADCY10_ENST00000545172.1_Missense_Mutation_p.T425I	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	578					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TCGAAGGTTGGTCTGTCGTTC	0.363																																							uc001ger.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1732-1734)ACC>ATC		adenylate cyclase 10							233.0	217.0	222.0					1																	167830185		2203	4300	6503	SO:0001583	missense	55811				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding	g.chr1:167830185G>A	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1733C>T	1.37:g.167830185G>A	ENSP00000356825:p.Thr578Ile					ADCY10_uc009wvk.2_Missense_Mutation_p.T486I|ADCY10_uc010plj.1_Missense_Mutation_p.T425I|ADCY10_uc009wvl.2_Missense_Mutation_p.T577I	p.T578I	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN			15	2031	-			578					B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	c.1733C>T	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	G	9.583	1.124166	0.20959	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.30714	1.53;1.52;1.53	5.56	2.45	0.29901	.	0.857854	0.10403	N	0.678904	T	0.15565	0.0375	L	0.57536	1.79	0.32197	N	0.578284	P;P;P	0.49559	0.925;0.846;0.761	P;B;B	0.45712	0.491;0.387;0.216	T	0.09885	-1.0654	9	0.35671	T	0.21	-10.0689	4.6476	0.12579	0.086:0.1507:0.6082:0.1551	.	425;486;578	F5GWS5;Q96PN6-2;Q96PN6	.;.;ADCYA_HUMAN	I	425;578;486	ENSP00000441992:T425I;ENSP00000356825:T578I;ENSP00000356822:T486I	ENSP00000356822:T486I	T	-	2	0	ADCY10	166096809	0.894000	0.30519	0.965000	0.40720	0.292000	0.27327	0.637000	0.24659	0.792000	0.33850	0.563000	0.77884	ACC		0.363	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417		31	213	0	0	0	0.012213	0	31	213				
SELE	6401	broad.mit.edu	37	1	169698396	169698396	+	Missense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:169698396A>T	ENST00000333360.7	-	7	1160	c.1021T>A	c.(1021-1023)Ttg>Atg	p.L341M	SELE_ENST00000367782.4_Missense_Mutation_p.L341M|SELE_ENST00000367780.4_Missense_Mutation_p.L279M|SELE_ENST00000367775.1_Missense_Mutation_p.L279M|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367777.1_Missense_Mutation_p.L341M|SELE_ENST00000367781.4_Missense_Mutation_p.L341M|SELE_ENST00000367774.1_Missense_Mutation_p.L341M|SELE_ENST00000367776.1_Missense_Mutation_p.L341M|SELE_ENST00000367779.4_Missense_Mutation_p.L341M	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	341	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	GGTCCCTGCAACATGAAGCCT	0.517																																							uc001ggm.3		NA																	0				ovary(3)|skin(2)	5						c.(1021-1023)TTG>ATG		selectin E precursor							90.0	81.0	84.0					1																	169698396		2203	4300	6503	SO:0001583	missense	6401				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity	g.chr1:169698396A>T	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1021T>A	1.37:g.169698396A>T	ENSP00000331736:p.Leu341Met					C1orf112_uc001ggj.2_Intron	p.L341M	NM_000450	NP_000441	P16581	LYAM2_HUMAN			7	1178	-	all_hematologic(923;0.208)		341			Extracellular (Potential).|Sushi 3.		A2RRD6|P16111	Missense_Mutation	SNP	ENST00000333360.7	37	c.1021T>A	CCDS1283.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.198432	0.38806	.	.	ENSG00000007908	ENST00000367781;ENST00000367782;ENST00000367780;ENST00000367779;ENST00000333360;ENST00000367777;ENST00000367775;ENST00000367776;ENST00000367774	T;T;T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	4.93	-9.86	0.00473	Complement control module (2);Sushi/SCR/CCP (3);	0.272580	0.19487	N	0.113081	T	0.56366	0.1980	M	0.80028	2.48	0.27262	N	0.958612	P	0.51791	0.948	P	0.53401	0.725	T	0.72620	-0.4238	10	0.52906	T	0.07	-6.0806	13.1518	0.59494	0.7947:0.0:0.1116:0.0937	.	341	P16581	LYAM2_HUMAN	M	341;341;279;341;341;341;279;341;341	ENSP00000356755:L341M;ENSP00000356756:L341M;ENSP00000356754:L279M;ENSP00000356753:L341M;ENSP00000331736:L341M;ENSP00000356751:L341M;ENSP00000356749:L279M;ENSP00000356750:L341M;ENSP00000356748:L341M	ENSP00000331736:L341M	L	-	1	2	SELE	167965020	0.000000	0.05858	0.001000	0.08648	0.402000	0.30811	-1.608000	0.02068	-2.467000	0.00532	-0.417000	0.06048	TTG		0.517	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450		63	80	0	0	0	0.01441	0	63	80				
SLC9C2	284525	broad.mit.edu	37	1	173493964	173493964	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:173493964C>A	ENST00000367714.3	-	20	2890	c.2468G>T	c.(2467-2469)tGt>tTt	p.C823F	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	823					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										GCCTCTTGAACAAAGGAAGGT	0.398																																							uc001giz.2		NA																	0				ovary(2)	2						c.(2467-2469)TGT>TTT		solute carrier family 9, member 11							175.0	169.0	171.0					1																	173493964		2203	4300	6503	SO:0001583	missense	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173493964C>A	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2468G>T	1.37:g.173493964C>A	ENSP00000356687:p.Cys823Phe					SLC9A11_uc009wwe.2_Missense_Mutation_p.C381F|SLC9A11_uc010pmq.1_RNA	p.C823F	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN			20	2891	-			823					Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	c.2468G>T	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	C	7.577	0.668009	0.14710	.	.	ENSG00000162753	ENST00000367714	T	0.04234	3.67	5.8	3.91	0.45181	.	0.945625	0.08914	N	0.875362	T	0.01287	0.0042	N	0.08118	0	0.54753	D	0.999982	B	0.23806	0.091	B	0.19148	0.024	T	0.47573	-0.9107	10	0.42905	T	0.14	0.94	12.9596	0.58451	0.0:0.6884:0.3116:0.0	.	823	Q5TAH2	S9A11_HUMAN	F	823	ENSP00000356687:C823F	ENSP00000356687:C823F	C	-	2	0	SLC9A11	171760587	0.826000	0.29277	0.544000	0.28141	0.355000	0.29361	1.575000	0.36493	0.776000	0.33473	-0.283000	0.09986	TGT		0.398	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		44	152	1	0	9.39024e-22	0.009718	2.0558e-21	44	152				
UCHL5	51377	broad.mit.edu	37	1	192985498	192985498	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:192985498C>A	ENST00000367455.4	-	11	1208	c.973G>T	c.(973-975)Gct>Tct	p.A325S	UCHL5_ENST00000367454.1_Missense_Mutation_p.A324S|UCHL5_ENST00000367451.4_Missense_Mutation_p.A351S	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	325	Interaction with ADRM1.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						GTTTCCTGAGCTTTCTTTGCG	0.284																																							uc001gsm.2		NA																	0				lung(2)|ovary(1)	3						c.(973-975)GCT>TCT		ubiquitin carboxyl-terminal hydrolase L5							250.0	241.0	244.0					1																	192985498		2203	4300	6503	SO:0001583	missense	51377				DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:192985498C>A		CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.973G>T	1.37:g.192985498C>A	ENSP00000356425:p.Ala325Ser					UCHL5_uc001gsn.2_RNA|UCHL5_uc001gso.2_Missense_Mutation_p.A324S|UCHL5_uc010pov.1_RNA	p.A325S	NM_015984	NP_057068	Q9Y5K5	UCHL5_HUMAN			11	1104	-			325			Interaction with ADRM1.		Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Missense_Mutation	SNP	ENST00000367455.4	37	c.973G>T	CCDS1378.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352548	0.41700	.	.	ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451	T;T;T;T	0.64618	-0.11;-0.08;-0.08;-0.08	5.83	4.92	0.64577	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.536113	0.20454	N	0.092033	T	0.46795	0.1411	N	0.20845	0.615	0.80722	D	1	B;B	0.22683	0.073;0.043	B;B	0.19391	0.025;0.011	T	0.34004	-0.9846	10	0.16420	T	0.52	-12.9883	15.0852	0.72145	0.0:0.9319:0.0:0.0681	.	324;325	Q9Y5K5-3;Q9Y5K5	.;UCHL5_HUMAN	S	325;324;364;351	ENSP00000356425:A325S;ENSP00000356424:A324S;ENSP00000356420:A364S;ENSP00000356421:A351S	ENSP00000356420:A364S	A	-	1	0	UCHL5	191252121	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.615000	0.61190	1.471000	0.48121	0.650000	0.86243	GCT		0.284	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086318.3	NM_015984		84	267	1	0	2.16659e-41	0.01441	5.59527e-41	84	267				
CFHR5	81494	broad.mit.edu	37	1	196971705	196971705	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:196971705C>T	ENST00000256785.4	+	8	1350	c.1241C>T	c.(1240-1242)gCt>gTt	p.A414V	CFHR5_ENST00000367414.5_Missense_Mutation_p.A438V			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	414	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						GAAAAAGTAGCTGTTCTCTGT	0.388																																							uc001gts.3		NA																	0				breast(1)|skin(1)	2						c.(1240-1242)GCT>GTT		complement factor H-related 5 precursor							80.0	84.0	83.0					1																	196971705		2203	4300	6503	SO:0001583	missense	81494				complement activation, alternative pathway	extracellular region		g.chr1:196971705C>T	AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.1241C>T	1.37:g.196971705C>T	ENSP00000256785:p.Ala414Val						p.A414V	NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN			8	1369	+			414			Sushi 7.		Q2NKK2	Missense_Mutation	SNP	ENST00000256785.4	37	c.1241C>T	CCDS1387.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703353	0.48412	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	T;T	0.63096	-0.02;-0.02	3.76	2.75	0.32379	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.41328	0.1154	N	0.16098	0.37	0.09310	N	1	B	0.26708	0.157	B	0.29663	0.105	T	0.20405	-1.0276	9	0.11794	T	0.64	.	9.6253	0.39746	0.0:0.7854:0.2146:0.0	.	414	Q9BXR6	FHR5_HUMAN	V	438;414	ENSP00000356384:A438V;ENSP00000256785:A414V	ENSP00000256785:A414V	A	+	2	0	CFHR5	195238328	0.001000	0.12720	0.014000	0.15608	0.024000	0.10985	0.878000	0.28126	1.805000	0.52779	0.467000	0.42956	GCT		0.388	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787		43	48	0	0	0	0.007835	0	43	48				
NR5A2	2494	broad.mit.edu	37	1	200012997	200012997	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:200012997C>A	ENST00000367362.3	+	3	544	c.298C>A	c.(298-300)Ctc>Atc	p.L100I	NR5A2_ENST00000544748.1_Missense_Mutation_p.L28I|NR5A2_ENST00000236914.3_Missense_Mutation_p.L54I	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	100					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					CCATTATGGGCTCCTCACCTG	0.398																																					Melanoma(179;1138 2773 15678 26136)	Melanoma(179;1138 2773 15678 26136)	uc001gvb.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(298-300)CTC>ATC		nuclear receptor subfamily 5, group A, member 2							105.0	96.0	99.0					1																	200012997		2203	4300	6503	SO:0001583	missense	2494				embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr1:200012997C>A	U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.298C>A	1.37:g.200012997C>A	ENSP00000356331:p.Leu100Ile					NR5A2_uc001gvc.2_Missense_Mutation_p.L54I|NR5A2_uc009wzh.2_Missense_Mutation_p.L60I|NR5A2_uc010pph.1_Missense_Mutation_p.L28I	p.L100I	NM_205860	NP_995582	O00482	NR5A2_HUMAN			3	504	+	Prostate(682;0.19)		100			Nuclear receptor.|NR C4-type.		B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	ENST00000367362.3	37	c.298C>A	CCDS1401.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577475	0.86645	.	.	ENSG00000116833	ENST00000367362;ENST00000236914;ENST00000544748;ENST00000235480	D;D;D	0.96992	-4.2;-4.2;-4.2	5.91	5.91	0.95273	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.94941	0.8364	N	0.10664	0.02	0.80722	D	1	B;B	0.28584	0.12;0.216	P;P	0.49752	0.621;0.534	D	0.91246	0.5025	9	.	.	.	.	20.3052	0.98627	0.0:1.0:0.0:0.0	.	54;100	F1D8R9;O00482	.;NR5A2_HUMAN	I	100;54;28;20	ENSP00000356331:L100I;ENSP00000236914:L54I;ENSP00000439116:L28I	.	L	+	1	0	NR5A2	198279620	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	5.441000	0.66569	2.814000	0.96858	0.650000	0.86243	CTC		0.398	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086497.2			24	46	1	0	1.85244e-09	0.00333	3.38659e-09	24	46				
RCOR3	55758	broad.mit.edu	37	1	211486235	211486235	+	Missense_Mutation	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:211486235A>G	ENST00000367005.4	+	10	1216	c.1075A>G	c.(1075-1077)Act>Gct	p.T359A	RCOR3_ENST00000452621.2_Missense_Mutation_p.T417A|RCOR3_ENST00000419091.2_Missense_Mutation_p.T417A|RCOR3_ENST00000367006.4_Intron|RCOR3_ENST00000526255.1_3'UTR	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		TGATGCTTCTACTTTAGGGGA	0.443																																							uc001hig.2		NA																	0				ovary(1)	1						c.(1075-1077)ACT>GCT		REST corepressor 3 isoform d							130.0	126.0	128.0					1																	211486235		2203	4300	6503	SO:0001583	missense	55758				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr1:211486235A>G	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.1075A>G	1.37:g.211486235A>G	ENSP00000355972:p.Thr359Ala					RCOR3_uc010psv.1_RNA|RCOR3_uc001hie.2_Missense_Mutation_p.T417A|RCOR3_uc010psw.1_Missense_Mutation_p.T417A|RCOR3_uc001hif.2_Intron|RCOR3_uc009xcz.2_RNA	p.T359A	NM_018254	NP_060724	Q9P2K3	RCOR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)	10	1244	+			359					B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	c.1075A>G	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	A	0.778	-0.763174	0.02996	.	.	ENSG00000117625	ENST00000452621;ENST00000419091;ENST00000367005	T;T;T	0.42900	0.96;1.6;1.6	5.11	0.0872	0.14449	.	0.319837	0.37715	N	0.001972	T	0.18087	0.0434	N	0.08118	0	0.24394	N	0.994737	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.27839	-1.0062	10	0.08381	T	0.77	-1.504	11.1444	0.48422	0.3897:0.0:0.6103:0.0	.	417;359;417	Q9P2K3-3;Q9P2K3;Q9P2K3-4	.;RCOR3_HUMAN;.	A	417;417;359	ENSP00000398558:T417A;ENSP00000413929:T417A;ENSP00000355972:T359A	ENSP00000355972:T359A	T	+	1	0	RCOR3	209552858	0.995000	0.38212	0.997000	0.53966	0.999000	0.98932	0.506000	0.22658	-0.163000	0.10946	0.528000	0.53228	ACT		0.443	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254		64	122	0	0	0	0.01441	0	64	122				
USH2A	7399	broad.mit.edu	37	1	216166400	216166400	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:216166400G>T	ENST00000307340.3	-	35	7153	c.6767C>A	c.(6766-6768)tCc>tAc	p.S2256Y	USH2A_ENST00000366943.2_Missense_Mutation_p.S2256Y	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2256	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GACATTAAAGGAGTCAGGTGA	0.473										HNSCC(13;0.011)	OREG0014251	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(6766-6768)TCC>TAC		usherin isoform B							239.0	238.0	239.0					1																	216166400		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216166400G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6767C>A	1.37:g.216166400G>T	ENSP00000305941:p.Ser2256Tyr	HNSCC(13;0.011)	OREG0014251	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2234		p.S2256Y	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	35	7154	-			2256			Fibronectin type-III 9.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.6767C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220142	0.79464	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.59772	0.24;0.24	6.17	5.26	0.73747	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.44688	D	0.000425	T	0.82144	0.4973	H	0.94306	3.52	0.44462	D	0.99739	D	0.76494	0.999	D	0.66196	0.942	D	0.87960	0.2729	10	0.87932	D	0	.	17.0474	0.86508	0.0:0.0:0.8718:0.1282	.	2256	O75445	USH2A_HUMAN	Y	2256	ENSP00000305941:S2256Y;ENSP00000355910:S2256Y	ENSP00000305941:S2256Y	S	-	2	0	USH2A	214233023	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.229000	0.72294	1.602000	0.50124	0.655000	0.94253	TCC		0.473	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		319	364	1	0	6.11876e-135	0.01441	1.79844e-134	319	364				
USH2A	7399	broad.mit.edu	37	1	216497666	216497666	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:216497666C>A	ENST00000307340.3	-	7	1558	c.1172G>T	c.(1171-1173)aGt>aTt	p.S391I	USH2A_ENST00000366943.2_Missense_Mutation_p.S391I|USH2A_ENST00000366942.3_Missense_Mutation_p.S391I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	391	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.		S -> I (in USH2A; unknown pathological significance). {ECO:0000269|PubMed:15325563}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGTTGTGGACTAAAGAACTG	0.318										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26	GRCh37	CM044729	USH2A	M		c.(1171-1173)AGT>ATT		usherin isoform B							72.0	75.0	74.0					1																	216497666		2196	4295	6491	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216497666C>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1172G>T	1.37:g.216497666C>A	ENSP00000305941:p.Ser391Ile	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.S391I	p.S391I	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	7	1559	-			391		S -> I (in USH2A; uncertain pathogenicity).	Laminin N-terminal.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.1172G>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.435467	0.83885	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.80123	-1.34;-1.34;-1.34	5.79	5.79	0.91817	Laminin, N-terminal (3);	0.000000	0.50627	D	0.000101	D	0.91905	0.7437	M	0.90082	3.085	0.53005	D	0.999969	D;D	0.76494	0.999;0.999	D;D	0.71870	0.975;0.972	D	0.92782	0.6241	10	0.87932	D	0	.	20.0411	0.97590	0.0:1.0:0.0:0.0	.	391;391	O75445-2;O75445	.;USH2A_HUMAN	I	391	ENSP00000305941:S391I;ENSP00000355910:S391I;ENSP00000355909:S391I	ENSP00000305941:S391I	S	-	2	0	USH2A	214564289	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.695000	0.61767	2.739000	0.93911	0.655000	0.94253	AGT		0.318	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		11	48	1	0	2.80697e-09	0.010729	5.09662e-09	11	48				
ZNF678	339500	broad.mit.edu	37	1	227838768	227838768	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:227838768G>T	ENST00000343776.5	+	3	421	c.76G>T	c.(76-78)Gtt>Ttt	p.V26F	ZNF678_ENST00000397097.3_Intron|ZNF678_ENST00000608949.1_Missense_Mutation_p.V26F|ZNF678_ENST00000465266.1_3'UTR	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	26					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				ttataaactggtttatacagg	0.383																																							uc001hqw.1		NA																	0				pancreas(1)	1						c.(76-78)GTT>TTT		zinc finger protein 678							99.0	109.0	106.0					1																	227838768		2203	4300	6503	SO:0001583	missense	339500				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr1:227838768G>T	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.76G>T	1.37:g.227838768G>T	ENSP00000344828:p.Val26Phe					ZNF678_uc009xet.1_RNA|ZNF678_uc009xeu.1_Intron	p.V26F	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN			3	421	+		Prostate(94;0.0885)	81					Q8IVQ9	Missense_Mutation	SNP	ENST00000343776.5	37	c.76G>T		.	.	.	.	.	.	.	.	.	.	G	4.992	0.184199	0.09495	.	.	ENSG00000181450	ENST00000343776	T	0.07688	3.17	0.364	0.364	0.16124	.	.	.	.	.	T	0.07503	0.0189	.	.	.	0.09310	N	0.999999	P	0.44006	0.824	B	0.42959	0.403	T	0.34378	-0.9831	7	0.34782	T	0.22	.	.	.	.	.	26	Q5SXM1	ZN678_HUMAN	F	26	ENSP00000344828:V26F	ENSP00000344828:V26F	V	+	1	0	ZNF678	225905391	0.075000	0.21258	0.105000	0.21289	0.096000	0.18686	-0.312000	0.08113	0.406000	0.25560	0.407000	0.27541	GTT		0.383	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549		133	288	1	0	2.44662e-51	0.01441	6.64082e-51	133	288				
TRIM11	81559	broad.mit.edu	37	1	228582544	228582544	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:228582544C>A	ENST00000284551.6	-	6	1547	c.1269G>T	c.(1267-1269)ggG>ggT	p.G423G	RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000493030.2_Silent_p.G298G|TRIM11_ENST00000460651.1_5'UTR	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	423	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				ATAGCAGTGACCCATCGGTGG	0.632																																							uc001hss.2		NA																	0				lung(3)|ovary(1)	4						c.(1267-1269)GGG>GGT		tripartite motif-containing 11							69.0	76.0	73.0					1																	228582544		2203	4300	6503	SO:0001819	synonymous_variant	81559				response to virus	cytoplasm|nucleus	protein binding|zinc ion binding	g.chr1:228582544C>A	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.1269G>T	1.37:g.228582544C>A						TRIM11_uc010pvx.1_Silent_p.G422G	p.G423G	NM_145214	NP_660215	Q96F44	TRI11_HUMAN			6	1524	-		Prostate(94;0.0724)	423			B30.2/SPRY.		A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Silent	SNP	ENST00000284551.6	37	c.1269G>T	CCDS31048.1																																																																																				0.632	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3	NM_145214		56	69	1	0	5.22555e-25	0.01441	1.16806e-24	56	69				
TRIM17	51127	broad.mit.edu	37	1	228602468	228602468	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:228602468G>T	ENST00000366697.2	-	1	1262	c.306C>A	c.(304-306)caC>caA	p.H102Q	TRIM17_ENST00000295033.3_Missense_Mutation_p.H102Q|TRIM17_ENST00000456946.2_Missense_Mutation_p.H102Q|TRIM17_ENST00000366698.2_Missense_Mutation_p.H102Q			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	102					protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				GGGGCTCGTGGTGCTCCTGGC	0.662																																							uc001hsu.2		NA																	0				ovary(1)	1						c.(304-306)CAC>CAA		tripartite motif-containing 17 isoform 1							75.0	81.0	79.0					1																	228602468		2203	4300	6503	SO:0001583	missense	51127				protein autoubiquitination	intracellular	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:228602468G>T	AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.306C>A	1.37:g.228602468G>T	ENSP00000355658:p.His102Gln					TRIM17_uc001hsv.2_Missense_Mutation_p.H102Q|TRIM17_uc001hsw.2_Missense_Mutation_p.H75Q|TRIM17_uc009xfb.2_Missense_Mutation_p.H102Q	p.H102Q	NM_016102	NP_057186	Q9Y577	TRI17_HUMAN			2	691	-		Prostate(94;0.0724)	102			B box-type.		B4DVJ2|Q5VST8	Missense_Mutation	SNP	ENST00000366697.2	37	c.306C>A	CCDS1571.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664569	0.88251	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033;ENST00000456946;ENST00000479800;ENST00000355586	T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	4.82	4.82	0.62117	Zinc finger, B-box (3);	0.000000	0.44483	D	0.000442	D	0.88153	0.6360	H	0.97240	3.965	0.48185	D	0.999603	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.92124	0.5706	10	0.87932	D	0	.	16.2069	0.82134	0.0:0.0:1.0:0.0	.	102;102	Q9Y577-2;Q9Y577	.;TRI17_HUMAN	Q	102;102;102;102;75;102	ENSP00000355658:H102Q;ENSP00000355659:H102Q;ENSP00000295033:H102Q;ENSP00000403312:H102Q;ENSP00000430468:H75Q;ENSP00000347794:H102Q	ENSP00000295033:H102Q	H	-	3	2	TRIM17	226669091	0.997000	0.39634	1.000000	0.80357	0.820000	0.46376	2.700000	0.47085	2.607000	0.88179	0.655000	0.94253	CAC		0.662	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096439.2	NM_016102		76	105	1	0	8.2577e-42	0.01441	2.14297e-41	76	105				
OR13G1	441933	broad.mit.edu	37	1	247836209	247836209	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:247836209G>A	ENST00000359688.2	-	1	156	c.135C>T	c.(133-135)gcC>gcT	p.A45A	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TATAGATTTTGGCAATGATGA	0.438																																							uc001idi.1		NA																	0				skin(1)	1						c.(133-135)GCC>GCT		olfactory receptor, family 13, subfamily G,							91.0	75.0	80.0					1																	247836209		2203	4300	6503	SO:0001819	synonymous_variant	441933				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247836209G>A	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.135C>T	1.37:g.247836209G>A							p.A45A	NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	135	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		45			Cytoplasmic (Potential).		B2RN80|Q5T2T2|Q6IF86	Silent	SNP	ENST00000359688.2	37	c.135C>T	CCDS31094.1																																																																																				0.438	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487		40	50	0	0	0	0.00874	0	40	50				
OR2M1P	388762	broad.mit.edu	37	1	248285441	248285441	+	IGR	SNP	G	G	T	rs6587422	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:248285441G>T								OR2L13 (21217 upstream) : OR2M5 (23008 downstream)																							GTCCCCCATGGACGTCAGGCT	0.522													G|||	785	0.156749	0.3351	0.0706	5008	,	,		21406	0.1796		0.0736	False		,,,				2504	0.0389						uc001idy.1		NA																	0					0						c.(4-6)GAC>TAC		RecName: Full=Olfactory receptor 2M5;																																				SO:0001628	intergenic_variant	388762							g.chr1:248285441G>T																													1.37:g.248285441G>T							p.D2Y	NR_002141						1	4	+									Missense_Mutation	SNP		37	c.4G>T																																																																																				0	0.522									194	327	1	0	1.52457e-88	0.01441	4.40799e-88	194	327				
OR2T11	127077	broad.mit.edu	37	1	248790195	248790195	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:248790195G>A	ENST00000330803.2	-	1	296	c.235C>T	c.(235-237)Ctg>Ttg	p.L79L		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGTCTGCCAGGAGTTTTGGG	0.493																																							uc001ier.1		NA																	0				lung(1)	1						c.(235-237)CTG>TTG		olfactory receptor, family 2, subfamily T,							65.0	66.0	66.0					1																	248790195		2054	4233	6287	SO:0001819	synonymous_variant	127077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248790195G>A	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.235C>T	1.37:g.248790195G>A							p.L79L	NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	235	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		79			Extracellular (Potential).		Q6IEY6	Silent	SNP	ENST00000330803.2	37	c.235C>T	CCDS31122.1																																																																																				0.493	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964		46	34	0	0	0	0.013114	0	46	34				
FAM171A1	221061	broad.mit.edu	37	10	15256130	15256130	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:15256130C>A	ENST00000378116.4	-	8	1463	c.1457G>T	c.(1456-1458)aGg>aTg	p.R486M	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	486						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GTAACTACCCCTGTAGTCATC	0.478																																							uc001iob.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1456-1458)AGG>ATG		hypothetical protein LOC221061 precursor							132.0	112.0	119.0					10																	15256130		2203	4300	6503	SO:0001583	missense	221061					integral to membrane		g.chr10:15256130C>A	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1457G>T	10.37:g.15256130C>A	ENSP00000367356:p.Arg486Met						p.R486M	NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN			8	1464	-			486			Cytoplasmic (Potential).		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	c.1457G>T	CCDS31154.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.32|15.32	2.798401|2.798401	0.50208|0.50208	.|.	.|.	ENSG00000148468|ENSG00000148468	ENST00000396781|ENST00000378116	.|T	.|0.34275	.|1.37	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	.|0.213205	.|0.44483	.|D	.|0.000457	T|T	0.61899|0.61899	0.2384|0.2384	M|M	0.71581|0.71581	2.175|2.175	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.64080|0.64080	-0.6491|-0.6491	6|10	0.37606|0.72032	T|D	0.19|0.01	-28.434|-28.434	19.0487|19.0487	0.93032|0.93032	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|486	.|Q5VUB5	.|F1711_HUMAN	W|M	486|486	.|ENSP00000367356:R486M	ENSP00000380001:G486W|ENSP00000367356:R486M	G|R	-|-	1|2	0|0	FAM171A1|FAM171A1	15296136|15296136	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.261000|0.261000	0.26267|0.26267	3.397000|3.397000	0.52572|0.52572	2.724000|2.724000	0.93272|0.93272	0.563000|0.563000	0.77884|0.77884	GGG|AGG		0.478	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		41	125	1	0	2.95478e-19	0.00874	6.33847e-19	41	125				
CUBN	8029	broad.mit.edu	37	10	16975228	16975228	+	Silent	SNP	C	C	A	rs560009723		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:16975228C>A	ENST00000377833.4	-	40	6047	c.5982G>T	c.(5980-5982)ccG>ccT	p.P1994P		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1994	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.G1995C(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGGCCAGCCCGGGGAGAAGA	0.507																																							uc001ioo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(5980-5982)CCG>CCT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						98.0	84.0	89.0					10																	16975228		2203	4300	6503	SO:0001819	synonymous_variant	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16975228C>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5982G>T	10.37:g.16975228C>A							p.P1994P	NM_001081	NP_001072	O60494	CUBN_HUMAN			40	6034	-			1994			CUB 14.		B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	c.5982G>T	CCDS7113.1																																																																																				0.507	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		25	72	1	0	1.26454e-06	0.005443	2.19849e-06	25	72				
GPR158	57512	broad.mit.edu	37	10	25887469	25887469	+	Nonsense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:25887469A>T	ENST00000376351.3	+	11	3273	c.2914A>T	c.(2914-2916)Aaa>Taa	p.K972*	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	972					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AAAGCCTCAGAAATCTGGGAT	0.463																																							uc001isj.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(2914-2916)AAA>TAA		G protein-coupled receptor 158 precursor							70.0	76.0	74.0					10																	25887469		2203	4300	6503	SO:0001587	stop_gained	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25887469A>T	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2914A>T	10.37:g.25887469A>T	ENSP00000365529:p.Lys972*					GPR158_uc001isk.2_Nonsense_Mutation_p.K347*	p.K972*	NM_020752	NP_065803	Q5T848	GP158_HUMAN			11	2974	+			972			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Nonsense_Mutation	SNP	ENST00000376351.3	37	c.2914A>T	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	A	43	10.399157	0.99398	.	.	ENSG00000151025	ENST00000376351	.	.	.	5.61	4.47	0.54385	.	0.077190	0.53938	D	0.000056	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8766	0.57994	0.864:0.136:0.0:0.0	.	.	.	.	X	972	.	ENSP00000365529:K972X	K	+	1	0	GPR158	25927475	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.836000	0.69375	0.933000	0.37291	0.528000	0.53228	AAA		0.463	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		40	150	0	0	0	0.00874	0	40	150				
GAD2	2572	broad.mit.edu	37	10	26581399	26581399	+	Silent	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:26581399T>A	ENST00000376261.3	+	14	1895	c.1392T>A	c.(1390-1392)acT>acA	p.T464T	GAD2_ENST00000259271.3_Silent_p.T464T	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	464					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CCTAGGGGACTACCGGGTTTG	0.463																																							uc001isp.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1390-1392)ACT>ACA		glutamate decarboxylase 2	L-Glutamic Acid(DB00142)						110.0	101.0	104.0					10																	26581399		2203	4300	6503	SO:0001819	synonymous_variant	2572				glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding	g.chr10:26581399T>A	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1392T>A	10.37:g.26581399T>A						GAD2_uc001isq.2_Silent_p.T464T	p.T464T	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN			14	1895	+			464					Q9UD87	Silent	SNP	ENST00000376261.3	37	c.1392T>A	CCDS7149.1																																																																																				0.463	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818		16	65	0	0	0	0.004007	0	16	65				
MTPAP	55149	broad.mit.edu	37	10	30615475	30615475	+	Missense_Mutation	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:30615475C>G	ENST00000263063.4	-	5	913	c.870G>C	c.(868-870)gaG>gaC	p.E290D	MTPAP_ENST00000358107.4_Missense_Mutation_p.E420D|MTPAP_ENST00000488290.1_5'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	290					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GGTCAAGGCACTCTCCTAACA	0.443																																							uc001iva.3		NA																	0				ovary(1)	1						c.(868-870)GAG>GAC		PAP associated domain containing 1 precursor							128.0	138.0	135.0					10																	30615475		2203	4300	6503	SO:0001583	missense	55149				cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding	g.chr10:30615475C>G	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.870G>C	10.37:g.30615475C>G	ENSP00000263063:p.Glu290Asp					MTPAP_uc001ivb.3_Missense_Mutation_p.E420D	p.E290D	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN			5	933	-			290					D3DRX0|Q659E3|Q6P7E5|Q9HA74	Missense_Mutation	SNP	ENST00000263063.4	37	c.870G>C	CCDS7165.1	.	.	.	.	.	.	.	.	.	.	C	5.266	0.234598	0.09969	.	.	ENSG00000107951	ENST00000358107;ENST00000263063	T;T	0.07444	3.19;3.19	5.18	-1.84	0.07809	.	0.116998	0.56097	D	0.000030	T	0.02571	0.0078	N	0.14661	0.345	0.29720	N	0.83874	P;B	0.37500	0.597;0.002	B;B	0.31869	0.137;0.011	T	0.44467	-0.9326	10	0.06891	T	0.86	-24.3463	4.4312	0.11529	0.0965:0.2833:0.0962:0.524	.	420;290	Q9NVV4-2;Q9NVV4	.;PAPD1_HUMAN	D	420;290	ENSP00000350820:E420D;ENSP00000263063:E290D	ENSP00000263063:E290D	E	-	3	2	MTPAP	30655481	0.023000	0.18921	0.992000	0.48379	0.787000	0.44495	-0.815000	0.04481	-0.284000	0.09102	-0.373000	0.07131	GAG		0.443	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047426.2	NM_018109		125	169	0	0	0	0.01441	0	125	169				
ENTPD7	57089	broad.mit.edu	37	10	101439629	101439629	+	Missense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:101439629A>T	ENST00000370489.4	+	5	723	c.545A>T	c.(544-546)gAg>gTg	p.E182V		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	182						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		CTTCTCCCTGAGAGGTGAGAT	0.537																																							uc001kqa.3		NA																	0				ovary(1)	1						c.(544-546)GAG>GTG		ectonucleoside triphosphate diphosphohydrolase							85.0	80.0	81.0					10																	101439629		2203	4300	6503	SO:0001583	missense	57089					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity	g.chr10:101439629A>T	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.545A>T	10.37:g.101439629A>T	ENSP00000359520:p.Glu182Val					ENTPD7_uc009xwl.2_Missense_Mutation_p.E184V	p.E182V	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)	5	723	+		Colorectal(252;0.234)	182			Vesicular (Potential).		B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	37	c.545A>T	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.601391	0.66445	.	.	ENSG00000198018	ENST00000370489	T	0.13307	2.6	5.28	5.28	0.74379	.	0.050625	0.85682	D	0.000000	T	0.29093	0.0723	M	0.71871	2.18	0.80722	D	1	P	0.41159	0.74	P	0.50440	0.641	T	0.01175	-1.1428	10	0.49607	T	0.09	-20.9602	15.0485	0.71846	1.0:0.0:0.0:0.0	.	182	Q9NQZ7	ENTP7_HUMAN	V	182	ENSP00000359520:E182V	ENSP00000359520:E182V	E	+	2	0	ENTPD7	101429619	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.735000	0.91549	2.232000	0.73038	0.533000	0.62120	GAG		0.537	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354		55	100	0	0	0	0.01441	0	55	100				
LZTS2	84445	broad.mit.edu	37	10	102763434	102763434	+	Silent	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:102763434C>G	ENST00000370220.1	+	2	3642	c.579C>G	c.(577-579)tcC>tcG	p.S193S	LZTS2_ENST00000370223.3_Silent_p.S193S					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		cctcctcttcctcctcctctt	0.642																																					Esophageal Squamous(8;38 437 13604 19902 37640)	Esophageal Squamous(8;38 437 13604 19902 37640)	uc001ksj.2		NA																	0				ovary(2)|large_intestine(1)|breast(1)	4						c.(577-579)TCC>TCG		leucine zipper, putative tumor suppressor 2							103.0	122.0	115.0					10																	102763434		2203	4300	6503	SO:0001819	synonymous_variant	84445				cell division|mitosis|Wnt receptor signaling pathway	membrane|microtubule|microtubule organizing center		g.chr10:102763434C>G	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.579C>G	10.37:g.102763434C>G						LZTS2_uc010qpw.1_Silent_p.S193S|LZTS2_uc001ksk.2_Silent_p.S193S|LZTS2_uc001ksl.2_Silent_p.S193S|LZTS2_uc001ksm.2_RNA	p.S193S	NM_032429	NP_115805	Q9BRK4	LZTS2_HUMAN		Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)	3	648	+			193			Ser-rich.|Required for centrosomal localization (By similarity).			Silent	SNP	ENST00000370220.1	37	c.579C>G	CCDS7507.1																																																																																				0.642	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743		78	365	0	0	0	0.01441	0	78	365				
PNLIPRP3	119548	broad.mit.edu	37	10	118202577	118202577	+	Missense_Mutation	SNP	C	C	A	rs373852386		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:118202577C>A	ENST00000369230.3	+	3	361	c.215C>A	c.(214-216)gCg>gAg	p.A72E		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	72					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		GAGATCAGTGCGGTTAATTCT	0.363																																							uc001lcl.3		NA																	0				ovary(1)	1						c.(214-216)GCG>GAG		pancreatic lipase-related protein 3 precursor							73.0	67.0	69.0					10																	118202577		2203	4300	6503	SO:0001583	missense	119548				lipid catabolic process	extracellular region	triglyceride lipase activity	g.chr10:118202577C>A	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.215C>A	10.37:g.118202577C>A	ENSP00000358232:p.Ala72Glu						p.A72E	NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN		all cancers(201;0.0131)	3	316	+			72						Missense_Mutation	SNP	ENST00000369230.3	37	c.215C>A	CCDS31292.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184488	0.38609	.	.	ENSG00000203837	ENST00000369230	D	0.90444	-2.67	4.19	4.19	0.49359	Lipase, N-terminal (1);	0.112777	0.36374	N	0.002621	D	0.88507	0.6455	L	0.51914	1.62	0.24042	N	0.996073	B	0.26445	0.149	B	0.34093	0.175	T	0.83107	-0.0125	10	0.66056	D	0.02	.	12.4301	0.55569	0.0:1.0:0.0:0.0	.	72	Q17RR3	LIPR3_HUMAN	E	72	ENSP00000358232:A72E	ENSP00000358232:A72E	A	+	2	0	PNLIPRP3	118192567	0.876000	0.30132	0.922000	0.36590	0.017000	0.09413	1.439000	0.35013	2.034000	0.60081	0.644000	0.83932	GCG		0.363	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404		10	16	1	0	0.000442599	0.006214	0.000735821	10	16				
KCNK18	338567	broad.mit.edu	37	10	118969418	118969418	+	Nonsense_Mutation	SNP	G	G	T	rs3026042		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:118969418G>T	ENST00000334549.1	+	3	763	c.763G>T	c.(763-765)Gaa>Taa	p.E255*		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	255			E -> K (in dbSNP:rs3026042).		cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		CTCGTGTCCCGAACTGGTGTT	0.532																																							uc010qsr.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(763-765)GAA>TAA		potassium channel, subfamily K, member 18							152.0	136.0	141.0					10																	118969418		2203	4300	6503	SO:0001587	stop_gained	338567					integral to membrane|plasma membrane		g.chr10:118969418G>T	AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.763G>T	10.37:g.118969418G>T	ENSP00000334650:p.Glu255*						p.E255*	NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN		all cancers(201;0.0211)	3	763	+		Colorectal(252;0.19)	255			Cytoplasmic (Potential).		Q5SQQ8	Nonsense_Mutation	SNP	ENST00000334549.1	37	c.763G>T	CCDS7598.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858687	0.51376	.	.	ENSG00000186795	ENST00000334549	.	.	.	5.4	4.48	0.54585	.	0.100987	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	16.3839	0.83495	0.0:0.1321:0.8679:0.0	.	.	.	.	X	255	.	ENSP00000334650:E255X	E	+	1	0	KCNK18	118959408	1.000000	0.71417	0.861000	0.33841	0.026000	0.11368	4.453000	0.60061	1.399000	0.46721	0.655000	0.94253	GAA		0.532	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840		68	109	1	0	2.36135e-34	0.01441	5.78913e-34	68	109				
CPXM2	119587	broad.mit.edu	37	10	125526525	125526525	+	Silent	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:125526525A>G	ENST00000241305.3	-	10	1597	c.1443T>C	c.(1441-1443)atT>atC	p.I481I	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	481					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CAGGGATTGCAATATAGTGAT	0.453																																							uc001lhk.1		NA																	0				ovary(2)	2						c.(1441-1443)ATT>ATC		carboxypeptidase X (M14 family), member 2							118.0	109.0	112.0					10																	125526525		2203	4300	6503	SO:0001819	synonymous_variant	119587				cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding	g.chr10:125526525A>G	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1443T>C	10.37:g.125526525A>G						CPXM2_uc001lhj.2_RNA	p.I481I	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)	10	1768	-		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)	481					B4E3Q2	Silent	SNP	ENST00000241305.3	37	c.1443T>C	CCDS7637.1																																																																																				0.453	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148		57	98	0	0	0	0.01441	0	57	98				
DOCK1	1793	broad.mit.edu	37	10	128925932	128925932	+	Splice_Site	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr10:128925932G>T	ENST00000280333.6	+	27	2797		c.e27-1			NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.?(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TCCTTCCCCAGGGGCCAACCC	0.473																																							uc001ljt.2		NA																	1	Unknown(1)		ovary(1)	central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9						c.e27-1		dedicator of cytokinesis 1							91.0	84.0	86.0					10																	128925932		1897	4117	6014	SO:0001630	splice_region_variant	1793				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr10:128925932G>T	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.2689-1G>T	10.37:g.128925932G>T						DOCK1_uc010qun.1_Splice_Site_p.G918_splice	p.G897_splice	NM_001380	NP_001371	Q14185	DOCK1_HUMAN		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)	27	2753	+		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)						A9Z1Z5	Splice_Site	SNP	ENST00000280333.6	37	c.2689_splice		.	.	.	.	.	.	.	.	.	.	G	13.81	2.347997	0.41599	.	.	ENSG00000150760	ENST00000280333	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4202	0.90587	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK1	128815922	1.000000	0.71417	0.999000	0.59377	0.186000	0.23388	9.495000	0.97964	2.416000	0.81992	0.557000	0.71058	.		0.473	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	Intron	26	80	1	0	2.48779e-11	0.005443	4.72681e-11	26	80				
KRTAP5-4	387267	broad.mit.edu	37	11	1642979	1642979	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:1642979C>A	ENST00000399682.1	-	1	389	c.345G>T	c.(343-345)ggG>ggT	p.G115G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTTGGAACCCCCACAGGAGC	0.662																																							uc009ycy.1		NA																	0					0						c.(481-483)GGG>GGT		keratin associated protein 5-4							10.0	20.0	17.0					11																	1642979		673	1555	2228	SO:0001819	synonymous_variant	387267					keratin filament		g.chr11:1642979C>A	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.345G>T	11.37:g.1642979C>A							p.G161G	NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	3	570	-		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	175			9 X 4 AA repeats of C-C-X-P.			Silent	SNP	ENST00000399682.1	37	c.483G>T																																																																																					0.662	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709		72	103	1	0	3.53432e-41	0.01441	9.08338e-41	72	103				
OR51F1	256892	broad.mit.edu	37	11	4790612	4790612	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:4790612G>A	ENST00000380383.1	-	1	556	c.557C>T	c.(556-558)tCc>tTc	p.S186F	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron|OR51F1_ENST00000343430.3_Missense_Mutation_p.S179F			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S179F(1)		kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		GTAACAATAGGAGTGAGAAAG	0.393																																							uc010qyl.1		NA																	1	Substitution - Missense(1)		skin(1)	ovary(1)|skin(1)	2						c.(535-537)TCC>TTC		olfactory receptor, family 51, subfamily F,							141.0	135.0	137.0					11																	4790612		2201	4298	6499	SO:0001583	missense	256892					integral to membrane	olfactory receptor activity	g.chr11:4790612G>A	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.557C>T	11.37:g.4790612G>A	ENSP00000369744:p.Ser186Phe						p.S179F	NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)	1	536	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	179						Missense_Mutation	SNP	ENST00000380383.1	37	c.536C>T		.	.	.	.	.	.	.	.	.	.	G	11.41	1.630370	0.28978	.	.	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.00099	8.73;8.73	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.110699	0.41001	D	0.000972	T	0.00328	0.0010	L	0.43923	1.385	0.28759	N	0.901003	D	0.89917	1.0	D	0.77004	0.989	T	0.60525	-0.7246	10	0.87932	D	0	.	11.028	0.47757	0.0849:0.0:0.9151:0.0	.	186	A6NGY5	O51F1_HUMAN	F	179;186	ENSP00000345163:S179F;ENSP00000369744:S186F	ENSP00000345163:S179F	S	-	2	0	OR51F1	4747188	0.003000	0.15002	0.994000	0.49952	0.003000	0.03518	0.507000	0.22675	2.728000	0.93425	0.655000	0.94253	TCC		0.393	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752		44	68	0	0	0	0.011902	0	44	68				
OR2AG2	338755	broad.mit.edu	37	11	6790080	6790080	+	Missense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:6790080A>T	ENST00000338569.2	-	1	206	c.109T>A	c.(109-111)Ttg>Atg	p.L37M		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTCAGTGCCAACATGTATAGG	0.537																																							uc001meq.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(109-111)TTG>ATG		olfactory receptor, family 2, subfamily AG,							124.0	115.0	118.0					11																	6790080		2201	4296	6497	SO:0001583	missense	338755				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6790080A>T	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.109T>A	11.37:g.6790080A>T	ENSP00000342697:p.Leu37Met						p.L37M	NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	109	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	37			Helical; Name=1; (Potential).			Missense_Mutation	SNP	ENST00000338569.2	37	c.109T>A	CCDS31413.1	.	.	.	.	.	.	.	.	.	.	A	2.422	-0.332974	0.05278	.	.	ENSG00000188124	ENST00000338569	T	0.00451	7.35	4.28	-2.47	0.06442	.	0.525096	0.15639	N	0.251999	T	0.00271	0.0008	N	0.12471	0.22	0.18873	N	0.999989	D	0.67145	0.996	D	0.65684	0.937	T	0.45804	-0.9236	10	0.05436	T	0.98	.	1.046	0.01569	0.3292:0.2726:0.2594:0.1388	.	37	A6NM03	O2AG2_HUMAN	M	37	ENSP00000342697:L37M	ENSP00000342697:L37M	L	-	1	2	OR2AG2	6746656	0.000000	0.05858	0.160000	0.22671	0.385000	0.30292	-2.359000	0.01085	-0.440000	0.07211	0.533000	0.62120	TTG		0.537	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490		61	84	0	0	0	0.01441	0	61	84				
SPON1	10418	broad.mit.edu	37	11	14063147	14063148	+	RNA	DNP	GG	GG	CC			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:14063147_14063148GG>CC	ENST00000310358.7	+	0	963_964							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		AGGAGGACCCGGATCCAGGTGT	0.475																																							uc001mle.2		NA																	0					0						c.(424-426)CGG>CCC		spondin 1, extracellular matrix protein																																						10418				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding	g.chr11:14063147_14063148GG>CC	AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576	Exception_encountered	11.37:g.14063147_14063148delinsCC							p.R142P	NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN		Epithelial(150;0.00898)	3	963_964	+			142			Reelin.		A8K6W5|O94862|Q8NCD7|Q8WUR5	Missense_Mutation	DNP	ENST00000310358.7	37	c.425_426GG>CC																																																																																					0.475	SPON1-201	KNOWN	basic	processed_transcript	processed_transcript		NM_145584		93	133	0	0	0	0.004672	0	93	133				
INSC	387755	broad.mit.edu	37	11	15134022	15134022	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:15134022C>A	ENST00000379554.3	+	1	53	c.7C>A	c.(7-9)Cgg>Agg	p.R3R	INSC_ENST00000379556.3_5'Flank|INSC_ENST00000424273.1_5'Flank	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	3					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)		p.R3W(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						AGCCATGAGACGGCCCCCTGG	0.627																																							uc001mly.2		NA																	1	Substitution - Missense(1)	p.R3W(1)	ovary(1)	upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(7-9)CGG>AGG		inscuteable isoform a							48.0	59.0	55.0					11																	15134022		1952	4123	6075	SO:0001819	synonymous_variant	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15134022C>A	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.7C>A	11.37:g.15134022C>A						INSC_uc001mlz.2_5'Flank	p.R3R	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN			1	53	+			3					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Silent	SNP	ENST00000379554.3	37	c.7C>A	CCDS41621.1																																																																																				0.627	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		40	48	1	0	1.02591e-13	0.010771	2.01395e-13	40	48				
OR4A15	81328	broad.mit.edu	37	11	55136137	55136137	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:55136137G>T	ENST00000314706.3	+	1	778	c.778G>T	c.(778-780)Ggg>Tgg	p.G260W		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						GAGTTTGGAAGGGAAACGAAA	0.428																																							uc010rif.1		NA																	0				ovary(1)|skin(1)	2						c.(778-780)GGG>TGG		olfactory receptor, family 4, subfamily A,							187.0	164.0	171.0					11																	55136137		2201	4296	6497	SO:0001583	missense	81328				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55136137G>T	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.778G>T	11.37:g.55136137G>T	ENSP00000325065:p.Gly260Trp						p.G260W	NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN			1	778	+			260			Cytoplasmic (Potential).		Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	c.778G>T	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	-	15.38	2.815822	0.50527	.	.	ENSG00000181958	ENST00000314706	T	0.00304	8.19	3.65	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	0.393988	0.21765	N	0.069441	T	0.00845	0.0028	H	0.96239	3.79	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.30327	-0.9982	10	0.87932	D	0	.	7.0004	0.24807	0.108:0.1765:0.7155:0.0	.	260	Q8NGL6	O4A15_HUMAN	W	260	ENSP00000325065:G260W	ENSP00000325065:G260W	G	+	1	0	OR4A15	54892713	0.000000	0.05858	0.028000	0.17463	0.377000	0.30045	0.640000	0.24705	0.717000	0.32145	0.492000	0.49549	GGG		0.428	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275		97	107	1	0	2.42943e-58	0.01441	6.73156e-58	97	107				
OR10Q1	219960	broad.mit.edu	37	11	57996156	57996156	+	Silent	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:57996156A>G	ENST00000316770.2	-	1	234	c.192T>C	c.(190-192)taT>taC	p.Y64Y		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				ACAGGAAGAAATACATCGGGG	0.527																																							uc010rkd.1		NA																	0				ovary(2)	2						c.(190-192)TAT>TAC		olfactory receptor, family 10, subfamily Q,							100.0	102.0	101.0					11																	57996156		2201	4295	6496	SO:0001819	synonymous_variant	219960				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57996156A>G	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.192T>C	11.37:g.57996156A>G							p.Y64Y	NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN			1	192	-		Breast(21;0.0589)	64			Helical; Name=2; (Potential).		Q6IFG4	Silent	SNP	ENST00000316770.2	37	c.192T>C	CCDS31547.1																																																																																				0.527	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471		26	96	0	0	0	0.005443	0	26	96				
AHNAK	79026	broad.mit.edu	37	11	62292534	62292534	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:62292534C>T	ENST00000378024.4	-	5	9629	c.9355G>A	c.(9355-9357)Gac>Aac	p.D3119N	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3119					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ACTTTCATGTCACCTTCCACT	0.478																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(9355-9357)GAC>AAC		AHNAK nucleoprotein isoform 1							220.0	237.0	231.0					11																	62292534		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62292534C>T	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.9355G>A	11.37:g.62292534C>T	ENSP00000367263:p.Asp3119Asn					AHNAK_uc001ntk.1_Intron	p.D3119N	NM_001620	NP_001611	Q09666	AHNK_HUMAN			5	9655	-		Melanoma(852;0.155)	3119					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.9355G>A	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	13.00	2.105183	0.37145	.	.	ENSG00000124942	ENST00000378024	T	0.13538	2.58	4.2	4.2	0.49525	.	.	.	.	.	T	0.21590	0.0520	M	0.80332	2.49	0.34041	D	0.655022	P	0.44044	0.825	B	0.41946	0.371	T	0.41233	-0.9520	9	0.25751	T	0.34	-9.6855	14.3317	0.66561	0.0:1.0:0.0:0.0	.	3119	Q09666	AHNK_HUMAN	N	3119	ENSP00000367263:D3119N	ENSP00000367263:D3119N	D	-	1	0	AHNAK	62049110	0.749000	0.28305	0.905000	0.35620	0.022000	0.10575	0.051000	0.14141	1.875000	0.54330	0.305000	0.20034	GAC		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		47	564	0	0	0	0.01441	0	47	564				
SLC22A25	387601	broad.mit.edu	37	11	62932091	62932091	+	Missense_Mutation	SNP	C	C	T	rs148517822	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:62932091C>T	ENST00000306494.6	-	8	1300	c.1301G>A	c.(1300-1302)cGt>cAt	p.R434H	SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						CAAAACCACACGCAGGGTCTG	0.478													C|||	5	0.000998403	0.0008	0.0	5008	,	,		19598	0.0		0.003	False		,,,				2504	0.001						uc001nwr.1		NA																	0				ovary(3)|skin(1)	4						c.(1300-1302)CGT>CAT		putative UST1-like organic anion transporter		C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	72.0	72.0	72.0		1301	3.6	0.0	11	dbSNP_134	72	11,8585	8.4+/-32.0	0,11,4287	yes	missense	SLC22A25	NM_199352.3	29	0,12,6487	TT,TC,CC		0.128,0.0227,0.0923	probably-damaging	434/548	62932091	12,12986	2201	4298	6499	SO:0001583	missense	387601				transmembrane transport	integral to membrane		g.chr11:62932091C>T	AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.1301G>A	11.37:g.62932091C>T	ENSP00000307443:p.Arg434His					SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_RNA|SLC22A25_uc001nws.1_RNA	p.R434H	NM_199352	NP_955384	Q6T423	S22AP_HUMAN			8	1301	-			434			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000306494.6	37	c.1301G>A	CCDS31592.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	10.34	1.321778	0.23994	2.27E-4	0.00128	ENSG00000196600	ENST00000306494	T	0.57436	0.4	4.56	3.61	0.41365	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.58380	0.2118	M	0.88570	2.965	0.23969	N	0.996312	P	0.42649	0.786	B	0.42245	0.381	T	0.58584	-0.7611	10	0.59425	D	0.04	.	8.1964	0.31398	0.0:0.8784:0.0:0.1216	.	434	Q6T423	S22AP_HUMAN	H	434	ENSP00000307443:R434H	ENSP00000307443:R434H	R	-	2	0	SLC22A25	62688667	0.000000	0.05858	0.038000	0.18304	0.016000	0.09150	0.464000	0.21988	1.006000	0.39211	0.586000	0.80456	CGT		0.478	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383519.3	NM_199352		41	47	0	0	0	0.007835	0	41	47				
RTN3	10313	broad.mit.edu	37	11	63449190	63449190	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:63449190G>T	ENST00000377819.5	+	1	236	c.82G>T	c.(82-84)Ggc>Tgc	p.G28C	RTN3_ENST00000356000.3_Missense_Mutation_p.G28C|RTN3_ENST00000537981.1_Missense_Mutation_p.G28C|RTN3_ENST00000339997.4_Missense_Mutation_p.G28C|RTN3_ENST00000538995.1_3'UTR|RTN3_ENST00000341307.2_Missense_Mutation_p.G28C|RTN3_ENST00000540798.1_Missense_Mutation_p.G28C|RTN3_ENST00000354497.4_Missense_Mutation_p.G28C	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	28					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						GCCCGGCGGCGGCGGGAGCCC	0.746																																							uc001nxq.2		NA																	0				ovary(1)	1						c.(82-84)GGC>TGC		reticulon 3 isoform b							10.0	13.0	12.0					11																	63449190		2081	4111	6192	SO:0001583	missense	10313				apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane		g.chr11:63449190G>T	AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.82G>T	11.37:g.63449190G>T	ENSP00000367050:p.Gly28Cys					RTN3_uc001nxo.2_Missense_Mutation_p.G28C|RTN3_uc001nxm.2_Missense_Mutation_p.G28C|RTN3_uc001nxn.2_Missense_Mutation_p.G28C|RTN3_uc001nxp.2_Missense_Mutation_p.G28C|RTN3_uc009yov.2_Missense_Mutation_p.G28C|RTN3_uc010rmt.1_RNA|RTN3_uc010rmu.1_Missense_Mutation_p.G28C	p.G28C	NM_201428	NP_958831	O95197	RTN3_HUMAN			1	269	+			28					B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	ENST00000377819.5	37	c.82G>T	CCDS58141.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099610	0.56183	.	.	ENSG00000133318	ENST00000341307;ENST00000356000;ENST00000542238;ENST00000377819;ENST00000339997;ENST00000540798;ENST00000545432;ENST00000543552;ENST00000537981;ENST00000354497	T;T;T;T;T;T;T;T;T;T	0.67171	1.14;1.01;0.96;0.57;0.42;0.36;-0.25;-0.17;1.2;0.57	4.18	2.28	0.28536	.	0.350496	0.20461	N	0.091897	T	0.65995	0.2745	L	0.27053	0.805	0.25710	N	0.985498	D;D;D;P;P;D;P	0.76494	0.984;0.999;0.998;0.956;0.67;0.999;0.67	P;D;P;P;B;D;B	0.67231	0.608;0.95;0.893;0.704;0.217;0.95;0.217	T	0.55982	-0.8054	10	0.87932	D	0	-0.6667	6.5436	0.22394	0.2304:0.0:0.7696:0.0	.	28;28;28;28;28;28;28	B7Z4M0;F5H774;O95197;O95197-5;O95197-3;O95197-2;O95197-4	.;.;RTN3_HUMAN;.;.;.;.	C	28	ENSP00000340903:G28C;ENSP00000348279:G28C;ENSP00000437971:G28C;ENSP00000367050:G28C;ENSP00000344106:G28C;ENSP00000442733:G28C;ENSP00000441614:G28C;ENSP00000442080:G28C;ENSP00000440874:G28C;ENSP00000346492:G28C	ENSP00000344106:G28C	G	+	1	0	RTN3	63205766	0.994000	0.37717	0.990000	0.47175	0.986000	0.74619	1.658000	0.37376	0.249000	0.21456	0.462000	0.41574	GGC		0.746	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397846.1	NM_006054		12	13	1	0	1.15088e-07	0.004007	2.03411e-07	12	13				
MOGAT2	80168	broad.mit.edu	37	11	75438556	75438556	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:75438556G>T	ENST00000198801.5	+	3	417	c.347G>T	c.(346-348)gGa>gTa	p.G116V	MOGAT2_ENST00000526712.1_Missense_Mutation_p.G34V	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	116					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)			NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					CTGGCAGTCGGAGCCTTTGCC	0.617																																							uc010rru.1		NA																	0				ovary(2)	2						c.(346-348)GGA>GTA		monoacylglycerol O-acyltransferase 2							89.0	82.0	84.0					11																	75438556		2200	4293	6493	SO:0001583	missense	80168				glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity	g.chr11:75438556G>T	AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.347G>T	11.37:g.75438556G>T	ENSP00000198801:p.Gly116Val					MOGAT2_uc001oww.1_Missense_Mutation_p.G116V|MOGAT2_uc010rrv.1_Missense_Mutation_p.G34V	p.G116V	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN			3	347	+	Ovarian(111;0.103)		116			Helical; (Potential).		A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	SNP	ENST00000198801.5	37	c.347G>T	CCDS8240.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693166	0.68271	.	.	ENSG00000166391	ENST00000198801;ENST00000526712	T;T	0.19394	2.15;2.15	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.75082	-0.3443	10	0.87932	D	0	-13.0687	18.2673	0.90056	0.0:0.0:1.0:0.0	.	116;116	Q3SYC2;Q3SYC2-3	MOGT2_HUMAN;.	V	116;34	ENSP00000198801:G116V;ENSP00000436283:G34V	ENSP00000198801:G116V	G	+	2	0	MOGAT2	75116204	1.000000	0.71417	0.856000	0.33681	0.168000	0.22595	9.374000	0.97172	2.646000	0.89796	0.655000	0.94253	GGA		0.617	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098		33	92	1	0	5.8336e-16	0.003271	1.2029e-15	33	92				
OR10G4	390264	broad.mit.edu	37	11	123886668	123886668	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:123886668C>A	ENST00000320891.4	+	1	387	c.387C>A	c.(385-387)ctC>ctA	p.L129L		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GTTACCCGCTCAGGTACACCA	0.552																																							uc010sac.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(385-387)CTC>CTA		olfactory receptor, family 10, subfamily G,							167.0	153.0	157.0					11																	123886668		2202	4299	6501	SO:0001819	synonymous_variant	390264				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123886668C>A	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.387C>A	11.37:g.123886668C>A							p.L129L	NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	387	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	129			Cytoplasmic (Potential).		Q6IEW0	Silent	SNP	ENST00000320891.4	37	c.387C>A	CCDS31702.1																																																																																				0.552	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		51	239	1	0	6.2918e-36	0.01441	1.56413e-35	51	239				
OR10G7	390265	broad.mit.edu	37	11	123908791	123908791	+	Silent	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:123908791T>C	ENST00000330487.5	-	1	926	c.918A>G	c.(916-918)gtA>gtG	p.V306V		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCTGAGCAAATACTGACCCAT	0.353																																							uc001pzq.1		NA																	0				ovary(2)	2						c.(916-918)GTA>GTG		olfactory receptor, family 10, subfamily G,							64.0	62.0	63.0					11																	123908791		2200	4299	6499	SO:0001819	synonymous_variant	390265				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123908791T>C	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.918A>G	11.37:g.123908791T>C							p.V306V	NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	918	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	306			Cytoplasmic (Potential).		Q6IFE8	Silent	SNP	ENST00000330487.5	37	c.918A>G	CCDS31705.1																																																																																				0.353	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463		36	47	0	0	0	0.00623	0	36	47				
FOXM1	2305	broad.mit.edu	37	12	2975569	2975569	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:2975569T>A	ENST00000359843.3	-	5	1033	c.965A>T	c.(964-966)cAg>cTg	p.Q322L	FOXM1_ENST00000537018.1_5'UTR|FOXM1_ENST00000342628.2_Missense_Mutation_p.Q322L|FOXM1_ENST00000361953.3_Missense_Mutation_p.Q322L	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	322					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			CTTAAACACCTGGTCCAATGT	0.498																																							uc001qlf.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(964-966)CAG>CTG		forkhead box M1 isoform 2							105.0	95.0	98.0					12																	2975569		2203	4300	6503	SO:0001583	missense	2305				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding	g.chr12:2975569T>A	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.965A>T	12.37:g.2975569T>A	ENSP00000352901:p.Gln322Leu					FOXM1_uc001qle.2_Missense_Mutation_p.Q322L|FOXM1_uc001qlg.2_Missense_Mutation_p.Q322L|FOXM1_uc009zea.2_Missense_Mutation_p.Q321L|FOXM1_uc009zeb.2_Missense_Mutation_p.Q321L	p.Q322L	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000622)		5	1230	-			322			Fork-head.		O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	ENST00000359843.3	37	c.965A>T	CCDS8515.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.597986	0.87055	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.95377	-3.19;-3.69;-3.21	5.95	5.95	0.96441	Transcription factor, fork head (1);	0.110120	0.64402	D	0.000005	D	0.96626	0.8899	L	0.46157	1.445	0.58432	D	0.999998	P;D;P;D;D	0.89917	0.732;0.999;0.686;0.999;1.0	P;D;P;D;D	0.91635	0.745;0.999;0.628;0.999;0.999	D	0.96852	0.9626	10	0.54805	T	0.06	.	15.6591	0.77169	0.0:0.0:0.0:1.0	.	321;322;322;322;322	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	L	322	ENSP00000342307:Q322L;ENSP00000354492:Q322L;ENSP00000352901:Q322L	ENSP00000342307:Q322L	Q	-	2	0	FOXM1	2845830	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.689000	0.84165	2.288000	0.76882	0.529000	0.55759	CAG		0.498	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953		79	92	0	0	0	0.01441	0	79	92				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		17	25	1	0	1.5739e-10	0.004007	2.91747e-10	17	25				
KMT2D	8085	broad.mit.edu	37	12	49445287	49445287	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:49445287G>A	ENST00000301067.7	-	10	2178	c.2179C>T	c.(2179-2181)Cca>Tca	p.P727S		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	727	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCAGGTAGTGGCAACAGGGGT	0.692																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(2179-2181)CCA>TCA		myeloid/lymphoid or mixed-lineage leukemia 2							33.0	40.0	38.0					12																	49445287		1984	4106	6090	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49445287G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2179C>T	12.37:g.49445287G>A	ENSP00000301067:p.Pro727Ser	HNSCC(34;0.089)					p.P727S	NM_003482	NP_003473	O14686	MLL2_HUMAN			10	2179	-			727	Missing (in Ref. 1; AAC51734).		Pro-rich.		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.2179C>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174310	0.57692	.	.	ENSG00000167548	ENST00000301067	T	0.78924	-1.22	3.73	3.73	0.42828	.	.	.	.	.	T	0.65450	0.2692	N	0.24115	0.695	0.28244	N	0.925563	B	0.33528	0.416	B	0.29524	0.103	T	0.65043	-0.6264	9	0.87932	D	0	.	13.8235	0.63338	0.0:0.0:1.0:0.0	.	727	O14686	MLL2_HUMAN	S	727	ENSP00000301067:P727S	ENSP00000301067:P727S	P	-	1	0	MLL2	47731554	1.000000	0.71417	0.737000	0.30932	0.293000	0.27360	5.579000	0.67457	2.391000	0.81399	0.462000	0.41574	CCA		0.692	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			59	113	0	0	0	0.01441	0	59	113				
SP1	6667	broad.mit.edu	37	12	53800380	53800380	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:53800380G>T	ENST00000327443.4	+	4	1785	c.1687G>T	c.(1687-1689)Gct>Tct	p.A563S	SP1_ENST00000426431.2_Missense_Mutation_p.A556S	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	563	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		TGATCATGGAGCTCAGCTTGG	0.502																																							uc001scw.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1687-1689)GCT>TCT		Sp1 transcription factor isoform a							105.0	97.0	100.0					12																	53800380		2203	4300	6503	SO:0001583	missense	6667				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:53800380G>T	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1687G>T	12.37:g.53800380G>T	ENSP00000329357:p.Ala563Ser					SP1_uc010sog.1_Missense_Mutation_p.A556S	p.A563S	NM_138473	NP_612482	P08047	SP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.00527)	4	1784	+			563			Transactivation domain C (highly charged).		E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	37	c.1687G>T	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	G	7.152	0.584023	0.13749	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.07688	3.18;3.17	4.61	2.75	0.32379	.	0.505672	0.17729	N	0.163967	T	0.02929	0.0087	N	0.03608	-0.345	0.22888	N	0.998605	B	0.25486	0.127	B	0.10450	0.005	T	0.45614	-0.9249	10	0.08599	T	0.76	.	8.7683	0.34717	0.2558:0.0:0.7442:0.0	.	563	P08047	SP1_HUMAN	S	563;556	ENSP00000329357:A563S;ENSP00000404263:A556S	ENSP00000329357:A563S	A	+	1	0	SP1	52086647	0.976000	0.34144	1.000000	0.80357	0.941000	0.58515	0.423000	0.21313	0.664000	0.31047	0.462000	0.41574	GCT		0.502	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1			60	94	1	0	6.60958e-23	0.01441	1.45301e-22	60	94				
NPFF	8620	broad.mit.edu	37	12	53899526	53899526	+	IGR	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:53899526C>A	ENST00000267017.3	-	0	592				TARBP2_ENST00000266987.2_Missense_Mutation_p.L279I|TARBP2_ENST00000394357.2_Missense_Mutation_p.L258I|TARBP2_ENST00000552857.1_Missense_Mutation_p.P145H|TARBP2_ENST00000456234.2_Missense_Mutation_p.L258I	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GATCCTGTCCCTCCGCAGTTG	0.617																																							uc001sdo.2		NA																	0				central_nervous_system(1)	1						c.(835-837)CTC>ATC		TAR RNA binding protein 2 isoform a							97.0	100.0	99.0					12																	53899526		2203	4300	6503	SO:0001628	intergenic_variant	6895				miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding	g.chr12:53899526C>A	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		12.37:g.53899526C>A						TARBP2_uc001sdp.2_Missense_Mutation_p.L258I|TARBP2_uc001sdq.2_Missense_Mutation_p.L135I|TARBP2_uc001sdr.2_Missense_Mutation_p.L135I|TARBP2_uc001sds.2_Missense_Mutation_p.P236H|TARBP2_uc001sdt.2_Missense_Mutation_p.L258I|TARBP2_uc001sdu.2_Missense_Mutation_p.L135I|TARBP2_uc001sdv.2_RNA	p.L279I	NM_134323	NP_599150	Q15633	TRBP2_HUMAN			8	1323	+			279			Sufficient for interaction with DICER1.		Q3SXL4	Missense_Mutation	SNP	ENST00000267017.3	37	c.835C>A	CCDS8862.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.5|29.5	5.014253|5.014253	0.93404|0.93404	.|.	.|.	ENSG00000139546|ENSG00000139546	ENST00000266987;ENST00000456234;ENST00000394357|ENST00000552857;ENST00000550407	T;T;T|.	0.72167|.	-0.63;-0.6;-0.6|.	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74566|0.74566	0.3733|0.3733	M|M	0.66378|0.66378	2.025|2.025	0.80722|0.80722	D|D	1|1	D|.	0.63880|.	0.993|.	D|.	0.70016|.	0.967|.	T|T	0.75563|0.75563	-0.3274|-0.3274	10|6	0.37606|0.54805	T|T	0.19|0.06	-16.4187|-16.4187	17.5584|17.5584	0.87900|0.87900	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	279|.	Q15633|.	TRBP2_HUMAN|.	I|H	279;258;258|145;137	ENSP00000266987:L279I;ENSP00000416077:L258I;ENSP00000377885:L258I|.	ENSP00000266987:L279I|ENSP00000447767:P137H	L|P	+|+	1|2	0|0	TARBP2|TARBP2	52185793|52185793	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.993000|0.993000	0.82548|0.82548	4.485000|4.485000	0.60279|0.60279	2.759000|2.759000	0.94783|0.94783	0.561000|0.561000	0.74099|0.74099	CTC|CCT		0.617	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717		8	297	1	0	0.00307968	0.00308	0.00507241	8	297				
OR6C1	390321	broad.mit.edu	37	12	55714896	55714896	+	Silent	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:55714896T>A	ENST00000379668.2	+	1	551	c.513T>A	c.(511-513)atT>atA	p.I171I		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						GGTCTAATATTATTGACCATT	0.373																																							uc010spi.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(511-513)ATT>ATA		olfactory receptor, family 6, subfamily C,							74.0	65.0	68.0					12																	55714896		2202	4299	6501	SO:0001819	synonymous_variant	390321				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55714896T>A	AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	ENST00000379668.2:c.513T>A	12.37:g.55714896T>A							p.I171I	NM_001005182	NP_001005182	Q96RD1	OR6C1_HUMAN			1	513	+			171			Extracellular (Potential).		B2RNM0	Silent	SNP	ENST00000379668.2	37	c.513T>A	CCDS31818.1																																																																																				0.373	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398152.1	NM_001005182		31	78	0	0	0	0.009535	0	31	78				
PTPRB	5787	broad.mit.edu	37	12	70956688	70956688	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:70956688G>T	ENST00000261266.5	-	14	3479	c.3450C>A	c.(3448-3450)taC>taA	p.Y1150*	PTPRB_ENST00000550857.1_Nonsense_Mutation_p.Y1060*|PTPRB_ENST00000550358.1_Nonsense_Mutation_p.Y1280*|PTPRB_ENST00000451516.2_Nonsense_Mutation_p.Y1060*|PTPRB_ENST00000334414.6_Nonsense_Mutation_p.Y1368*|PTPRB_ENST00000551525.1_Nonsense_Mutation_p.Y1367*|PTPRB_ENST00000538708.1_Nonsense_Mutation_p.Y1060*	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1150	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TCACCATCTTGTACATTCTGC	0.453																																							uc001swb.3		NA																	0				lung(2)|skin(1)	3						c.(3448-3450)TAC>TAA		protein tyrosine phosphatase, receptor type, B							118.0	110.0	113.0					12																	70956688		1899	4129	6028	SO:0001587	stop_gained	5787				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:70956688G>T	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.3450C>A	12.37:g.70956688G>T	ENSP00000261266:p.Tyr1150*					PTPRB_uc010sto.1_Nonsense_Mutation_p.Y1060*|PTPRB_uc010stp.1_Nonsense_Mutation_p.Y1060*|PTPRB_uc001swc.3_Nonsense_Mutation_p.Y1368*|PTPRB_uc001swa.3_Nonsense_Mutation_p.Y1280*|PTPRB_uc001swd.3_Nonsense_Mutation_p.Y1367*|PTPRB_uc009zrr.1_Nonsense_Mutation_p.Y1247*	p.Y1150*	NM_002837	NP_002828	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)		14	3480	-	Renal(347;0.236)		1150			Fibronectin type-III 13.|Extracellular (Potential).		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Nonsense_Mutation	SNP	ENST00000261266.5	37	c.3450C>A	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	39	7.865653	0.98534	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	.	.	.	5.98	4.16	0.48862	.	0.058479	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4962	0.44778	0.2105:0.0:0.7895:0.0	.	.	.	.	X	1368;1060;1280;1060;1060;1150;1367;1247	.	ENSP00000261266:Y1150X	Y	-	3	2	PTPRB	69242955	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	1.474000	0.35398	1.543000	0.49345	-0.140000	0.14226	TAC		0.453	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1			58	115	1	0	5.19286e-32	0.01441	1.26146e-31	58	115				
NAV3	89795	broad.mit.edu	37	12	78225190	78225190	+	5'UTR	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:78225190C>A	ENST00000397909.2	+	0	122				NAV3_ENST00000536525.2_5'UTR|NAV3_ENST00000228327.6_5'UTR|NAV3_ENST00000266692.7_5'UTR			Q8IVL0	NAV3_HUMAN	neuron navigator 3							membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GTCTACCAGACTGAGGTTAGA	0.373										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(-53--49)GACTG>GAATG		neuron navigator 3							354.0	350.0	351.0					12																	78225190		876	1991	2867	SO:0001623	5_prime_UTR_variant	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78225190C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.-52C>A	12.37:g.78225190C>A		HNSCC(70;0.22)				NAV3_uc001syo.2_Translation_Start_Site		NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			1	122	+								Q8NFW7|Q9Y2E7	Translation_Start_Site	SNP	ENST00000397909.2	37	c.-51C>A																																																																																					0.373	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		194	376	1	0	4.36549e-90	0.01441	1.26909e-89	194	376				
SLC6A15	55117	broad.mit.edu	37	12	85279240	85279240	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:85279240G>T	ENST00000266682.5	-	4	1089	c.548C>A	c.(547-549)cCt>cAt	p.P183H	SLC6A15_ENST00000552192.1_Missense_Mutation_p.P76H|SLC6A15_ENST00000551388.1_Intron|SLC6A15_ENST00000450363.3_Missense_Mutation_p.P183H	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	183					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						TTTCACCAAAGGACACTGATC	0.373																																							uc001szv.2		NA																	0				pancreas(2)|ovary(1)	3						c.(547-549)CCT>CAT		solute carrier family 6, member 15 isoform 1							83.0	83.0	83.0					12																	85279240		2203	4300	6503	SO:0001583	missense	55117				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr12:85279240G>T	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.548C>A	12.37:g.85279240G>T	ENSP00000266682:p.Pro183His					SLC6A15_uc010sul.1_Missense_Mutation_p.P76H|SLC6A15_uc001szy.2_Missense_Mutation_p.P183H	p.P183H	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN			4	1041	-			183			Extracellular (Potential).		A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	c.548C>A	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641726	0.87859	.	.	ENSG00000072041	ENST00000266682;ENST00000552192;ENST00000450363	T;T;T	0.74842	-0.88;-0.88;-0.88	5.02	5.02	0.67125	.	0.191770	0.33457	N	0.004896	D	0.86781	0.6015	M	0.78223	2.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87952	0.2724	10	0.62326	D	0.03	.	18.7628	0.91860	0.0:0.0:1.0:0.0	.	183;183	Q9H9F5;Q9H2J7	.;S6A15_HUMAN	H	183;76;183	ENSP00000266682:P183H;ENSP00000450145:P76H;ENSP00000390706:P183H	ENSP00000266682:P183H	P	-	2	0	SLC6A15	83803371	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.414000	0.97362	2.517000	0.84864	0.585000	0.79938	CCT		0.373	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767		56	90	1	0	6.3091e-27	0.01441	1.44674e-26	56	90				
MGAT4C	25834	broad.mit.edu	37	12	86373526	86373526	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:86373526C>A	ENST00000604798.1	-	8	2182	c.978G>T	c.(976-978)aaG>aaT	p.K326N	MGAT4C_ENST00000548651.1_Missense_Mutation_p.K326N|MGAT4C_ENST00000332156.1_Missense_Mutation_p.K326N|MGAT4C_ENST00000393205.2_Missense_Mutation_p.K355N|MGAT4C_ENST00000552435.2_3'UTR|MGAT4C_ENST00000549405.2_Missense_Mutation_p.K326N|MGAT4C_ENST00000552808.2_Missense_Mutation_p.K326N			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	326					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AATCATCATCCTTCAGCTTAT	0.408																																							uc001tai.3		NA																	0				ovary(3)	3						c.(976-978)AAG>AAT		alpha-1,3-mannosyl-glycoprotein							81.0	79.0	80.0					12																	86373526		2203	4300	6503	SO:0001583	missense	25834				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr12:86373526C>A		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.978G>T	12.37:g.86373526C>A	ENSP00000474896:p.Lys326Asn					MGAT4C_uc001tal.3_Missense_Mutation_p.K326N|MGAT4C_uc001taj.3_Missense_Mutation_p.K326N|MGAT4C_uc001tak.3_Missense_Mutation_p.K326N|MGAT4C_uc010sum.1_Missense_Mutation_p.K350N|MGAT4C_uc001tah.3_Missense_Mutation_p.K326N	p.K326N	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN			8	2228	-			326			Lumenal (Potential).		B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	37	c.978G>T	CCDS9030.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.408676	0.25378	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	5.75	0.689	0.18033	.	0.000000	0.85682	D	0.000000	T	0.64692	0.2621	M	0.81942	2.565	0.51012	D	0.999909	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.63143	-0.6703	10	0.56958	D	0.05	-19.0112	9.9517	0.41642	0.0:0.5045:0.0:0.4955	.	355;326	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	N	326;355;326;326;326;326;326	ENSP00000331664:K326N;ENSP00000376900:K355N;ENSP00000449022:K326N;ENSP00000446647:K326N;ENSP00000447253:K326N;ENSP00000449172:K326N	ENSP00000331664:K326N	K	-	3	2	MGAT4C	84897657	0.957000	0.32711	0.995000	0.50966	0.010000	0.07245	0.202000	0.17295	-0.139000	0.11414	-0.312000	0.09012	AAG		0.408	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244		33	68	1	0	4.74835e-14	0.010818	9.46114e-14	33	68				
NR1H4	9971	broad.mit.edu	37	12	100904815	100904815	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:100904815C>A	ENST00000551379.1	+	2	397	c.369C>A	c.(367-369)cgC>cgA	p.R123R	NR1H4_ENST00000549996.1_Silent_p.R113R|NR1H4_ENST00000548884.1_Silent_p.R113R|NR1H4_ENST00000188403.7_Silent_p.R123R|NR1H4_ENST00000392986.3_Silent_p.R113R			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	123					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	AGAAGCCCCGCATGGGCGCGT	0.527																																							uc001tht.1		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(367-369)CGC>CGA		nuclear receptor subfamily 1, group H, member 4							90.0	97.0	95.0					12																	100904815		2203	4300	6503	SO:0001819	synonymous_variant	9971				bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr12:100904815C>A	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.369C>A	12.37:g.100904815C>A						NR1H4_uc001thp.1_Silent_p.R113R|NR1H4_uc001thq.1_Silent_p.R113R|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Silent_p.R113R|NR1H4_uc010svk.1_Silent_p.R113R|NR1H4_uc001ths.1_Silent_p.R123R	p.R123R	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN			2	397	+			123					A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Silent	SNP	ENST00000551379.1	37	c.369C>A	CCDS55876.1																																																																																				0.527	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123		53	122	1	0	2.48254e-18	0.01441	5.28285e-18	53	122				
STAB2	55576	broad.mit.edu	37	12	104133198	104133198	+	Silent	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:104133198T>C	ENST00000388887.2	+	54	5910	c.5706T>C	c.(5704-5706)tgT>tgC	p.C1902C		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						AGGGGGAGTGTGGGAGCTGTG	0.413																																							uc001tjw.2		NA																	0				ovary(9)|skin(5)	14						c.(5704-5706)TGT>TGC		stabilin 2 precursor							123.0	116.0	119.0					12																	104133198		2203	4300	6503	SO:0001819	synonymous_variant	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104133198T>C	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5706T>C	12.37:g.104133198T>C						STAB2_uc009zug.2_RNA	p.C1902C	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN			54	5892	+			1902			Extracellular (Potential).			Silent	SNP	ENST00000388887.2	37	c.5706T>C	CCDS31888.1																																																																																				0.413	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			16	114	0	0	0	0.004007	0	16	114				
ACACB	32	broad.mit.edu	37	12	109577847	109577847	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:109577847C>T	ENST00000338432.7	+	2	756	c.637C>T	c.(637-639)Cgc>Tgc	p.R213C	ACACB_ENST00000377854.5_Missense_Mutation_p.R213C|ACACB_ENST00000377848.3_Missense_Mutation_p.R213C			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	213					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AGCTGAGACCCGCGTCCCCAC	0.587																																							uc001tob.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(637-639)CGC>TGC		acetyl-Coenzyme A carboxylase beta	Biotin(DB00121)						51.0	49.0	50.0					12																	109577847		2203	4300	6503	SO:0001583	missense	32				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr12:109577847C>T	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.637C>T	12.37:g.109577847C>T	ENSP00000341044:p.Arg213Cys					ACACB_uc001toc.2_Missense_Mutation_p.R213C	p.R213C	NM_001093	NP_001084	O00763	ACACB_HUMAN			2	756	+			213					A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	c.637C>T	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.415503	0.25552	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	T;T;T	0.19250	2.16;2.16;2.16	4.8	-0.745	0.11098	.	1.785350	0.02703	N	0.111987	T	0.07683	0.0193	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24584	-1.0156	10	0.51188	T	0.08	.	0.4142	0.00446	0.2056:0.3235:0.1583:0.3126	.	213	O00763	ACACB_HUMAN	C	213	ENSP00000341044:R213C;ENSP00000367079:R213C;ENSP00000367085:R213C	ENSP00000341044:R213C	R	+	1	0	ACACB	108062230	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.249000	0.18216	-0.029000	0.13827	0.655000	0.94253	CGC		0.587	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		42	86	0	0	0	0.011902	0	42	86				
CAMKK2	10645	broad.mit.edu	37	12	121701685	121701685	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:121701685C>A	ENST00000324774.5	-	6	1511	c.683G>T	c.(682-684)gGc>gTc	p.G228V	CAMKK2_ENST00000446440.2_Missense_Mutation_p.G228V|CAMKK2_ENST00000392473.2_Missense_Mutation_p.G228V|CAMKK2_ENST00000337174.3_Missense_Mutation_p.G228V|CAMKK2_ENST00000347034.2_Missense_Mutation_p.G228V|CAMKK2_ENST00000404169.3_Missense_Mutation_p.G228V|CAMKK2_ENST00000392474.2_Missense_Mutation_p.G228V|CAMKK2_ENST00000412367.2_Missense_Mutation_p.G228V|CAMKK2_ENST00000402834.4_Missense_Mutation_p.G228V|CAMKK2_ENST00000538733.1_Missense_Mutation_p.G228V|CAMKK2_ENST00000535524.1_Intron	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	228	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTCAATGGGGCCCCTGGGCTG	0.607																																							uc001tzu.2		NA																	0				lung(1)|large_intestine(1)|stomach(1)	3						c.(682-684)GGC>GTC		calcium/calmodulin-dependent protein kinase							43.0	41.0	42.0					12																	121701685		2203	4300	6503	SO:0001583	missense	10645				calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity	g.chr12:121701685C>A	AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.683G>T	12.37:g.121701685C>A	ENSP00000312741:p.Gly228Val					CAMKK2_uc001tzt.2_Missense_Mutation_p.G228V|CAMKK2_uc001tzv.2_Missense_Mutation_p.G228V|CAMKK2_uc001tzw.2_Missense_Mutation_p.G228V|CAMKK2_uc001tzx.2_Missense_Mutation_p.G228V|CAMKK2_uc001tzy.2_Missense_Mutation_p.G228V|CAMKK2_uc001uaa.1_Missense_Mutation_p.G228V|CAMKK2_uc001uab.2_Missense_Mutation_p.G228V|CAMKK2_uc001uac.2_Missense_Mutation_p.G228V	p.G228V	NM_006549	NP_006540	Q96RR4	KKCC2_HUMAN			6	807	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		228			Protein kinase.		A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Missense_Mutation	SNP	ENST00000324774.5	37	c.683G>T	CCDS9216.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256753	0.80246	.	.	ENSG00000110931	ENST00000392474;ENST00000347034;ENST00000538733;ENST00000337174;ENST00000324774;ENST00000412367;ENST00000404169;ENST00000360452;ENST00000446440;ENST00000392473	T;T;T;T;T;T;T;T;T	0.74315	-0.81;-0.82;-0.8;-0.81;-0.83;-0.81;-0.83;-0.81;-0.81	5.97	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.105219	0.64402	D	0.000004	T	0.71710	0.3372	N	0.24115	0.695	0.80722	D	1	B;P;P;P;P;P;P	0.49961	0.232;0.869;0.869;0.616;0.93;0.892;0.869	B;B;B;B;P;P;B	0.52109	0.113;0.343;0.343;0.343;0.563;0.69;0.343	T	0.75706	-0.3224	10	0.66056	D	0.02	4.5055	14.4425	0.67327	0.0:0.9295:0.0:0.0705	.	228;228;228;228;228;228;228	Q96RR4-6;Q96RR4-2;Q96RR4-7;Q96RR4-5;Q96RR4-4;Q96RR4;Q96RR4-3	.;.;.;.;.;KKCC2_HUMAN;.	V	228;228;228;228;228;228;228;211;228;228	ENSP00000376266:G228V;ENSP00000321230:G228V;ENSP00000445944:G228V;ENSP00000336634:G228V;ENSP00000312741:G228V;ENSP00000388368:G228V;ENSP00000384600:G228V;ENSP00000388273:G228V;ENSP00000376265:G228V	ENSP00000312741:G228V	G	-	2	0	CAMKK2	120186068	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	3.467000	0.53078	1.534000	0.49203	0.591000	0.81541	GGC		0.607	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402563.1	NM_172226		34	49	1	0	1.22384e-17	0.013726	2.57344e-17	34	49				
WDR66	144406	broad.mit.edu	37	12	122396894	122396894	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:122396894T>C	ENST00000288912.4	+	13	2881	c.2027T>C	c.(2026-2028)cTt>cCt	p.L676P	WDR66_ENST00000397454.2_Missense_Mutation_p.L676P	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	676							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		GTTTACATTCTTGATGCAATG	0.418																																					Esophageal Squamous(85;849 1794 49757 52143)	Esophageal Squamous(85;849 1794 49757 52143)	uc009zxk.2		NA																	0				ovary(1)|skin(1)	2						c.(2026-2028)CTT>CCT		WD repeat domain 66							146.0	135.0	139.0					12																	122396894		1850	4104	5954	SO:0001583	missense	144406						calcium ion binding	g.chr12:122396894T>C	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2027T>C	12.37:g.122396894T>C	ENSP00000288912:p.Leu676Pro						p.L676P	NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)	13	2169	+	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)		676			WD 7.		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	ENST00000288912.4	37	c.2027T>C	CCDS41853.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004956	0.74932	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.64991	0.96;-0.13	4.96	4.96	0.65561	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.227194	0.38605	N	0.001633	T	0.77942	0.4206	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.81241	-0.1022	10	0.87932	D	0	.	14.3204	0.66482	0.0:0.0:0.0:1.0	.	676	Q8TBY9	WDR66_HUMAN	P	676	ENSP00000288912:L676P;ENSP00000380595:L676P	ENSP00000288912:L676P	L	+	2	0	WDR66	120881277	0.998000	0.40836	0.957000	0.39632	0.897000	0.52465	6.475000	0.73582	1.841000	0.53522	0.459000	0.35465	CTT		0.418	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668		60	118	0	0	0	0.01441	0	60	118				
PSPC1	55269	broad.mit.edu	37	13	20283715	20283715	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr13:20283715C>A	ENST00000338910.4	-	7	1342	c.1183G>T	c.(1183-1185)Gat>Tat	p.D395Y		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	395	Gly-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		GGACCCATATCACCCATTCTC	0.383																																							uc001uml.2		NA																	0				breast(1)	1						c.(1183-1185)GAT>TAT		paraspeckle protein 1							184.0	161.0	168.0					13																	20283715		1815	4070	5885	SO:0001583	missense	55269				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding	g.chr13:20283715C>A	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.1183G>T	13.37:g.20283715C>A	ENSP00000343966:p.Asp395Tyr					PSPC1_uc001umj.1_Intron|PSPC1_uc001umk.1_Intron	p.D395Y	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)	7	1369	-		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)	395			Gly-rich.		Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Missense_Mutation	SNP	ENST00000338910.4	37	c.1183G>T	CCDS41870.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457215	0.63401	.	.	ENSG00000121390	ENST00000338910;ENST00000422828	T	0.16196	2.36	5.09	5.09	0.68999	.	0.107337	0.64402	D	0.000006	T	0.30479	0.0766	L	0.40543	1.245	0.54753	D	0.999984	D	0.64830	0.994	P	0.57679	0.825	T	0.01715	-1.1289	10	0.62326	D	0.03	-24.4707	18.8473	0.92212	0.0:1.0:0.0:0.0	.	395	Q8WXF1	PSPC1_HUMAN	Y	395;335	ENSP00000343966:D395Y	ENSP00000343966:D395Y	D	-	1	0	PSPC1	19181715	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.842000	0.75379	2.521000	0.84997	0.591000	0.81541	GAT		0.383	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2			113	56	1	0	1.46925e-46	0.01441	3.94767e-46	113	56				
TRPC4	7223	broad.mit.edu	37	13	38266181	38266181	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr13:38266181G>T	ENST00000379705.3	-	4	2046	c.1189C>A	c.(1189-1191)Cca>Aca	p.P397T	TRPC4_ENST00000338947.5_Missense_Mutation_p.P224T|TRPC4_ENST00000426868.2_Missense_Mutation_p.P397T|TRPC4_ENST00000379681.3_Missense_Mutation_p.P397T|TRPC4_ENST00000358477.2_Missense_Mutation_p.P397T|TRPC4_ENST00000379679.1_Missense_Mutation_p.P224T|TRPC4_ENST00000447043.1_Missense_Mutation_p.P397T|TRPC4_ENST00000379673.2_Missense_Mutation_p.P397T|TRPC4_ENST00000355779.2_Missense_Mutation_p.P397T			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	397					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GTTGGTGGTGGACCTTGCCTG	0.438																																							uc001uws.2		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(1189-1191)CCA>ACA		transient receptor potential cation channel,							110.0	100.0	103.0					13																	38266181		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38266181G>T	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1189C>A	13.37:g.38266181G>T	ENSP00000369027:p.Pro397Thr					TRPC4_uc010abv.2_Intron|TRPC4_uc001uwt.2_Missense_Mutation_p.P397T|TRPC4_uc010tey.1_Missense_Mutation_p.P397T|TRPC4_uc010abw.2_Missense_Mutation_p.P224T|TRPC4_uc010abx.2_Missense_Mutation_p.P397T|TRPC4_uc010aby.2_Missense_Mutation_p.P397T	p.P397T	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	4	1424	-			397			Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.1189C>A	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671878	0.88348	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.90844	0.7124	M	0.70842	2.15	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;0.995;0.999	D;D;D;D;D;D	0.87578	0.959;0.993;0.998;0.996;0.944;0.984	D	0.88589	0.3142	10	0.35671	T	0.21	-17.8916	20.1931	0.98233	0.0:0.0:1.0:0.0	.	397;397;397;224;397;397	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	T	397;397;224;224;397;397;397;397;397	ENSP00000369027:P397T;ENSP00000369003:P397T;ENSP00000342580:P224T;ENSP00000369001:P224T;ENSP00000410133:P397T;ENSP00000348025:P397T;ENSP00000351264:P397T;ENSP00000368995:P397T;ENSP00000414316:P397T	ENSP00000342580:P224T	P	-	1	0	TRPC4	37164181	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.771000	0.95319	0.563000	0.77884	CCA		0.438	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		91	48	1	0	6.00224e-42	0.01441	1.56529e-41	91	48				
PCDH17	27253	broad.mit.edu	37	13	58207981	58207981	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr13:58207981C>T	ENST00000377918.3	+	1	1327	c.1301C>T	c.(1300-1302)aCa>aTa	p.T434I		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GACCGCGAGACACAAGACGAG	0.627																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(1300-1302)ACA>ATA		protocadherin 17 precursor							46.0	33.0	37.0					13																	58207981		2202	4297	6499	SO:0001583	missense	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58207981C>T	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1301C>T	13.37:g.58207981C>T	ENSP00000367151:p.Thr434Ile					PCDH17_uc010aec.1_Missense_Mutation_p.T434I	p.T434I	NM_001040429	NP_001035519	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	2193	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	434			Extracellular (Potential).|Cadherin 4.		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	c.1301C>T	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	2.423	-0.332587	0.05314	.	.	ENSG00000118946	ENST00000377918	T	0.52983	0.64	5.7	5.7	0.88788	Cadherin (4);Cadherin-like (1);	0.307036	0.39083	N	0.001464	T	0.33585	0.0868	L	0.31578	0.945	0.28765	N	0.900699	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.13150	-1.0520	9	.	.	.	.	10.2952	0.43620	0.0:0.854:0.0:0.146	.	434;434	O14917-2;O14917	.;PCD17_HUMAN	I	434	ENSP00000367151:T434I	.	T	+	2	0	PCDH17	57105982	0.988000	0.35896	0.964000	0.40570	0.107000	0.19398	2.488000	0.45276	2.704000	0.92352	0.650000	0.86243	ACA		0.627	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		19	73	0	0	0	0.014323	0	19	73				
RNF219	79596	broad.mit.edu	37	13	79189773	79189773	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr13:79189773T>C	ENST00000282003.6	-	6	2181	c.2123A>G	c.(2122-2124)aAa>aGa	p.K708R	RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	708	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		GATTTTTCTTTTTGTTGATTG	0.403																																							uc001vkw.1		NA																	0				large_intestine(2)	2						c.(2122-2124)AAA>AGA		ring finger protein 219							131.0	128.0	129.0					13																	79189773		2203	4300	6503	SO:0001583	missense	79596						zinc ion binding	g.chr13:79189773T>C	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.2123A>G	13.37:g.79189773T>C	ENSP00000282003:p.Lys708Arg					uc001vku.1_Intron|RNF219_uc010afb.1_Missense_Mutation_p.K518R|RNF219_uc010afc.2_3'UTR	p.K708R	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN		GBM - Glioblastoma multiforme(99;0.0414)	6	2182	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)	708			Ser-rich.		B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	c.2123A>G	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.534982	0.85812	.	.	ENSG00000152193	ENST00000282003	T	0.15718	2.4	5.66	5.66	0.87406	.	0.085869	0.50627	D	0.000109	T	0.19248	0.0462	L	0.56769	1.78	0.35812	D	0.823935	P	0.52316	0.952	B	0.38842	0.283	T	0.30534	-0.9975	10	0.87932	D	0	-22.4236	14.7731	0.69693	0.0:0.0:0.0:1.0	.	708	Q5W0B1	RN219_HUMAN	R	708	ENSP00000282003:K708R	ENSP00000282003:K708R	K	-	2	0	RNF219	78087774	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.573000	0.67417	2.285000	0.76669	0.533000	0.62120	AAA		0.403	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546		46	196	0	0	0	0.01441	0	46	196				
PCCA	5095	broad.mit.edu	37	13	100953772	100953772	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr13:100953772G>C	ENST00000376285.1	+	13	1162	c.1124G>C	c.(1123-1125)cGt>cCt	p.R375P	PCCA_ENST00000376279.3_Missense_Mutation_p.R375P|PCCA_ENST00000376286.4_Missense_Mutation_p.R349P	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	375	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	GAAATGATCCGTGTTGCTAAG	0.502																																							uc001voo.2		NA																	0				skin(2)	2						c.(1123-1125)CGT>CCT		propionyl-Coenzyme A carboxylase, alpha	Biotin(DB00121)						182.0	158.0	166.0					13																	100953772		2203	4300	6503	SO:0001583	missense	5095				fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity	g.chr13:100953772G>C	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1124G>C	13.37:g.100953772G>C	ENSP00000365462:p.Arg375Pro					PCCA_uc010aga.2_Missense_Mutation_p.R349P|PCCA_uc010tiz.1_Missense_Mutation_p.R375P|PCCA_uc001vop.2_RNA	p.R375P	NM_000282	NP_000273	P05165	PCCA_HUMAN			13	1162	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		375			ATP-grasp.|Biotin carboxylation.		B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	c.1124G>C	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930985	0.73327	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.97791	-4.54;-4.54;-4.54	5.65	4.78	0.61160	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.047672	0.85682	D	0.000000	D	0.99315	0.9760	H	0.99130	4.44	0.58432	D	0.999999	D;D;D	0.56746	0.967;0.977;0.967	D;D;D	0.68353	0.951;0.957;0.951	D	0.98294	1.0515	10	0.87932	D	0	.	15.8106	0.78561	0.0:0.0:0.859:0.141	.	375;349;375	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	P	349;375;375	ENSP00000365463:R349P;ENSP00000365456:R375P;ENSP00000365462:R375P	ENSP00000365456:R375P	R	+	2	0	PCCA	99751773	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.676000	0.84012	1.462000	0.47948	0.650000	0.86243	CGT		0.502	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2			47	212	0	0	0	0.01441	0	47	212				
CPNE6	9362	broad.mit.edu	37	14	24546540	24546540	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr14:24546540C>A	ENST00000397016.2	+	16	1788	c.1477C>A	c.(1477-1479)Cga>Aga	p.R493R	CPNE6_ENST00000216775.2_Silent_p.R493R|CPNE6_ENST00000537691.1_Silent_p.R548R	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	493	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GCGCTGCCCCCGAGGGGTGCC	0.647																																							uc001wll.2		NA																	0				skin(2)|ovary(1)	3						c.(1477-1479)CGA>AGA		copine 6							64.0	65.0	64.0					14																	24546540		2203	4300	6503	SO:0001819	synonymous_variant	9362				lipid metabolic process|nervous system development|synaptic transmission|vesicle-mediated transport		calcium ion binding|transporter activity	g.chr14:24546540C>A	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1477C>A	14.37:g.24546540C>A						CPNE6_uc010tnv.1_Silent_p.R548R|CPNE6_uc001wlm.2_Silent_p.R318R|CPNE6_uc001wln.2_Silent_p.R161R	p.R493R	NM_006032	NP_006023	O95741	CPNE6_HUMAN		GBM - Glioblastoma multiforme(265;0.0184)	15	1576	+			493			VWFA.		B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Silent	SNP	ENST00000397016.2	37	c.1477C>A	CCDS9607.1																																																																																				0.647	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5			57	30	1	0	1.3268e-25	0.01441	2.99093e-25	57	30				
CCDC88C	440193	broad.mit.edu	37	14	91770243	91770243	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr14:91770243T>C	ENST00000389857.6	-	20	3523	c.3437A>G	c.(3436-3438)aAg>aGg	p.K1146R		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1146					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CTCCGTCTCCTTGGCCGTGTG	0.652																																							uc010aty.2		NA																	0				ovary(3)	3						c.(3436-3438)AAG>AGG		DVL-binding protein DAPLE							76.0	83.0	81.0					14																	91770243		2150	4253	6403	SO:0001583	missense	440193				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association	g.chr14:91770243T>C		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3437A>G	14.37:g.91770243T>C	ENSP00000374507:p.Lys1146Arg						p.K1146R	NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN			20	3536	-		all_cancers(154;0.0468)	1146			Potential.		Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	c.3437A>G	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	T	9.546	1.114685	0.20795	.	.	ENSG00000015133	ENST00000389857	T	0.14391	2.51	5.52	1.35	0.21983	.	0.125201	0.35320	U	0.003290	T	0.09024	0.0223	L	0.48877	1.53	0.80722	D	1	B	0.15141	0.012	B	0.16289	0.015	T	0.28459	-1.0043	10	0.23302	T	0.38	-33.6722	1.3822	0.02233	0.1382:0.1748:0.1445:0.5425	.	1146	Q9P219	DAPLE_HUMAN	R	1146	ENSP00000374507:K1146R	ENSP00000374507:K1146R	K	-	2	0	CCDC88C	90839996	0.998000	0.40836	0.881000	0.34555	0.852000	0.48524	3.210000	0.51129	0.031000	0.15407	0.459000	0.35465	AAG		0.652	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		68	38	0	0	0	0.01441	0	68	38				
AHNAK2	113146	broad.mit.edu	37	14	105409967	105409967	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr14:105409967G>A	ENST00000333244.5	-	7	11940	c.11821C>T	c.(11821-11823)Cca>Tca	p.P3941S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3941						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTGGCTCCTGGGGCCTCGACG	0.602																																							uc010axc.1		NA																	0				ovary(1)	1						c.(11821-11823)CCA>TCA		AHNAK nucleoprotein 2							161.0	174.0	170.0					14																	105409967		1985	4147	6132	SO:0001583	missense	113146					nucleus		g.chr14:105409967G>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11821C>T	14.37:g.105409967G>A	ENSP00000353114:p.Pro3941Ser					AHNAK2_uc001ypx.2_Missense_Mutation_p.P3841S	p.P3941S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	11941	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3941					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.11821C>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	15.81	2.942640	0.53079	.	.	ENSG00000185567	ENST00000333244	T	0.02631	4.22	3.91	2.01	0.26516	.	1.635720	0.05772	U	0.606963	T	0.17365	0.0417	M	0.90977	3.165	0.09310	N	1	D	0.54601	0.967	P	0.61275	0.886	T	0.05022	-1.0911	10	0.56958	D	0.05	-16.8809	7.6293	0.28230	0.0948:0.1676:0.7376:0.0	.	3941	Q8IVF2	AHNK2_HUMAN	S	3941	ENSP00000353114:P3941S	ENSP00000353114:P3941S	P	-	1	0	AHNAK2	104481012	0.215000	0.23574	0.001000	0.08648	0.020000	0.10135	1.255000	0.32909	0.643000	0.30638	0.306000	0.20318	CCA		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		224	138	0	0	0	0.01441	0	224	138				
NBEAP1	606	broad.mit.edu	37	15	20876518	20876518	+	RNA	SNP	C	C	G	rs533513740	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:20876518C>G	ENST00000556948.1	-	0	82							P0C6P0	BCL8_HUMAN	neurobeachin pseudogene 1																		CAAAGGTACTCCATGAGATAA	0.338													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		39980	0.0		0.0	False		,,,				2504	0.0						uc010tze.1		NA																	0					0						c.(94-96)GGA>GCA		RecName: Full=Putative protein BCL8;																																						606							g.chr15:20876518C>G			15q11.2	2014-03-20	2011-05-03	2011-05-03	ENSG00000258590	ENSG00000258590			1007	pseudogene	pseudogene		601889	"""B-cell CLL/lymphoma 8"""	BCL8		9159141	Standard	NR_027992		Approved	BCL8A	uc010tze.1	P0C6P0	OTTHUMG00000171717		15.37:g.20876518C>G						BCL8_uc010tzd.1_RNA	p.G32A	NR_027992						2	302	-									Missense_Mutation	SNP	ENST00000556948.1	37	c.95G>C																																																																																					0.338	NBEAP1-002	KNOWN	not_best_in_genome_evidence|basic	retained_intron	pseudogene	OTTHUMT00000414853.1	NR_027992		28	203	0	0	0	0.005443	0	28	203				
GOLGA8EP	390535	broad.mit.edu	37	15	23444033	23444033	+	RNA	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:23444033G>A	ENST00000526079.1	+	0	1677				RN7SL106P_ENST00000488468.2_RNA|AC100757.1_ENST00000458911.1_RNA	NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		TCTGGACAGTGAGGGGGAGGA	0.627																																							uc001yvu.2		NA																	0				skin(1)	1						c.(688-690)GAG>AAG		golgi autoantigen, golgin subfamily a, 8E							13.0	17.0	16.0					15																	23444033		1474	2691	4165			390535							g.chr15:23444033G>A			15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23444033G>A							p.E230K	NM_001012423	NP_001012423				all cancers(64;5.21e-07)|Epithelial(43;5.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.000614)	14	1677	+		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)							Missense_Mutation	SNP	ENST00000526079.1	37	c.688G>A																																																																																					0.627	GOLGA8EP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000393312.1	NR_033350.1		15	196	0	0	0	0.010504	0	15	196				
ACTC1	70	broad.mit.edu	37	15	35086900	35086900	+	Missense_Mutation	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:35086900A>G	ENST00000290378.4	-	2	765	c.110T>C	c.(109-111)gTg>gCg	p.V37A	ACTC1_ENST00000557860.1_5'Flank|RP11-814P5.1_ENST00000503496.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	37					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CGGGCGGCCCACGATGGACGG	0.687																																							uc001ziu.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(109-111)GTG>GCG		cardiac muscle alpha actin 1 proprotein							23.0	26.0	25.0					15																	35086900		2191	4287	6478	SO:0001583	missense	70				apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding	g.chr15:35086900A>G	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.110T>C	15.37:g.35086900A>G	ENSP00000290378:p.Val37Ala					uc001zit.1_Intron	p.V37A	NM_005159	NP_005150	P68032	ACTC_HUMAN		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)	2	353	-		all_lung(180;2.3e-08)	37					P04270	Missense_Mutation	SNP	ENST00000290378.4	37	c.110T>C	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.249057	0.80024	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.95447	-3.71	4.21	4.21	0.49690	.	0.000000	0.47093	U	0.000259	D	0.98188	0.9401	H	0.96430	3.82	0.58432	D	0.999998	B	0.28636	0.218	P	0.50049	0.629	D	0.99881	1.1113	10	0.87932	D	0	.	13.6121	0.62086	1.0:0.0:0.0:0.0	.	37	P68032	ACTC_HUMAN	A	37	ENSP00000290378:V37A	ENSP00000290378:V37A	V	-	2	0	ACTC1	32874192	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.326000	0.96389	1.680000	0.50976	0.459000	0.35465	GTG		0.687	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159		36	47	0	0	0	0.003271	0	36	47				
INO80	54617	broad.mit.edu	37	15	41361779	41361779	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:41361779G>C	ENST00000361937.3	-	14	2195	c.1771C>G	c.(1771-1773)Cct>Gct	p.P591A	INO80_ENST00000401393.3_Missense_Mutation_p.P591A			Q9ULG1	INO80_HUMAN	INO80 complex subunit	591	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTAAATTTAGGAACAAATCTA	0.348																																							uc001zni.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1771-1773)CCT>GCT		INO80 complex homolog 1							88.0	85.0	86.0					15																	41361779		2203	4300	6503	SO:0001583	missense	54617				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity	g.chr15:41361779G>C	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.1771C>G	15.37:g.41361779G>C	ENSP00000355205:p.Pro591Ala					INO80_uc010ucu.1_RNA	p.P591A	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN			14	1984	-			591			Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase ATP-binding.		A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	c.1771C>G	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283313	0.80803	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.94232	-3.38;-3.38	5.06	4.15	0.48705	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.96901	0.8988	M	0.88181	2.935	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.97432	1.0016	10	0.87932	D	0	.	13.7206	0.62725	0.0752:0.0:0.9248:0.0	.	591	Q9ULG1	INO80_HUMAN	A	591	ENSP00000355205:P591A;ENSP00000384686:P591A	ENSP00000355205:P591A	P	-	1	0	INO80	39149071	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.967000	0.87967	1.255000	0.44051	0.585000	0.79938	CCT		0.348	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553		25	31	0	0	0	0.004656	0	25	31				
TUBGCP4	27229	broad.mit.edu	37	15	43663583	43663583	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:43663583G>A	ENST00000260383.7	+	1	285	c.31G>A	c.(31-33)Ggg>Agg	p.G11R	ZSCAN29_ENST00000568898.1_5'Flank|ZSCAN29_ENST00000396976.2_5'Flank|ZSCAN29_ENST00000562072.1_5'Flank|TUBGCP4_ENST00000570081.1_Intron|TUBGCP4_ENST00000564079.1_Missense_Mutation_p.G11R|ZSCAN29_ENST00000396972.1_5'Flank|ZSCAN29_ENST00000563508.1_5'Flank			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	11					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		GGCTCTGAGCGGGTACCCTGG	0.652											OREG0023087	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001zro.2		NA																	0				ovary(3)	3						c.(31-33)GGG>AGG		tubulin, gamma complex associated protein 4							47.0	55.0	53.0					15																	43663583		1998	4169	6167	SO:0001583	missense	27229				G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton	g.chr15:43663583G>A	AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.31G>A	15.37:g.43663583G>A	ENSP00000260383:p.Gly11Arg		OREG0023087	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	918	ZSCAN29_uc001zrj.1_5'Flank|ZSCAN29_uc001zrk.1_5'Flank|ZSCAN29_uc010bdf.1_5'Flank|ZSCAN29_uc001zrl.1_5'Flank|ZSCAN29_uc010bdg.1_5'Flank|ZSCAN29_uc001zrm.2_5'Flank|TUBGCP4_uc001zrn.2_Missense_Mutation_p.G11R	p.G11R	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN		GBM - Glioblastoma multiforme(94;3.53e-07)	1	271	+		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)	11					B3KNK6|Q969X3|Q9NVF0	Missense_Mutation	SNP	ENST00000260383.7	37	c.31G>A		.	.	.	.	.	.	.	.	.	.	G	35	5.426594	0.96131	.	.	ENSG00000137822	ENST00000260383	T	0.60548	0.18	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.76278	0.3965	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.78884	-0.2028	10	0.87932	D	0	-15.073	17.287	0.87145	0.0:0.0:1.0:0.0	.	11;11	Q9UGJ1;Q9UGJ1-2	GCP4_HUMAN;.	R	11	ENSP00000260383:G11R	ENSP00000260383:G11R	G	+	1	0	TUBGCP4	41450875	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	6.487000	0.73633	2.740000	0.93945	0.313000	0.20887	GGG		0.652	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000432970.1	NM_014444		27	45	0	0	0	0.007291	0	27	45				
ATP8B4	79895	broad.mit.edu	37	15	50152668	50152668	+	Missense_Mutation	SNP	C	C	A	rs142334062		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:50152668C>A	ENST00000284509.6	-	28	3443	c.3302G>T	c.(3301-3303)cGc>cTc	p.R1101L	ATP8B4_ENST00000559829.1_Missense_Mutation_p.R1101L	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	1101						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CTGCCACCGGCGGATCTGGAG	0.498																																							uc001zxu.2		NA																	0				skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(3301-3303)CGC>CTC		ATPase class I type 8B member 4							58.0	58.0	58.0					15																	50152668		2195	4292	6487	SO:0001583	missense	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50152668C>A	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.3302G>T	15.37:g.50152668C>A	ENSP00000284509:p.Arg1101Leu					ATP8B4_uc010ber.2_Missense_Mutation_p.R974L|ATP8B4_uc010ufd.1_Missense_Mutation_p.R911L|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Missense_Mutation_p.R104L	p.R1101L	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	28	3444	-		all_lung(180;0.00183)	1101			Cytoplasmic (Potential).		Q9H727	Missense_Mutation	SNP	ENST00000284509.6	37	c.3302G>T	CCDS32238.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371578	0.61624	.	.	ENSG00000104043	ENST00000284509	T	0.59083	0.29	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.74906	0.3778	M	0.70787	2.145	0.58432	D	0.999998	D;B	0.89917	1.0;0.01	D;B	0.79784	0.993;0.014	T	0.75944	-0.3139	10	0.51188	T	0.08	.	16.52	0.84311	0.0:1.0:0.0:0.0	.	179;1101	Q6PG43;Q8TF62	.;AT8B4_HUMAN	L	1101	ENSP00000284509:R1101L	ENSP00000284509:R1101L	R	-	2	0	ATP8B4	47939960	1.000000	0.71417	0.999000	0.59377	0.654000	0.38779	6.403000	0.73264	2.486000	0.83907	0.455000	0.32223	CGC		0.498	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		30	121	1	0	3.1745e-13	0.008361	6.1862e-13	30	121				
ATP8B4	79895	broad.mit.edu	37	15	50152670	50152670	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:50152670G>A	ENST00000284509.6	-	28	3441	c.3300C>T	c.(3298-3300)atC>atT	p.I1100I	ATP8B4_ENST00000559829.1_Silent_p.I1100I	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	1100						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GCCACCGGCGGATCTGGAGAG	0.498																																							uc001zxu.2		NA																	0				skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(3298-3300)ATC>ATT		ATPase class I type 8B member 4							56.0	56.0	56.0					15																	50152670		2195	4292	6487	SO:0001819	synonymous_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50152670G>A	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.3300C>T	15.37:g.50152670G>A						ATP8B4_uc010ber.2_Silent_p.I973I|ATP8B4_uc010ufd.1_Silent_p.I910I|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Silent_p.I103I	p.I1100I	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	28	3442	-		all_lung(180;0.00183)	1100			Cytoplasmic (Potential).		Q9H727	Silent	SNP	ENST00000284509.6	37	c.3300C>T	CCDS32238.1																																																																																				0.498	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		30	119	0	0	0	0.00632	0	30	119				
IGDCC4	57722	broad.mit.edu	37	15	65677380	65677380	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:65677380G>T	ENST00000352385.2	-	19	3463	c.3254C>A	c.(3253-3255)cCc>cAc	p.P1085H	IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	1085						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						AGCCGGCCGGGGGCCTGCCTG	0.672											OREG0023195	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002aou.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(3253-3255)CCC>CAC		immunoglobulin superfamily, DCC subclass, member							20.0	26.0	24.0					15																	65677380		2128	4255	6383	SO:0001583	missense	57722					integral to membrane|plasma membrane		g.chr15:65677380G>T		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.3254C>A	15.37:g.65677380G>T	ENSP00000319623:p.Pro1085His		OREG0023195	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1086	IGDCC4_uc002aot.1_Missense_Mutation_p.P673H	p.P1085H	NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN			19	3464	-			1085			Cytoplasmic (Potential).		Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	c.3254C>A	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673176	0.67928	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.59364	0.27	5.23	5.23	0.72850	.	0.326711	0.26414	N	0.024512	T	0.49201	0.1543	L	0.40543	1.245	0.09310	N	1	P	0.51791	0.948	B	0.43155	0.41	T	0.46345	-0.9198	10	0.13470	T	0.59	-8.6787	15.9369	0.79717	0.0:0.0:1.0:0.0	.	1085	Q8TDY8	IGDC4_HUMAN	H	1085;814	ENSP00000319623:P1085H	ENSP00000319623:P1085H	P	-	2	0	IGDCC4	63464433	0.980000	0.34600	0.958000	0.39756	0.818000	0.46254	2.010000	0.40913	2.444000	0.82710	0.561000	0.74099	CCC		0.672	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962		19	57	1	0	2.5808e-16	0.006122	5.36322e-16	19	57				
ALPK3	57538	broad.mit.edu	37	15	85401453	85401453	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:85401453G>C	ENST00000258888.5	+	6	4257	c.4090G>C	c.(4090-4092)Ggg>Cgg	p.G1364R		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1364			G -> E (in a metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ACTGGCTCTAGGGGCCCGGAG	0.627																																							uc002ble.2		NA																	0		p.G1364E(1)		stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12						c.(4090-4092)GGG>CGG		alpha-kinase 3							17.0	22.0	20.0					15																	85401453		2203	4298	6501	SO:0001583	missense	57538				heart development	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr15:85401453G>C	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4090G>C	15.37:g.85401453G>C	ENSP00000258888:p.Gly1364Arg						p.G1364R	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		6	4257	+			1364		G -> E (in a metastatic melanoma sample; somatic mutation).			Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	c.4090G>C	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	g	26.3	4.721714	0.89298	.	.	ENSG00000136383	ENST00000258888	D	0.86432	-2.12	5.79	5.79	0.91817	.	0.274718	0.36703	N	0.002444	D	0.92779	0.7704	M	0.71581	2.175	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	D	0.93010	0.6431	10	0.72032	D	0.01	-29.7261	15.5415	0.76052	0.0:0.0:1.0:0.0	.	1364	Q96L96	ALPK3_HUMAN	R	1364	ENSP00000258888:G1364R	ENSP00000258888:G1364R	G	+	1	0	ALPK3	83202457	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.895000	0.69814	2.742000	0.94016	0.558000	0.71614	GGG		0.627	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		11	18	0	0	0	0.013537	0	11	18				
BLM	641	broad.mit.edu	37	15	91341491	91341491	+	Silent	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:91341491A>G	ENST00000355112.3	+	17	3400	c.3282A>G	c.(3280-3282)tcA>tcG	p.S1094S	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Silent_p.S1094S	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	1094					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ATAGTTCATCACAAGGAATGA	0.318			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														uc002bpr.2		NA	yes	Rec		Bloom Syndrome	15	15q26.1	641	Mis|N|F	Bloom Syndrome			"""L, E"""		leukemia|lymphoma|skin squamous cell |other cancers			0				ovary(3)|skin(2)|breast(1)	6						c.(3280-3282)TCA>TCG	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom syndrome protein							122.0	122.0	122.0					15																	91341491		2198	4296	6494	SO:0001819	synonymous_variant	641	Bloom_syndrome	Familial Cancer Database		double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding	g.chr15:91341491A>G	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.3282A>G	15.37:g.91341491A>G						BLM_uc010uqh.1_Silent_p.S1094S|BLM_uc010uqi.1_Silent_p.S719S|BLM_uc010bnx.2_Silent_p.S1094S|BLM_uc002bpt.2_Silent_p.S69S	p.S1094S	NM_000057	NP_000048	P54132	BLM_HUMAN	Lung(145;0.189)		17	3379	+	Lung NSC(78;0.0875)|all_lung(78;0.109)		1094					Q52M96	Silent	SNP	ENST00000355112.3	37	c.3282A>G	CCDS10363.1																																																																																				0.318	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			62	79	0	0	0	0.01441	0	62	79				
BAIAP3	8938	broad.mit.edu	37	16	1395019	1395019	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:1395019C>T	ENST00000324385.5	+	21	2122	c.1964C>T	c.(1963-1965)aCc>aTc	p.T655I	BAIAP3_ENST00000397489.1_Missense_Mutation_p.T637I|BAIAP3_ENST00000562208.1_Missense_Mutation_p.T597I|BAIAP3_ENST00000426824.3_Missense_Mutation_p.T620I|BAIAP3_ENST00000397488.2_Missense_Mutation_p.T637I|BAIAP3_ENST00000421665.2_Missense_Mutation_p.T584I|BAIAP3_ENST00000568887.1_Missense_Mutation_p.T592I	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	655					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CCCAAGATGACCCTGGAGGTG	0.657																																							uc002clk.1		NA																	0				pancreas(1)	1						c.(1963-1965)ACC>ATC		BAI1-associated protein 3							58.0	59.0	59.0					16																	1395019		2199	4300	6499	SO:0001583	missense	8938				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding	g.chr16:1395019C>T	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1964C>T	16.37:g.1395019C>T	ENSP00000324510:p.Thr655Ile					BAIAP3_uc002clj.2_Missense_Mutation_p.T637I|BAIAP3_uc010uuz.1_Missense_Mutation_p.T620I|BAIAP3_uc010uva.1_Missense_Mutation_p.T592I|BAIAP3_uc010uvc.1_Missense_Mutation_p.T584I	p.T655I	NM_003933	NP_003924	O94812	BAIP3_HUMAN			21	1964	+		Hepatocellular(780;0.0893)	655					A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	c.1964C>T	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	C	6.653	0.488987	0.12641	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.72394	-0.64;-0.64;-0.65;-0.64;-0.63	4.42	0.49	0.16861	.	0.467935	0.23157	N	0.051297	T	0.53498	0.1800	L	0.38175	1.15	0.24484	N	0.994338	P;P;B;B	0.39717	0.684;0.679;0.418;0.418	B;B;B;B	0.36289	0.221;0.202;0.1;0.109	T	0.46693	-0.9173	10	0.46703	T	0.11	-28.0924	6.9713	0.24650	0.358:0.4953:0.1468:0.0	.	584;597;655;637	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	I	620;637;655;637;584	ENSP00000407242:T620I;ENSP00000380625:T637I;ENSP00000324510:T655I;ENSP00000380626:T637I;ENSP00000409533:T584I	ENSP00000324510:T655I	T	+	2	0	BAIAP3	1335020	0.012000	0.17670	0.066000	0.19879	0.186000	0.23388	0.055000	0.14229	0.244000	0.21351	0.436000	0.28706	ACC		0.657	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3			41	54	0	0	0	0.00874	0	41	54				
MLST8	64223	broad.mit.edu	37	16	2256104	2256104	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:2256104C>A	ENST00000569417.1	+	2	372	c.18C>A	c.(16-18)ggC>ggA	p.G6G	MLST8_ENST00000564088.1_Silent_p.G6G|MLST8_ENST00000301725.7_Silent_p.G25G|MLST8_ENST00000565250.1_Silent_p.G6G|MLST8_ENST00000382450.4_Silent_p.G6G|MLST8_ENST00000301724.10_Silent_p.G6G|MLST8_ENST00000561651.1_3'UTR|MLST8_ENST00000397124.1_Silent_p.G6G|AC009065.3_ENST00000517149.1_RNA	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	6					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				large_intestine(3)|lung(2)|skin(1)	6						CCTCCCCAGGCACGGTGGGCA	0.632																																							uc002coz.2		NA																	0					0						c.(16-18)GGC>GGA		G protein beta subunit-like																																				SO:0001819	synonymous_variant	64223				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding	g.chr16:2256104C>A		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.18C>A	16.37:g.2256104C>A						MLST8_uc002coy.2_Silent_p.G6G|MLST8_uc002cpa.2_5'UTR|MLST8_uc002cpb.2_Silent_p.G6G|MLST8_uc010uvx.1_5'UTR|MLST8_uc002cpc.2_Silent_p.G6G|MLST8_uc002cpd.2_5'UTR|MLST8_uc002cpe.2_Silent_p.G6G|MLST8_uc010uvy.1_Silent_p.G6G|MLST8_uc002cpg.2_Silent_p.G25G|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Silent_p.G6G	p.G6G	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN			2	137	+			6			WD 1.		B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Silent	SNP	ENST00000569417.1	37	c.18C>A	CCDS10462.2																																																																																				0.632	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2	NM_022372		13	203	1	0	1.15088e-07	0.004007	2.03411e-07	13	203				
TIGD7	91151	broad.mit.edu	37	16	3349590	3349590	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:3349590T>C	ENST00000396862.1	-	2	2853	c.1025A>G	c.(1024-1026)tAt>tGt	p.Y342C	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Missense_Mutation_p.Y342C	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	342	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						CTTCCATCTATACAGCCGTTT	0.368																																							uc002cus.2		NA																	0					0						c.(1024-1026)TAT>TGT		tigger transposable element derived 7							56.0	59.0	58.0					16																	3349590		2197	4300	6497	SO:0001583	missense	91151				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr16:3349590T>C	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1025A>G	16.37:g.3349590T>C	ENSP00000380071:p.Tyr342Cys					ZNF263_uc002cur.2_3'UTR	p.Y342C	NM_033208	NP_149985	Q6NT04	TIGD7_HUMAN			1	1811	-			342			DDE.		Q9BXZ0	Missense_Mutation	SNP	ENST00000396862.1	37	c.1025A>G	CCDS10500.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.069905	0.36566	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.64260	-0.09;-0.09	4.85	4.85	0.62838	.	0.000000	0.36665	U	0.002470	T	0.77922	0.4203	M	0.81341	2.54	0.29877	N	0.826312	D	0.89917	1.0	D	0.79108	0.992	T	0.76793	-0.2828	10	0.87932	D	0	.	10.8334	0.46673	0.0:0.0:0.0:1.0	.	342	Q6NT04	TIGD7_HUMAN	C	342	ENSP00000380071:Y342C;ENSP00000268674:Y342C	ENSP00000268674:Y342C	Y	-	2	0	TIGD7	3289591	0.996000	0.38824	0.977000	0.42913	0.624000	0.37722	1.507000	0.35758	1.824000	0.53156	0.533000	0.62120	TAT		0.368	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251465.1	NM_033208		30	95	0	0	0	0.007291	0	30	95				
DNAJA3	9093	broad.mit.edu	37	16	4494686	4494686	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:4494686T>A	ENST00000262375.6	+	7	1030	c.953T>A	c.(952-954)gTg>gAg	p.V318E	DNAJA3_ENST00000431375.2_Missense_Mutation_p.V165E|DNAJA3_ENST00000355296.4_Missense_Mutation_p.V318E	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	318					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						GGCCAGACCGTGAGGATGCCT	0.567																																							uc002cwk.2		NA																	0				ovary(2)|breast(2)	4						c.(952-954)GTG>GAG		DnaJ (Hsp40) homolog, subfamily A, member 3							137.0	90.0	106.0					16																	4494686		2197	4300	6497	SO:0001583	missense	9093				activation of caspase activity|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of cell proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein kinase activity|neuromuscular junction development|positive regulation of apoptosis|positive regulation of protein ubiquitination|protein folding|protein folding|protein stabilization|response to heat|response to interferon-gamma	cytosol|mitochondrial matrix|mitochondrial nucleoid|nucleus	ATP binding|heat shock protein binding|interferon-gamma receptor binding|metal ion binding|NF-kappaB binding|protein kinase binding	g.chr16:4494686T>A	AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.953T>A	16.37:g.4494686T>A	ENSP00000262375:p.Val318Glu					DNAJA3_uc002cwl.2_Missense_Mutation_p.V318E|DNAJA3_uc010uxk.1_Missense_Mutation_p.V165E	p.V318E	NM_005147	NP_005138	Q96EY1	DNJA3_HUMAN			7	978	+			318					B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	ENST00000262375.6	37	c.953T>A	CCDS10515.1	.	.	.	.	.	.	.	.	.	.	T	30	5.053903	0.93793	.	.	ENSG00000103423	ENST00000262375;ENST00000355296;ENST00000431375	T;T;T	0.66995	-0.24;-0.23;0.78	5.51	5.51	0.81932	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	D	0.86070	0.5845	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.987	D	0.89739	0.3932	10	0.87932	D	0	-17.7242	14.7875	0.69813	0.0:0.0:0.0:1.0	.	165;318;318	E7ES32;Q96EY1-2;Q96EY1	.;.;DNJA3_HUMAN	E	318;318;165	ENSP00000262375:V318E;ENSP00000347445:V318E;ENSP00000393970:V165E	ENSP00000262375:V318E	V	+	2	0	DNAJA3	4434687	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.633000	0.83260	2.078000	0.62432	0.459000	0.35465	GTG		0.567	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1			13	55	0	0	0	0.00245	0	13	55				
EEF2K	29904	broad.mit.edu	37	16	22262545	22262545	+	Nonsense_Mutation	SNP	G	G	T	rs148576611		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:22262545G>T	ENST00000263026.5	+	6	994	c.520G>T	c.(520-522)Gag>Tag	p.E174*		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	174	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		GCGCTACATCGAGCCCGTAGA	0.592																																					NSCLC(195;1411 2157 20319 27471 51856)	NSCLC(195;1411 2157 20319 27471 51856)	uc002dki.2		NA																	0				large_intestine(1)	1						c.(520-522)GAG>TAG		elongation factor-2 kinase							115.0	101.0	106.0					16																	22262545		2197	4300	6497	SO:0001587	stop_gained	29904				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding	g.chr16:22262545G>T	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.520G>T	16.37:g.22262545G>T	ENSP00000263026:p.Glu174*					EEF2K_uc002dkh.2_RNA	p.E174*	NM_013302	NP_037434	O00418	EF2K_HUMAN		GBM - Glioblastoma multiforme(48;0.0223)	6	1005	+			174			Alpha-type protein kinase.		Q8N588	Nonsense_Mutation	SNP	ENST00000263026.5	37	c.520G>T	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	G	38	6.864790	0.97897	.	.	ENSG00000103319	ENST00000263026	.	.	.	5.43	4.48	0.54585	.	0.045411	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-15.6546	13.9083	0.63850	0.0733:0.0:0.9267:0.0	.	.	.	.	X	174	.	ENSP00000263026:E174X	E	+	1	0	EEF2K	22170046	1.000000	0.71417	0.678000	0.29963	0.240000	0.25518	6.360000	0.73064	1.299000	0.44798	0.462000	0.41574	GAG		0.592	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302		29	145	1	0	7.26314e-15	0.007291	1.4692e-14	29	145				
PALB2	79728	broad.mit.edu	37	16	23632700	23632700	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:23632700C>A	ENST00000261584.4	-	10	3248	c.3096G>T	c.(3094-3096)atG>atT	p.M1032I	CTD-2196E14.3_ENST00000561764.1_RNA	NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1032	Interaction with RAD51, BRCA2 and POLH.|Required for interaction with POLH and POLH DNA synthesis stimulation.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		CAATGTTGTTCATAATAGTAG	0.408			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																															uc002dlx.1		NA	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	F|N|Mis	partner and localizer of BRCA2			"""L, O, E"""		Wilms tumor|medulloblastoma|AML ,breast			0				lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11						c.(3094-3096)ATG>ATT	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	partner and localizer of BRCA2							100.0	94.0	96.0					16																	23632700		2197	4300	6497	SO:0001583	missense	79728	FanconAnemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of			double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding	g.chr16:23632700C>A		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.3096G>T	16.37:g.23632700C>A	ENSP00000261584:p.Met1032Ile						p.M1032I	NM_024675	NP_078951	Q86YC2	PALB2_HUMAN		GBM - Glioblastoma multiforme(48;0.0167)	10	3296	-			1032			Interaction with RAD51 and BRCA2.|WD 4.		A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	c.3096G>T	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647651	0.29246	.	.	ENSG00000083093	ENST00000261584	T	0.28666	1.6	5.31	4.3	0.51218	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.379178	0.29609	N	0.011673	T	0.30355	0.0762	M	0.65975	2.015	0.25308	N	0.989228	B	0.26195	0.144	B	0.21708	0.036	T	0.10497	-1.0627	10	0.28530	T	0.3	-3.3152	11.8038	0.52143	0.1748:0.8252:0.0:0.0	.	1032	Q86YC2	PALB2_HUMAN	I	1032	ENSP00000261584:M1032I	ENSP00000261584:M1032I	M	-	3	0	PALB2	23540201	0.986000	0.35501	0.991000	0.47740	0.840000	0.47671	1.929000	0.40114	2.632000	0.89209	0.455000	0.32223	ATG		0.408	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675		13	73	1	0	1.5739e-10	0.004007	2.91747e-10	13	73				
ZNF646	9726	broad.mit.edu	37	16	31087950	31087950	+	Missense_Mutation	SNP	G	G	T	rs143373931	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:31087950G>T	ENST00000394979.2	+	1	728	c.305G>T	c.(304-306)cGc>cTc	p.R102L	ZNF646_ENST00000300850.5_Missense_Mutation_p.R102L|ZNF668_ENST00000564456.1_5'Flank|ZNF668_ENST00000300849.4_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCTGAGGGCCGCCGCAGGCAC	0.612																																							uc002eap.2		NA																	0				breast(2)	2						c.(304-306)CGC>CTC		zinc finger protein 646							39.0	37.0	38.0					16																	31087950		2197	4300	6497	SO:0001583	missense	9726				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr16:31087950G>T	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.305G>T	16.37:g.31087950G>T	ENSP00000378429:p.Arg102Leu					ZNF668_uc002eao.2_5'Flank	p.R102L	NM_014699	NP_055514	O15015	ZN646_HUMAN			2	594	+			102					Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37	c.305G>T		.	.	.	.	.	.	.	.	.	.	G	14.19	2.460122	0.43736	.	.	ENSG00000167395	ENST00000428260;ENST00000300850;ENST00000394979	T;T;T	0.08370	3.37;3.1;3.11	5.65	2.64	0.31445	.	.	.	.	.	T	0.11495	0.0280	L	0.27053	0.805	0.27042	N	0.963987	D	0.56746	0.977	P	0.55303	0.773	T	0.18241	-1.0343	9	0.38643	T	0.18	-6.6766	9.7986	0.40751	0.2185:0.0:0.7815:0.0	.	102	O15015-2	.	L	102	ENSP00000391271:R102L;ENSP00000300850:R102L;ENSP00000378429:R102L	ENSP00000300850:R102L	R	+	2	0	ZNF646	30995451	0.662000	0.27439	0.940000	0.37924	0.966000	0.64601	1.239000	0.32719	0.318000	0.23185	-0.251000	0.11542	CGC		0.612	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699		24	65	1	0	6.21321e-17	0.00278	1.29625e-16	24	65				
SLC6A10P	386757	broad.mit.edu	37	16	32891042	32891042	+	RNA	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:32891042C>A	ENST00000330048.5	-	0	2925					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		ACATCCCACCCTGGGGGACAG	0.602																																							uc002edh.1		NA																	0					0						c.e3-1		RecName: Full=Transporter;																																						386757							g.chr16:32891042C>A	U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32891042C>A						SLC6A10P_uc002edi.1_Splice_Site	p.G5_splice							3	189	-									Splice_Site	SNP	ENST00000330048.5	37	c.13_splice																																																																																					0.602	SLC6A10P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000432081.2			68	77	1	0	2.40982e-25	0.01441	5.40938e-25	68	77				
CES5A	221223	broad.mit.edu	37	16	55903558	55903558	+	Silent	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:55903558G>T	ENST00000290567.9	-	4	637	c.516C>A	c.(514-516)gtC>gtA	p.V172V	CES5A_ENST00000521992.1_Silent_p.V201V|CES5A_ENST00000518005.1_Silent_p.V66V|CES5A_ENST00000520435.1_Silent_p.V142V|CES5A_ENST00000541580.1_Intron|CES5A_ENST00000319165.9_Silent_p.V172V	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	172						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						GGTACTGGACGACCACAACCA	0.547																																							uc002eip.2		NA																	0					0						c.(514-516)GTC>GTA		carboxylesterase 7 isoform 1							77.0	58.0	64.0					16																	55903558		2198	4300	6498	SO:0001819	synonymous_variant	221223					extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity	g.chr16:55903558G>T	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.516C>A	16.37:g.55903558G>T						CES7_uc002eio.2_Silent_p.V172V|CES7_uc002eiq.2_5'UTR|CES7_uc002eir.2_Silent_p.V66V	p.V172V	NM_001143685	NP_001137157	Q6NT32	EST5A_HUMAN		all cancers(182;0.229)|Epithelial(162;0.231)	4	665	-			172					B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Silent	SNP	ENST00000290567.9	37	c.516C>A	CCDS45490.1																																																																																				0.547	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024		30	34	1	0	5.8336e-16	0.003271	1.2029e-15	30	34				
NLRC5	84166	broad.mit.edu	37	16	57111271	57111271	+	Silent	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:57111271G>T	ENST00000262510.6	+	41	5124	c.4899G>T	c.(4897-4899)ctG>ctT	p.L1633L	NLRC5_ENST00000308149.7_Silent_p.L1604L|NLRC5_ENST00000539144.1_Silent_p.L1604L|NLRC5_ENST00000436936.1_3'UTR	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1633					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				TGCCTGGGCTGCCAGAGCTCA	0.582																																							uc002ekk.1		NA																	0				ovary(4)|skin(2)|breast(1)	7						c.(4897-4899)CTG>CTT		nucleotide-binding oligomerization domains 27							62.0	53.0	56.0					16																	57111271		2198	4300	6498	SO:0001819	synonymous_variant	84166				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	g.chr16:57111271G>T	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4899G>T	16.37:g.57111271G>T						NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekq.1_Silent_p.L175L|NLRC5_uc002ekr.1_Silent_p.L520L	p.L1633L	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN			41	5124	+		all_neural(199;0.225)	1633			LRR 21.		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	37	c.4899G>T	CCDS10773.1																																																																																				0.582	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		29	51	1	0	1.06801e-11	0.009535	2.0365e-11	29	51				
DPEP2	64174	broad.mit.edu	37	16	68024723	68024723	+	Splice_Site	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:68024723C>A	ENST00000572888.1	-	6	1560		c.e6+1		DPEP2_ENST00000393847.1_Splice_Site|DPEP2_ENST00000412757.2_Splice_Site			Q9H4A9	DPEP2_HUMAN	dipeptidase 2						arachidonic acid metabolic process (GO:0019369)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		CAGTTTCTCACCAGAAGCTGC	0.572																																							uc010cey.2		NA																	0				skin(1)	1						c.e6+1		dipeptidase 2 precursor							119.0	120.0	120.0					16																	68024723		2198	4300	6498	SO:0001630	splice_region_variant	64174				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity	g.chr16:68024723C>A	AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261	3.4.13.19		23028	protein-coding gene	gene with protein product		609925					Standard	NM_022355		Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.909+1G>T	16.37:g.68024723C>A						DPEP2_uc002evd.3_Splice_Site_p.L303_splice|DPEP2_uc002eve.2_Splice_Site_p.L303_splice|DPEP2_uc002evf.2_Splice_Site	p.L303_splice	NM_022355	NP_071750	Q9H4A9	DPEP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)	6	1073	-		Ovarian(137;0.192)						B2RCF8|Q6UX92|Q8TC95	Splice_Site	SNP	ENST00000572888.1	37	c.909_splice	CCDS10857.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535987	0.85812	.	.	ENSG00000167261	ENST00000393847;ENST00000412757;ENST00000322384	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8153	0.78595	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPEP2	66582224	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.082000	0.76851	2.673000	0.90976	0.650000	0.86243	.		0.572	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437026.1	NM_022355	Intron	171	188	1	0	9.33601e-71	0.01441	2.65602e-70	171	188				
CHST6	4166	broad.mit.edu	37	16	75513122	75513122	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr16:75513122C>A	ENST00000332272.4	-	3	784	c.605G>T	c.(604-606)cGc>cTc	p.R202L	RP11-77K12.4_ENST00000530512.3_RNA|CHST6_ENST00000390664.2_Missense_Mutation_p.R202L	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	202			R -> S (in MCDC1). {ECO:0000269|PubMed:14735064}.		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CCGCGGGTCGCGCACCAGGTG	0.687																																							uc002fef.2		NA																	0					0						c.(604-606)CGC>CTC		carbohydrate (N-acetylglucosamine 6-O)							26.0	27.0	27.0					16																	75513122		2193	4293	6486	SO:0001583	missense	4166				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr16:75513122C>A	AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.605G>T	16.37:g.75513122C>A	ENSP00000328983:p.Arg202Leu					CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.R202L	p.R202L	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN			3	785	-			202		R -> S (in MCD).	PAPS (By similarity).|Lumenal (Potential).		D3DUK3	Missense_Mutation	SNP	ENST00000332272.4	37	c.605G>T	CCDS10918.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230205	0.79688	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	D;D	0.99980	-10.28;-10.28	4.68	4.68	0.58851	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.99977	0.9993	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96468	0.9346	10	0.87932	D	0	.	15.0725	0.72049	0.0:1.0:0.0:0.0	.	202	Q9GZX3	CHST6_HUMAN	L	202	ENSP00000328983:R202L;ENSP00000375079:R202L	ENSP00000328983:R202L	R	-	2	0	CHST6	74070623	1.000000	0.71417	0.994000	0.49952	0.563000	0.35712	7.671000	0.83941	2.132000	0.65825	0.591000	0.81541	CGC		0.687	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435478.1	NM_021615		46	58	1	0	8.01111e-26	0.010771	1.81358e-25	46	58				
POLR2A	5430	broad.mit.edu	37	17	7406556	7406556	+	Missense_Mutation	SNP	G	G	C	rs565133398		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:7406556G>C	ENST00000322644.6	+	17	3272	c.2873G>C	c.(2872-2874)cGg>cCg	p.R958P		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	958					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GAATTTGAGCGGATGCGGGAG	0.602																																							uc002ghf.3		NA																	0				pancreas(1)	1						c.(2872-2874)CGG>CCG		DNA-directed RNA polymerase II A							125.0	121.0	122.0					17																	7406556		2203	4300	6503	SO:0001583	missense	5430				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding	g.chr17:7406556G>C			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2873G>C	17.37:g.7406556G>C	ENSP00000314949:p.Arg958Pro						p.R958P	NM_000937	NP_000928	P24928	RPB1_HUMAN			17	3107	+		Prostate(122;0.173)	958					A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	c.2873G>C	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941258	0.53079	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.68479	-0.33	5.25	4.24	0.50183	RNA polymerase Rpb1, domain 6 (1);RNA polymerase Rpb1, domain 5 (1);	0.196922	0.43747	D	0.000535	T	0.73016	0.3533	M	0.73962	2.25	0.80722	D	1	P	0.47350	0.894	P	0.54210	0.745	T	0.75062	-0.3450	10	0.72032	D	0.01	-6.1686	6.7545	0.23505	0.2797:0.0:0.7203:0.0	.	958	P24928	RPB1_HUMAN	P	914;958	ENSP00000314949:R958P	ENSP00000314949:R958P	R	+	2	0	SLC35G6	7347280	1.000000	0.71417	0.985000	0.45067	0.959000	0.62525	3.288000	0.51739	1.493000	0.48517	-0.345000	0.07892	CGG		0.602	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937		30	83	0	0	0	0.010818	0	30	83				
NOS2	4843	broad.mit.edu	37	17	26114788	26114788	+	Missense_Mutation	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:26114788C>G	ENST00000313735.6	-	5	616	c.383G>C	c.(382-384)gGa>gCa	p.G128A		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	128					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GTCCCTGGGTCCTCTGGTCAA	0.498																																							uc002gzu.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(382-384)GGA>GCA		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						154.0	158.0	157.0					17																	26114788		2203	4300	6503	SO:0001583	missense	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26114788C>G	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.383G>C	17.37:g.26114788C>G	ENSP00000327251:p.Gly128Ala					NOS2_uc010crh.1_Missense_Mutation_p.G128A|NOS2_uc010wab.1_Missense_Mutation_p.G128A	p.G128A	NM_000625	NP_000616	P35228	NOS2_HUMAN			5	647	-			128					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	c.383G>C	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	C	9.434	1.086369	0.20390	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.22945	1.93	5.64	4.67	0.58626	Nitric oxide synthase, oxygenase domain (2);	0.125815	0.52532	D	0.000075	T	0.21590	0.0520	M	0.62723	1.935	0.35250	D	0.778619	B;P	0.39748	0.01;0.686	B;B	0.30105	0.01;0.111	T	0.28170	-1.0052	10	0.12103	T	0.63	.	13.8047	0.63223	0.0:0.9265:0.0:0.0735	.	128;128	F8WEM3;P35228	.;NOS2_HUMAN	A	128	ENSP00000327251:G128A	ENSP00000305638:G128A	G	-	2	0	NOS2	23138915	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.798000	0.47884	1.400000	0.46741	0.557000	0.71058	GGA		0.498	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		138	150	0	0	0	0.01441	0	138	150				
KRT37	8688	broad.mit.edu	37	17	39578346	39578346	+	Missense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:39578346A>T	ENST00000225550.3	-	5	994	c.995T>A	c.(994-996)gTg>gAg	p.V332E	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	332	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				TTGGCGCTCCACCTCCAGGGC	0.582																																							uc002hwp.1		NA																	0				skin(1)	1						c.(994-996)GTG>GAG		keratin 37							173.0	130.0	144.0					17																	39578346		2203	4298	6501	SO:0001583	missense	8688					intermediate filament	structural molecule activity	g.chr17:39578346A>T	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.995T>A	17.37:g.39578346A>T	ENSP00000225550:p.Val332Glu					uc002hwo.1_Intron	p.V332E	NM_003770	NP_003761	O76014	KRT37_HUMAN			5	1042	-		Breast(137;0.000496)	332			Coil 2.|Rod.			Missense_Mutation	SNP	ENST00000225550.3	37	c.995T>A	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082001	0.76528	.	.	ENSG00000108417	ENST00000225550	D	0.89196	-2.48	4.87	3.75	0.43078	Filament (1);	0.203139	0.25616	N	0.029446	D	0.92980	0.7766	M	0.85373	2.75	0.31194	N	0.70058	D	0.60160	0.987	P	0.59357	0.856	D	0.91588	0.5284	10	0.87932	D	0	.	9.4617	0.38789	0.8131:0.1869:0.0:0.0	.	332	O76014	KRT37_HUMAN	E	332	ENSP00000225550:V332E	ENSP00000225550:V332E	V	-	2	0	KRT37	36831872	0.696000	0.27757	0.998000	0.56505	0.996000	0.88848	2.514000	0.45503	0.681000	0.31386	0.533000	0.62120	GTG		0.582	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770		32	126	0	0	0	0.003271	0	32	126				
KRT37	8688	broad.mit.edu	37	17	39580632	39580632	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:39580632G>T	ENST00000225550.3	-	1	143	c.144C>A	c.(142-144)aaC>aaA	p.N48K	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	48	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				CGTGTGCCACGTTGGCCAAGA	0.617																																							uc002hwp.1		NA																	0				skin(1)	1						c.(142-144)AAC>AAA		keratin 37							50.0	50.0	50.0					17																	39580632		2203	4300	6503	SO:0001583	missense	8688					intermediate filament	structural molecule activity	g.chr17:39580632G>T	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.144C>A	17.37:g.39580632G>T	ENSP00000225550:p.Asn48Lys					uc002hwo.1_RNA	p.N48K	NM_003770	NP_003761	O76014	KRT37_HUMAN			1	191	-		Breast(137;0.000496)	48			Head.			Missense_Mutation	SNP	ENST00000225550.3	37	c.144C>A	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	.	11.60	1.687494	0.29962	.	.	ENSG00000108417	ENST00000225550	T	0.81163	-1.46	4.0	-3.8	0.04307	.	0.594677	0.15015	N	0.285351	T	0.63271	0.2497	L	0.34521	1.04	0.09310	N	1	B	0.31026	0.304	B	0.23716	0.048	T	0.53085	-0.8488	10	0.72032	D	0.01	.	6.6221	0.22808	0.4974:0.1248:0.3777:0.0	.	48	O76014	KRT37_HUMAN	K	48	ENSP00000225550:N48K	ENSP00000225550:N48K	N	-	3	2	KRT37	36834158	0.000000	0.05858	0.007000	0.13788	0.078000	0.17371	-0.158000	0.10070	-0.665000	0.05317	-0.794000	0.03295	AAC		0.617	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770		31	83	1	0	1.39806e-14	0.008361	2.81729e-14	31	83				
ABI3	51225	broad.mit.edu	37	17	47299962	47299962	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:47299962T>A	ENST00000225941.1	+	8	1484	c.986T>A	c.(985-987)tTc>tAc	p.F329Y	ABI3_ENST00000419580.2_Missense_Mutation_p.F323Y	NM_001135186.1|NM_016428.2	NP_001128658.1|NP_057512	Q9P2A4	ABI3_HUMAN	ABI family, member 3	329	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular component movement (GO:0006928)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	12			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GAGCTCTCCTTCTCTGAGGGC	0.577										HNSCC(55;0.14)																													uc002iop.1		NA																	0					0						c.(985-987)TTC>TAC		NESH protein isoform 1							132.0	93.0	106.0					17																	47299962		2203	4300	6503	SO:0001583	missense	51225				cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding	g.chr17:47299962T>A	AB037886	CCDS11546.1, CCDS45725.1	17q21.3	2011-03-04	2008-09-12		ENSG00000108798	ENSG00000108798			29859	protein-coding gene	gene with protein product		606363				10978530, 11956071	Standard	NM_001135186		Approved	NESH, SSH3BP3	uc002iop.1	Q9P2A4	OTTHUMG00000161306	ENST00000225941.1:c.986T>A	17.37:g.47299962T>A	ENSP00000225941:p.Phe329Tyr	HNSCC(55;0.14)				ABI3_uc002ioq.1_Missense_Mutation_p.F323Y	p.F329Y	NM_016428	NP_057512	Q9P2A4	ABI3_HUMAN	Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)		8	1484	+			329			SH3.		C9IZN8|Q9H0P6	Missense_Mutation	SNP	ENST00000225941.1	37	c.986T>A	CCDS11546.1	.	.	.	.	.	.	.	.	.	.	T	35	5.435087	0.96150	.	.	ENSG00000108798	ENST00000225941;ENST00000419580	T;T	0.57273	0.41;0.41	5.17	5.17	0.71159	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	D	0.82527	0.5056	H	0.98276	4.19	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	D;D	0.85130	0.995;0.997	D	0.88858	0.3324	10	0.87932	D	0	-26.3601	13.2618	0.60108	0.0:0.0:0.0:1.0	.	323;329	Q9P2A4-2;Q9P2A4	.;ABI3_HUMAN	Y	329;323	ENSP00000225941:F329Y;ENSP00000406651:F323Y	ENSP00000225941:F329Y	F	+	2	0	ABI3	44654961	1.000000	0.71417	0.997000	0.53966	0.885000	0.51271	5.703000	0.68340	1.955000	0.56771	0.379000	0.24179	TTC		0.577	ABI3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364475.1	NM_016428		23	65	0	0	0	0.014323	0	23	65				
DDX42	11325	broad.mit.edu	37	17	61885106	61885106	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:61885106G>T	ENST00000578681.1	+	10	1470	c.869G>T	c.(868-870)gGt>gTt	p.G290V	DDX42_ENST00000583590.1_Missense_Mutation_p.G290V|DDX42_ENST00000359353.5_Missense_Mutation_p.G171V|DDX42_ENST00000457800.2_Missense_Mutation_p.G290V|DDX42_ENST00000389924.2_Missense_Mutation_p.G290V	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	290	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						GCATTAAGTGGTAGAGACATG	0.398																																							uc002jbu.2		NA																	0				ovary(2)|skin(2)|large_intestine(1)	5						c.(868-870)GGT>GTT		DEAD box polypeptide 42 protein							156.0	148.0	151.0					17																	61885106		2203	4300	6503	SO:0001583	missense	11325				protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr17:61885106G>T	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.869G>T	17.37:g.61885106G>T	ENSP00000464050:p.Gly290Val					DDX42_uc002jbv.2_Missense_Mutation_p.G290V|DDX42_uc002jbw.1_Missense_Mutation_p.G26V|DDX42_uc002jbx.2_Missense_Mutation_p.G26V	p.G290V	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN			10	1126	+			290			Helicase ATP-binding.		A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	c.869G>T	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	G	31	5.071627	0.93950	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.19669	2.13;2.13	5.93	5.93	0.95920	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	H	0.99058	4.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81028	-0.1118	10	0.87932	D	0	-18.342	19.3421	0.94347	0.0:0.0:1.0:0.0	.	290	Q86XP3	DDX42_HUMAN	V	290;290;26	ENSP00000374574:G290V;ENSP00000390121:G290V	ENSP00000352308:G26V	G	+	2	0	DDX42	59238838	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	GGT		0.398	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372		88	124	1	0	2.07245e-51	0.01441	5.65408e-51	88	124				
SLC39A11	201266	broad.mit.edu	37	17	71027788	71027788	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:71027788C>A	ENST00000542342.2	-	4	301	c.213G>T	c.(211-213)ggG>ggT	p.G71G	SLC39A11_ENST00000255559.3_Silent_p.G71G|SLC39A11_ENST00000579732.1_Silent_p.G71G	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	71					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						CACCGAAGCCCCCAGAGGACG	0.532																																					NSCLC(95;736 1527 12296 39625 41839)	NSCLC(95;736 1527 12296 39625 41839)	uc002jjb.2		NA																	0				ovary(1)	1						c.(211-213)GGG>GGT		solute carrier family 39, member 11 isoform 1							120.0	108.0	112.0					17																	71027788		2203	4300	6503	SO:0001819	synonymous_variant	201266				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr17:71027788C>A	AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.213G>T	17.37:g.71027788C>A						SLC39A11_uc002jja.2_Silent_p.G71G|SLC39A11_uc002jjc.1_Silent_p.G71G	p.G71G	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN			4	328	-			71					B2R8H7|Q8WZ81	Silent	SNP	ENST00000542342.2	37	c.213G>T	CCDS54160.1																																																																																				0.532	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441442.1			50	52	1	0	1.61863e-15	0.01441	3.32475e-15	50	52				
KIF19	124602	broad.mit.edu	37	17	72348161	72348161	+	Silent	SNP	G	G	C	rs370139850		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:72348161G>C	ENST00000389916.4	+	13	1881	c.1743G>C	c.(1741-1743)tcG>tcC	p.S581S	AC103809.2_ENST00000599136.1_Missense_Mutation_p.C37W	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	581					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGATGCAGTCGCACGCGCTGC	0.711																																							uc002jkm.3		NA																	0					0						c.(1741-1743)TCG>TCC		kinesin family member 19							6.0	6.0	6.0					17																	72348161		1918	3950	5868	SO:0001819	synonymous_variant	124602				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr17:72348161G>C	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1743G>C	17.37:g.72348161G>C						KIF19_uc002jkl.2_Silent_p.S539S	p.S581S	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN			13	1881	+			581					A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	ENST00000389916.4	37	c.1743G>C	CCDS32718.2																																																																																				0.711	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		5	8	0	0	0	0.001168	0	5	8				
KCTD2	23510	broad.mit.edu	37	17	73055632	73055632	+	Silent	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:73055632C>T	ENST00000322444.6	+	4	574	c.568C>T	c.(568-570)Ctg>Ttg	p.L190L	KCTD2_ENST00000581589.1_5'UTR	NM_015353.1	NP_056168.1	Q14681	KCTD2_HUMAN	potassium channel tetramerization domain containing 2	190					protein homooligomerization (GO:0051260)		protein complex binding (GO:0032403)			kidney(1)|lung(2)	3	all_lung(278;0.226)					GTACAGAGTCCTGCAGTGTCA	0.562																																							uc002jmp.2		NA																	0					0						c.(568-570)CTG>TTG		potassium channel tetramerisation domain							105.0	84.0	91.0					17																	73055632		2203	4300	6503	SO:0001819	synonymous_variant	23510					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr17:73055632C>T	BC033329	CCDS32728.1	17q25.2	2013-06-20	2013-06-20			ENSG00000180901			21294	protein-coding gene	gene with protein product		613422	"""potassium channel tetramerisation domain containing 2"""			12620391	Standard	XR_248405		Approved	KIAA0176	uc002jmp.3	Q14681		ENST00000322444.6:c.568C>T	17.37:g.73055632C>T						KCTD2_uc010dfz.2_RNA|KCTD2_uc002jmq.2_RNA	p.L190L	NM_015353	NP_056168	Q14681	KCTD2_HUMAN			4	635	+	all_lung(278;0.226)		190						Silent	SNP	ENST00000322444.6	37	c.568C>T	CCDS32728.1																																																																																				0.562	KCTD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445538.1			16	63	0	0	0	0.006122	0	16	63				
MGAT5B	146664	broad.mit.edu	37	17	74902107	74902107	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:74902107T>C	ENST00000569840.2	+	8	1437	c.863T>C	c.(862-864)gTc>gCc	p.V288A	MGAT5B_ENST00000374998.3_3'UTR|MGAT5B_ENST00000428789.2_Missense_Mutation_p.V299A|MGAT5B_ENST00000301618.4_Missense_Mutation_p.V288A	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	288					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAGATCCTGGTCCACATCGGC	0.692																																							uc002jti.2		NA																	0				ovary(2)|skin(1)	3						c.(895-897)GTC>GCC		N-acetylglucosaminyltranferase VB isoform 2							57.0	63.0	61.0					17																	74902107		2203	4300	6503	SO:0001583	missense	146664					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr17:74902107T>C	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.863T>C	17.37:g.74902107T>C	ENSP00000456037:p.Val288Ala					MGAT5B_uc002jth.2_Missense_Mutation_p.V288A	p.V299A	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN			7	999	+			288			Lumenal (Potential).		Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	ENST00000569840.2	37	c.896T>C	CCDS59299.1	.	.	.	.	.	.	.	.	.	.	T	19.63	3.864420	0.71949	.	.	ENSG00000167889	ENST00000374998;ENST00000301618;ENST00000428789	T;T	0.57107	0.43;0.42	5.49	5.49	0.81192	.	0.224128	0.39687	N	0.001293	T	0.53126	0.1777	M	0.64997	1.995	0.58432	D	0.999997	P;P	0.37370	0.592;0.592	B;B	0.37601	0.254;0.169	T	0.59721	-0.7401	10	0.87932	D	0	-47.5201	14.7722	0.69688	0.0:0.0:0.0:1.0	.	299;288	Q3V5L5-2;Q3V5L5-5	.;.	A	288;288;299	ENSP00000301618:V288A;ENSP00000391227:V299A	ENSP00000301618:V288A	V	+	2	0	MGAT5B	72413702	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.861000	0.87004	2.085000	0.62840	0.379000	0.24179	GTC		0.692	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677		42	88	0	0	0	0.01441	0	42	88				
SLC38A10	124565	broad.mit.edu	37	17	79225400	79225400	+	Missense_Mutation	SNP	G	G	A	rs202180999		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:79225400G>A	ENST00000374759.3	-	14	2341	c.1958C>T	c.(1957-1959)cCc>cTc	p.P653L	SLC38A10_ENST00000288439.5_Missense_Mutation_p.P653L	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	653					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CGCTGGGAGGGGAGGCTTCCC	0.672																																							uc002jzz.1		NA																	0				pancreas(1)|skin(1)	2						c.(1957-1959)CCC>CTC		solute carrier family 38, member 10 isoform a							10.0	12.0	11.0					17																	79225400		2046	4136	6182	SO:0001583	missense	124565				amino acid transport|sodium ion transport	integral to membrane		g.chr17:79225400G>A	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.1958C>T	17.37:g.79225400G>A	ENSP00000363891:p.Pro653Leu					SLC38A10_uc002jzy.1_Missense_Mutation_p.P571L|SLC38A10_uc002kab.2_Missense_Mutation_p.P653L	p.P653L	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)		14	2333	-	all_neural(118;0.0804)|Melanoma(429;0.242)		653					Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	ENST00000374759.3	37	c.1958C>T	CCDS42397.1	.	.	.	.	.	.	.	.	.	.	G	8.273	0.813725	0.16537	.	.	ENSG00000157637	ENST00000374759;ENST00000540966;ENST00000288439	T;T;T	0.42900	3.16;0.96;2.96	3.1	-1.49	0.08718	.	17.800300	0.00166	N	0.000000	T	0.30479	0.0766	L	0.31926	0.97	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.09143	-1.0688	10	0.29301	T	0.29	-0.9754	4.5795	0.12252	0.4269:0.1756:0.3975:0.0	.	653;653	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	L	653;31;653	ENSP00000363891:P653L;ENSP00000437601:P31L;ENSP00000288439:P653L	ENSP00000288439:P653L	P	-	2	0	SLC38A10	76839995	0.001000	0.12720	0.001000	0.08648	0.147000	0.21601	-0.557000	0.05985	-0.131000	0.11578	0.297000	0.19635	CCC		0.672	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570		7	31	0	0	0	0.006214	0	7	31				
OGFOD3	79701	broad.mit.edu	37	17	80361813	80361813	+	Splice_Site	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:80361813C>A	ENST00000313056.5	-	7	850	c.699G>T	c.(697-699)aaG>aaT	p.K233N	RP13-20L14.4_ENST00000579188.1_RNA|OGFOD3_ENST00000329197.5_Splice_Site_p.K233N	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	233	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										GCGCGCTCACCTTGTCCACGT	0.677																																							uc002keu.1		NA																	0				ovary(1)	1						c.(697-699)AAG>AAT		hypothetical protein LOC79701 isoform 1							76.0	57.0	63.0					17																	80361813		2203	4300	6503	SO:0001630	splice_region_variant	79701					integral to membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr17:80361813C>A	BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.699+1G>T	17.37:g.80361813C>A						C17orf101_uc002ket.1_Missense_Mutation_p.K233N|C17orf101_uc010dip.1_RNA	p.K233N	NM_024648	NP_078924	Q6PK18	CQ101_HUMAN			7	800	-			233			Fe2OG dioxygenase.|Lumenal (Potential).		C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	ENST00000313056.5	37	c.699G>T	CCDS11811.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813754	0.90790	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.57273	0.41;0.92	5.32	5.32	0.75619	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.68650	0.3024	L	0.55743	1.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	T	0.66814	-0.5828	9	.	.	.	-35.2441	17.5748	0.87946	0.0:1.0:0.0:0.0	.	233;233	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	N	233	ENSP00000320116:K233N;ENSP00000330075:K233N	.	K	-	3	2	C17orf101	77955102	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.513000	0.67037	2.482000	0.83794	0.655000	0.94253	AAG		0.677	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442895.1	NM_175902	Missense_Mutation	9	14	1	0	1.58986e-06	0.008291	2.74613e-06	9	14				
LRRC30	339291	broad.mit.edu	37	18	7231504	7231504	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr18:7231504T>A	ENST00000383467.2	+	1	382	c.368T>A	c.(367-369)tTt>tAt	p.F123Y		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	123										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						AAGGTCCTGTTTGTCAACATG	0.597																																							uc010wzk.1		NA																	0				ovary(1)|liver(1)	2						c.(367-369)TTT>TAT		leucine rich repeat containing 30							38.0	43.0	41.0					18																	7231504		2020	4188	6208	SO:0001583	missense	339291							g.chr18:7231504T>A		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.368T>A	18.37:g.7231504T>A	ENSP00000372959:p.Phe123Tyr						p.F123Y	NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN			1	368	+			123			LRR 3.			Missense_Mutation	SNP	ENST00000383467.2	37	c.368T>A	CCDS42409.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.199490	0.38806	.	.	ENSG00000206422	ENST00000383467	T	0.23754	1.89	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.08537	0.0212	N	0.00823	-1.155	0.42620	D	0.993347	P	0.42692	0.787	B	0.40134	0.32	T	0.35176	-0.9799	10	0.02654	T	1	.	16.1864	0.81955	0.0:0.0:0.0:1.0	.	123	A6NM36	LRC30_HUMAN	Y	123	ENSP00000372959:F123Y	ENSP00000372959:F123Y	F	+	2	0	LRRC30	7221504	1.000000	0.71417	0.929000	0.37066	0.490000	0.33462	7.493000	0.81493	2.281000	0.76405	0.528000	0.53228	TTT		0.597	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1	XM_292678		24	54	0	0	0	0.014323	0	24	54				
RNMT	8731	broad.mit.edu	37	18	13737009	13737009	+	Splice_Site	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr18:13737009G>T	ENST00000383314.2	+	5	794	c.554G>T	c.(553-555)gGa>gTa	p.G185V	RNMT_ENST00000543302.2_Splice_Site_p.G185V|RNMT_ENST00000262173.3_Splice_Site_p.G185V|RNMT_ENST00000592764.1_Splice_Site_p.G185V|RNMT_ENST00000535051.1_5'UTR|RNMT_ENST00000589866.1_Splice_Site_p.G185V			O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase	185	mRNA cap 0 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00895}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA (guanine-N7)-methylation (GO:0036265)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|receptor complex (GO:0043235)	mRNA (guanine-N7-)-methyltransferase activity (GO:0004482)|RNA binding (GO:0003723)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|skin(2)	18						TCTCTTTTAGGAGAATTTTTG	0.348																																					GBM(29;474 594 19092 36647 41529)	GBM(29;474 594 19092 36647 41529)	uc002ksk.1		NA																	0					0						c.(553-555)GGA>GTA		RNA (guanine-7-) methyltransferase							85.0	88.0	87.0					18																	13737009		2203	4300	6503	SO:0001630	splice_region_variant	8731				mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	mRNA (guanine-N7-)-methyltransferase activity|RNA binding	g.chr18:13737009G>T	AF067791	CCDS11867.1	18p11.21	2008-05-14			ENSG00000101654	ENSG00000101654	2.1.1.56		10075	protein-coding gene	gene with protein product		603514				9828141, 9705270	Standard	NM_003799		Approved	RG7MT1	uc002ksl.1	O43148	OTTHUMG00000131718	ENST00000383314.2:c.554-1G>T	18.37:g.13737009G>T						RNMT_uc002ksl.1_Missense_Mutation_p.G185V|RNMT_uc002ksm.1_Missense_Mutation_p.G185V|RNMT_uc010dlk.2_Missense_Mutation_p.G185V|RNMT_uc010xae.1_RNA	p.G185V	NM_003799	NP_003790	O43148	MCES_HUMAN			4	621	+			185					B0YJ90|D3DUJ5|O94996|Q9UIJ9	Missense_Mutation	SNP	ENST00000383314.2	37	c.554G>T	CCDS11867.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918230	0.73098	.	.	ENSG00000101654	ENST00000383314;ENST00000543302;ENST00000544744;ENST00000262173	.	.	.	5.62	5.62	0.85841	.	0.046357	0.85682	D	0.000000	T	0.77103	0.4081	M	0.75615	2.305	0.80722	D	1	D;D	0.59357	0.985;0.978	P;P	0.58660	0.843;0.805	T	0.76694	-0.2865	8	.	.	.	.	19.6503	0.95798	0.0:0.0:1.0:0.0	.	185;185	O43148-2;O43148	.;MCES_HUMAN	V	185;185;7;185	.	.	G	+	2	0	RNMT	13727009	1.000000	0.71417	0.998000	0.56505	0.709000	0.40893	7.175000	0.77632	2.636000	0.89361	0.650000	0.86243	GGA		0.348	RNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254636.1	NM_003799	Missense_Mutation	21	42	1	0	1.96292e-10	0.010504	3.61341e-10	21	42				
OSBPL1A	114876	broad.mit.edu	37	18	21747356	21747356	+	Silent	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr18:21747356T>C	ENST00000319481.3	-	25	2678	c.2472A>G	c.(2470-2472)gtA>gtG	p.V824V	OSBPL1A_ENST00000399443.3_Silent_p.V311V|OSBPL1A_ENST00000357041.4_Silent_p.V442V	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	824					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					GGATAATGAATACACTTTCAG	0.463																																							uc002kve.2		NA																	0				ovary(4)	4						c.(2470-2472)GTA>GTG		oxysterol-binding protein-like 1A isoform B							98.0	104.0	102.0					18																	21747356		2203	4300	6503	SO:0001819	synonymous_variant	114876				cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding	g.chr18:21747356T>C	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2472A>G	18.37:g.21747356T>C						OSBPL1A_uc002kvd.2_Silent_p.V311V|OSBPL1A_uc010xbc.1_Silent_p.V442V	p.V824V	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN			25	2646	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		824					B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	37	c.2472A>G	CCDS11884.1																																																																																				0.463	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597		47	97	0	0	0	0.01441	0	47	97				
SALL3	27164	broad.mit.edu	37	18	76757146	76757146	+	Missense_Mutation	SNP	G	G	T	rs140437850		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr18:76757146G>T	ENST00000537592.2	+	3	3727	c.3727G>T	c.(3727-3729)Gtg>Ttg	p.V1243L	SALL3_ENST00000536229.3_Missense_Mutation_p.V1038L|SALL3_ENST00000575389.2_Missense_Mutation_p.V1171L	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1243					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCAGCTCCCCGTGAGTCTTGG	0.607																																							uc002lmt.2		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(3727-3729)GTG>TTG		sal-like 3							92.0	89.0	90.0					18																	76757146		2203	4300	6503	SO:0001583	missense	27164				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:76757146G>T	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3727G>T	18.37:g.76757146G>T	ENSP00000441823:p.Val1243Leu					SALL3_uc010dra.2_Missense_Mutation_p.V778L	p.V1243L	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)	3	3727	+		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)	1243					Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	c.3727G>T	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922689	0.33908	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.42900	0.96	5.39	5.39	0.77823	.	0.000000	0.50627	D	0.000101	T	0.53883	0.1824	L	0.58583	1.82	0.58432	D	0.999999	P;D	0.61697	0.732;0.99	B;P	0.53861	0.142;0.736	T	0.45673	-0.9245	10	0.25751	T	0.34	-19.6341	19.1739	0.93594	0.0:0.0:1.0:0.0	.	903;1243	F5GXY4;Q9BXA9	.;SALL3_HUMAN	L	1243;1171;903	ENSP00000441823:V1243L	ENSP00000299466:V1243L	V	+	1	0	SALL3	74858134	1.000000	0.71417	0.293000	0.24932	0.286000	0.27126	6.651000	0.74372	2.526000	0.85167	0.561000	0.74099	GTG		0.607	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999		42	136	1	0	2.37825e-27	0.010771	5.50099e-27	42	136				
PTPRS	5802	broad.mit.edu	37	19	5225821	5225821	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:5225821G>C	ENST00000587303.1	-	16	2510	c.2411C>G	c.(2410-2412)gCg>gGg	p.A804G	PTPRS_ENST00000357368.4_Missense_Mutation_p.A804G|PTPRS_ENST00000592099.1_Intron|PTPRS_ENST00000262963.6_Missense_Mutation_p.A800G|PTPRS_ENST00000588012.1_Missense_Mutation_p.A782G|PTPRS_ENST00000372412.4_Missense_Mutation_p.A805G|PTPRS_ENST00000348075.2_Missense_Mutation_p.A782G|PTPRS_ENST00000353284.2_Intron|PTPRS_ENST00000588552.1_Intron			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	804	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GATGGAGTACGCGGTCTCAGG	0.647																																							uc002mbv.2		NA																	0				large_intestine(2)|ovary(1)|central_nervous_system(1)	4						c.(2410-2412)GCG>GGG		protein tyrosine phosphatase, receptor type,							130.0	95.0	107.0					19																	5225821		2203	4300	6503	SO:0001583	missense	5802				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr19:5225821G>C	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.2411C>G	19.37:g.5225821G>C	ENSP00000467537:p.Ala804Gly					PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Missense_Mutation_p.A782G|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	p.A804G	NM_002850	NP_002841	Q13332	PTPRS_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	17	2645	-			804			Fibronectin type-III 5.|Extracellular (Potential).		O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	c.2411C>G	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	g	12.23	1.876922	0.33162	.	.	ENSG00000105426	ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	3.25	3.25	0.37280	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.168074	0.39274	U	0.001407	T	0.47097	0.1427	L	0.42008	1.315	0.80722	D	1	B;P	0.35174	0.006;0.488	B;B	0.37989	0.006;0.262	T	0.50668	-0.8801	10	0.36615	T	0.2	.	15.1052	0.72315	0.0:0.0:1.0:0.0	.	782;804	Q13332-6;Q13332	.;PTPRS_HUMAN	G	805;804;804;795;800;782	ENSP00000361489:A805G;ENSP00000349932:A804G;ENSP00000262963:A800G;ENSP00000269907:A782G	ENSP00000262963:A800G	A	-	2	0	PTPRS	5176821	0.994000	0.37717	0.650000	0.29550	0.644000	0.38419	7.267000	0.78462	1.851000	0.53745	0.473000	0.43528	GCG		0.647	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2			24	30	0	0	0	0.00278	0	24	30				
KEAP1	9817	broad.mit.edu	37	19	10602620	10602620	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:10602620G>A	ENST00000171111.5	-	3	1505	c.958C>T	c.(958-960)Cgg>Tgg	p.R320W	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.R320W	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	320					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TTGGGCGCCCGGCAGGGCATC	0.642																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(958-960)CGG>TGG		kelch-like ECH-associated protein 1							33.0	38.0	36.0					19																	10602620		2203	4299	6502	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602620G>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.958C>T	19.37:g.10602620G>A	ENSP00000171111:p.Arg320Trp					KEAP1_uc002mop.1_Missense_Mutation_p.R38W|KEAP1_uc002mor.1_Missense_Mutation_p.R320W	p.R320W	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	1114	-			320					B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.958C>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400886	0.83120	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.73469	-0.75;-0.75	5.61	4.52	0.55395	.	0.058307	0.64402	D	0.000003	D	0.83995	0.5375	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.75484	0.986	D	0.85213	0.1022	10	0.72032	D	0.01	.	13.0207	0.58784	0.0:0.0:0.8382:0.1618	.	320	Q14145	KEAP1_HUMAN	W	320	ENSP00000171111:R320W;ENSP00000377245:R320W	ENSP00000171111:R320W	R	-	1	2	KEAP1	10463620	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.824000	0.62701	2.656000	0.90262	0.561000	0.74099	CGG		0.642	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		27	18	0	0	0	0.005443	0	27	18				
SLC5A5	6528	broad.mit.edu	37	19	18001744	18001744	+	Silent	SNP	C	C	A	rs375404000		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:18001744C>A	ENST00000222248.3	+	14	2048	c.1701C>A	c.(1699-1701)ctC>ctA	p.L567L		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	567					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GGTGGGACCTCGCACGGCAGA	0.592																																					Melanoma(65;1008 1708 7910 46650)	Melanoma(65;1008 1708 7910 46650)	uc002nhr.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1699-1701)CTC>CTA		solute carrier family 5 (sodium iodide							114.0	110.0	111.0					19																	18001744		2203	4300	6503	SO:0001819	synonymous_variant	6528				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity	g.chr19:18001744C>A		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1701C>A	19.37:g.18001744C>A							p.L567L	NM_000453	NP_000444	Q92911	SC5A5_HUMAN			14	2048	+			567			Cytoplasmic (Potential).		O43702|Q2M335|Q9NYB6	Silent	SNP	ENST00000222248.3	37	c.1701C>A	CCDS12368.1																																																																																				0.592	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1			123	61	1	0	2.34035e-62	0.01441	6.55298e-62	123	61				
CTC-260E6.6	0	broad.mit.edu	37	19	20369339	20369339	+	RNA	SNP	T	T	C	rs529326632		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:20369339T>C	ENST00000593655.1	-	0	199																											AGAAACCTAATATAGATACCA	0.373													T|||	1	0.000199681	0.0	0.0014	5008	,	,		21018	0.0		0.0	False		,,,				2504	0.0						uc002nov.2		NA																	0					0						c.(130-132)AAT>AAC		SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;																																						284441							g.chr19:20369339T>C																													19.37:g.20369339T>C							p.N44N	NR_003128						1	883	+									Silent	SNP	ENST00000593655.1	37	c.132T>C																																																																																					0.373	CTC-260E6.6-006	KNOWN	basic	antisense	antisense	OTTHUMT00000462901.1			54	122	0	0	0	0.01441	0	54	122				
ZNF675	171392	broad.mit.edu	37	19	23836246	23836246	+	Missense_Mutation	SNP	T	T	C	rs147297608		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:23836246T>C	ENST00000359788.4	-	4	1657	c.1489A>G	c.(1489-1491)Aca>Gca	p.T497A	ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	497					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CTTTTATGTGTAGTAAGGGAT	0.363													T|||	1	0.000199681	0.0	0.0014	5008	,	,		18482	0.0		0.0	False		,,,				2504	0.0						uc002nri.2		NA																	0				ovary(1)|kidney(1)	2						c.(1489-1491)ACA>GCA		zinc finger protein 675		T	ALA/THR	0,4406		0,0,2203	45.0	48.0	47.0		1489	0.9	0.2	19	dbSNP_134	47	3,8595		0,3,4296	no	missense	ZNF675	NM_138330.2	58	0,3,6499	CC,CT,TT		0.0349,0.0,0.0231	benign	497/569	23836246	3,13001	2203	4299	6502	SO:0001583	missense	171392				bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr19:23836246T>C		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1489A>G	19.37:g.23836246T>C	ENSP00000352836:p.Thr497Ala						p.T497A	NM_138330	NP_612203	Q8TD23	ZN675_HUMAN			4	1671	-		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)	497			C2H2-type 13.		Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	c.1489A>G	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	0.012	-1.676698	0.00751	0.0	3.49E-4	ENSG00000197372	ENST00000359788	T	0.17213	2.29	0.886	0.886	0.19194	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05731	0.0150	N	0.02775	-0.495	0.09310	N	1	B	0.16802	0.019	B	0.15870	0.014	T	0.34725	-0.9817	9	0.40728	T	0.16	.	1.4475	0.02367	0.3179:0.244:0.0:0.4381	.	497	Q8TD23	ZN675_HUMAN	A	497	ENSP00000352836:T497A	ENSP00000352836:T497A	T	-	1	0	ZNF675	23628086	0.000000	0.05858	0.196000	0.23383	0.196000	0.23810	-2.565000	0.00918	0.257000	0.21650	0.254000	0.18369	ACA		0.363	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330		30	24	0	0	0	0.010818	0	30	24				
ZNF607	84775	broad.mit.edu	37	19	38202555	38202555	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:38202555G>A	ENST00000355202.4	-	0	560				ZNF607_ENST00000395835.3_De_novo_Start_OutOfFrame|CTD-2528L19.4_ENST00000586606.2_De_novo_Start_OutOfFrame	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			AGTCCTTGGCGTTTCTCTACC	0.438																																							uc002ohc.1		NA																	0					0						c.(-37--33)AACGC>AATGC		zinc finger protein 607							116.0	98.0	104.0					19																	38202555		2203	4300	6503			84775				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38202555G>A	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.-36C>T	19.37:g.38202555G>A						ZNF607_uc002ohb.1_Translation_Start_Site		NM_032689	NP_116078	Q96SK3	ZN607_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)		2	561	-								F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Translation_Start_Site	SNP	ENST00000355202.4	37	c.-35C>T	CCDS33006.1																																																																																				0.438	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689		15	47	0	0	0	0.00245	0	15	47				
PSG11	5680	broad.mit.edu	37	19	43519364	43519364	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:43519364G>T	ENST00000401740.1	-	4	971	c.868C>A	c.(868-870)Cag>Aag	p.Q290K	PSG11_ENST00000403486.1_Missense_Mutation_p.Q168K|PSG11_ENST00000320078.7_Missense_Mutation_p.Q290K|PSG11_ENST00000306322.7_Missense_Mutation_p.Q168K|PSG11_ENST00000595312.1_5'Flank			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	299	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GGAGTAATCTGAGGGATAAAG	0.463																																							uc002ovm.1		NA																	0					0						c.(868-870)CAG>AAG		pregnancy specific beta-1-glycoprotein 11							163.0	163.0	163.0					19																	43519364		2199	4297	6496	SO:0001583	missense	5680				female pregnancy	extracellular region		g.chr19:43519364G>T	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.868C>A	19.37:g.43519364G>T	ENSP00000384995:p.Gln290Lys					PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG11_uc002ovn.1_Missense_Mutation_p.Q296K|PSG11_uc002ovo.1_Missense_Mutation_p.Q168K|PSG11_uc002ovp.1_Missense_Mutation_p.Q168K	p.Q290K	NM_002785	NP_002776	Q9UQ72	PSG11_HUMAN			4	975	-		Prostate(69;0.00682)	290			Ig-like C2-type 2.		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	c.868C>A	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	g	2.717	-0.267574	0.05754	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	0.418	-0.836	0.10770	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54967	0.1891	N	0.21508	0.67	0.09310	N	1	B;B	0.26318	0.036;0.146	B;B	0.36766	0.022;0.232	T	0.49021	-0.8982	8	0.38643	T	0.18	.	.	.	.	.	168;290	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	K	290;168;168;290	ENSP00000319140:Q290K;ENSP00000385427:Q168K;ENSP00000304913:Q168K;ENSP00000384995:Q290K	ENSP00000304913:Q168K	Q	-	1	0	PSG11	48211204	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.569000	0.05902	-0.686000	0.05170	0.184000	0.17185	CAG		0.463	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785		73	269	1	0	5.32961e-40	0.01441	1.36315e-39	73	269				
PSG2	5670	broad.mit.edu	37	19	43579759	43579759	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:43579759G>A	ENST00000406487.1	-	3	554	c.456C>T	c.(454-456)tcC>tcT	p.S152S		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	152	Ig-like C2-type 1.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				AGTTGCTGCTGGAGATGGAGG	0.498																																							uc002ovr.2		NA																	0					0						c.(454-456)TCC>TCT		pregnancy specific beta-1-glycoprotein 2							154.0	158.0	156.0					19																	43579759		2202	4298	6500	SO:0001819	synonymous_variant	5670				cell migration|female pregnancy	extracellular region		g.chr19:43579759G>A		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.456C>T	19.37:g.43579759G>A						PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Silent_p.S152S|PSG2_uc010eiq.1_Silent_p.S152S|PSG2_uc002ovs.3_Silent_p.S152S|PSG2_uc002ovt.3_Silent_p.S152S	p.S152S	NM_031246	NP_112536	P11465	PSG2_HUMAN			3	549	-		Prostate(69;0.00682)	152			Ig-like C2-type 1.		Q8TCD9|Q9UEA4|Q9UQ78	Silent	SNP	ENST00000406487.1	37	c.456C>T	CCDS12616.1																																																																																				0.498	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246		78	313	0	0	0	0.01441	0	78	313				
SEC1P	653677	broad.mit.edu	37	19	49183484	49183484	+	RNA	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:49183484G>A	ENST00000430145.2	+	0	571					NR_004401.2				secretory blood group 1, pseudogene																		AGGGCCGCCTGGGGAACCAGA	0.682																																							uc010xzv.1		NA																	0					0						c.(502-504)CTG>CTA		SubName: Full=cDNA FLJ58287, highly similar to Galactoside 2-alpha-L-fucosyltransferase 2 (EC 2.4.1.69);																																						653677							g.chr19:49183484G>A			19q13.33	2012-07-04			ENSG00000232871	ENSG00000232871			44149	pseudogene	pseudogene							Standard	NR_004401		Approved		uc010xzv.2		OTTHUMG00000154617		19.37:g.49183484G>A						SEC1_uc002pka.2_Silent_p.L128L|SEC1_uc010xzw.1_Silent_p.L85L|SEC1_uc010ema.2_Silent_p.L74L	p.L168L	NR_004401						5	631	+									Silent	SNP	ENST00000430145.2	37	c.504G>A																																																																																					0.682	SEC1P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000336334.1	NR_004401		8	11	0	0	0	0.004482	0	8	11				
KLK3	354	broad.mit.edu	37	19	51361318	51361318	+	Silent	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:51361318G>T	ENST00000326003.2	+	3	281	c.240G>T	c.(238-240)ctG>ctT	p.L80L	KLK3_ENST00000360617.3_Silent_p.L80L|KLK3_ENST00000595952.1_Intron|KLK3_ENST00000597483.1_Intron|KLK3_ENST00000593997.1_Silent_p.L80L	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	80	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		GGCACAGCCTGTTTCATCCTG	0.547																																					Colon(185;1767 2023 13025 30120 37630)	Colon(185;1767 2023 13025 30120 37630)	uc002pts.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(238-240)CTG>CTT		prostate specific antigen isoform 3							69.0	59.0	62.0					19																	51361318		2203	4300	6503	SO:0001819	synonymous_variant	354				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity	g.chr19:51361318G>T	X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.240G>T	19.37:g.51361318G>T						KLK3_uc010ycj.1_Silent_p.L80L|KLK3_uc002ptr.1_Intron|KLK3_uc010eof.1_RNA	p.L80L	NM_001030047	NP_001025218	P07288	KLK3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)	3	281	+		all_neural(266;0.057)	80			Peptidase S1.		C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Silent	SNP	ENST00000326003.2	37	c.240G>T	CCDS12807.1																																																																																				0.547	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464067.1	NM_145864		20	55	1	0	1.2644e-06	0.010504	2.19849e-06	20	55				
LILRA4	23547	broad.mit.edu	37	19	54848199	54848199	+	Missense_Mutation	SNP	C	C	G	rs143168076	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:54848199C>G	ENST00000291759.4	-	6	1224	c.1168G>C	c.(1168-1170)Gcg>Ccg	p.A390P	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	390	Ig-like C2-type 4.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TAGGTCCCCGCGTGGGCTGAG	0.622																																							uc002qfj.2		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(1168-1170)GCG>CCG		leukocyte immunoglobulin-like receptor subfamily							153.0	133.0	140.0					19																	54848199		2203	4300	6503	SO:0001583	missense	23547					integral to membrane	receptor activity	g.chr19:54848199C>G	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.1168G>C	19.37:g.54848199C>G	ENSP00000291759:p.Ala390Pro					LILRA4_uc002qfi.2_Missense_Mutation_p.A324P	p.A390P	NM_012276	NP_036408	P59901	LIRA4_HUMAN		GBM - Glioblastoma multiforme(193;0.0565)	6	1225	-	Ovarian(34;0.19)		390			Ig-like C2-type 4.|Extracellular (Potential).		Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	c.1168G>C	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	14.14	2.446455	0.43429	.	.	ENSG00000239961	ENST00000291759	T	0.03272	3.99	2.51	-2.9	0.05648	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.818908	0.10130	N	0.712145	T	0.10680	0.0261	M	0.79343	2.45	0.09310	N	1	D	0.57899	0.981	P	0.61477	0.889	T	0.11743	-1.0575	10	0.72032	D	0.01	.	2.703	0.05154	0.2123:0.3616:0.0:0.4261	.	390	P59901	LIRA4_HUMAN	P	390	ENSP00000291759:A390P	ENSP00000291759:A390P	A	-	1	0	LILRA4	59540011	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.666000	0.05280	-0.537000	0.06290	0.455000	0.32223	GCG		0.622	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276		115	254	0	0	0	0.01441	0	115	254				
PTPRH	5794	broad.mit.edu	37	19	55693405	55693406	+	Missense_Mutation	DNP	CC	CC	AA	rs145661468|rs536529711	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:55693405_55693406CC>AA	ENST00000376350.3	-	19	3198_3199	c.3176_3177GG>TT	c.(3175-3177)cGG>cTT	p.R1059L	SYT5_ENST00000537500.1_5'Flank|SYT5_ENST00000354308.3_5'Flank|SYT5_ENST00000590851.1_5'Flank|PTPRH_ENST00000263434.5_Missense_Mutation_p.R881L	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	1059	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CCATCAACGGCCGACTCTCTCT	0.634																																							uc002qjq.2		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(3175-3177)CGG>CTT		protein tyrosine phosphatase, receptor type, H																																				SO:0001583	missense	5794				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr19:55693405_55693406CC>AA		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.3176_3177delinsAA	19.37:g.55693405_55693406delinsAA	ENSP00000365528:p.Arg1059Leu					PTPRH_uc010esv.2_Missense_Mutation_p.R881L|SYT5_uc002qjm.1_5'Flank|SYT5_uc002qjp.2_5'Flank|SYT5_uc002qjn.1_5'Flank|SYT5_uc002qjo.1_5'Flank	p.R1059L	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)	19	3249_3250	-		Renal(1328;0.245)	1059			Cytoplasmic (Potential).|Tyrosine-protein phosphatase.		C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	DNP	ENST00000376350.3	37	c.3176_3177GG>TT	CCDS33110.1																																																																																				0.634	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1			73	100	0	0	0	0.004672	0	73	100				
NLRP11	204801	broad.mit.edu	37	19	56300690	56300690	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:56300690C>A	ENST00000589093.1	-	8	2682	c.2589G>T	c.(2587-2589)agG>agT	p.R863S	NLRP11_ENST00000589824.2_Missense_Mutation_p.R809S|NLRP11_ENST00000443188.1_Missense_Mutation_p.R863S|NLRP11_ENST00000360133.3_Missense_Mutation_p.R809S|NLRP11_ENST00000592953.1_Missense_Mutation_p.R764S			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	863							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TCTCCAGGCTCCTCAGTTTTT	0.423																																							uc010ygf.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(2587-2589)AGG>AGT		NLR family, pyrin domain containing 11							139.0	145.0	143.0					19																	56300690		2203	4300	6503	SO:0001583	missense	204801						ATP binding	g.chr19:56300690C>A	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2589G>T	19.37:g.56300690C>A	ENSP00000466285:p.Arg863Ser					NLRP11_uc002qlz.2_Missense_Mutation_p.R710S|NLRP11_uc002qmb.2_Missense_Mutation_p.R764S|NLRP11_uc002qmc.2_RNA	p.R863S	NM_145007	NP_659444	P59045	NAL11_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	10	3300	-		Colorectal(82;0.0002)	863			LRR 5.		C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	c.2589G>T	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255334	0.39896	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.54071	0.59;0.59	2.92	-0.415	0.12355	.	.	.	.	.	T	0.53850	0.1822	L	0.53729	1.69	0.09310	N	1	P;P	0.49961	0.885;0.93	B;P	0.56042	0.416;0.79	T	0.44221	-0.9342	9	0.26408	T	0.33	.	5.1838	0.15174	0.0:0.5774:0.0:0.4226	.	863;809	P59045;P59045-2	NAL11_HUMAN;.	S	863;809	ENSP00000409898:R863S;ENSP00000353251:R809S	ENSP00000353251:R809S	R	-	3	2	NLRP11	60992502	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.827000	0.00746	-0.002000	0.14469	0.591000	0.81541	AGG		0.423	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007		96	116	1	0	1.43847e-43	0.01441	3.82632e-43	96	116				
NLRP5	126206	broad.mit.edu	37	19	56572869	56572869	+	Missense_Mutation	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:56572869A>G	ENST00000390649.3	+	15	3578	c.3578A>G	c.(3577-3579)gAt>gGt	p.D1193G		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1193					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TTTGATGAAGATGACCGGTAC	0.478																																							uc002qmj.2		NA																	0				ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(3577-3579)GAT>GGT		NACHT, LRR and PYD containing protein 5							150.0	143.0	145.0					19																	56572869		1932	4140	6072	SO:0001583	missense	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56572869A>G	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3578A>G	19.37:g.56572869A>G	ENSP00000375063:p.Asp1193Gly					NLRP5_uc002qmi.2_Missense_Mutation_p.D1174G	p.D1193G	NM_153447	NP_703148	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	15	3578	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	1193					A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	c.3578A>G	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	A	8.974	0.973684	0.18736	.	.	ENSG00000171487	ENST00000390649	T	0.73789	-0.78	3.16	1.01	0.19927	.	.	.	.	.	T	0.77143	0.4087	L	0.57536	1.79	0.09310	N	1	D	0.69078	0.997	P	0.60789	0.879	T	0.64007	-0.6508	9	0.72032	D	0.01	.	3.3616	0.07189	0.6302:0.2397:0.1301:0.0	.	1193	P59047	NALP5_HUMAN	G	1193	ENSP00000375063:D1193G	ENSP00000375063:D1193G	D	+	2	0	NLRP5	61264681	0.098000	0.21812	0.023000	0.16930	0.003000	0.03518	2.288000	0.43514	0.139000	0.18822	-0.313000	0.08912	GAT		0.478	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		36	147	0	0	0	0.004289	0	36	147				
SLC27A5	10998	broad.mit.edu	37	19	59010492	59010492	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr19:59010492G>T	ENST00000263093.2	-	8	1872	c.1763C>A	c.(1762-1764)cCa>cAa	p.P588Q	SLC27A5_ENST00000599700.1_5'UTR|SLC27A5_ENST00000601355.1_Missense_Mutation_p.P504Q|SLC27A5_ENST00000594786.1_5'UTR	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	588					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		CTCCGCACCTGGCACGCACAC	0.552																																							uc002qtc.2		NA																	0					0						c.(1762-1764)CCA>CAA		solute carrier family 27 (fatty acid							94.0	86.0	89.0					19																	59010492		2203	4300	6503	SO:0001583	missense	10998				bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity	g.chr19:59010492G>T	AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.1763C>A	19.37:g.59010492G>T	ENSP00000263093:p.Pro588Gln					SLC27A5_uc002qtb.2_RNA	p.P588Q	NM_012254	NP_036386	Q9Y2P5	S27A5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)	8	1873	-		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	588			Cytoplasmic (Probable).		B3KVP6|B4DPQ1	Missense_Mutation	SNP	ENST00000263093.2	37	c.1763C>A	CCDS12983.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.034472	0.93575	.	.	ENSG00000083807	ENST00000263093	T	0.57595	0.39	4.91	4.91	0.64330	.	0.455157	0.24242	N	0.040253	T	0.73305	0.3570	M	0.88450	2.955	0.51767	D	0.999939	D	0.61080	0.989	P	0.60949	0.881	T	0.78600	-0.2141	10	0.62326	D	0.03	-26.2906	13.9757	0.64271	0.0:0.0:1.0:0.0	.	588	Q9Y2P5	S27A5_HUMAN	Q	588	ENSP00000263093:P588Q	ENSP00000263093:P588Q	P	-	2	0	SLC27A5	63702304	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.397000	0.66302	2.435000	0.82474	0.563000	0.77884	CCA		0.552	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467060.1	NM_012254		39	49	1	0	2.35958e-20	0.009718	5.12367e-20	39	49				
MYT1L	23040	broad.mit.edu	37	2	1914022	1914022	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:1914022G>T	ENST00000399161.2	-	13	2554	c.1807C>A	c.(1807-1809)Cgc>Agc	p.R603S	MYT1L_ENST00000428368.2_Missense_Mutation_p.R601S	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	603					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CTGAGCACGCGGTCCGAGGCC	0.642																																							uc002qxe.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(1807-1809)CGC>AGC		myelin transcription factor 1-like							51.0	61.0	58.0					2																	1914022		2102	4205	6307	SO:0001583	missense	23040				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:1914022G>T	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1807C>A	2.37:g.1914022G>T	ENSP00000382114:p.Arg603Ser					MYT1L_uc002qxd.2_Missense_Mutation_p.R601S|MYT1L_uc010ewl.1_RNA	p.R603S	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)	13	2634	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	603					A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37	c.1807C>A		.	.	.	.	.	.	.	.	.	.	G	28.6	4.933124	0.92458	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.54279	0.58;0.58	5.55	5.55	0.83447	.	0.060346	0.64402	D	0.000002	T	0.63224	0.2493	L	0.55481	1.735	0.80722	D	1	D;D	0.57571	0.974;0.98	P;P	0.53861	0.628;0.736	T	0.62191	-0.6906	10	0.45353	T	0.12	-15.0503	19.1056	0.93293	0.0:0.0:1.0:0.0	.	603;601	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	S	603;549;601	ENSP00000382114:R603S;ENSP00000396103:R601S	ENSP00000295067:R549S	R	-	1	0	MYT1L	1893029	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.237000	0.72345	2.600000	0.87896	0.655000	0.94253	CGC		0.642	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		32	55	1	0	2.85442e-18	0.010818	6.05e-18	32	55				
NRXN1	9378	broad.mit.edu	37	2	51255149	51255149	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:51255149C>A	ENST00000406316.2	-	2	1739	c.263G>T	c.(262-264)cGc>cTc	p.R88L	NRXN1_ENST00000404971.1_Missense_Mutation_p.R88L|NRXN1_ENST00000402717.3_Missense_Mutation_p.R88L|NRXN1_ENST00000401669.2_Missense_Mutation_p.R88L|NRXN1_ENST00000405581.1_Missense_Mutation_p.R88L|NRXN1_ENST00000406859.3_Missense_Mutation_p.R88L|NRXN1_ENST00000405472.3_Missense_Mutation_p.R88L	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	88	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GAGCTGCAGGCGGCCGCCGCG	0.677																																							uc010fbq.2		NA																	0				ovary(2)	2						c.(262-264)CGC>CTC		neurexin 1 isoform alpha2 precursor							13.0	17.0	16.0					2																	51255149		1981	4137	6118	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:51255149C>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.263G>T	2.37:g.51255149C>A	ENSP00000384311:p.Arg88Leu					NRXN1_uc002rxe.3_Missense_Mutation_p.R88L|NRXN1_uc002rxd.1_Missense_Mutation_p.R88L	p.R88L	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		2	1740	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.263G>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367263	0.82463	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	T;T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	4.97	4.97	0.65823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.469460	0.05932	U	0.635372	D	0.85371	0.5681	M	0.80982	2.52	0.34054	D	0.656491	P;P;B	0.44816	0.53;0.844;0.01	P;B;B	0.45681	0.49;0.411;0.009	T	0.83303	-0.0027	10	0.59425	D	0.04	.	18.2347	0.89946	0.0:1.0:0.0:0.0	.	88;88;88	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	L	88	ENSP00000385142:R88L;ENSP00000384311:R88L;ENSP00000434015:R88L;ENSP00000385017:R88L;ENSP00000385434:R88L;ENSP00000385681:R88L;ENSP00000385310:R88L	ENSP00000385017:R88L	R	-	2	0	NRXN1	51108653	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.852000	0.55934	2.293000	0.77203	0.563000	0.77884	CGC		0.677	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			13	31	1	0	0.000219431	0.00245	0.000368257	13	31				
SUCLG1	8802	broad.mit.edu	37	2	84668224	84668224	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:84668224C>A	ENST00000393868.2	-	5	746	c.536G>T	c.(535-537)gGa>gTa	p.G179V		NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit	179					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	TTTACATTCTCCAGGCTGAAA	0.348																																					Ovarian(48;203 1101 37206 40305 50790)	Ovarian(48;203 1101 37206 40305 50790)	uc002son.2		NA																	0					0						c.(535-537)GGA>GTA		succinate-CoA ligase, GDP-forming alpha subunit	Succinic acid(DB00139)						81.0	80.0	80.0					2																	84668224		2203	4300	6503	SO:0001583	missense	8802				tricarboxylic acid cycle		ATP citrate synthase activity|GTP binding|succinate-CoA ligase (GDP-forming) activity	g.chr2:84668224C>A	Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.536G>T	2.37:g.84668224C>A	ENSP00000377446:p.Gly179Val					SUCLG1_uc010ysk.1_Missense_Mutation_p.G166V	p.G179V	NM_003849	NP_003840	P53597	SUCA_HUMAN			5	729	-			179					Q9BWB0|Q9UNP6	Missense_Mutation	SNP	ENST00000393868.2	37	c.536G>T	CCDS1967.2	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646088	0.67358	.	.	ENSG00000163541	ENST00000393868	D	0.83419	-1.72	5.89	4.99	0.66335	Succinyl-CoA synthetase-like (2);	0.094446	0.64402	D	0.000001	D	0.90277	0.6959	H	0.96662	3.86	0.80722	D	1	D;P	0.54772	0.968;0.954	B;P	0.46237	0.332;0.508	D	0.92987	0.6411	10	0.87932	D	0	-16.0536	14.6141	0.68537	0.0:0.8533:0.1467:0.0	.	179;179	B7Z438;P53597	.;SUCA_HUMAN	V	179	ENSP00000377446:G179V	ENSP00000377446:G179V	G	-	2	0	SUCLG1	84521735	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.120000	0.50430	1.438000	0.47492	0.561000	0.74099	GGA		0.348	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252298.2	NM_003849		23	69	1	0	4.7796e-09	0.004656	8.61949e-09	23	69				
RETSAT	54884	broad.mit.edu	37	2	85578057	85578057	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:85578057G>A	ENST00000295802.4	-	3	555	c.443C>T	c.(442-444)cCc>cTc	p.P148L	RETSAT_ENST00000263854.6_Missense_Mutation_p.P148L|RETSAT_ENST00000457495.2_Missense_Mutation_p.P87L	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	148					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	AGAGGACAGGGGAGCCCAGTC	0.532																																							uc002spd.2		NA																	0				ovary(2)	2						c.(442-444)CCC>CTC		all-trans-13,14-dihydroretinol saturase	Vitamin A(DB00162)						74.0	70.0	71.0					2																	85578057		2203	4300	6503	SO:0001583	missense	54884				retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity	g.chr2:85578057G>A	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.443C>T	2.37:g.85578057G>A	ENSP00000295802:p.Pro148Leu					RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Missense_Mutation_p.P87L|RETSAT_uc010fgf.2_Intron	p.P148L	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN			3	634	-			148					A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	c.443C>T	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.10|13.10	2.134936|2.134936	0.37728|0.37728	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000295802;ENST00000263854;ENST00000457495|ENST00000409984	T;T|T	0.62232|0.10860	1.7;0.04|2.83	5.92|5.92	3.06|3.06	0.35304|0.35304	.|.	0.625506|0.625506	0.17111|0.17111	N|N	0.186632|0.186632	T|T	0.15478|0.15478	0.0373|0.0373	M|M	0.64170|0.64170	1.965|1.965	0.21416|0.21416	N|N	0.999694|0.999694	B;B|.	0.16166|.	0.016;0.005|.	B;B|.	0.20184|.	0.028;0.006|.	T|T	0.08722|0.08722	-1.0708|-1.0708	9|7	.|.	.|.	.|.	0.1548|0.1548	6.2806|6.2806	0.21005|0.21005	0.0736:0.1324:0.6568:0.1372|0.0736:0.1324:0.6568:0.1372	.|.	87;148|.	G5E9N3;Q6NUM9|.	.;RETST_HUMAN|.	L|S	148;148;87|87	ENSP00000295802:P148L;ENSP00000405040:P87L|ENSP00000387196:P87S	.|.	P|P	-|-	2|1	0|0	RETSAT|RETSAT	85431568|85431568	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.854000|0.854000	0.48673|0.48673	0.438000|0.438000	0.21559|0.21559	0.840000|0.840000	0.34995|0.34995	0.655000|0.655000	0.94253|0.94253	CCC|CCC		0.532	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750		48	59	0	0	0	0.013114	0	48	59				
RGPD4	285190	broad.mit.edu	37	2	108487939	108487939	+	Missense_Mutation	SNP	T	T	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:108487939T>G	ENST00000408999.3	+	20	3556	c.3479T>G	c.(3478-3480)tTc>tGc	p.F1160C	RGPD4_ENST00000354986.4_Missense_Mutation_p.F1160C	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1160	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GCTGAAGAATTCAAGCAGAAA	0.438																																							uc010ywk.1		NA																	0				skin(2)	2						c.(3478-3480)TTC>TGC		RANBP2-like and GRIP domain containing 4							6.0	6.0	6.0					2																	108487939		139	661	800	SO:0001583	missense	285190				intracellular transport		binding	g.chr2:108487939T>G	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3479T>G	2.37:g.108487939T>G	ENSP00000386810:p.Phe1160Cys					RGPD4_uc002tdu.2_Missense_Mutation_p.F347C|RGPD4_uc010ywl.1_RNA	p.F1160C	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN			20	3561	+			1160			RanBD1 1.		B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	c.3479T>G	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	11.73	1.725394	0.30593	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.57752	0.38;0.38	2.33	2.33	0.28932	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.77239	0.4101	H	0.95260	3.645	0.40526	D	0.980886	D	0.89917	1.0	D	0.97110	1.0	T	0.81015	-0.1124	9	0.87932	D	0	-11.9504	9.2036	0.37275	0.0:0.0:0.0:1.0	.	1160	Q7Z3J3	RGPD4_HUMAN	C	1160;1160;918	ENSP00000347081:F1160C;ENSP00000386810:F1160C	ENSP00000347081:F1160C	F	+	2	0	RGPD4	107854371	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	5.933000	0.70130	1.072000	0.40860	0.136000	0.15936	TTC		0.438	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		14	217	0	0	0	0.001855	0	14	217				
IL37	27178	broad.mit.edu	37	2	113674730	113674730	+	Missense_Mutation	SNP	C	C	A	rs200591262		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:113674730C>A	ENST00000263326.3	+	3	212	c.170C>A	c.(169-171)cCg>cAg	p.P57Q	IL37_ENST00000349806.3_Intron|IL37_ENST00000352179.3_Missense_Mutation_p.P36Q|IL37_ENST00000311328.2_Missense_Mutation_p.P31Q|IL37_ENST00000353225.3_Intron	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	57					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)			NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						AACTTAAACCCGAAGAAATTC	0.443																																							uc002tij.2		NA																	0					0						c.(169-171)CCG>CAG		interleukin 1 family, member 7 isoform 1							99.0	95.0	96.0					2																	113674730		2203	4300	6503	SO:0001583	missense	27178				immune response	cytosol|extracellular space|nucleus	cytokine activity|interleukin-1 receptor antagonist activity|interleukin-1 receptor binding	g.chr2:113674730C>A	AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.170C>A	2.37:g.113674730C>A	ENSP00000263326:p.Pro57Gln					IL1F7_uc002tik.2_Missense_Mutation_p.P36Q|IL1F7_uc002til.2_Intron|IL1F7_uc002tim.2_Intron|IL1F7_uc002tin.2_Missense_Mutation_p.P31Q	p.P57Q	NM_014439	NP_055254	Q9NZH6	IL37_HUMAN			3	212	+			57					B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Missense_Mutation	SNP	ENST00000263326.3	37	c.170C>A	CCDS2103.1	.	.	.	.	.	.	.	.	.	.	c	11.75	1.731246	0.30684	.	.	ENSG00000125571	ENST00000263326;ENST00000352179;ENST00000311328	T;T;T	0.61158	0.13;0.13;0.13	2.83	1.0	0.19881	.	1.244600	0.05889	N	0.627938	T	0.72228	0.3434	M	0.78456	2.415	0.09310	N	1	D;D;P	0.89917	1.0;0.98;0.93	D;P;P	0.66084	0.941;0.865;0.578	T	0.51888	-0.8648	10	0.87932	D	0	-2.9495	4.8592	0.13575	0.0:0.7001:0.0:0.2999	.	31;36;57	Q9NZH6-2;Q9NZH6-4;Q9NZH6	.;.;IL37_HUMAN	Q	57;36;31	ENSP00000263326:P57Q;ENSP00000263327:P36Q;ENSP00000309883:P31Q	ENSP00000263326:P57Q	P	+	2	0	IL37	113391201	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.375000	0.07475	0.269000	0.21961	-0.148000	0.13756	CCG		0.443	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254126.1	NM_014439		40	85	1	0	9.9191e-30	0.00874	2.36635e-29	40	85				
EN1	2019	broad.mit.edu	37	2	119600786	119600786	+	Missense_Mutation	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:119600786C>G	ENST00000295206.6	-	2	1417	c.907G>C	c.(907-909)Gac>Cac	p.D303H	EN1_ENST00000546667.1_5'Flank	NM_001426.3	NP_001417.3	Q05925	HME1_HUMAN	engrailed homeobox 1	303					anatomical structure morphogenesis (GO:0009653)|dorsal/ventral pattern formation (GO:0009953)|embryonic forelimb morphogenesis (GO:0035115)|hindbrain development (GO:0030902)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|multicellular organism growth (GO:0035264)|neuron development (GO:0048666)|pigmentation (GO:0043473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|response to cocaine (GO:0042220)|skeletal system development (GO:0001501)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	9						GGCCGCTTGTCCTCCTTCTCG	0.677																																							uc002tlm.2		NA																	0				large_intestine(1)|lung(1)	2						c.(907-909)GAC>CAC		engrailed homeobox 1							26.0	23.0	24.0					2																	119600786		2199	4297	6496	SO:0001583	missense	2019				skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:119600786C>G	L12699	CCDS2123.1	2q14.2	2011-06-20	2007-02-15		ENSG00000163064	ENSG00000163064		"""Homeoboxes / ANTP class : NKL subclass"""	3342	protein-coding gene	gene with protein product		131290				8094370	Standard	NM_001426		Approved		uc002tlm.3	Q05925	OTTHUMG00000131401	ENST00000295206.6:c.907G>C	2.37:g.119600786C>G	ENSP00000295206:p.Asp303His						p.D303H	NM_001426	NP_001417	Q05925	HME1_HUMAN			2	1923	-			303			Homeobox.		Q4ZG44	Missense_Mutation	SNP	ENST00000295206.6	37	c.907G>C	CCDS2123.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025384	0.75390	.	.	ENSG00000163064	ENST00000295206	D	0.95412	-3.7	4.72	4.72	0.59763	Homeodomain-related (1);Homeobox engrailed (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96917	0.8993	L	0.57536	1.79	0.50171	D	0.999851	D	0.60575	0.988	D	0.68621	0.959	D	0.97747	1.0212	10	0.87932	D	0	-26.5486	17.2852	0.87139	0.0:1.0:0.0:0.0	.	303	Q05925	HME1_HUMAN	H	303	ENSP00000295206:D303H	ENSP00000295206:D303H	D	-	1	0	EN1	119317256	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.712000	0.84684	2.174000	0.68829	0.555000	0.69702	GAC		0.677	EN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254191.3			8	19	0	0	0	0.00308	0	8	19				
NCKAP5	344148	broad.mit.edu	37	2	133540303	133540303	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:133540303G>C	ENST00000409261.1	-	14	4454	c.4081C>G	c.(4081-4083)Cag>Gag	p.Q1361E	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000317721.6_Missense_Mutation_p.Q1361E	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1361										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTCCCATGCTGACTGCTGAAG	0.617																																							uc002ttp.2		NA																	0					0						c.(4081-4083)CAG>GAG		Nck-associated protein 5 isoform 1							43.0	43.0	43.0					2																	133540303		1923	4128	6051	SO:0001583	missense	344148						protein binding	g.chr2:133540303G>C	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4081C>G	2.37:g.133540303G>C	ENSP00000387128:p.Gln1361Glu					NCKAP5_uc002ttq.2_Intron	p.Q1361E	NM_207363	NP_997246	O14513	NCKP5_HUMAN			14	4455	-			1361					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.4081C>G	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.500362	0.44455	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11385	2.78;2.78	5.5	5.5	0.81552	.	0.206931	0.23782	U	0.044615	T	0.09992	0.0245	L	0.32530	0.975	0.80722	D	1	P	0.42692	0.787	B	0.36666	0.23	T	0.18587	-1.0332	10	0.30078	T	0.28	.	17.7704	0.88490	0.0:0.0:1.0:0.0	.	1361	O14513	NCKP5_HUMAN	E	1361	ENSP00000387128:Q1361E;ENSP00000380603:Q1361E	ENSP00000380603:Q1361E	Q	-	1	0	NCKAP5	133256773	1.000000	0.71417	0.980000	0.43619	0.767000	0.43475	6.143000	0.71756	2.854000	0.98071	0.655000	0.94253	CAG		0.617	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		34	75	0	0	0	0.012213	0	34	75				
NEB	4703	broad.mit.edu	37	2	152470916	152470916	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:152470916C>A	ENST00000172853.10	-	73	10893	c.10746G>T	c.(10744-10746)gtG>gtT	p.V3582V	NEB_ENST00000397345.3_Silent_p.V3825V|NEB_ENST00000409198.1_Silent_p.V3582V|NEB_ENST00000603639.1_Silent_p.V3825V|NEB_ENST00000427231.2_Silent_p.V3825V|NEB_ENST00000604864.1_Silent_p.V3825V			P20929	NEBU_HUMAN	nebulin	3582					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCTTGGCCAGCACCACCCCCA	0.527																																							uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(10744-10746)GTG>GTT		nebulin isoform 3							256.0	252.0	253.0					2																	152470916		2065	4218	6283	SO:0001819	synonymous_variant	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152470916C>A	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10746G>T	2.37:g.152470916C>A							p.V3582V	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	73	10937	-			3582			Nebulin 98.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37	c.10746G>T																																																																																					0.527	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		281	341	1	0	1.52656e-134	0.01441	4.46225e-134	281	341				
SCN3A	6328	broad.mit.edu	37	2	165970341	165970341	+	Silent	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:165970341G>T	ENST00000360093.3	-	20	4145	c.3654C>A	c.(3652-3654)ctC>ctA	p.L1218L	SCN3A_ENST00000409101.3_Silent_p.L1169L|SCN3A_ENST00000283254.7_Silent_p.L1218L	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1218					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACCACTACTGAGAAGGATCA	0.393																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(3652-3654)CTC>CTA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						173.0	151.0	158.0					2																	165970341		2203	4300	6503	SO:0001819	synonymous_variant	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165970341G>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3654C>A	2.37:g.165970341G>T						SCN3A_uc002ucy.2_Silent_p.L1169L|SCN3A_uc002ucz.2_Silent_p.L1169L|SCN3A_uc002uda.1_Silent_p.L1038L|SCN3A_uc002udb.1_Silent_p.L1038L	p.L1218L	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN			20	4146	-			1218			Helical; Name=S1 of repeat III; (Potential).		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37	c.3654C>A																																																																																					0.393	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		24	159	1	0	2.21704e-12	0.00278	4.27342e-12	24	159				
SCN3A	6328	broad.mit.edu	37	2	165987787	165987787	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:165987787C>A	ENST00000360093.3	-	16	3023	c.2532G>T	c.(2530-2532)gtG>gtT	p.V844V	SCN3A_ENST00000409101.3_Silent_p.V795V|SCN3A_ENST00000283254.7_Silent_p.V844V	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	844					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACAATCCCTCCACATTTGACA	0.368																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(2530-2532)GTG>GTT		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						111.0	107.0	108.0					2																	165987787		2203	4300	6503	SO:0001819	synonymous_variant	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165987787C>A	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2532G>T	2.37:g.165987787C>A						SCN3A_uc002ucy.2_Silent_p.V795V|SCN3A_uc002ucz.2_Silent_p.V795V|SCN3A_uc002uda.1_Silent_p.V664V|SCN3A_uc002udb.1_Silent_p.V664V	p.V844V	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN			16	3024	-			844					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37	c.2532G>T																																																																																					0.368	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		58	165	1	0	1.12612e-26	0.01441	2.57122e-26	58	165				
CHN1	1123	broad.mit.edu	37	2	175677163	175677163	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:175677163C>T	ENST00000409900.3	-	9	1073	c.760G>A	c.(760-762)Gac>Aac	p.D254N	CHN1_ENST00000295497.7_Missense_Mutation_p.D129N|CHN1_ENST00000409597.1_Missense_Mutation_p.D70N|CHN1_ENST00000409156.3_Missense_Mutation_p.D228N|CHN1_ENST00000488080.1_5'UTR	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	254					ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			GGCTTACAGTCATTTGGGACC	0.398			T	TAF15	extraskeletal myxoid chondrosarcoma																																		uc002uji.2		NA		Dom	yes		2	2q31-q32.1	1123	T	chimerin (chimaerin) 1			M	TAF15		extraskeletal myxoid chondrosarcoma		0				ovary(2)|skin(1)	3						c.(760-762)GAC>AAC		chimerin (chimaerin) 1 isoform a							162.0	149.0	153.0					2																	175677163		1943	4155	6098	SO:0001583	missense	1123				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	g.chr2:175677163C>T		CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.760G>A	2.37:g.175677163C>T	ENSP00000386741:p.Asp254Asn					CHN1_uc010zeq.1_Missense_Mutation_p.D228N|CHN1_uc002ujj.2_Missense_Mutation_p.D29N|CHN1_uc002ujg.2_Missense_Mutation_p.D129N	p.D254N	NM_001822	NP_001813	P15882	CHIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.226)		9	1290	-			254			Phorbol-ester/DAG-type.		A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	ENST00000409900.3	37	c.760G>A	CCDS46455.1	.	.	.	.	.	.	.	.	.	.	C	35	5.504580	0.96371	.	.	ENSG00000128656	ENST00000409900;ENST00000295497;ENST00000409597;ENST00000409156;ENST00000409089;ENST00000444394;ENST00000413882;ENST00000443238;ENST00000444573	D;D;D;D;D;D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05;-1.78;-3.05;-3.05;-3.05;-3.05	6.05	6.05	0.98169	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	D	0.000000	D	0.90738	0.7093	N	0.17800	0.525	0.80722	D	1	P;P;B	0.48998	0.918;0.815;0.266	P;P;B	0.51833	0.681;0.534;0.179	D	0.90246	0.4290	10	0.41790	T	0.15	.	19.5968	0.95544	0.0:1.0:0.0:0.0	.	228;254;129	B4DV19;P15882;P15882-2	.;CHIN_HUMAN;.	N	254;129;70;228;46;29;72;80;146	ENSP00000386741:D254N;ENSP00000295497:D129N;ENSP00000386469:D70N;ENSP00000386470:D228N;ENSP00000386322:D46N;ENSP00000411911:D29N;ENSP00000410496:D72N;ENSP00000409798:D80N;ENSP00000392603:D146N	ENSP00000295497:D129N	D	-	1	0	CHN1	175385409	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.039000	0.70972	2.866000	0.98385	0.650000	0.86243	GAC		0.398	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334453.1	NM_001822		105	88	0	0	0	0.01441	0	105	88				
COL5A2	1290	broad.mit.edu	37	2	189916924	189916924	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:189916924C>A	ENST00000374866.3	-	41	3017	c.2743G>T	c.(2743-2745)Ggc>Tgc	p.G915C		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	915					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCAACTCTGCCCGCAGAACCA	0.363																																							uc002uqk.2		NA																	0				ovary(2)	2						c.(2743-2745)GGC>TGC		alpha 2 type V collagen preproprotein							95.0	101.0	99.0					2																	189916924		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189916924C>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2743G>T	2.37:g.189916924C>A	ENSP00000364000:p.Gly915Cys					COL5A2_uc010frx.2_Missense_Mutation_p.G491C	p.G915C	NM_000393	NP_000384	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		41	3018	-			915					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.2743G>T	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.151332	0.78001	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99494	-6.01	5.56	5.56	0.83823	.	0.000000	0.53938	D	0.000042	D	0.99701	0.9886	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97713	1.0192	9	.	.	.	.	19.9052	0.97004	0.0:1.0:0.0:0.0	.	555;915	Q5PR22;P05997	.;CO5A2_HUMAN	C	915;555	ENSP00000364000:G915C	.	G	-	1	0	COL5A2	189625169	1.000000	0.71417	0.977000	0.42913	0.986000	0.74619	7.738000	0.84966	2.776000	0.95493	0.655000	0.94253	GGC		0.363	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		75	121	1	0	2.38877e-28	0.01441	5.59835e-28	75	121				
BOLL	66037	broad.mit.edu	37	2	198646503	198646503	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:198646503G>A	ENST00000392296.4	-	2	381	c.72C>T	c.(70-72)gcC>gcT	p.A24A	BOLL_ENST00000433157.1_Silent_p.A24A|BOLL_ENST00000282278.8_5'UTR|BOLL_ENST00000430004.1_Silent_p.A24A|BOLL_ENST00000321801.7_Silent_p.A36A	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein	24					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						CATATCTTGGGGCACTTGTTG	0.368																																							uc002uus.2		NA																	0				ovary(2)	2						c.(70-72)GCC>GCT		boule isoform 2							209.0	212.0	211.0					2																	198646503		2203	4300	6503	SO:0001819	synonymous_variant	66037				cell differentiation|meiosis|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm	nucleotide binding|protein binding|RNA binding|translation activator activity	g.chr2:198646503G>A		CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747	ENST00000392296.4:c.72C>T	2.37:g.198646503G>A						BOLL_uc002uur.2_Silent_p.A30A|BOLL_uc002uut.2_Silent_p.A36A|BOLL_uc010zha.1_5'UTR|BOLL_uc002uuu.1_Silent_p.A30A	p.A24A	NM_033030	NP_149019	Q8N9W6	BOLL_HUMAN			2	382	-			24					B4DZA4|Q0JW32|Q53T62|Q969U3	Silent	SNP	ENST00000392296.4	37	c.72C>T	CCDS2325.1																																																																																				0.368	BOLL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256107.3	NM_033030		83	203	0	0	0	0.01441	0	83	203				
CPS1	1373	broad.mit.edu	37	2	211456679	211456679	+	Missense_Mutation	SNP	G	G	A	rs149930500		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:211456679G>A	ENST00000233072.5	+	10	1268	c.1072G>A	c.(1072-1074)Gat>Aat	p.D358N	CPS1_ENST00000430249.2_Missense_Mutation_p.D364N|CPS1_ENST00000451903.2_5'Flank	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	358	Glutamine amidotransferase type-1.		D -> H (in CPS1D). {ECO:0000269|PubMed:21120950}.		anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GAATGTCAACGATCAAACAAA	0.378																																							uc002vee.3		NA																	0				ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(1072-1074)GAT>AAT		carbamoyl-phosphate synthetase 1 isoform b							68.0	63.0	64.0					2																	211456679		2203	4300	6503	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211456679G>A	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1072G>A	2.37:g.211456679G>A	ENSP00000233072:p.Asp358Asn					CPS1_uc010fur.2_Missense_Mutation_p.D364N|CPS1_uc010fus.2_5'Flank	p.D358N	NM_001875	NP_001866	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	10	1204	+			358			Glutamine amidotransferase type-1.		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.1072G>A	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	33	5.248600	0.95305	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D	0.91521	-2.86;-2.86	5.77	5.77	0.91146	Glutamine amidotransferase type 1 (2);	0.000000	0.85682	D	0.000000	D	0.97717	0.9251	H	0.98849	4.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98494	1.0611	10	0.87932	D	0	-1.1276	20.3472	0.98799	0.0:0.0:1.0:0.0	.	368;358	Q59HF8;P31327	.;CPSM_HUMAN	N	364;366;358;358	ENSP00000402608:D364N;ENSP00000233072:D358N	ENSP00000233072:D358N	D	+	1	0	CPS1	211164924	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	9.420000	0.97426	2.890000	0.99128	0.650000	0.86243	GAT		0.378	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			41	56	0	0	0	0.00874	0	41	56				
ABCA12	26154	broad.mit.edu	37	2	215807686	215807686	+	Missense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:215807686A>T	ENST00000272895.7	-	50	7618	c.7399T>A	c.(7399-7401)Ttt>Att	p.F2467I	ABCA12_ENST00000389661.4_Missense_Mutation_p.F2149I|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2467	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATACATTGAAACTTTCCATTC	0.393																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(7399-7401)TTT>ATT		ATP-binding cassette, sub-family A, member 12							133.0	115.0	121.0					2																	215807686		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215807686A>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7399T>A	2.37:g.215807686A>T	ENSP00000272895:p.Phe2467Ile					ABCA12_uc002vev.2_Missense_Mutation_p.F2149I|ABCA12_uc010zjn.1_Missense_Mutation_p.F1394I	p.F2467I	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	50	7619	-		Renal(323;0.127)	2467			ABC transporter 2.		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.7399T>A	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	33	5.237046	0.95240	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.94330	-3.4;-3.4	5.65	5.65	0.86999	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.64402	D	0.000001	D	0.93058	0.7790	N	0.11724	0.165	0.80722	D	1	P;D	0.89917	0.78;1.0	P;D	0.91635	0.791;0.999	D	0.94799	0.7969	10	0.87932	D	0	.	15.827	0.78718	1.0:0.0:0.0:0.0	.	2467;2149	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	I	2467;2149	ENSP00000272895:F2467I;ENSP00000374312:F2149I	ENSP00000272895:F2467I	F	-	1	0	ABCA12	215515931	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.971000	0.93419	2.276000	0.75962	0.528000	0.53228	TTT		0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		28	51	0	0	0	0.008361	0	28	51				
TNS1	7145	broad.mit.edu	37	2	218713528	218713528	+	Missense_Mutation	SNP	C	C	A	rs369539752		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:218713528C>A	ENST00000171887.4	-	17	1789	c.1337G>T	c.(1336-1338)gGc>gTc	p.G446V	TNS1_ENST00000430930.1_Missense_Mutation_p.G446V|TNS1_ENST00000419504.1_Missense_Mutation_p.G446V|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	446					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TAAGCCAAAGCCACTCAGCAG	0.667																																							uc002vgt.2		NA																	0				ovary(3)|breast(1)	4						c.(1336-1338)GGC>GTC		tensin							60.0	64.0	63.0					2																	218713528		2203	4300	6503	SO:0001583	missense	7145					cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr2:218713528C>A	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1337G>T	2.37:g.218713528C>A	ENSP00000171887:p.Gly446Val					TNS1_uc002vgr.2_Missense_Mutation_p.G446V|TNS1_uc002vgs.2_Missense_Mutation_p.G446V|TNS1_uc010zjv.1_Missense_Mutation_p.G446V|TNS1_uc010fvj.1_Missense_Mutation_p.G514V|TNS1_uc010fvk.1_Missense_Mutation_p.G571V|TNS1_uc010fvi.1_Missense_Mutation_p.G133V	p.G446V	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)	17	1735	-		Renal(207;0.0483)|Lung NSC(271;0.213)	446					Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	c.1337G>T	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869842	0.72065	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	D;D;D;D	0.98105	-4.61;-4.57;-4.61;-4.72	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.98620	0.9538	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	0.968;1.0;1.0;0.976;0.96	D	0.99823	1.1048	10	0.87932	D	0	.	18.0186	0.89249	0.0:1.0:0.0:0.0	.	446;500;446;446;446	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	V	446;446;446;571	ENSP00000171887:G446V;ENSP00000408724:G446V;ENSP00000406016:G446V;ENSP00000405460:G571V	ENSP00000171887:G446V	G	-	2	0	TNS1	218421773	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.833000	0.69349	2.499000	0.84300	0.561000	0.74099	GGC		0.667	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648		70	96	1	0	4.46356e-37	0.01441	1.11484e-36	70	96				
TTLL4	9654	broad.mit.edu	37	2	219605285	219605285	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:219605285G>A	ENST00000392102.1	+	5	1979	c.1639G>A	c.(1639-1641)Gaa>Aaa	p.E547K	TTLL4_ENST00000258398.4_Missense_Mutation_p.E547K|TTLL4_ENST00000442769.1_Missense_Mutation_p.E547K|TTLL4_ENST00000457313.1_Missense_Mutation_p.E382K	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	547					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		CTCCCCCAGCGAATCGGTGGC	0.433																																					GBM(172;1818 2053 15407 20943 49753)	GBM(172;1818 2053 15407 20943 49753)	uc002viy.2		NA																	0				ovary(2)|skin(1)	3						c.(1639-1641)GAA>AAA		tubulin tyrosine ligase-like family, member 4							139.0	129.0	132.0					2																	219605285		2203	4300	6503	SO:0001583	missense	9654				protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity	g.chr2:219605285G>A		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.1639G>A	2.37:g.219605285G>A	ENSP00000375951:p.Glu547Lys					TTLL4_uc010zkl.1_Missense_Mutation_p.E382K|TTLL4_uc010fvx.2_Missense_Mutation_p.E547K	p.E547K	NM_014640	NP_055455	Q14679	TTLL4_HUMAN		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)	5	2009	+		Renal(207;0.0915)	547					A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	c.1639G>A	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664459	0.29604	.	.	ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398	T;T;T;T	0.04275	3.88;4.11;3.66;4.11	5.22	5.22	0.72569	.	0.630244	0.14303	N	0.328172	T	0.05823	0.0152	L	0.34521	1.04	0.31869	N	0.619971	P;D;P	0.61697	0.688;0.99;0.804	B;P;B	0.46685	0.04;0.524;0.058	T	0.17137	-1.0379	10	0.21540	T	0.41	.	9.9499	0.41631	0.0931:0.0:0.9069:0.0	.	382;547;547	E9PH58;E7EX20;Q14679	.;.;TTLL4_HUMAN	K	382;547;547;547	ENSP00000393332:E382K;ENSP00000375951:E547K;ENSP00000396555:E547K;ENSP00000258398:E547K	ENSP00000258398:E547K	E	+	1	0	TTLL4	219313529	0.988000	0.35896	0.933000	0.37362	0.012000	0.07955	2.144000	0.42197	2.435000	0.82474	0.561000	0.74099	GAA		0.433	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640		31	246	0	0	0	0.00623	0	31	246				
OBSL1	23363	broad.mit.edu	37	2	220431754	220431754	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:220431754C>A	ENST00000404537.1	-	5	1988	c.1932G>T	c.(1930-1932)caG>caT	p.Q644H	OBSL1_ENST00000265318.4_Missense_Mutation_p.Q644H|OBSL1_ENST00000373876.1_Missense_Mutation_p.Q644H|OBSL1_ENST00000603926.1_Missense_Mutation_p.Q644H|OBSL1_ENST00000289656.3_Missense_Mutation_p.Q231H|OBSL1_ENST00000373873.4_Missense_Mutation_p.Q644H	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	644					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		ACCAGGTACCCTGGATGATGG	0.602																																							uc010fwk.2		NA																	0					0						c.(1930-1932)CAG>CAT		obscurin-like 1							30.0	33.0	32.0					2																	220431754		1983	4162	6145	SO:0001583	missense	23363				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity	g.chr2:220431754C>A	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1932G>T	2.37:g.220431754C>A	ENSP00000385636:p.Gln644His					OBSL1_uc010fwl.1_Missense_Mutation_p.Q119H|OBSL1_uc002vmi.2_Missense_Mutation_p.Q644H|OBSL1_uc002vmj.2_Missense_Mutation_p.Q231H	p.Q644H	NM_015311	NP_056126	O75147	OBSL1_HUMAN		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)	5	1989	-		Renal(207;0.0376)	644					A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	c.1932G>T	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083136	0.36758	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	4.83	3.86	0.44501	Immunoglobulin-like fold (1);	.	.	.	.	T	0.45994	0.1370	L	0.37630	1.12	0.38793	D	0.955028	D;D;B;B	0.58268	0.982;0.982;0.06;0.068	D;D;B;B	0.64687	0.928;0.928;0.024;0.139	T	0.41787	-0.9489	9	0.42905	T	0.14	.	5.6074	0.17387	0.1866:0.6655:0.0:0.1479	.	645;644;231;644	A4KVA4;O75147;A8MSZ8;O75147-2	.;OBSL1_HUMAN;.;.	H	644;644;644;644;231	ENSP00000265318:Q644H;ENSP00000385636:Q644H;ENSP00000362983:Q644H;ENSP00000362980:Q644H;ENSP00000289656:Q231H	ENSP00000265318:Q644H	Q	-	3	2	OBSL1	220139998	0.005000	0.15991	1.000000	0.80357	0.993000	0.82548	-0.029000	0.12329	2.517000	0.84864	0.655000	0.94253	CAG		0.602	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1			26	37	1	0	7.33532e-06	0.003954	1.25884e-05	26	37				
NYAP2	57624	broad.mit.edu	37	2	226446863	226446863	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:226446863G>A	ENST00000272907.6	+	4	1143	c.730G>A	c.(730-732)Gtg>Atg	p.V244M	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	244					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												AGAGGAGCCCGTGTACATCGA	0.592																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(730-732)GTG>ATG		hypothetical protein LOC57624							111.0	118.0	116.0					2																	226446863		1946	4128	6074	SO:0001583	missense	57624							g.chr2:226446863G>A	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.730G>A	2.37:g.226446863G>A	ENSP00000272907:p.Val244Met					KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.V14M	p.V244M	NM_020864	NP_065915	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	4	905	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	244					A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	c.730G>A	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	32	5.121280	0.94385	.	.	ENSG00000144460	ENST00000272907	T	0.63580	-0.05	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.82291	0.5005	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.83324	-0.0016	10	0.72032	D	0.01	-34.3849	20.3541	0.98825	0.0:0.0:1.0:0.0	.	244	Q9P242	K1486_HUMAN	M	244	ENSP00000272907:V244M	ENSP00000272907:V244M	V	+	1	0	KIAA1486	226155107	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	9.472000	0.97709	2.816000	0.96949	0.644000	0.83932	GTG		0.592	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		14	309	0	0	0	0.004007	0	14	309				
COL4A4	1286	broad.mit.edu	37	2	227892700	227892700	+	Silent	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:227892700C>T	ENST00000396625.3	-	42	4206	c.3999G>A	c.(3997-3999)caG>caA	p.Q1333Q	COL4A4_ENST00000329662.7_Silent_p.Q1333Q	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1333	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CATGTGGTCCCTGCGGTCCCG	0.488																																							uc010zlt.1		NA																	0				ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11						c.(3997-3999)CAG>CAA		alpha 4 type IV collagen precursor							36.0	39.0	38.0					2																	227892700		1843	4091	5934	SO:0001819	synonymous_variant	1286				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding	g.chr2:227892700C>T		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.3999G>A	2.37:g.227892700C>T							p.Q1333Q	NM_000092	NP_000083	P53420	CO4A4_HUMAN		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)	42	4653	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	1333			Triple-helical region.		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	37	c.3999G>A	CCDS42828.1																																																																																				0.488	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092		19	59	0	0	0	0.006122	0	19	59				
RASSF2	9770	broad.mit.edu	37	20	4768901	4768901	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:4768901G>T	ENST00000379400.3	-	9	848	c.653C>A	c.(652-654)gCa>gAa	p.A218E	RASSF2_ENST00000379376.2_Missense_Mutation_p.A218E|RASSF2_ENST00000478553.1_5'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	218	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						AAACTCCTCTGCTGAATTCTC	0.378																																					Melanoma(158;1891 3343 50738)	Melanoma(158;1891 3343 50738)	uc002wld.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)	6						c.(652-654)GCA>GAA		Ras association domain family 2							116.0	117.0	117.0					20																	4768901		2203	4300	6503	SO:0001583	missense	9770				cell cycle|signal transduction	nucleus	protein binding	g.chr20:4768901G>T	D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.653C>A	20.37:g.4768901G>T	ENSP00000368710:p.Ala218Glu					RASSF2_uc002wlc.2_RNA|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Missense_Mutation_p.A218E|RASSF2_uc010gbh.2_5'Flank	p.A218E	NM_170774	NP_739580	P50749	RASF2_HUMAN			8	707	-			218			Ras-associating.		A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	ENST00000379400.3	37	c.653C>A	CCDS13083.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626649	0.46840	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.17054	2.3;2.3	5.18	5.18	0.71444	Ras-association (3);	0.096591	0.64402	D	0.000001	T	0.25606	0.0623	L	0.55481	1.735	0.21064	N	0.999796	B	0.25351	0.124	B	0.35655	0.207	T	0.20371	-1.0277	10	0.87932	D	0	.	17.4242	0.87522	0.0:0.0:1.0:0.0	.	218	P50749	RASF2_HUMAN	E	218	ENSP00000368710:A218E;ENSP00000368684:A218E	ENSP00000368684:A218E	A	-	2	0	RASSF2	4716901	0.977000	0.34250	0.059000	0.19551	0.918000	0.54935	4.881000	0.63114	2.698000	0.92095	0.655000	0.94253	GCA		0.378	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077828.1	NM_014737		67	71	1	0	7.33394e-39	0.01441	1.86682e-38	67	71				
BPIFB4	149954	broad.mit.edu	37	20	31685467	31685467	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:31685467C>A	ENST00000375483.3	+	11	1443	c.1443C>A	c.(1441-1443)atC>atA	p.I481I		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	481						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TCATCAGGATCCAGGTGCTGA	0.597																																							uc010zue.1		NA																	0					0						c.(1441-1443)ATC>ATA		antimicrobial peptide RY2G5 precursor							162.0	138.0	146.0					20																	31685467		2203	4300	6503	SO:0001819	synonymous_variant	149954					cytoplasm|extracellular region	lipid binding	g.chr20:31685467C>A	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1443C>A	20.37:g.31685467C>A							p.I481I	NM_182519	NP_872325	P59827	LPLC4_HUMAN			11	1458	+			481					Q5TDX6	Silent	SNP	ENST00000375483.3	37	c.1443C>A	CCDS13213.2																																																																																				0.597	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519		93	122	1	0	8.92586e-32	0.01441	2.14867e-31	93	122				
PTPRT	11122	broad.mit.edu	37	20	40730911	40730911	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:40730911C>A	ENST00000373187.1	-	26	3566	c.3567G>T	c.(3565-3567)gtG>gtT	p.V1189V	PTPRT_ENST00000373193.3_Silent_p.V1192V|PTPRT_ENST00000373201.1_Silent_p.V1179V|PTPRT_ENST00000373184.1_Silent_p.V1199V|PTPRT_ENST00000373190.1_Silent_p.V1188V|PTPRT_ENST00000373198.4_Silent_p.V1208V|PTPRT_ENST00000356100.2_Silent_p.V1198V			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1189	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CCTCGGGCCGCACACGGGGTG	0.562																																							uc002xkg.2		NA																	0				skin(8)|ovary(7)|lung(5)	20						c.(3565-3567)GTG>GTT		protein tyrosine phosphatase, receptor type, T							54.0	58.0	57.0					20																	40730911		2074	4227	6301	SO:0001819	synonymous_variant	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40730911C>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3567G>T	20.37:g.40730911C>A						PTPRT_uc010ggj.2_Silent_p.V1208V|PTPRT_uc010ggi.2_Silent_p.V392V	p.V1189V	NM_007050	NP_008981	O14522	PTPRT_HUMAN			26	3751	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	1189			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	c.3567G>T	CCDS42874.1																																																																																				0.562	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			18	80	1	0	1.67942e-08	0.006122	3.01841e-08	18	80				
PTPRT	11122	broad.mit.edu	37	20	40743842	40743842	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:40743842C>A	ENST00000373187.1	-	22	3095	c.3096G>T	c.(3094-3096)caG>caT	p.Q1032H	PTPRT_ENST00000373193.3_Missense_Mutation_p.Q1035H|PTPRT_ENST00000373201.1_Missense_Mutation_p.Q1022H|PTPRT_ENST00000373184.1_Missense_Mutation_p.Q1042H|PTPRT_ENST00000373190.1_Missense_Mutation_p.Q1031H|PTPRT_ENST00000373198.4_Missense_Mutation_p.Q1051H|PTPRT_ENST00000356100.2_Missense_Mutation_p.Q1041H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1032	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGCTTACCTTCTGGACTGTGA	0.527																																							uc002xkg.2		NA																	0				skin(8)|ovary(7)|lung(5)	20						c.(3094-3096)CAG>CAT		protein tyrosine phosphatase, receptor type, T							114.0	117.0	116.0					20																	40743842		1995	4151	6146	SO:0001583	missense	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40743842C>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3096G>T	20.37:g.40743842C>A	ENSP00000362283:p.Gln1032His					PTPRT_uc010ggj.2_Missense_Mutation_p.Q1051H|PTPRT_uc010ggi.2_Missense_Mutation_p.Q235H	p.Q1032H	NM_007050	NP_008981	O14522	PTPRT_HUMAN			22	3280	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	1032			Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	c.3096G>T	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.461902	0.43736	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	D;D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	5.65	3.39	0.38822	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.82912	0.5140	L	0.35249	1.045	0.80722	D	1	D;D	0.67145	0.995;0.996	P;P	0.61722	0.893;0.891	D	0.83611	0.0134	10	0.87932	D	0	.	9.3569	0.38173	0.0:0.7443:0.0:0.2557	.	1054;1032	O14522-1;O14522	.;PTPRT_HUMAN	H	1031;1032;1035;1041;1054;1042;1022	ENSP00000362286:Q1031H;ENSP00000362283:Q1032H;ENSP00000362289:Q1035H;ENSP00000348408:Q1041H;ENSP00000362294:Q1054H;ENSP00000362280:Q1042H;ENSP00000362297:Q1022H	ENSP00000348408:Q1041H	Q	-	3	2	PTPRT	40177256	0.983000	0.35010	1.000000	0.80357	0.877000	0.50540	0.216000	0.17585	1.393000	0.46605	-0.254000	0.11334	CAG		0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			29	94	1	0	8.4185e-14	0.012213	1.66492e-13	29	94				
TOX2	84969	broad.mit.edu	37	20	42635366	42635366	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:42635366C>A	ENST00000358131.5	+	3	580	c.372C>A	c.(370-372)ctC>ctA	p.L124L	TOX2_ENST00000423191.2_Silent_p.L73L|RN7SL443P_ENST00000464331.2_RNA|TOX2_ENST00000341197.4_Silent_p.L115L|TOX2_ENST00000372999.1_Silent_p.L73L	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	124					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCATGGACCTCCCAGCCATCA	0.637																																							uc002xlf.3		NA																	0				ovary(1)	1						c.(370-372)CTC>CTA		TOX high mobility group box family member 2							93.0	70.0	78.0					20																	42635366		2203	4300	6503	SO:0001819	synonymous_variant	84969				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr20:42635366C>A	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.372C>A	20.37:g.42635366C>A						TOX2_uc010ggo.2_Silent_p.L115L|TOX2_uc002xle.3_Silent_p.L73L|TOX2_uc010ggp.2_Silent_p.L73L|TOX2_uc002xlg.2_Silent_p.L73L	p.L124L	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		3	389	+		Myeloproliferative disorder(115;0.00452)	124					A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	37	c.372C>A	CCDS42875.1																																																																																				0.637	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2			34	24	1	0	6.90743e-12	0.003755	1.32185e-11	34	24				
HNF4A	3172	broad.mit.edu	37	20	43043291	43043291	+	Missense_Mutation	SNP	C	C	A	rs193922475		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:43043291C>A	ENST00000316099.4	+	5	726	c.637C>A	c.(637-639)Ctg>Atg	p.L213M	HNF4A_ENST00000443598.2_Missense_Mutation_p.L213M|HNF4A_ENST00000457232.1_Missense_Mutation_p.L191M|HNF4A_ENST00000415691.2_Missense_Mutation_p.L213M|HNF4A_ENST00000609795.1_Missense_Mutation_p.L191M|HNF4A_ENST00000316673.4_Missense_Mutation_p.L191M	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	213					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CGAGCTCCCCCTGGACGACCA	0.622																																					Colon(79;2 1269 8820 14841 52347)	Colon(79;2 1269 8820 14841 52347)	uc002xma.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(637-639)CTG>ATG		hepatocyte nuclear factor 4 alpha isoform b							70.0	52.0	58.0					20																	43043291		2203	4300	6503	SO:0001583	missense	3172				blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:43043291C>A	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.637C>A	20.37:g.43043291C>A	ENSP00000312987:p.Leu213Met					HNF4A_uc002xlt.2_Missense_Mutation_p.L191M|HNF4A_uc002xlu.2_Missense_Mutation_p.L191M|HNF4A_uc002xlv.2_Missense_Mutation_p.L191M|HNF4A_uc002xly.2_Missense_Mutation_p.L213M|HNF4A_uc002xlz.2_Missense_Mutation_p.L213M|HNF4A_uc010ggq.2_Missense_Mutation_p.L206M	p.L213M	NM_000457	NP_000448	P41235	HNF4A_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		5	726	+		Myeloproliferative disorder(115;0.0122)	213					A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	37	c.637C>A	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655219	0.67472	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.95238	-3.65;-3.65;-3.65;-3.65;-3.65	5.75	3.83	0.44106	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	M	0.87456	2.885	0.80722	D	1	D;B;B;D;D;D;B	0.76494	0.999;0.308;0.308;0.998;0.999;0.999;0.151	D;P;P;D;D;D;B	0.79784	0.993;0.463;0.463;0.975;0.993;0.982;0.333	D	0.97057	0.9768	10	0.72032	D	0.01	.	12.5414	0.56172	0.0:0.865:0.0:0.135	.	206;213;213;213;191;191;191	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	M	191;191;213;213;243;213	ENSP00000315180:L191M;ENSP00000396216:L191M;ENSP00000312987:L213M;ENSP00000410911:L213M;ENSP00000412111:L213M	ENSP00000312987:L213M	L	+	1	2	HNF4A	42476705	0.675000	0.27558	0.771000	0.31576	0.637000	0.38172	1.373000	0.34272	0.789000	0.33779	-0.251000	0.11542	CTG		0.622	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3			7	25	1	0	5.68852e-11	0.004482	1.07315e-10	7	25				
CDH22	64405	broad.mit.edu	37	20	44839121	44839121	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:44839121C>A	ENST00000372262.3	-	6	1511	c.1111G>T	c.(1111-1113)Gac>Tac	p.D371Y	CDH22_ENST00000474438.1_5'UTR|CDH22_ENST00000537909.1_Missense_Mutation_p.D371Y	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	371	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GTGCCCAGGTCGGCGAAGCGG	0.711																																							uc002xrm.2		NA																	0				ovary(4)|skin(1)	5						c.(1111-1113)GAC>TAC		cadherin 22 precursor							28.0	27.0	28.0					20																	44839121		2203	4299	6502	SO:0001583	missense	64405				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr20:44839121C>A	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1111G>T	20.37:g.44839121C>A	ENSP00000361336:p.Asp371Tyr					CDH22_uc010ghk.1_Missense_Mutation_p.D371Y|CDH22_uc002xrn.1_Missense_Mutation_p.D122Y	p.D371Y	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN			6	1512	-		Myeloproliferative disorder(115;0.0122)	371			Extracellular (Potential).|Cadherin 3.		B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	c.1111G>T	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189254	0.57909	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.60040	0.22;0.22	4.17	4.17	0.49024	Cadherin (3);Cadherin-like (1);	0.055407	0.64402	D	0.000001	T	0.64864	0.2637	L	0.37897	1.145	0.53005	D	0.999969	D	0.53312	0.959	D	0.65233	0.933	T	0.63386	-0.6649	10	0.34782	T	0.22	.	15.6457	0.77049	0.0:1.0:0.0:0.0	.	371	Q9UJ99	CAD22_HUMAN	Y	371	ENSP00000361336:D371Y;ENSP00000437790:D371Y	ENSP00000361336:D371Y	D	-	1	0	CDH22	44272528	0.723000	0.28027	0.998000	0.56505	0.983000	0.72400	1.438000	0.35002	2.171000	0.68590	0.555000	0.69702	GAC		0.711	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248		14	32	1	0	7.93312e-07	0.00245	1.39288e-06	14	32				
CDH22	64405	broad.mit.edu	37	20	44869744	44869744	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:44869744C>A	ENST00000372262.3	-	2	808	c.408G>T	c.(406-408)cgG>cgT	p.R136R	CDH22_ENST00000537909.1_Silent_p.R136R	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	136	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GAGCCTGGGCCCGCAGCGTGT	0.622																																							uc002xrm.2		NA																	0				ovary(4)|skin(1)	5						c.(406-408)CGG>CGT		cadherin 22 precursor							81.0	67.0	72.0					20																	44869744		2203	4300	6503	SO:0001819	synonymous_variant	64405				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr20:44869744C>A	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.408G>T	20.37:g.44869744C>A						CDH22_uc010ghk.1_Silent_p.R136R	p.R136R	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN			2	809	-		Myeloproliferative disorder(115;0.0122)	136			Extracellular (Potential).|Cadherin 1.		B9EGK7|O43205	Silent	SNP	ENST00000372262.3	37	c.408G>T	CCDS13395.1																																																																																				0.622	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248		24	93	1	0	7.07758e-08	0.004656	1.25929e-07	24	93				
ZNF831	128611	broad.mit.edu	37	20	57768321	57768321	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:57768321C>A	ENST00000371030.2	+	1	2247	c.2247C>A	c.(2245-2247)gtC>gtA	p.V749V		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	749							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCCCCCTGGTCTCTCCAAATG	0.642																																							uc002yan.2		NA																	0				skin(13)|ovary(1)	14						c.(2245-2247)GTC>GTA		zinc finger protein 831							18.0	22.0	20.0					20																	57768321		1938	4138	6076	SO:0001819	synonymous_variant	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57768321C>A	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2247C>A	20.37:g.57768321C>A							p.V749V	NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN			1	2247	+	all_lung(29;0.0085)		749					Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	37	c.2247C>A	CCDS42894.1																																																																																				0.642	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		12	9	1	0	0.000978159	0.010729	0.00162112	12	9				
ZNF831	128611	broad.mit.edu	37	20	57768439	57768439	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:57768439G>T	ENST00000371030.2	+	1	2365	c.2365G>T	c.(2365-2367)Gcc>Tcc	p.A789S		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	789							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGAAGGAGGTGCCCGAGGTGT	0.662																																							uc002yan.2		NA																	0				skin(13)|ovary(1)	14						c.(2365-2367)GCC>TCC		zinc finger protein 831							34.0	43.0	40.0					20																	57768439		1907	4109	6016	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57768439G>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2365G>T	20.37:g.57768439G>T	ENSP00000360069:p.Ala789Ser						p.A789S	NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN			1	2365	+	all_lung(29;0.0085)		789					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.2365G>T	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	6.299	0.423216	0.11928	.	.	ENSG00000124203	ENST00000371030	T	0.04360	3.64	4.42	-7.33	0.01431	.	2.087180	0.02304	N	0.071453	T	0.01661	0.0053	N	0.03608	-0.345	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.42649	-0.9439	10	0.08179	T	0.78	.	2.969	0.05917	0.1486:0.3549:0.3827:0.1138	.	789	Q5JPB2	ZN831_HUMAN	S	789	ENSP00000360069:A789S	ENSP00000360069:A789S	A	+	1	0	ZNF831	57201834	0.000000	0.05858	0.000000	0.03702	0.174000	0.22865	-2.144000	0.01296	-0.956000	0.03631	0.501000	0.49751	GCC		0.662	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		29	20	1	0	3.65163e-15	0.00632	7.47179e-15	29	20				
RBBP8NL	140893	broad.mit.edu	37	20	60985978	60985978	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:60985978C>A	ENST00000252998.1	-	14	2107	c.1951G>T	c.(1951-1953)Gac>Tac	p.D651Y		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	651						extracellular space (GO:0005615)											GGACTGTGGTCCTCGGCGTCC	0.677																																							uc002ycw.1		NA																	0					0						c.(1951-1953)GAC>TAC		hypothetical protein LOC140893							85.0	83.0	84.0					20																	60985978		2203	4300	6503	SO:0001583	missense	140893							g.chr20:60985978C>A	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.1951G>T	20.37:g.60985978C>A	ENSP00000252998:p.Asp651Tyr						p.D651Y	NM_080833	NP_543023	Q8NC74	CT151_HUMAN	BRCA - Breast invasive adenocarcinoma(19;6.43e-06)		14	2108	-	Breast(26;2.05e-08)		651					B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	ENST00000252998.1	37	c.1951G>T	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514927	0.27123	.	.	ENSG00000130701	ENST00000252998	T	0.20463	2.07	2.67	2.67	0.31697	.	.	.	.	.	T	0.24431	0.0592	N	0.24115	0.695	0.19775	N	0.999957	D	0.76494	0.999	D	0.64042	0.921	T	0.11227	-1.0596	9	0.18276	T	0.48	.	8.9702	0.35901	0.0:1.0:0.0:0.0	.	651	Q8NC74	CT151_HUMAN	Y	651	ENSP00000252998:D651Y	ENSP00000252998:D651Y	D	-	1	0	C20orf151	60419373	0.101000	0.21875	0.291000	0.24904	0.003000	0.03518	1.141000	0.31528	1.823000	0.53134	0.491000	0.48974	GAC		0.677	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833		76	85	1	0	1.24833e-42	0.01441	3.30405e-42	76	85				
BIRC7	79444	broad.mit.edu	37	20	61870819	61870819	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:61870819G>T	ENST00000217169.3	+	6	973	c.759G>T	c.(757-759)aaG>aaT	p.K253N	NKAIN4_ENST00000466885.1_5'Flank|BIRC7_ENST00000342412.6_Missense_Mutation_p.K235N|MIR3196_ENST00000579556.1_RNA|BIRC7_ENST00000395306.1_Missense_Mutation_p.K148N	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	253					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					GGACGTGCAAGGTGTGCCTGG	0.692																																							uc002yej.2		NA																	0				ovary(1)|lung(1)|kidney(1)	3						c.(757-759)AAG>AAT		livin inhibitor of apoptosis isoform alpha							91.0	82.0	85.0					20																	61870819		2203	4299	6502	SO:0001583	missense	79444				activation of JUN kinase activity|anti-apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytoplasm|nucleus	enzyme binding|zinc ion binding	g.chr20:61870819G>T	AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.759G>T	20.37:g.61870819G>T	ENSP00000217169:p.Lys253Asn					BIRC7_uc010gkc.1_3'UTR|BIRC7_uc002yei.2_Missense_Mutation_p.K235N	p.K253N	NM_139317	NP_647478	Q96CA5	BIRC7_HUMAN			6	932	+	all_cancers(38;2.72e-09)		253			RING-type.		Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	ENST00000217169.3	37	c.759G>T	CCDS13513.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121417	0.37436	.	.	ENSG00000101197	ENST00000342412;ENST00000217169;ENST00000395306	T;T;T	0.67345	3.59;3.59;-0.26	5.06	2.87	0.33458	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.144286	0.31495	N	0.007547	T	0.74794	0.3763	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	D;D	0.71414	0.973;0.955	T	0.74118	-0.3768	10	0.59425	D	0.04	.	6.3531	0.21387	0.393:0.0:0.607:0.0	.	253;235	Q96CA5;Q96CA5-2	BIRC7_HUMAN;.	N	235;253;148	ENSP00000345213:K235N;ENSP00000217169:K253N;ENSP00000378717:K148N	ENSP00000217169:K253N	K	+	3	2	BIRC7	61341264	0.994000	0.37717	1.000000	0.80357	0.035000	0.12851	0.781000	0.26774	1.119000	0.41883	-0.218000	0.12543	AAG		0.692	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080114.2	NM_139317		19	126	1	0	3.32936e-07	0.006122	5.86496e-07	19	126				
MYT1	4661	broad.mit.edu	37	20	62839775	62839775	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:62839775G>T	ENST00000328439.1	+	7	1590	c.1226G>T	c.(1225-1227)gGc>gTc	p.G409V	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.G409V	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Interaction with PIN1.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					AGCCAGCTGGGCCTGGGAGAG	0.657																																					GBM(59;481 1041 20555 21139 33705)	GBM(59;481 1041 20555 21139 33705)	uc002yii.2		NA																	0				ovary(2)	2						c.(1225-1227)GGC>GTC		myelin transcription factor 1							21.0	22.0	22.0					20																	62839775		2202	4295	6497	SO:0001583	missense	4661				cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:62839775G>T	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1226G>T	20.37:g.62839775G>T	ENSP00000327465:p.Gly409Val					MYT1_uc002yih.2_Intron|MYT1_uc002yij.2_Missense_Mutation_p.G41V	p.G409V	NM_004535	NP_004526	Q01538	MYT1_HUMAN			7	1590	+	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)		409					B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	c.1226G>T	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	g	1.586	-0.530422	0.04112	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.43294	0.95;0.96	4.46	2.22	0.28083	.	0.419959	0.24873	N	0.034910	T	0.25344	0.0616	L	0.51422	1.61	0.09310	N	0.999998	P;B	0.34724	0.465;0.204	B;B	0.28011	0.085;0.035	T	0.06356	-1.0831	10	0.17369	T	0.5	-7.2887	2.1727	0.03854	0.1096:0.1254:0.3705:0.3945	.	409;409	F5H7M8;Q01538	.;MYT1_HUMAN	V	409	ENSP00000327465:G409V;ENSP00000442412:G409V	ENSP00000327465:G409V	G	+	2	0	MYT1	62310219	0.980000	0.34600	0.396000	0.26296	0.241000	0.25554	3.192000	0.50989	0.843000	0.35070	0.450000	0.29827	GGC		0.657	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535		28	26	1	0	2.12542e-12	0.00632	4.11171e-12	28	26				
PCMTD2	55251	broad.mit.edu	37	20	62904813	62904813	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:62904813G>C	ENST00000308824.6	+	6	1073	c.946G>C	c.(946-948)Gag>Cag	p.E316Q	PCMTD2_ENST00000299468.7_Intron|PCMTD2_ENST00000266078.7_3'UTR|PCMTD2_ENST00000369758.4_Missense_Mutation_p.E289Q|PCMTD2_ENST00000609372.1_Missense_Mutation_p.E166Q	NM_018257.2	NP_060727.2	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2	316						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|upper_aerodigestive_tract(1)	17	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					AGACTTGGAAGAGGAACGGAG	0.537																																							uc002yil.3		NA																	0					0						c.(946-948)GAG>CAG		protein-L-isoaspartate (D-aspartate)							82.0	102.0	95.0					20																	62904813		2203	4300	6503	SO:0001583	missense	55251					cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity	g.chr20:62904813G>C	AK001745	CCDS13559.1, CCDS46631.1	20q13.33	2012-10-02	2005-10-06	2005-10-06	ENSG00000203880	ENSG00000203880			15882	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 36"""	C20orf36			Standard	NM_018257		Approved	FLJ10883	uc002yil.4	Q9NV79	OTTHUMG00000033029	ENST00000308824.6:c.946G>C	20.37:g.62904813G>C	ENSP00000307854:p.Glu316Gln					PCMTD2_uc002yim.3_Missense_Mutation_p.E289Q	p.E316Q	NM_018257	NP_060727	Q9NV79	PCMD2_HUMAN			6	1146	+	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)		316					E1P5H3|Q8IW60|Q9H4K2	Missense_Mutation	SNP	ENST00000308824.6	37	c.946G>C	CCDS13559.1	.	.	.	.	.	.	.	.	.	.	.	19.84	3.901524	0.72754	.	.	ENSG00000203880	ENST00000369758;ENST00000308824;ENST00000266078	T;T;T	0.55052	0.62;1.27;0.54	5.17	4.23	0.50019	.	0.378990	0.29100	N	0.013151	T	0.46464	0.1394	L	0.47190	1.495	0.48632	D	0.999685	B;B	0.30482	0.241;0.281	B;B	0.30495	0.116;0.04	T	0.48927	-0.8991	10	0.72032	D	0.01	-11.5754	11.7845	0.52034	0.0812:0.0:0.9188:0.0	.	289;316	Q9NV79-2;Q9NV79	.;PCMD2_HUMAN	Q	289;316;92	ENSP00000358773:E289Q;ENSP00000307854:E316Q;ENSP00000266078:E92Q	ENSP00000266078:E92Q	E	+	1	0	PCMTD2	62375257	1.000000	0.71417	0.148000	0.22405	0.924000	0.55760	4.558000	0.60789	1.178000	0.42870	0.655000	0.94253	GAG		0.537	PCMTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080301.1	NM_018257		90	94	0	0	0	0.01441	0	90	94				
TIAM1	7074	broad.mit.edu	37	21	32526706	32526706	+	Missense_Mutation	SNP	A	A	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr21:32526706A>C	ENST00000286827.3	-	18	3501	c.3030T>G	c.(3028-3030)caT>caG	p.H1010Q	TIAM1_ENST00000541036.1_Missense_Mutation_p.H950Q	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1010					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GGTTCATCTCATGCAAACTGC	0.572																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(3028-3030)CAT>CAG		T-cell lymphoma invasion and metastasis 1							134.0	120.0	125.0					21																	32526706		2203	4300	6503	SO:0001583	missense	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32526706A>C		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3030T>G	21.37:g.32526706A>C	ENSP00000286827:p.His1010Gln					TIAM1_uc011adk.1_Missense_Mutation_p.H1010Q|TIAM1_uc011adl.1_Missense_Mutation_p.H950Q	p.H1010Q	NM_003253	NP_003244	Q13009	TIAM1_HUMAN			18	3502	-			1010					B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.3030T>G	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.195037	0.38806	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.39787	1.06;1.08	4.55	-0.663	0.11410	.	0.053759	0.85682	D	0.000000	T	0.31231	0.0790	L	0.52573	1.65	0.52501	D	0.999952	P;P;P	0.46220	0.874;0.8;0.8	B;B;B	0.41894	0.369;0.203;0.203	T	0.14200	-1.0481	10	0.18710	T	0.47	.	8.8945	0.35455	0.6131:0.0:0.3869:0.0	.	950;950;1010	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	Q	1010;851;950	ENSP00000286827:H1010Q;ENSP00000441570:H950Q	ENSP00000286827:H1010Q	H	-	3	2	TIAM1	31448577	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	2.589000	0.46145	-0.095000	0.12351	0.533000	0.62120	CAT		0.572	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		76	62	0	0	0	0.01441	0	76	62				
PDE9A	5152	broad.mit.edu	37	21	44192569	44192569	+	Silent	SNP	C	C	T	rs200654083		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr21:44192569C>T	ENST00000291539.6	+	19	1767	c.1707C>T	c.(1705-1707)agC>agT	p.S569S	PDE9A_ENST00000398224.3_Silent_p.S442S|PDE9A_ENST00000335440.6_Silent_p.S467S|PDE9A_ENST00000335512.4_Silent_p.S509S|PDE9A_ENST00000398232.3_Silent_p.S502S|PDE9A_ENST00000539837.1_Silent_p.S441S|PDE9A_ENST00000380328.2_Silent_p.S516S|PDE9A_ENST00000398229.3_Silent_p.S435S|PDE9A_ENST00000398234.3_Silent_p.S468S|PDE9A_ENST00000398236.3_Silent_p.S483S|PDE9A_ENST00000398225.3_Silent_p.S528S|PDE9A_ENST00000349112.3_Silent_p.S441S|PDE9A_ENST00000398227.3_Silent_p.S409S|PDE9A_ENST00000328862.6_Silent_p.S543S|PDE9A_ENST00000470987.1_3'UTR	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	569					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	AGACTGACAGCTTGACGTCTG	0.532																																							uc002zbm.2		NA																	0				ovary(1)|skin(1)	2						c.(1705-1707)AGC>AGT		phosphodiesterase 9A isoform a							68.0	54.0	59.0					21																	44192569		2202	4300	6502	SO:0001819	synonymous_variant	5152				platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding	g.chr21:44192569C>T	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1707C>T	21.37:g.44192569C>T						PDE9A_uc002zbn.2_Silent_p.S442S|PDE9A_uc002zbo.2_Silent_p.S516S|PDE9A_uc002zbp.2_Silent_p.S362S|PDE9A_uc002zbq.2_Silent_p.S467S|PDE9A_uc002zbs.2_Silent_p.S362S|PDE9A_uc002zbr.2_Silent_p.S362S|PDE9A_uc002zbt.2_Silent_p.S441S|PDE9A_uc002zbu.2_Silent_p.S435S|PDE9A_uc002zbv.2_Silent_p.S409S|PDE9A_uc002zbw.2_Silent_p.S352S|PDE9A_uc002zbx.2_Silent_p.S509S|PDE9A_uc002zby.2_Silent_p.S352S|PDE9A_uc002zbz.2_Silent_p.S461S|PDE9A_uc002zca.2_Silent_p.S528S|PDE9A_uc002zcb.2_Silent_p.S543S|PDE9A_uc002zcc.2_Silent_p.S468S|PDE9A_uc002zcd.2_Silent_p.S483S|PDE9A_uc002zce.2_Silent_p.S502S|PDE9A_uc002zcf.2_Silent_p.S362S|PDE9A_uc002zcg.2_Silent_p.S362S|PDE9A_uc002zch.2_Silent_p.S352S	p.S569S	NM_002606	NP_002597	O76083	PDE9A_HUMAN			19	1770	+			569					B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Silent	SNP	ENST00000291539.6	37	c.1707C>T	CCDS13690.1																																																																																				0.532	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1			10	5	0	0	0	0.013537	0	10	5				
PWP2	5822	broad.mit.edu	37	21	45544482	45544482	+	Silent	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr21:45544482C>T	ENST00000291576.7	+	15	1966	c.1839C>T	c.(1837-1839)taC>taT	p.Y613Y		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	613					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		CCCTGTGCTACTCTGCAGACG	0.562																																							uc002zeb.2		NA																	0				pancreas(1)	1						c.(1837-1839)TAC>TAT		PWP2 periodic tryptophan protein homolog							106.0	79.0	88.0					21																	45544482		2203	4300	6503	SO:0001819	synonymous_variant	5822					cytoplasm|nucleolus	signal transducer activity	g.chr21:45544482C>T		CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.1839C>T	21.37:g.45544482C>T							p.Y613Y	NM_005049	NP_005040	Q15269	PWP2_HUMAN		STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)	15	1929	+			613			WD 13.		B2RAG8|Q96A77	Silent	SNP	ENST00000291576.7	37	c.1839C>T	CCDS33579.1																																																																																				0.562	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049		21	52	0	0	0	0.00333	0	21	52				
SEZ6L	23544	broad.mit.edu	37	22	26736548	26736548	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr22:26736548C>A	ENST00000248933.6	+	10	2257	c.2162C>A	c.(2161-2163)cCt>cAt	p.P721H	SEZ6L_ENST00000343706.4_Missense_Mutation_p.P721H|SEZ6L_ENST00000529632.2_Missense_Mutation_p.P721H|SEZ6L_ENST00000404234.3_Missense_Mutation_p.P721H|SEZ6L_ENST00000360929.3_Missense_Mutation_p.P721H|SEZ6L_ENST00000402979.1_Missense_Mutation_p.P494H|SEZ6L_ENST00000403121.1_Missense_Mutation_p.P494H			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	721	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CATTCGGACCCTGCTGGCCTC	0.488																																							uc003acb.2		NA																	0				ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(2161-2163)CCT>CAT		seizure related 6 homolog (mouse)-like							88.0	78.0	81.0					22																	26736548		2203	4300	6503	SO:0001583	missense	23544					endoplasmic reticulum membrane|integral to membrane		g.chr22:26736548C>A	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2162C>A	22.37:g.26736548C>A	ENSP00000248933:p.Pro721His					SEZ6L_uc003acc.2_Missense_Mutation_p.P721H|SEZ6L_uc011akc.1_Missense_Mutation_p.P721H|SEZ6L_uc003acd.2_Missense_Mutation_p.P721H|SEZ6L_uc011akd.1_Missense_Mutation_p.P721H|SEZ6L_uc003ace.2_Missense_Mutation_p.P721H|SEZ6L_uc003acf.1_Missense_Mutation_p.P494H|SEZ6L_uc010gvc.1_Missense_Mutation_p.P494H	p.P721H	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN			10	2318	+			721			CUB 3.|Extracellular (Potential).		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	c.2162C>A	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560649	0.86335	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.14	5.14	0.70334	CUB (5);	0.000000	0.56097	D	0.000036	T	0.35307	0.0927	L	0.43923	1.385	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.77004	0.983;0.989;0.985;0.982;0.989;0.989;0.989	T	0.01557	-1.1325	10	0.48119	T	0.1	.	17.7636	0.88470	0.0:1.0:0.0:0.0	.	721;721;494;721;721;721;721	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	H	721;721;721;721;721;494;494	ENSP00000384772:P721H;ENSP00000437037:P721H;ENSP00000354185:P721H;ENSP00000248933:P721H;ENSP00000342661:P721H;ENSP00000384838:P494H;ENSP00000384733:P494H	ENSP00000248933:P721H	P	+	2	0	SEZ6L	25066548	1.000000	0.71417	0.994000	0.49952	0.946000	0.59487	7.149000	0.77396	2.668000	0.90789	0.462000	0.41574	CCT		0.488	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			71	43	1	0	1.93348e-29	0.01441	4.59201e-29	71	43				
SYN3	8224	broad.mit.edu	37	22	32914053	32914053	+	Silent	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr22:32914053T>A	ENST00000358763.2	-	13	1829	c.1587A>T	c.(1585-1587)ccA>ccT	p.P529P	SYN3_ENST00000467095.1_5'UTR|SYN3_ENST00000332840.5_Silent_p.P529P	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	529	J; Pro-rich linker.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GGGGTGGTGCTGGCTTCTTGG	0.592																																							uc003amx.2		NA																	0				skin(1)	1						c.(1585-1587)CCA>CCT		synapsin III isoform IIIa							70.0	80.0	76.0					22																	32914053		2203	4300	6503	SO:0001819	synonymous_variant	8224				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity	g.chr22:32914053T>A	AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.1587A>T	22.37:g.32914053T>A						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Silent_p.P528P|SYN3_uc011amc.1_Silent_p.P163P	p.P529P	NM_003490	NP_003481	O14994	SYN3_HUMAN			12	1746	-			529			J; Pro-rich linker.		B1B1F9	Silent	SNP	ENST00000358763.2	37	c.1587A>T	CCDS13908.1																																																																																				0.592	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075892.4			70	55	0	0	0	0.01441	0	70	55				
PNPLA3	80339	broad.mit.edu	37	22	44333104	44333104	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr22:44333104C>T	ENST00000216180.3	+	6	1104	c.931C>T	c.(931-933)Ccc>Tcc	p.P311S	PNPLA3_ENST00000423180.2_Missense_Mutation_p.P307S	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	311					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				CAGCATCCTGCCCTGGGATGA	0.607																																							uc003bei.1		NA																	0					0						c.(931-933)CCC>TCC		patatin-like phospholipase domain containing 3							96.0	77.0	83.0					22																	44333104		2203	4300	6503	SO:0001583	missense	80339				triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity	g.chr22:44333104C>T		CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.931C>T	22.37:g.44333104C>T	ENSP00000216180:p.Pro311Ser					PNPLA3_uc010gzm.1_RNA	p.P311S	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN			6	1104	+		Ovarian(80;0.024)|all_neural(38;0.0416)	311			Lumenal (Potential).		B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Missense_Mutation	SNP	ENST00000216180.3	37	c.931C>T	CCDS14054.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464967	0.26335	.	.	ENSG00000100344	ENST00000216180;ENST00000423180	T;T	0.29142	1.58;1.58	4.99	1.59	0.23543	.	0.709072	0.13346	N	0.394788	T	0.16854	0.0405	L	0.34521	1.04	0.09310	N	1	B	0.31485	0.325	B	0.26864	0.074	T	0.15896	-1.0421	10	0.23891	T	0.37	-13.2075	3.2221	0.06719	0.1825:0.5449:0.1765:0.0961	.	311	Q9NST1	PLPL3_HUMAN	S	311;307	ENSP00000216180:P311S;ENSP00000397987:P307S	ENSP00000216180:P311S	P	+	1	0	PNPLA3	42664437	0.146000	0.22672	0.269000	0.24586	0.620000	0.37586	0.357000	0.20199	0.573000	0.29400	0.462000	0.41574	CCC		0.607	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318891.1	NM_025225		10	38	0	0	0	0.006214	0	10	38				
PHF21B	112885	broad.mit.edu	37	22	45312349	45312349	+	Silent	SNP	C	C	T	rs560827322		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr22:45312349C>T	ENST00000313237.5	-	4	525	c.375G>A	c.(373-375)gcG>gcA	p.A125A	PHF21B_ENST00000396103.3_Silent_p.A125A|PHF21B_ENST00000447824.3_Silent_p.A113A|PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000404079.2_Silent_p.A113A	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	125							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGCTGCCGGGCGCTGGCACAT	0.701																																							uc003bfn.2		NA																	0				ovary(2)|skin(1)	3						c.(373-375)GCG>GCA		PHD finger protein 21B isoform 1							23.0	27.0	26.0					22																	45312349		2194	4292	6486	SO:0001819	synonymous_variant	112885						zinc ion binding	g.chr22:45312349C>T	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.375G>A	22.37:g.45312349C>T						PHF21B_uc003bfm.2_5'UTR|PHF21B_uc011aqk.1_Silent_p.A113A|PHF21B_uc011aql.1_Silent_p.A125A|PHF21B_uc011aqm.1_Silent_p.A113A	p.A125A	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)	4	526	-		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)	125					B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Silent	SNP	ENST00000313237.5	37	c.375G>A	CCDS14061.1																																																																																				0.701	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415		23	64	0	0	0	0.00333	0	23	64				
SUMF1	285362	broad.mit.edu	37	3	4459759	4459759	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:4459759C>A	ENST00000272902.5	-	5	695	c.660G>T	c.(658-660)tgG>tgT	p.W220C	SUMF1_ENST00000405420.2_Missense_Mutation_p.W220C|SUMF1_ENST00000534863.1_Missense_Mutation_p.W220C|SUMF1_ENST00000458465.2_Intron|SUMF1_ENST00000383843.5_Missense_Mutation_p.W195C	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	220					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		GCTTCCCTGCCCAAGTGCAGT	0.502																																							uc003bpz.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(658-660)TGG>TGT		sulfatase modifying factor 1 isoform 1							82.0	85.0	84.0					3																	4459759		2203	4300	6503	SO:0001583	missense	285362					endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity	g.chr3:4459759C>A	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.660G>T	3.37:g.4459759C>A	ENSP00000272902:p.Trp220Cys					SUMF1_uc003bps.1_RNA|SUMF1_uc011ass.1_Missense_Mutation_p.W195C|SUMF1_uc010hby.1_Missense_Mutation_p.W220C|SUMF1_uc011ast.1_Intron	p.W220C	NM_182760	NP_877437	Q8NBK3	SUMF1_HUMAN		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)	5	685	-		Melanoma(143;0.068)|Colorectal(144;0.233)	220					B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Missense_Mutation	SNP	ENST00000272902.5	37	c.660G>T	CCDS2564.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302225	0.60195	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000383843;ENST00000405420	D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01	6.13	6.13	0.99165	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.106740	0.64402	D	0.000001	D	0.99432	0.9799	H	0.97587	4.035	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.995;0.997;0.997	D	0.98507	1.0617	10	0.87932	D	0	-26.0136	19.6116	0.95608	0.0:1.0:0.0:0.0	.	195;220;220	G5E9B0;E9PGL0;Q8NBK3	.;.;SUMF1_HUMAN	C	220;220;220;195;220	ENSP00000440421:W220C;ENSP00000272902:W220C;ENSP00000373355:W195C;ENSP00000384977:W220C	ENSP00000272902:W220C	W	-	3	0	SUMF1	4434759	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	6.929000	0.75852	2.932000	0.99384	0.644000	0.83932	TGG		0.502	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206591.2	NM_182760		108	69	1	0	1.09905e-38	0.01441	2.78425e-38	108	69				
NUP210	23225	broad.mit.edu	37	3	13415250	13415250	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:13415250C>A	ENST00000254508.5	-	12	1637	c.1555G>T	c.(1555-1557)Gtg>Ttg	p.V519L		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	519					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GGGTTCTGCACATCATGTGCC	0.587																																							uc003bxv.1		NA																	0				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11						c.(1555-1557)GTG>TTG		nucleoporin 210 precursor							156.0	116.0	130.0					3																	13415250		2203	4300	6503	SO:0001583	missense	23225				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore		g.chr3:13415250C>A	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1555G>T	3.37:g.13415250C>A	ENSP00000254508:p.Val519Leu					NUP210_uc003bxx.2_Missense_Mutation_p.V191L	p.V519L	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN			12	1638	-	all_neural(104;0.187)		519			Lumenal (Probable).		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	c.1555G>T	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	C	7.565	0.665617	0.14710	.	.	ENSG00000132182	ENST00000254508	T	0.05447	3.44	5.8	1.87	0.25490	Invasin/intimin cell-adhesion (1);	0.221978	0.38663	N	0.001607	T	0.05273	0.0140	L	0.46885	1.475	0.34395	D	0.69464	B;B	0.18013	0.025;0.015	B;B	0.15052	0.006;0.012	T	0.29579	-1.0007	10	0.27785	T	0.31	.	3.9777	0.09481	0.2313:0.5311:0.1119:0.1256	.	519;519	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	L	519	ENSP00000254508:V519L	ENSP00000254508:V519L	V	-	1	0	NUP210	13390250	0.973000	0.33851	0.027000	0.17364	0.098000	0.18820	1.185000	0.32065	0.059000	0.16252	-0.169000	0.13324	GTG		0.587	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923		43	25	1	0	2.43139e-17	0.01441	5.09252e-17	43	25				
ULK4	54986	broad.mit.edu	37	3	41996204	41996204	+	Silent	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:41996204A>T	ENST00000301831.4	-	2	510	c.48T>A	c.(46-48)acT>acA	p.T16T	ULK4_ENST00000420927.1_Silent_p.T16T|ULK4_ENST00000414606.1_Silent_p.T16T	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	16	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TATAGACAACAGTCTTGCTTC	0.418																																							uc003ckv.3		NA																	0					0						c.(46-48)ACT>ACA		unc-51-like kinase 4							145.0	138.0	140.0					3																	41996204		1872	4107	5979	SO:0001819	synonymous_variant	54986						ATP binding|protein serine/threonine kinase activity	g.chr3:41996204A>T	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.48T>A	3.37:g.41996204A>T						ULK4_uc003ckw.2_Silent_p.T16T|ULK4_uc003ckx.1_Silent_p.T16T	p.T16T	NM_017886	NP_060356	Q96C45	ULK4_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.214)	2	249	-			16			Protein kinase.		A6NF15|Q8IW79|Q9NWV6|Q9UF96	Silent	SNP	ENST00000301831.4	37	c.48T>A	CCDS43071.1																																																																																				0.418	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		75	50	0	0	0	0.01441	0	75	50				
RHOA	387	broad.mit.edu	37	3	49412905	49412905	+	Nonsense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:49412905C>A	ENST00000418115.1	-	2	502	c.118G>T	c.(118-120)Gag>Tag	p.E40*	RHOA_ENST00000422781.1_Nonsense_Mutation_p.E40*|RHOA_ENST00000454011.2_Nonsense_Mutation_p.E40*	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	40					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.E40Q(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		ACATAGTTCTCAAACACTGTG	0.438																																							uc003cwu.2		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)	ovary(2)	2						c.(118-120)GAG>TAG		ras homolog gene family, member A precursor	Atorvastatin(DB01076)|Simvastatin(DB00641)						157.0	147.0	150.0					3																	49412905		2203	4300	6503	SO:0001587	stop_gained	387				axon guidance|interspecies interaction between organisms|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of axonogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of neuron differentiation|positive regulation of NF-kappaB import into nucleus|positive regulation of stress fiber assembly|regulation of cell migration|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|spindle assembly involved in mitosis	cytoskeleton|cytosol|plasma membrane	GTP binding|GTPase activity|myosin binding	g.chr3:49412905C>A	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.118G>T	3.37:g.49412905C>A	ENSP00000400175:p.Glu40*					RHOA_uc010hku.2_5'UTR	p.E40*	NM_001664	NP_001655	P61586	RHOA_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	2	394	-			40			Effector region (Potential).		P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Nonsense_Mutation	SNP	ENST00000418115.1	37	c.118G>T	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	C	37	6.051123	0.97236	.	.	ENSG00000067560	ENST00000418115;ENST00000454011;ENST00000422781;ENST00000445425;ENST00000431929	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.8947	0.92419	0.0:1.0:0.0:0.0	.	.	.	.	X	40	.	ENSP00000400175:E40X	E	-	1	0	RHOA	49387909	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.687000	0.84139	2.809000	0.96659	0.558000	0.71614	GAG		0.438	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664		118	91	1	0	3.41453e-61	0.01441	9.51063e-61	118	91				
IL17RD	54756	broad.mit.edu	37	3	57130439	57130439	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:57130439G>A	ENST00000296318.7	-	13	2290	c.2202C>T	c.(2200-2202)caC>caT	p.H734H	IL17RD_ENST00000463523.1_Silent_p.H590H|IL17RD_ENST00000320057.5_Silent_p.H590H|IL17RD_ENST00000427856.2_Silent_p.H710H	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	734					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		GGGCGACCGCGTGGAGTTCAT	0.547																																							uc003dil.2		NA																	0					0						c.(2200-2202)CAC>CAT		interleukin 17 receptor D precursor							172.0	160.0	164.0					3																	57130439		2203	4300	6503	SO:0001819	synonymous_variant	54756					Golgi membrane|integral to membrane|plasma membrane	receptor activity	g.chr3:57130439G>A	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.2202C>T	3.37:g.57130439G>A						IL17RD_uc003dik.2_Silent_p.H710H|IL17RD_uc010hna.2_Silent_p.H590H	p.H734H	NM_017563	NP_060033	Q8NFM7	I17RD_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)	13	2291	-			734			Cytoplasmic (Potential).		Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Silent	SNP	ENST00000296318.7	37	c.2202C>T	CCDS2880.2																																																																																				0.547	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563		116	65	0	0	0	0.01441	0	116	65				
ARL6	84100	broad.mit.edu	37	3	97506897	97506897	+	Missense_Mutation	SNP	T	T	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:97506897T>G	ENST00000463745.1	+	6	890	c.413T>G	c.(412-414)gTg>gGg	p.V138G	ARL6_ENST00000394206.1_Missense_Mutation_p.V138G|ARL6_ENST00000335979.2_Missense_Mutation_p.V138G|ARL6_ENST00000496713.1_3'UTR	NM_001278293.1	NP_001265222.1	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	138					cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|melanosome transport (GO:0032402)|protein polymerization (GO:0051258)|protein targeting to membrane (GO:0006612)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	axonemal microtubule (GO:0005879)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane coat (GO:0030117)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)			large_intestine(1)|lung(4)	5		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		AGAGATGCAGTGACATCTGTA	0.323																																							uc003drv.2		NA																	0					0						c.(412-414)GTG>GGG		ADP-ribosylation factor-like 6							90.0	91.0	90.0					3																	97506897		2203	4298	6501	SO:0001583	missense	84100	Bardet-Biedl_syndrome			cilium assembly|determination of left/right symmetry|melanosome transport|protein polymerization|protein targeting to membrane|small GTPase mediated signal transduction|visual perception|Wnt receptor signaling pathway	axonemal microtubule|cilium axoneme|cilium membrane|membrane coat|microtubule basal body	GTP binding|metal ion binding|phospholipid binding|protein binding	g.chr3:97506897T>G	BC024239	CCDS2928.1	3q11.2	2014-05-09			ENSG00000113966	ENSG00000113966		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	13210	protein-coding gene	gene with protein product		608845		BBS3		15258860, 15314642, 21282186	Standard	NM_032146		Approved	RP55	uc003drv.3	Q9H0F7	OTTHUMG00000159189	ENST00000463745.1:c.413T>G	3.37:g.97506897T>G	ENSP00000419619:p.Val138Gly					ARL6_uc003drw.2_RNA|ARL6_uc003dru.2_Missense_Mutation_p.V138G|ARL6_uc010hoy.2_Missense_Mutation_p.V138G	p.V138G	NM_177976	NP_816931	Q9H0F7	ARL6_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)	7	726	+		Lung NSC(201;0.0193)|Prostate(884;0.174)	138					A8KA93|D3DN31	Missense_Mutation	SNP	ENST00000463745.1	37	c.413T>G	CCDS2928.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.88|17.88	3.497819|3.497819	0.64186|0.64186	.|.	.|.	ENSG00000113966|ENSG00000113966	ENST00000463745;ENST00000335979;ENST00000394206|ENST00000476753	T;T;T|.	0.64991|.	-0.13;-0.13;-0.13|.	5.49|5.49	5.49|5.49	0.81192|0.81192	Small GTP-binding protein domain (1);|.	0.210747|.	0.42053|.	D|.	0.000766|.	T|.	0.71986|.	0.3405|.	M|M	0.69463|0.69463	2.115|2.115	0.80722|0.80722	D|D	1|1	P|.	0.50710|.	0.938|.	P|.	0.53062|.	0.717|.	T|.	0.71998|.	-0.4423|.	10|.	0.87932|.	D|.	0|.	.|.	14.117|14.117	0.65161|0.65161	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	138|.	Q9H0F7|.	ARL6_HUMAN|.	G|G	138|33	ENSP00000419619:V138G;ENSP00000337722:V138G;ENSP00000377756:V138G|.	ENSP00000337722:V138G|.	V|X	+|+	2|1	0|0	ARL6|ARL6	98989587|98989587	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.655000|7.655000	0.83696|0.83696	2.206000|2.206000	0.71126|0.71126	0.533000|0.533000	0.62120|0.62120	GTG|TGA		0.323	ARL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353756.1	NM_032146		29	42	0	0	0	0.00632	0	29	42				
GATA2	2624	broad.mit.edu	37	3	128200788	128200788	+	Splice_Site	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:128200788C>A	ENST00000341105.2	-	5	1349		c.e5-1		GATA2_ENST00000430265.2_Intron|GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000487848.1_Splice_Site	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2						blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		TGGCGGCCGACTGGGAGGGCA	0.657			Mis		AML(CML blast transformation)																																		uc003ekm.3		NA		Dom	yes		3	3q21.3	2624	Mis	GATA binding protein 2			L			AML(CML blast transformation)		0				haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15						c.e6-1		GATA binding protein 2 isoform 1							72.0	59.0	64.0					3																	128200788		2203	4300	6503	SO:0001630	splice_region_variant	2624				blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	g.chr3:128200788C>A	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1018-1G>T	3.37:g.128200788C>A						GATA2_uc003ekn.3_Intron|GATA2_uc003eko.2_Splice_Site_p.S340_splice	p.S340_splice	NM_001145661	NP_001139133	P23769	GATA2_HUMAN		GBM - Glioblastoma multiforme(114;0.173)	6	1453	-								D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Splice_Site	SNP	ENST00000341105.2	37	c.1018_splice	CCDS3049.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.330578	0.81690	.	.	ENSG00000179348	ENST00000341105;ENST00000487848	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1809	0.89777	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GATA2	129683478	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.749000	0.85096	2.271000	0.75665	0.591000	0.81541	.		0.657	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1	NM_032638	Intron	39	18	1	0	3.61848e-18	0.007835	7.63901e-18	39	18				
IGSF10	285313	broad.mit.edu	37	3	151164418	151164418	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr3:151164418G>A	ENST00000282466.3	-	4	3350	c.3351C>T	c.(3349-3351)ccC>ccT	p.P1117P		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1117					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.P1117P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTCTACACTGGGTTTGTTCT	0.433																																							uc011bod.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(7)|ovary(5)|central_nervous_system(1)	13						c.(3349-3351)CCC>CCT		immunoglobulin superfamily, member 10 precursor							128.0	134.0	132.0					3																	151164418		2203	4300	6503	SO:0001819	synonymous_variant	285313				cell differentiation|multicellular organismal development|ossification	extracellular region		g.chr3:151164418G>A	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3351C>T	3.37:g.151164418G>A							p.P1117P	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		4	3351	-			1117					Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	c.3351C>T	CCDS3160.1																																																																																				0.433	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822		127	84	0	0	0	0.01441	0	127	84				
FAM193A	8603	broad.mit.edu	37	4	2661397	2661397	+	Splice_Site	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:2661397G>T	ENST00000324666.5	+	7	980	c.629G>T	c.(628-630)aGa>aTa	p.R210I	FAM193A_ENST00000545951.1_Splice_Site_p.R210I|FAM193A_ENST00000502458.1_Splice_Site_p.R234I|FAM193A_ENST00000382839.3_Splice_Site_p.R210I|FAM193A_ENST00000505311.1_Splice_Site_p.R210I	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	210										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						TACAGGAGAAGGTAAGGCTGG	0.552																																							uc010icl.2		NA																	0				ovary(3)	3						c.(628-630)AGA>ATA		hypothetical protein LOC8603							93.0	89.0	90.0					4																	2661397		2203	4300	6503	SO:0001630	splice_region_variant	8603							g.chr4:2661397G>T	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.629+1G>T	4.37:g.2661397G>T						FAM193A_uc010ick.2_Missense_Mutation_p.R410I|FAM193A_uc003gfd.2_Missense_Mutation_p.R210I|FAM193A_uc011bvm.1_Missense_Mutation_p.R234I|FAM193A_uc011bvn.1_Missense_Mutation_p.R210I|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.R64I	p.R210I	NM_003704	NP_003695	P78312	F193A_HUMAN			7	980	+			210					B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	c.629G>T	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	G	32	5.119595	0.94385	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.39229	1.12;1.52;1.11;1.12;1.09	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.997;0.997;0.997;0.997	T	0.64054	-0.6497	10	0.87932	D	0	-24.2438	19.0808	0.93180	0.0:0.0:1.0:0.0	.	210;234;210;234;210	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	I	210;210;210;234;64	ENSP00000372290:R210I;ENSP00000324587:R210I;ENSP00000443617:R210I;ENSP00000427505:R234I;ENSP00000427260:R64I	ENSP00000324587:R210I	R	+	2	0	FAM193A	2631195	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	9.268000	0.95675	2.745000	0.94114	0.561000	0.74099	AGA		0.552	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	Missense_Mutation	22	142	1	0	1.55795e-14	0.012319	3.11589e-14	22	142				
CLNK	116449	broad.mit.edu	37	4	10527500	10527500	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:10527500G>T	ENST00000226951.6	-	14	935	c.696C>A	c.(694-696)aaC>aaA	p.N232K	CLNK_ENST00000442825.2_Intron	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	232					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						GAGTATTTTGGTTTTCTAACA	0.418																																					GBM(87;402 1286 6949 13902 35851)	GBM(87;402 1286 6949 13902 35851)	uc003gmo.3		NA																	0				ovary(1)	1						c.(694-696)AAC>AAA		mast cell immunoreceptor signal transducer							86.0	80.0	82.0					4																	10527500		1829	4075	5904	SO:0001583	missense	116449				immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity	g.chr4:10527500G>T	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.696C>A	4.37:g.10527500G>T	ENSP00000226951:p.Asn232Lys						p.N232K	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN			14	833	-			232					Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	37	c.696C>A	CCDS47024.1	.	.	.	.	.	.	.	.	.	.	G	3.970	-0.008589	0.07727	.	.	ENSG00000109684	ENST00000226951;ENST00000429087	T	0.21361	2.01	3.9	0.639	0.17747	.	0.635484	0.14586	N	0.310562	T	0.11196	0.0273	L	0.29908	0.895	0.09310	N	0.999999	B	0.22346	0.068	B	0.15870	0.014	T	0.28364	-1.0046	10	0.24483	T	0.36	-7.5639	2.9153	0.05750	0.2737:0.0:0.5255:0.2007	.	232	Q7Z7G1	CLNK_HUMAN	K	232;196	ENSP00000226951:N232K	ENSP00000226951:N232K	N	-	3	2	CLNK	10136598	0.104000	0.21937	0.058000	0.19502	0.201000	0.24016	-0.157000	0.10085	0.070000	0.16634	0.563000	0.77884	AAC		0.418	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964		12	0	1	0	6.81908e-15	0.00245	1.38464e-14	12	0				
NKX3-2	579	broad.mit.edu	37	4	13543927	13543927	+	Missense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:13543927A>T	ENST00000382438.5	-	2	1327	c.692T>A	c.(691-693)cTg>cAg	p.L231Q		NM_001189.3	NP_001180.1	P78367	NKX32_HUMAN	NK3 homeobox 2	231					determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|intestinal epithelial cell development (GO:0060576)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|organ formation (GO:0048645)|pancreas development (GO:0031016)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|spleen development (GO:0048536)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						GGGCCCGGACAGGTAGCGCTG	0.672																																							uc003gmx.2		NA																	0					0						c.(691-693)CTG>CAG		NK3 homeobox 2							9.0	11.0	10.0					4																	13543927		2172	4286	6458	SO:0001583	missense	579				negative regulation of chondrocyte differentiation|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr4:13543927A>T	AF009801	CCDS3410.1	4p16.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000109705	ENSG00000109705		"""Homeoboxes / ANTP class : NKL subclass"""	951	protein-coding gene	gene with protein product		602183	"""bagpipe homeobox homolog 1 (Drosophila)"""	BAPX1		9344671	Standard	NM_001189		Approved	NKX3B, NKX3.2	uc003gmx.2	P78367	OTTHUMG00000090657	ENST00000382438.5:c.692T>A	4.37:g.13543927A>T	ENSP00000371875:p.Leu231Gln						p.L231Q	NM_001189	NP_001180	P78367	NKX32_HUMAN			2	768	-			231			Homeobox.		Q2M2I7	Missense_Mutation	SNP	ENST00000382438.5	37	c.692T>A	CCDS3410.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.851034	0.91277	.	.	ENSG00000109705	ENST00000382438	D	0.97161	-4.27	5.36	4.1	0.47936	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000002	D	0.99058	0.9677	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98423	1.0578	10	0.87932	D	0	.	10.9767	0.47469	0.8436:0.1564:0.0:0.0	.	231	P78367	NKX32_HUMAN	Q	231	ENSP00000371875:L231Q	ENSP00000371875:L231Q	L	-	2	0	NKX3-2	13153025	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.198000	0.77823	2.037000	0.60232	0.454000	0.30748	CTG		0.672	NKX3-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207317.3			7	14	0	0	0	0.001984	0	7	14				
ARAP2	116984	broad.mit.edu	37	4	36148964	36148964	+	Nonsense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:36148964G>A	ENST00000303965.4	-	19	3706	c.3217C>T	c.(3217-3219)Caa>Taa	p.Q1073*		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1073	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TCCCCATTTTGAACCATTGTG	0.353																																							uc003gsq.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(3217-3219)CAA>TAA		ArfGAP with RhoGAP domain, ankyrin repeat and PH							96.0	107.0	103.0					4																	36148964		2201	4299	6500	SO:0001587	stop_gained	116984				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding	g.chr4:36148964G>A	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3217C>T	4.37:g.36148964G>A	ENSP00000302895:p.Gln1073*						p.Q1073*	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN			19	3555	-			1073			PH 4.		Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Nonsense_Mutation	SNP	ENST00000303965.4	37	c.3217C>T	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	G	46	12.779997	0.99696	.	.	ENSG00000047365	ENST00000303965	.	.	.	5.24	5.24	0.73138	.	0.130037	0.52532	D	0.000079	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.8229	0.92105	0.0:0.0:1.0:0.0	.	.	.	.	X	1073	.	ENSP00000302895:Q1073X	Q	-	1	0	ARAP2	35825359	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.338000	0.65947	2.429000	0.82318	0.650000	0.86243	CAA		0.353	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230		211	120	0	0	0	0.01441	0	211	120				
N4BP2	55728	broad.mit.edu	37	4	40122701	40122701	+	Silent	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:40122701A>G	ENST00000261435.6	+	9	3386	c.2970A>G	c.(2968-2970)gtA>gtG	p.V990V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	990					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						CTGGAGTAGTAGAACCACAAA	0.448																																							uc003guy.3		NA																	0				lung(3)|breast(2)|kidney(2)|ovary(1)	8						c.(2968-2970)GTA>GTG		Nedd4 binding protein 2							78.0	75.0	76.0					4																	40122701		2203	4300	6503	SO:0001819	synonymous_variant	55728					cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding	g.chr4:40122701A>G	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2970A>G	4.37:g.40122701A>G						N4BP2_uc010ifq.2_Silent_p.V910V|N4BP2_uc010ifr.2_Silent_p.V910V	p.V990V	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN			9	3308	+			990					A0AVR3|Q9NVK2|Q9P2D4	Silent	SNP	ENST00000261435.6	37	c.2970A>G	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.934446	0.00488	.	.	ENSG00000078177	ENST00000513269	.	.	.	5.6	-4.97	0.03029	.	.	.	.	.	T	0.31949	0.0813	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.36456	-0.9747	4	.	.	.	-2.2914	11.1377	0.48383	0.4192:0.0926:0.4882:0.0	.	.	.	.	G	637	.	.	R	+	1	2	N4BP2	39799096	0.017000	0.18338	0.000000	0.03702	0.000000	0.00434	0.085000	0.14912	-1.143000	0.02866	-1.937000	0.00501	AGA		0.448	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177		26	111	0	0	0	0.00632	0	26	111				
LRRC66	339977	broad.mit.edu	37	4	52861367	52861367	+	Silent	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:52861367C>A	ENST00000343457.3	-	4	1827	c.1821G>T	c.(1819-1821)ggG>ggT	p.G607G		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	607						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GTTCAGTGCCCCCTCTTTCCT	0.463																																							uc003gzi.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1819-1821)GGG>GGT		leucine rich repeat containing 66							75.0	76.0	75.0					4																	52861367		1968	4175	6143	SO:0001819	synonymous_variant	339977					integral to membrane		g.chr4:52861367C>A	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1821G>T	4.37:g.52861367C>A							p.G607G	NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN			4	1834	-			607						Silent	SNP	ENST00000343457.3	37	c.1821G>T	CCDS43229.1																																																																																				0.463	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611		33	174	1	0	9.65021e-13	0.010818	1.87369e-12	33	174				
CLOCK	9575	broad.mit.edu	37	4	56336970	56336970	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:56336970G>C	ENST00000309964.4	-	7	602	c.352C>G	c.(352-354)Ctt>Gtt	p.L118V	CLOCK_ENST00000513440.1_Missense_Mutation_p.L118V|CLOCK_ENST00000381322.1_Missense_Mutation_p.L118V	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	118	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			AAACCATCAAGAGCCTGAAAT	0.274																																							uc003haz.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(352-354)CTT>GTT		clock							80.0	85.0	84.0					4																	56336970		2201	4297	6498	SO:0001583	missense	9575				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr4:56336970G>C	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.352C>G	4.37:g.56336970G>C	ENSP00000308741:p.Leu118Val					CLOCK_uc003hba.1_Missense_Mutation_p.L118V	p.L118V	NM_004898	NP_004889	O15516	CLOCK_HUMAN	LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)		9	1278	-	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		118			PAS 1.		A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	ENST00000309964.4	37	c.352C>G	CCDS3500.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010679	0.75046	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	T;T;T	0.19394	2.15;2.15;2.15	5.58	5.58	0.84498	PAS (2);PAS fold (1);	0.124483	0.56097	D	0.000039	T	0.54515	0.1863	M	0.87097	2.86	0.80722	D	1	D	0.56287	0.975	D	0.69824	0.966	T	0.57877	-0.7735	10	0.56958	D	0.05	.	19.9348	0.97133	0.0:0.0:1.0:0.0	.	118	O15516	CLOCK_HUMAN	V	118	ENSP00000308741:L118V;ENSP00000370723:L118V;ENSP00000426983:L118V	ENSP00000308741:L118V	L	-	1	0	CLOCK	56031727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.628000	0.67791	2.789000	0.95967	0.591000	0.81541	CTT		0.274	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898		29	76	0	0	0	0.009535	0	29	76				
KIAA1211	57482	broad.mit.edu	37	4	57182639	57182639	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:57182639C>T	ENST00000504228.1	+	6	3076	c.2971C>T	c.(2971-2973)Cgc>Tgc	p.R991C	KIAA1211_ENST00000541073.1_Missense_Mutation_p.R984C|KIAA1211_ENST00000264229.6_Missense_Mutation_p.R991C			Q6ZU35	K1211_HUMAN	KIAA1211	991	Pro-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GCTGCTGTCTCGCCGAGCGGG	0.662																																							uc003hbk.2		NA																	0				ovary(1)|skin(1)	2						c.(2971-2973)CGC>TGC		hypothetical protein LOC57482							40.0	48.0	45.0					4																	57182639		2020	4185	6205	SO:0001583	missense	57482							g.chr4:57182639C>T	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2971C>T	4.37:g.57182639C>T	ENSP00000423366:p.Arg991Cys					KIAA1211_uc010iha.2_Missense_Mutation_p.R984C|KIAA1211_uc011bzz.1_Missense_Mutation_p.R901C|KIAA1211_uc003hbm.1_Missense_Mutation_p.R877C	p.R991C	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN			8	3362	+	Glioma(25;0.08)|all_neural(26;0.101)		991			Pro-rich.		Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	c.2971C>T	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322011	0.41096	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073	T;T;T	0.78246	-1.16;-1.16;-1.16	5.06	3.19	0.36642	.	.	.	.	.	D	0.84570	0.5501	L	0.60455	1.87	0.09310	N	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.69824	0.966;0.938;0.938	T	0.74668	-0.3588	9	0.87932	D	0	-12.1243	12.3199	0.54979	0.3159:0.6841:0.0:0.0	.	984;984;991	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	C	991;991;984	ENSP00000264229:R991C;ENSP00000423366:R991C;ENSP00000444006:R984C	ENSP00000264229:R991C	R	+	1	0	KIAA1211	56877396	0.954000	0.32549	0.058000	0.19502	0.311000	0.27955	2.522000	0.45572	1.298000	0.44778	0.561000	0.74099	CGC		0.662	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722		7	20	0	0	0	0.001984	0	7	20				
UGT2B7	7364	broad.mit.edu	37	4	69962246	69962246	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:69962246T>C	ENST00000508661.1	+	1	35	c.8T>C	c.(7-9)gTg>gCg	p.V3A	UGT2B7_ENST00000509763.1_Intron|UGT2B7_ENST00000305231.7_Missense_Mutation_p.V3A			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	3					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AGGATGTCTGTGAAATGGACT	0.408																																							uc003heg.3		NA																	0				ovary(1)|skin(1)	2						c.(7-9)GTG>GCG		UDP glucuronosyltransferase 2B7 precursor							121.0	119.0	120.0					4																	69962246		2203	4300	6503	SO:0001583	missense	7364				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69962246T>C	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.8T>C	4.37:g.69962246T>C	ENSP00000427659:p.Val3Ala					UGT2B7_uc010ihq.2_Missense_Mutation_p.V3A	p.V3A	NM_001074	NP_001065	P16662	UD2B7_HUMAN			1	54	+			3					B2R810|Q6GTW0	Missense_Mutation	SNP	ENST00000508661.1	37	c.8T>C		.	.	.	.	.	.	.	.	.	.	T	2.875	-0.233051	0.05983	.	.	ENSG00000171234	ENST00000305231;ENST00000508661	T;T	0.59502	0.26;0.89	2.78	-2.31	0.06765	.	3.250740	0.01571	U	0.020590	T	0.45637	0.1352	L	0.43152	1.355	0.09310	N	1	B;B	0.14438	0.01;0.0	B;B	0.20184	0.028;0.004	T	0.09840	-1.0656	9	.	.	.	.	2.3799	0.04351	0.4356:0.1444:0.0:0.42	.	3;3	E9PBP8;P16662	.;UD2B7_HUMAN	A	3	ENSP00000304811:V3A;ENSP00000427659:V3A	.	V	+	2	0	UGT2B7	69996835	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	-1.377000	0.02558	-0.122000	0.11766	0.260000	0.18958	GTG		0.408	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074		39	82	0	0	0	0.006999	0	39	82				
SULT1B1	27284	broad.mit.edu	37	4	70596345	70596345	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:70596345C>A	ENST00000310613.3	-	7	949	c.652G>T	c.(652-654)Gat>Tat	p.D218Y		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	218					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						AAGATCTCATCATTCAGGTTC	0.363																																							uc003hen.2		NA																	0					0						c.(652-654)GAT>TAT		sulfotransferase family, cytosolic, 1B, member							157.0	144.0	148.0					4																	70596345		2203	4300	6503	SO:0001583	missense	27284				3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol		g.chr4:70596345C>A	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.652G>T	4.37:g.70596345C>A	ENSP00000308770:p.Asp218Tyr						p.D218Y	NM_014465	NP_055280	O43704	ST1B1_HUMAN			7	950	-			218			PAPS (By similarity).		O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	ENST00000310613.3	37	c.652G>T	CCDS3530.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026614	0.54683	.	.	ENSG00000173597	ENST00000310613	T	0.02050	4.48	4.09	4.09	0.47781	Sulfotransferase domain (1);	0.284658	0.24798	N	0.035509	T	0.15305	0.0369	M	0.93462	3.42	0.25460	N	0.98792	D	0.57257	0.979	P	0.60286	0.872	T	0.06481	-1.0824	10	0.87932	D	0	.	14.1779	0.65555	0.0:1.0:0.0:0.0	.	218	O43704	ST1B1_HUMAN	Y	218	ENSP00000308770:D218Y	ENSP00000308770:D218Y	D	-	1	0	SULT1B1	70630934	0.695000	0.27747	0.147000	0.22382	0.985000	0.73830	1.645000	0.37238	2.006000	0.58801	0.467000	0.42956	GAT		0.363	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251563.2	NM_014465		12	46	1	0	6.40141e-05	0.010729	0.000108113	12	46				
AFM	173	broad.mit.edu	37	4	74357672	74357672	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:74357672G>A	ENST00000226355.3	+	8	1020	c.927G>A	c.(925-927)gaG>gaA	p.E309E		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	309	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAATACCAGAGCGCGGCCAGT	0.353																																							uc003hhb.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(925-927)GAG>GAA		afamin precursor							85.0	89.0	88.0					4																	74357672		2203	4300	6503	SO:0001819	synonymous_variant	173				vitamin transport		vitamin E binding	g.chr4:74357672G>A	L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.927G>A	4.37:g.74357672G>A							p.E309E	NM_001133	NP_001124	P43652	AFAM_HUMAN	Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		8	958	+	Breast(15;0.00102)		309			Albumin 2.		A8K3E1|Q32MR3|Q4W5C5	Silent	SNP	ENST00000226355.3	37	c.927G>A	CCDS3557.1																																																																																				0.353	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2			33	68	0	0	0	0.010818	0	33	68				
PRDM8	56978	broad.mit.edu	37	4	81123121	81123121	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:81123121C>T	ENST00000504452.1	+	8	1344	c.505C>T	c.(505-507)Ccc>Tcc	p.P169S	PRDM8_ENST00000415738.2_Missense_Mutation_p.P169S|PRDM8_ENST00000339711.4_Missense_Mutation_p.P169S			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	169					corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						GTTTGAGTTCCCCTATGTGGC	0.572											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010ijo.2		NA																	0				skin(1)	1						c.(505-507)CCC>TCC		PR domain containing 8							130.0	142.0	138.0					4																	81123121		2151	4242	6393	SO:0001583	missense	56978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:81123121C>T	AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.505C>T	4.37:g.81123121C>T	ENSP00000423985:p.Pro169Ser		OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1203	PRDM8_uc003hmb.3_Missense_Mutation_p.P169S|PRDM8_uc003hmc.3_Missense_Mutation_p.P169S	p.P169S	NM_020226	NP_064611	Q9NQV8	PRDM8_HUMAN			8	1344	+			169			C2H2-type 1; atypical.		A8K7X2|Q6IQ36	Missense_Mutation	SNP	ENST00000504452.1	37	c.505C>T	CCDS43243.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928799	0.73327	.	.	ENSG00000152784	ENST00000504452;ENST00000515013;ENST00000339711;ENST00000415738	T;T;T;T	0.62941	-0.01;0.57;-0.01;-0.01	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.71247	0.3317	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66999	-0.5781	10	0.28530	T	0.3	.	18.2055	0.89853	0.0:1.0:0.0:0.0	.	169	Q9NQV8	PRDM8_HUMAN	S	169	ENSP00000423985:P169S;ENSP00000425149:P169S;ENSP00000339764:P169S;ENSP00000406998:P169S	ENSP00000339764:P169S	P	+	1	0	PRDM8	81342145	1.000000	0.71417	1.000000	0.80357	0.622000	0.37654	5.441000	0.66569	2.636000	0.89361	0.313000	0.20887	CCC		0.572	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362793.1			54	136	0	0	0	0.01441	0	54	136				
DSPP	1834	broad.mit.edu	37	4	88535365	88535365	+	Missense_Mutation	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:88535365C>G	ENST00000282478.7	+	4	1584	c.1551C>G	c.(1549-1551)agC>agG	p.S517R	DSPP_ENST00000399271.1_Missense_Mutation_p.S517R|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	517	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		ACAGTGATAGCACATCAGACA	0.403																																							uc003hqu.2		NA																	0				central_nervous_system(1)	1						c.(1549-1551)AGC>AGG		dentin sialophosphoprotein preproprotein							153.0	146.0	148.0					4																	88535365		2085	4222	6307	SO:0001583	missense	1834				biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent	g.chr4:88535365C>G	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1551C>G	4.37:g.88535365C>G	ENSP00000282478:p.Ser517Arg						p.S517R	NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000508)	5	1671	+		Hepatocellular(203;0.114)|all_hematologic(202;0.236)	517			Asp/Ser-rich.		A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	c.1551C>G	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	C	3.403	-0.121826	0.06838	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88046	-2.33;-2.33	4.17	2.38	0.29361	.	.	.	.	.	D	0.88358	0.6415	M	0.64404	1.975	0.21445	N	0.999686	D	0.57899	0.981	P	0.54140	0.743	T	0.78550	-0.2161	9	0.66056	D	0.02	-0.0574	7.8106	0.29228	0.0:0.786:0.0:0.214	.	517	Q9NZW4	DSPP_HUMAN	R	517	ENSP00000382213:S517R;ENSP00000282478:S517R	ENSP00000282478:S517R	S	+	3	2	DSPP	88754389	0.000000	0.05858	0.392000	0.26245	0.368000	0.29767	-0.370000	0.07523	0.875000	0.35847	-0.410000	0.06199	AGC		0.403	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208		16	41	0	0	0	0.004007	0	16	41				
MEPE	56955	broad.mit.edu	37	4	88767088	88767088	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:88767088C>A	ENST00000424957.3	+	4	1141	c.1068C>A	c.(1066-1068)aaC>aaA	p.N356K	MEPE_ENST00000540395.1_Missense_Mutation_p.N243K|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000395102.4_Missense_Mutation_p.N387K|MEPE_ENST00000497649.2_Missense_Mutation_p.N332K|MEPE_ENST00000560249.1_Missense_Mutation_p.N243K|MEPE_ENST00000361056.3_Missense_Mutation_p.N356K	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	356					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.N356K(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		GAGAAGGAAACAGAGTGGATG	0.478																																							uc003hqy.2		NA																	1	Substitution - Missense(1)	p.N356K(1)	ovary(1)	ovary(1)|lung(1)|skin(1)	3						c.(1066-1068)AAC>AAA		matrix, extracellular phosphoglycoprotein with							41.0	41.0	41.0					4																	88767088		2203	4300	6503	SO:0001583	missense	56955				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr4:88767088C>A	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.1068C>A	4.37:g.88767088C>A	ENSP00000416984:p.Asn356Lys					MEPE_uc010ikn.2_Missense_Mutation_p.N243K	p.N356K	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000432)	4	1107	+		Hepatocellular(203;0.114)	356					A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	c.1068C>A	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112269	0.56398	.	.	ENSG00000152595	ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	4.99	3.11	0.35812	.	0.108387	0.41396	D	0.000892	T	0.54062	0.1835	M	0.83953	2.67	0.32396	N	0.552609	D	0.61080	0.989	P	0.54706	0.759	T	0.66388	-0.5936	10	0.87932	D	0	-18.8069	6.1304	0.20201	0.0:0.7728:0.0:0.2272	.	356	Q9NQ76	MEPE_HUMAN	K	356;387;332;243;356	ENSP00000416984:N356K;ENSP00000378534:N387K;ENSP00000422747:N332K;ENSP00000443491:N243K;ENSP00000354341:N356K	ENSP00000354341:N356K	N	+	3	2	MEPE	88986112	1.000000	0.71417	0.999000	0.59377	0.617000	0.37484	0.815000	0.27253	1.336000	0.45506	0.655000	0.94253	AAC		0.478	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1			21	45	1	0	8.34094e-07	0.008871	1.45966e-06	21	45				
CCSER1	401145	broad.mit.edu	37	4	91549341	91549341	+	Silent	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:91549341A>T	ENST00000509176.1	+	6	2178	c.1890A>T	c.(1888-1890)gcA>gcT	p.A630A	CCSER1_ENST00000432775.2_Silent_p.A630A|CCSER1_ENST00000333691.8_Silent_p.A630A	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	630																	ACTGCACGGCAGTCAAGACGT	0.448																																							uc003hsv.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(1888-1890)GCA>GCT		KIAA1680 protein isoform 1							78.0	76.0	77.0					4																	91549341		1894	4131	6025	SO:0001819	synonymous_variant	401145							g.chr4:91549341A>T		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1890A>T	4.37:g.91549341A>T						FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Silent_p.A630A	p.A630A	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN			6	2230	+			630					Q4W5M0|Q86V57	Silent	SNP	ENST00000509176.1	37	c.1890A>T	CCDS47099.1																																																																																				0.448	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065		33	51	0	0	0	0.013726	0	33	51				
NDST4	64579	broad.mit.edu	37	4	115769409	115769409	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:115769409C>A	ENST00000264363.2	-	9	2580	c.1902G>T	c.(1900-1902)caG>caT	p.Q634H		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	634	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CATTAAAGAACTGAACTTCCT	0.328																																							uc003ibu.2		NA																	0				skin(3)|ovary(1)	4						c.(1900-1902)CAG>CAT		heparan sulfate N-deacetylase/N-sulfotransferase							157.0	150.0	152.0					4																	115769409		2203	4299	6502	SO:0001583	missense	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115769409C>A	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1902G>T	4.37:g.115769409C>A	ENSP00000264363:p.Gln634His					NDST4_uc010imw.2_RNA	p.Q634H	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	9	2581	-		Ovarian(17;0.156)	634			Lumenal (Potential).|Heparan sulfate N-sulfotransferase 4.		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	c.1902G>T	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122232	0.56613	.	.	ENSG00000138653	ENST00000264363	T	0.50277	0.75	5.71	-3.65	0.04502	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.50582	0.1624	L	0.31294	0.92	0.47949	D	0.999557	D	0.63046	0.992	D	0.65684	0.937	T	0.54357	-0.8306	10	0.59425	D	0.04	.	16.2809	0.82678	0.0:0.669:0.0:0.331	.	634	Q9H3R1	NDST4_HUMAN	H	634	ENSP00000264363:Q634H	ENSP00000264363:Q634H	Q	-	3	2	NDST4	115988858	0.764000	0.28473	0.990000	0.47175	0.984000	0.73092	-0.068000	0.11561	-0.389000	0.07786	-0.302000	0.09304	CAG		0.328	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		49	89	1	0	5.57489e-27	0.01441	1.28391e-26	49	89				
KIAA1109	84162	broad.mit.edu	37	4	123094284	123094284	+	Missense_Mutation	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:123094284A>G	ENST00000264501.4	+	4	564	c.191A>G	c.(190-192)tAc>tGc	p.Y64C	KIAA1109_ENST00000388738.3_Missense_Mutation_p.Y64C|KIAA1109_ENST00000455637.1_Missense_Mutation_p.Y64C			Q2LD37	K1109_HUMAN	KIAA1109	64					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AACAGATTATACAAGCATGGC	0.323																																							uc003ieh.2		NA																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(190-192)TAC>TGC		fragile site-associated protein							168.0	159.0	162.0					4																	123094284		1821	4081	5902	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123094284A>G	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.191A>G	4.37:g.123094284A>G	ENSP00000264501:p.Tyr64Cys						p.Y64C	NM_015312	NP_056127	Q2LD37	K1109_HUMAN			2	236	+			64					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.191A>G	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	A	17.59	3.428658	0.62844	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	T;T;T	0.25749	2.36;2.36;1.78	5.6	5.6	0.85130	.	0.590982	0.12897	U	0.430107	T	0.32406	0.0828	L	0.34521	1.04	0.51233	D	0.999913	D	0.54047	0.964	P	0.50791	0.65	T	0.03086	-1.1074	10	0.52906	T	0.07	.	15.4475	0.75243	1.0:0.0:0.0:0.0	.	64	Q2LD37	K1109_HUMAN	C	64	ENSP00000264501:Y64C;ENSP00000373390:Y64C;ENSP00000389925:Y64C	ENSP00000264501:Y64C	Y	+	2	0	KIAA1109	123313734	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.930000	0.75858	2.136000	0.66102	0.533000	0.62120	TAC		0.323	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		68	117	0	0	0	0.01441	0	68	117				
FNIP2	57600	broad.mit.edu	37	4	159790038	159790038	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:159790038G>C	ENST00000264433.6	+	13	2325	c.2250G>C	c.(2248-2250)gaG>gaC	p.E750D	FNIP2_ENST00000379346.3_Missense_Mutation_p.E773D	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	750	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CCTCCTTGGAGGCCAGTGAGG	0.517																																							uc003iqe.3		NA																	0					0						c.(2248-2250)GAG>GAC		folliculin interacting protein 2							50.0	55.0	54.0					4																	159790038		1921	4134	6055	SO:0001583	missense	57600				DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding	g.chr4:159790038G>C	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.2250G>C	4.37:g.159790038G>C	ENSP00000264433:p.Glu750Asp						p.E750D	NM_020840	NP_065891	Q9P278	FNIP2_HUMAN		COAD - Colon adenocarcinoma(41;0.00936)	13	2433	+	all_hematologic(180;0.24)		750			Interaction with PRKAA1.		Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	37	c.2250G>C	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	G	9.560	1.118201	0.20877	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.26223	1.75;1.75	5.18	3.45	0.39498	.	1.410440	0.03955	N	0.289078	T	0.17066	0.0410	N	0.16478	0.41	0.09310	N	1	B	0.29301	0.241	B	0.21917	0.037	T	0.25882	-1.0119	9	.	.	.	.	8.1357	0.31054	0.0835:0.2984:0.6181:0.0	.	750	Q9P278	FNIP2_HUMAN	D	750;773	ENSP00000264433:E750D;ENSP00000368651:E773D	.	E	+	3	2	FNIP2	160009488	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.037000	0.12164	0.663000	0.31027	-0.137000	0.14449	GAG		0.517	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840		38	81	0	0	0	0.003755	0	38	81				
KLKB1	3818	broad.mit.edu	37	4	187173004	187173004	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:187173004G>A	ENST00000264690.6	+	10	1320	c.1133G>A	c.(1132-1134)gGg>gAg	p.G378E	KLKB1_ENST00000513864.1_Missense_Mutation_p.G378E	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	378					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		TGTAACACTGGGGACAACTCT	0.418																																							uc003iyy.2		NA																	0				ovary(1)	1						c.(1132-1134)GGG>GAG		plasma kallikrein B1 precursor							129.0	135.0	133.0					4																	187173004		2203	4300	6503	SO:0001583	missense	3818				blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity	g.chr4:187173004G>A	M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.1133G>A	4.37:g.187173004G>A	ENSP00000264690:p.Gly378Glu					KLKB1_uc011clc.1_Missense_Mutation_p.G176E|KLKB1_uc011cld.1_Missense_Mutation_p.G340E	p.G378E	NM_000892	NP_000883	P03952	KLKB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)	10	1204	+		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)	378					A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	ENST00000264690.6	37	c.1133G>A	CCDS34120.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.42|10.42	1.346566|1.346566	0.24426|0.24426	.|.	.|.	ENSG00000164344|ENSG00000164344	ENST00000264690;ENST00000513864;ENST00000418715|ENST00000511608	D;D|D	0.88664|0.87103	-2.41;-2.35|-2.21	5.15|5.15	-3.61|-3.61	0.04556|0.04556	.|.	1.188450|1.188450	0.06019|0.06019	N|N	0.650928|0.650928	T|T	0.66819|0.66819	0.2828|0.2828	N|N	0.05230|0.05230	-0.09|-0.09	0.09310|0.09310	N|N	1|1	B;B;B|.	0.10296|.	0.002;0.001;0.003|.	B;B;B|.	0.06405|.	0.002;0.002;0.002|.	T|T	0.54423|0.54423	-0.8296|-0.8296	10|8	0.02654|0.32370	T|T	1|0.25	.|.	1.3576|1.3576	0.02185|0.02185	0.4341:0.1071:0.2323:0.2264|0.4341:0.1071:0.2323:0.2264	.|.	340;378;378|.	E7EQA8;A8K9A9;P03952|.	.;.;KLKB1_HUMAN|.	E|R	378;378;340|426	ENSP00000264690:G378E;ENSP00000424469:G378E|ENSP00000426629:G426R	ENSP00000264690:G378E|ENSP00000426629:G426R	G|G	+|+	2|1	0|0	KLKB1|KLKB1	187409998|187409998	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.806000|0.806000	0.45545|0.45545	-0.428000|-0.428000	0.06991|0.06991	-0.611000|-0.611000	0.05709|0.05709	0.645000|0.645000	0.84053|0.84053	GGG|GGG		0.418	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892		42	88	0	0	0	0.010771	0	42	88				
TRIML1	339976	broad.mit.edu	37	4	189060808	189060808	+	Silent	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:189060808G>T	ENST00000332517.3	+	1	236	c.96G>T	c.(94-96)ggG>ggT	p.G32G	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	32					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CCGAGTGTGGGCACAGCTTTT	0.517																																					Melanoma(31;213 1036 16579 23968 32372)	Melanoma(31;213 1036 16579 23968 32372)	uc003izm.1		NA																	0				ovary(1)|pancreas(1)|breast(1)|skin(1)	4						c.(94-96)GGG>GGT		tripartite motif family-like 1							180.0	178.0	179.0					4																	189060808		2203	4300	6503	SO:0001819	synonymous_variant	339976				multicellular organismal development		ligase activity|zinc ion binding	g.chr4:189060808G>T	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.96G>T	4.37:g.189060808G>T							p.G32G	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)	1	211	+		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)	32			RING-type.		Q96BE5	Silent	SNP	ENST00000332517.3	37	c.96G>T	CCDS3851.1																																																																																				0.517	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556		68	192	1	0	7.1157e-29	0.01441	1.68247e-28	68	192				
CTNND2	1501	broad.mit.edu	37	5	11384809	11384809	+	Missense_Mutation	SNP	G	G	A	rs376760091		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:11384809G>A	ENST00000304623.8	-	7	1334	c.1145C>T	c.(1144-1146)aCg>aTg	p.T382M	CTNND2_ENST00000503622.1_Intron|CTNND2_ENST00000458100.2_Intron|CTNND2_ENST00000359640.2_Missense_Mutation_p.T382M|CTNND2_ENST00000511377.1_Missense_Mutation_p.T291M|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	382					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GAGGGTGGCCGTGGCATACAG	0.701																																							uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(1144-1146)ACG>ATG		catenin (cadherin-associated protein), delta 2		G	MET/THR	1,4403		0,1,2201	35.0	30.0	31.0		1145	4.5	1.0	5		31	0,8600		0,0,4300	no	missense	CTNND2	NM_001332.2	81	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	382/1226	11384809	1,13003	2202	4300	6502	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11384809G>A	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1145C>T	5.37:g.11384809G>A	ENSP00000307134:p.Thr382Met					CTNND2_uc010itt.2_Missense_Mutation_p.T291M|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Translation_Start_Site	p.T382M	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN			7	1290	-			382					B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.1145C>T	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292383	0.80914	2.27E-4	0.0	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377	T;T;T	0.78126	-1.07;-1.15;-1.07	4.51	4.51	0.55191	.	0.080569	0.48767	D	0.000161	T	0.79913	0.4528	L	0.38175	1.15	0.80722	D	1	D	0.76494	0.999	P	0.56088	0.791	T	0.82859	-0.0249	10	0.66056	D	0.02	-11.6978	16.8191	0.85741	0.0:0.0:1.0:0.0	.	382	Q9UQB3	CTND2_HUMAN	M	382;382;291	ENSP00000307134:T382M;ENSP00000352661:T382M;ENSP00000426510:T291M	ENSP00000307134:T382M	T	-	2	0	CTNND2	11437809	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.419000	0.73345	2.045000	0.60652	0.462000	0.41574	ACG		0.701	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		10	19	0	0	0	0.010729	0	10	19				
CDH9	1007	broad.mit.edu	37	5	26881508	26881508	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:26881508T>A	ENST00000231021.4	-	12	2279	c.2107A>T	c.(2107-2109)Act>Tct	p.T703S		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	703					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AGAGGCACAGTCCTCCTTATC	0.418																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(2107-2109)ACT>TCT		cadherin 9, type 2 preproprotein							176.0	165.0	169.0					5																	26881508		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26881508T>A	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2107A>T	5.37:g.26881508T>A	ENSP00000231021:p.Thr703Ser					CDH9_uc011cnv.1_Missense_Mutation_p.T296S	p.T703S	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			12	2276	-			703			Cytoplasmic (Potential).		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.2107A>T	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	7.295	0.611782	0.14066	.	.	ENSG00000113100	ENST00000231021	T	0.76060	-0.99	4.96	3.76	0.43208	Cadherin, cytoplasmic domain (1);	0.116349	0.56097	D	0.000021	T	0.61652	0.2364	N	0.16166	0.38	0.36433	D	0.865008	B;B	0.26635	0.033;0.155	B;B	0.39339	0.155;0.297	T	0.58399	-0.7643	9	.	.	.	.	10.0639	0.42292	0.0:0.0:0.3255:0.6745	.	296;703	B4DFP0;Q9ULB4	.;CADH9_HUMAN	S	703	ENSP00000231021:T703S	.	T	-	1	0	CDH9	26917265	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.957000	0.49137	0.800000	0.34041	0.455000	0.32223	ACT		0.418	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		101	98	0	0	0	0.01441	0	101	98				
EGFLAM	133584	broad.mit.edu	37	5	38337723	38337723	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:38337723G>T	ENST00000354891.3	+	2	545	c.199G>T	c.(199-201)Ggg>Tgg	p.G67W	EGFLAM_ENST00000322350.5_Missense_Mutation_p.G67W	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	67	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					TCCCATCCTTGGGTACACTGT	0.512																																					Colon(62;485 1295 3347 17454)	Colon(62;485 1295 3347 17454)	uc003jlc.1		NA																	0				pancreas(3)|skin(3)|ovary(1)	7						c.(199-201)GGG>TGG		EGF-like, fibronectin type III and laminin G							88.0	64.0	72.0					5																	38337723		2203	4299	6502	SO:0001583	missense	133584					cell junction|proteinaceous extracellular matrix|synapse		g.chr5:38337723G>T	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.199G>T	5.37:g.38337723G>T	ENSP00000346964:p.Gly67Trp					EGFLAM_uc003jlb.1_Missense_Mutation_p.G67W	p.G67W	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN			2	523	+	all_lung(31;0.000385)		67			Fibronectin type-III 1.		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	c.199G>T	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587276	0.66105	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.61627	0.09;0.09	5.71	5.71	0.89125	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.119123	0.56097	D	0.000028	D	0.82499	0.5050	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86279	0.1666	10	0.87932	D	0	-23.4952	18.622	0.91324	0.0:0.0:1.0:0.0	.	67;67	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	W	67	ENSP00000346964:G67W;ENSP00000313084:G67W	ENSP00000313084:G67W	G	+	1	0	EGFLAM	38373480	1.000000	0.71417	0.905000	0.35620	0.461000	0.32589	6.288000	0.72679	2.688000	0.91661	0.655000	0.94253	GGG		0.512	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403		9	8	1	0	0.000442599	0.006214	0.000735821	9	8				
EDIL3	10085	broad.mit.edu	37	5	83402473	83402473	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:83402473C>A	ENST00000296591.5	-	6	1063	c.645G>T	c.(643-645)tgG>tgT	p.W215C	EDIL3_ENST00000380138.3_Missense_Mutation_p.W205C	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	215	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.W215*(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		TTACCTGAATCCACGGCCATC	0.398																																							uc003kio.1		NA																	1	Substitution - Nonsense(1)		prostate(1)	skin(2)	2						c.(643-645)TGG>TGT		EGF-like repeats and discoidin I-like							147.0	134.0	139.0					5																	83402473		2203	4300	6503	SO:0001583	missense	10085				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding	g.chr5:83402473C>A	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.645G>T	5.37:g.83402473C>A	ENSP00000296591:p.Trp215Cys					EDIL3_uc003kip.1_Missense_Mutation_p.W205C	p.W215C	NM_005711	NP_005702	O43854	EDIL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)	6	1064	-		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)	215			F5/8 type C 1.		B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	c.645G>T	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414680	0.83449	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.99532	-6.1;-6.1	5.37	5.37	0.77165	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.057654	0.85682	N	0.000000	D	0.99843	0.9928	H	0.98701	4.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.96538	0.9398	10	0.87932	D	0	-13.2045	19.1141	0.93331	0.0:1.0:0.0:0.0	.	205;215	O43854-2;O43854	.;EDIL3_HUMAN	C	215;205	ENSP00000296591:W215C;ENSP00000369483:W205C	ENSP00000296591:W215C	W	-	3	0	EDIL3	83438229	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.277000	0.78572	2.528000	0.85240	0.650000	0.86243	TGG		0.398	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711		75	47	1	0	1.43161e-34	0.01441	3.526e-34	75	47				
DMXL1	1657	broad.mit.edu	37	5	118469357	118469357	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:118469357G>T	ENST00000311085.8	+	12	1818	c.1738G>T	c.(1738-1740)Ggt>Tgt	p.G580C	DMXL1_ENST00000539542.1_Missense_Mutation_p.G580C	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	580										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TATTTCTTCTGGTCACAATAA	0.373																																							uc003ksd.2		NA																	0				ovary(2)	2						c.(1738-1740)GGT>TGT		Dmx-like 1							90.0	91.0	91.0					5																	118469357		2202	4300	6502	SO:0001583	missense	1657							g.chr5:118469357G>T	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1738G>T	5.37:g.118469357G>T	ENSP00000309690:p.Gly580Cys					DMXL1_uc010jcl.1_Missense_Mutation_p.G580C|DMXL1_uc003ksc.1_Missense_Mutation_p.G580C	p.G580C	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)	12	1919	+		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)	580			WD 5.			Missense_Mutation	SNP	ENST00000311085.8	37	c.1738G>T	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603317	0.66445	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.32023	1.47;2.86;2.55	5.43	5.43	0.79202	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.215406	0.47852	D	0.000211	T	0.45135	0.1327	L	0.52573	1.65	0.51233	D	0.999911	D;P	0.54397	0.966;0.943	P;P	0.55577	0.779;0.503	T	0.11446	-1.0587	10	0.31617	T	0.26	-8.7697	19.2239	0.93810	0.0:0.0:1.0:0.0	.	580;580	F5H269;Q9Y485	.;DMXL1_HUMAN	C	580	ENSP00000427692:G580C;ENSP00000309690:G580C;ENSP00000439479:G580C	ENSP00000309690:G580C	G	+	1	0	DMXL1	118497256	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.481000	0.60250	2.562000	0.86427	0.591000	0.81541	GGT		0.373	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509		22	61	1	0	4.35082e-09	0.010504	7.87291e-09	22	61				
SLC22A5	6584	broad.mit.edu	37	5	131705782	131705782	+	Missense_Mutation	SNP	G	G	C	rs148657753		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:131705782G>C	ENST00000245407.3	+	1	339	c.118G>C	c.(118-120)Gtg>Ctg	p.V40L	AC034220.3_ENST00000457998.2_RNA|AC034220.3_ENST00000417795.1_RNA|SLC22A5_ENST00000435065.2_Missense_Mutation_p.V40L	NM_003060.3	NP_003051.1	O76082	S22A5_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 5	40					carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|positive regulation of intestinal epithelial structure maintenance (GO:0060731)|quaternary ammonium group transport (GO:0015697)|quorum sensing involved in interaction with host (GO:0052106)|sodium ion transport (GO:0006814)|sodium-dependent organic cation transport (GO:0070715)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|drug transmembrane transporter activity (GO:0015238)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|symporter activity (GO:0015293)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	8		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Acetylcarnitine(DB08842)|Aminohippurate(DB00345)|Amphetamine(DB00182)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benzylpenicillin(DB01053)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefradine(DB01333)|Ceftazidime(DB00438)|Cephalexin(DB00567)|Cephaloglycin(DB00689)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Creatine(DB00148)|Cyclacillin(DB01000)|Dactinomycin(DB00970)|Desipramine(DB01151)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Epinephrine(DB00668)|Furosemide(DB00695)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Mepyramine(DB06691)|Methamphetamine(DB01577)|Niacin(DB00627)|Nicotine(DB00184)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Probenecid(DB01032)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Sparfloxacin(DB01208)|Thiamine(DB00152)|Tiotropium(DB01409)|Valproic Acid(DB00313)|Verapamil(DB00661)	CCTGTCCTCCGTGTTCCTGAT	0.687											OREG0003451	type=REGULATORY REGION|Gene=BC043424|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc003kww.3		NA																	0					0						c.(118-120)GTG>CTG		solute carrier family 22 member 5	L-Carnitine(DB00583)						27.0	26.0	26.0					5																	131705782		2202	4299	6501	SO:0001583	missense	6584				positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity	g.chr5:131705782G>C	AF057164	CCDS4154.1	5q23.3	2013-05-22	2008-01-11		ENSG00000197375	ENSG00000197375		"""Solute carriers"""	10969	protein-coding gene	gene with protein product		603377		CDSP		9618255, 9916797, 9685390	Standard	NM_003060		Approved	OCTN2, SCD	uc003kww.4	O76082	OTTHUMG00000059634	ENST00000245407.3:c.118G>C	5.37:g.131705782G>C	ENSP00000245407:p.Val40Leu		OREG0003451	type=REGULATORY REGION|Gene=BC043424|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1589	SLC22A5_uc003kwx.3_Missense_Mutation_p.V40L|uc003kwu.1_5'Flank	p.V40L	NM_003060	NP_003051	O76082	S22A5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		1	382	+		all_cancers(142;0.0751)|Breast(839;0.198)	40			Helical; Name=1; (Potential).		A2Q0V1|B2R844|D3DQ87|Q6ZQZ8|Q96EH6	Missense_Mutation	SNP	ENST00000245407.3	37	c.118G>C	CCDS4154.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104331	0.76983	.	.	ENSG00000197375	ENST00000245407;ENST00000435065	D;D	0.89270	-2.49;-2.49	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.93357	0.7882	M	0.90198	3.095	0.53688	D	0.999977	D;D	0.57257	0.979;0.979	P;P	0.54060	0.677;0.741	D	0.94059	0.7325	10	0.62326	D	0.03	.	12.366	0.55228	0.0774:0.0:0.9226:0.0	.	40;40	A2Q0V1;O76082	.;S22A5_HUMAN	L	40	ENSP00000245407:V40L;ENSP00000402760:V40L	ENSP00000245407:V40L	V	+	1	0	SLC22A5	131733681	1.000000	0.71417	0.946000	0.38457	0.380000	0.30137	4.270000	0.58896	2.481000	0.83766	0.462000	0.41574	GTG		0.687	SLC22A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132631.1	NM_003060		25	3	0	0	0	0.003954	0	25	3				
EGR1	1958	broad.mit.edu	37	5	137802542	137802542	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:137802542G>T	ENST00000239938.4	+	2	676	c.404G>T	c.(403-405)gGc>gTc	p.G135V		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	135					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ACCTATACTGGCCGCTTTTCC	0.582																																							uc003ldb.1		NA																	0				ovary(1)	1						c.(403-405)GGC>GTC		early growth response 1							97.0	105.0	102.0					5																	137802542		2203	4300	6503	SO:0001583	missense	1958				cellular response to heparin|cellular response to mycophenolic acid|glomerular mesangial cell proliferation|interleukin-1-mediated signaling pathway|positive regulation of glomerular metanephric mesangial cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of protein sumoylation|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytoplasm|nucleus	histone acetyltransferase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr5:137802542G>T	M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.404G>T	5.37:g.137802542G>T	ENSP00000239938:p.Gly135Val					EGR1_uc011cyu.1_Missense_Mutation_p.G135V	p.G135V	NM_001964	NP_001955	P18146	EGR1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)		2	674	+			135						Missense_Mutation	SNP	ENST00000239938.4	37	c.404G>T	CCDS4206.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923826	0.73213	.	.	ENSG00000120738	ENST00000535792;ENST00000411801;ENST00000239938	T	0.69306	-0.39	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.79953	0.4535	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	T	0.82408	-0.0472	10	0.87932	D	0	-28.9635	18.0413	0.89319	0.0:0.0:1.0:0.0	.	135;135	B4DNX4;P18146	.;EGR1_HUMAN	V	135	ENSP00000239938:G135V	ENSP00000239938:G135V	G	+	2	0	EGR1	137830441	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	8.062000	0.89475	2.251000	0.74343	0.462000	0.41574	GGC		0.582	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964		86	50	1	0	1.46381e-53	0.01441	4.01415e-53	86	50				
PCDHA8	56140	broad.mit.edu	37	5	140222535	140222535	+	Silent	SNP	G	G	T	rs555722520		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:140222535G>T	ENST00000531613.1	+	1	1629	c.1629G>T	c.(1627-1629)ccG>ccT	p.P543P	PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.P543P|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	543	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCGTGCCGCCTCTGGGCA	0.687																																							uc003lhs.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1627-1629)CCG>CCT		protocadherin alpha 8 isoform 1 precursor							52.0	62.0	58.0					5																	140222535		2192	4261	6453	SO:0001819	synonymous_variant	56140				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140222535G>T	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1629G>T	5.37:g.140222535G>T						PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.P543P	p.P543P	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1629	+			543			Cadherin 5.|Extracellular (Potential).		B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	c.1629G>T	CCDS54919.1																																																																																				0.687	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911		125	47	1	0	1.22322e-63	0.01441	3.44312e-63	125	47				
PCDHB14	56122	broad.mit.edu	37	5	140603356	140603356	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:140603356C>A	ENST00000239449.4	+	1	279	c.279C>A	c.(277-279)gaC>gaA	p.D93E	PCDHB14_ENST00000515856.2_Intron	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	93	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAGACCGAGACGAGCTGTGTG	0.448																																					Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	0				ovary(1)	1						c.(277-279)GAC>GAA		protocadherin beta 14 precursor							150.0	166.0	160.0					5																	140603356		2203	4300	6503	SO:0001583	missense	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140603356C>A	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.279C>A	5.37:g.140603356C>A	ENSP00000239449:p.Asp93Glu					PCDHB14_uc011dal.1_Intron	p.D93E	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	279	+			93			Extracellular (Potential).|Cadherin 1.		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	c.279C>A	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	1.505	-0.550937	0.03996	.	.	ENSG00000120327	ENST00000239449	T	0.13778	2.56	4.92	-3.57	0.04612	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.00967	0.0032	N	0.00004	-3.355	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49523	-0.8931	9	0.02654	T	1	.	3.5444	0.07823	0.3811:0.1142:0.3937:0.111	.	93	Q9Y5E9	PCDBE_HUMAN	E	93	ENSP00000239449:D93E	ENSP00000239449:D93E	D	+	3	2	PCDHB14	140583540	0.000000	0.05858	0.984000	0.44739	0.970000	0.65996	-0.153000	0.10144	-0.516000	0.06470	-1.179000	0.01719	GAC		0.448	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		147	119	1	0	9.53643e-70	0.01441	2.69861e-69	147	119				
PCDHGB1	56104	broad.mit.edu	37	5	140731926	140731926	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:140731926T>A	ENST00000523390.1	+	1	2099	c.2099T>A	c.(2098-2100)cTc>cAc	p.L700H	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	700					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCTCTTTCTCCTCGCGGTG	0.607																																							uc003ljo.1		NA																	0					0						c.(2098-2100)CTC>CAC		protocadherin gamma subfamily B, 1 isoform 1							130.0	141.0	138.0					5																	140731926		2095	4202	6297	SO:0001583	missense	56104				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140731926T>A	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.2099T>A	5.37:g.140731926T>A	ENSP00000429273:p.Leu700His					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA4_uc003ljq.1_5'Flank|PCDHGB1_uc011daq.1_Missense_Mutation_p.L700H|PCDHGA4_uc003ljp.1_5'Flank	p.L700H	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2099	+			700			Helical; (Potential).		Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	c.2099T>A	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	16.94	3.260277	0.59321	.	.	ENSG00000254221	ENST00000523390	T	0.74947	-0.89	5.54	5.54	0.83059	.	.	.	.	.	D	0.89894	0.6847	H	0.94423	3.535	0.32360	N	0.557326	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.977	D	0.93454	0.6804	9	0.87932	D	0	.	15.6437	0.77029	0.0:0.0:0.0:1.0	.	700;700	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	H	700	ENSP00000429273:L700H	ENSP00000429273:L700H	L	+	2	0	PCDHGB1	140712110	0.570000	0.26651	0.711000	0.30485	0.029000	0.11900	4.434000	0.59935	2.235000	0.73313	0.459000	0.35465	CTC		0.607	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922		159	93	0	0	0	0.01441	0	159	93				
PCDHGC5	56097	broad.mit.edu	37	5	140869611	140869611	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:140869611T>A	ENST00000252087.1	+	1	804	c.804T>A	c.(802-804)gaT>gaA	p.D268E	PCDHGC4_ENST00000306593.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCCACTGATCCAGACGAGG	0.527																																							uc003lla.1		NA																	0				ovary(3)	3						c.(802-804)GAT>GAA		protocadherin gamma subfamily C, 5 isoform 1							172.0	170.0	171.0					5																	140869611		2203	4300	6503	SO:0001583	missense	56097				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140869611T>A	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.804T>A	5.37:g.140869611T>A	ENSP00000252087:p.Asp268Glu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.D268E	p.D268E	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	804	+			268			Extracellular (Potential).|Cadherin 3.		Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	c.804T>A	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.045737	0.36085	.	.	ENSG00000240764	ENST00000252087	T	0.73897	-0.79	6.08	-3.51	0.04696	Cadherin (5);Cadherin-like (1);	0.000000	0.64402	D	0.000016	D	0.90710	0.7085	H	0.99299	4.505	0.39636	D	0.970259	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93028	0.6446	10	0.87932	D	0	.	16.5357	0.84372	0.0:0.7469:0.0:0.2531	.	268;268	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	E	268	ENSP00000252087:D268E	ENSP00000252087:D268E	D	+	3	2	PCDHGC5	140849795	0.000000	0.05858	0.989000	0.46669	0.021000	0.10359	-0.542000	0.06091	-0.348000	0.08286	-0.250000	0.11733	GAT		0.527	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929		166	83	0	0	0	0.01441	0	166	83				
DCTN4	51164	broad.mit.edu	37	5	150138543	150138543	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:150138543G>A	ENST00000447998.2	-	1	128	c.13C>T	c.(13-15)Ctg>Ttg	p.L5L	DCTN4_ENST00000446090.2_Silent_p.L5L|DCTN4_ENST00000521093.1_5'Flank|DCTN4_ENST00000424236.1_5'Flank	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	5					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCGACTGCAGCAAGGACGCC	0.612																																							uc003lsv.2		NA																	0				central_nervous_system(1)	1						c.(13-15)CTG>TTG		dynactin 4 (p62) isoform b							69.0	73.0	72.0					5																	150138543		2203	4300	6503	SO:0001819	synonymous_variant	51164					centrosome|nucleus	protein N-terminus binding	g.chr5:150138543G>A	AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.13C>T	5.37:g.150138543G>A						DCTN4_uc003lsu.2_5'Flank|DCTN4_uc010jhi.2_Silent_p.L5L|DCTN4_uc010jhj.2_RNA|DCTN4_uc011dck.1_5'Flank	p.L5L	NM_016221	NP_057305	Q9UJW0	DCTN4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		1	115	-		Medulloblastoma(196;0.167)	5					B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Silent	SNP	ENST00000447998.2	37	c.13C>T	CCDS4310.1																																																																																				0.612	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252372.1			69	50	0	0	0	0.01441	0	69	50				
TIMD4	91937	broad.mit.edu	37	5	156390260	156390260	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:156390260C>A	ENST00000274532.2	-	0	6				TIMD4_ENST00000407087.3_5'Flank	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAAGCCCAACCTCTTATATCC	0.463																																							uc003lwh.2		NA																	0				ovary(2)	2						c.(-52--48)GAGGT>GATGT		T-cell immunoglobulin and mucin domain							67.0	66.0	66.0					5																	156390260		2203	4300	6503			91937					integral to membrane		g.chr5:156390260C>A	BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.-51G>T	5.37:g.156390260C>A						TIMD4_uc010jii.2_Translation_Start_Site		NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	7	-	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)						B5MCL9	Translation_Start_Site	SNP	ENST00000274532.2	37	c.-50G>T	CCDS4332.1																																																																																				0.463	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379		55	29	1	0	1.67886e-27	0.01441	3.90023e-27	55	29				
FAM71B	153745	broad.mit.edu	37	5	156589539	156589539	+	Silent	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:156589539A>G	ENST00000302938.4	-	2	1832	c.1737T>C	c.(1735-1737)ggT>ggC	p.G579G		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	579						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCTCCTGGCCACCCTGGGCTT	0.478																																							uc003lwn.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(1735-1737)GGT>GGC		family with sequence similarity 71, member B							269.0	266.0	267.0					5																	156589539		2203	4300	6503	SO:0001819	synonymous_variant	153745					nucleus		g.chr5:156589539A>G		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1737T>C	5.37:g.156589539A>G							p.G579G	NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1837	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	579					Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	37	c.1737T>C	CCDS4335.1																																																																																				0.478	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		225	154	0	0	0	0.01441	0	225	154				
EHMT2	10919	broad.mit.edu	37	6	31852716	31852716	+	Silent	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:31852716C>T	ENST00000375537.4	-	19	2427	c.2421G>A	c.(2419-2421)cgG>cgA	p.R807R	EHMT2_ENST00000375530.4_Silent_p.R773R|EHMT2-AS1_ENST00000434689.1_RNA|EHMT2_ENST00000395728.3_Silent_p.R864R|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Silent_p.R830R	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	807					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.R807R(1)		central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CGTCGGCGCCCCGCGTCAGTA	0.637																																							uc003nxz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2419-2421)CGG>CGA		euchromatic histone-lysine N-methyltransferase 2							69.0	58.0	62.0					6																	31852716		2203	4300	6503	SO:0001819	synonymous_variant	10919				DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr6:31852716C>T	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.2421G>A	6.37:g.31852716C>T						EHMT2_uc003nxv.1_5'Flank|EHMT2_uc003nxw.1_5'Flank|EHMT2_uc003nxx.1_Silent_p.R5R|EHMT2_uc003nxy.1_Silent_p.R598R|EHMT2_uc011don.1_Silent_p.R830R|EHMT2_uc003nya.1_Silent_p.R773R	p.R807R	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN			19	2431	-			807			ANK 5.		B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Silent	SNP	ENST00000375537.4	37	c.2421G>A	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319196	0.23994	.	.	ENSG00000204371	ENST00000436026	.	.	.	4.28	1.47	0.22746	.	.	.	.	.	T	0.27559	0.0677	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.16808	-1.0390	4	.	.	.	.	2.605	0.04876	0.152:0.5212:0.1482:0.1786	.	.	.	.	R	138	.	.	G	-	1	0	EHMT2	31960695	0.004000	0.15560	0.997000	0.53966	0.903000	0.53119	-0.114000	0.10757	0.542000	0.28846	0.650000	0.86243	GGG		0.637	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709		19	49	0	0	0	0.007413	0	19	49				
EGFL8	80864	broad.mit.edu	37	6	32135340	32135340	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:32135340C>A	ENST00000395512.1	+	8	847	c.742C>A	c.(742-744)Cag>Aag	p.Q248K	EGFL8_ENST00000333845.6_Missense_Mutation_p.Q248K|EGFL8_ENST00000489721.1_3'UTR|PPT2-EGFL8_ENST00000422437.1_3'UTR|AGPAT1_ENST00000490711.1_5'Flank			Q99944	EGFL8_HUMAN	EGF-like-domain, multiple 8	248						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	10						TGAAGAGCTGCAGCCAGAACA	0.637																																							uc003oab.1		NA																	0					0						c.(742-744)CAG>AAG		NG3 protein precursor							52.0	60.0	57.0					6																	32135340		1511	2709	4220	SO:0001583	missense	80864					extracellular region|integral to membrane	calcium ion binding	g.chr6:32135340C>A	U89336	CCDS4743.1	6p21	2010-06-25	2003-05-21	2003-05-23	ENSG00000241404	ENSG00000241404			13944	protein-coding gene	gene with protein product		609897	"""chromosome 6 open reading frame 8"""	C6orf8			Standard	NM_030652		Approved	NG3		Q99944	OTTHUMG00000031222	ENST00000395512.1:c.742C>A	6.37:g.32135340C>A	ENSP00000378888:p.Gln248Lys					PPT2_uc003nzy.1_RNA|EGFL8_uc003oac.1_Missense_Mutation_p.Q248K	p.Q248K	NM_030652	NP_085155	Q99944	EGFL8_HUMAN			8	800	+			248					B0S884|G5E9Q0|Q5JP23|Q5SSX3|Q8IV30	Missense_Mutation	SNP	ENST00000395512.1	37	c.742C>A	CCDS4743.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004489	0.35320	.	.	ENSG00000241404	ENST00000333845;ENST00000395512;ENST00000432129	D;D;T	0.88586	-2.4;-2.4;2.17	5.59	4.7	0.59300	.	.	.	.	.	T	0.69682	0.3138	L	0.51422	1.61	0.20764	N	0.999853	B	0.27229	0.172	B	0.18871	0.023	T	0.56956	-0.7893	9	0.05959	T	0.93	-4.8306	12.2596	0.54642	0.0:0.829:0.171:0.0	.	248	Q99944	EGFL8_HUMAN	K	248;248;228	ENSP00000333380:Q248K;ENSP00000378888:Q248K;ENSP00000401694:Q228K	ENSP00000333380:Q248K	Q	+	1	0	EGFL8	32243318	0.966000	0.33281	0.993000	0.49108	0.993000	0.82548	2.291000	0.43540	1.312000	0.45043	0.491000	0.48974	CAG		0.637	EGFL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076463.3	NM_030652		57	74	1	0	7.36392e-32	0.01441	1.78073e-31	57	74				
SPDEF	25803	broad.mit.edu	37	6	34506078	34506078	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:34506078G>A	ENST00000374037.3	-	6	1395	c.981C>T	c.(979-981)ctC>ctT	p.L327L	SPDEF_ENST00000544425.1_Silent_p.L311L	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	327					cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						ACTGGTAGACGAGGCGCTGGG	0.632																																							uc003ojq.1		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(979-981)CTC>CTT		SAM pointed domain containing ets transcription							179.0	163.0	169.0					6																	34506078		2203	4300	6503	SO:0001819	synonymous_variant	25803				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:34506078G>A	AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.981C>T	6.37:g.34506078G>A						SPDEF_uc011dsq.1_Silent_p.L311L	p.L327L	NM_012391	NP_036523	O95238	SPDEF_HUMAN			6	1396	-			327			ETS.		B4DWH8|F5H778	Silent	SNP	ENST00000374037.3	37	c.981C>T	CCDS4794.1																																																																																				0.632	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391		37	141	0	0	0	0.009718	0	37	141				
MDFI	4188	broad.mit.edu	37	6	41621193	41621193	+	Silent	SNP	C	C	A	rs141575722		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:41621193C>A	ENST00000373050.4	+	4	625	c.438C>A	c.(436-438)ggC>ggA	p.G146G				Q99750	MDFI_HUMAN	MyoD family inhibitor	207					activation of JUN kinase activity (GO:0007257)|cytoplasmic sequestering of transcription factor (GO:0042994)|dorsal/ventral axis specification (GO:0009950)|embryo development (GO:0009790)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|prostate(2)|skin(1)|urinary_tract(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.121)		Colorectal(64;0.0123)|COAD - Colon adenocarcinoma(64;0.0264)|KIRC - Kidney renal clear cell carcinoma(1;0.138)			GTGGCTCTGGCGAGTGTGCCG	0.657																																							uc003oqp.3		NA																	0					0						c.(619-621)GGC>GGA		MyoD family inhibitor							112.0	92.0	99.0					6																	41621193		2203	4300	6503	SO:0001819	synonymous_variant	4188				cytoplasmic sequestering of transcription factor|dorsal/ventral axis specification|negative regulation of DNA binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr6:41621193C>A	U78313	CCDS4857.1, CCDS75451.1	6p21	2008-08-29			ENSG00000112559	ENSG00000112559			6967	protein-coding gene	gene with protein product	"""inhibitor of MyoD family a"""	604971				9250874, 17289077	Standard	NM_005586		Approved	I-mfa	uc003oqq.4	Q99750	OTTHUMG00000014681	ENST00000373050.4:c.438C>A	6.37:g.41621193C>A						MDFI_uc003oqq.3_Silent_p.G207G|MDFI_uc010jxn.2_Silent_p.G207G	p.G207G	NM_005586	NP_005577	Q99750	MDFI_HUMAN	Colorectal(64;0.0123)|COAD - Colon adenocarcinoma(64;0.0264)|KIRC - Kidney renal clear cell carcinoma(1;0.138)		6	950	+	Ovarian(28;0.0327)|Colorectal(47;0.121)		207			Cys-rich.			Silent	SNP	ENST00000373050.4	37	c.621C>A																																																																																					0.657	MDFI-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000040519.2	NM_005586		43	132	1	0	3.54561e-26	0.009718	8.06095e-26	43	132				
GPR115	221393	broad.mit.edu	37	6	47681561	47681561	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:47681561C>A	ENST00000283303.2	+	6	838	c.580C>A	c.(580-582)Ctc>Atc	p.L194I	RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000327753.3_Missense_Mutation_p.L194I|GPR115_ENST00000371220.1_Missense_Mutation_p.L251I	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	194					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						CAACCACATCCTCGACACAGC	0.413																																					GBM(22;431 510 9010 26644 32828)	GBM(22;431 510 9010 26644 32828)	uc003oza.1		NA																	0				ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						c.(580-582)CTC>ATC		G-protein coupled receptor 115 precursor							70.0	69.0	69.0					6																	47681561		2203	4300	6503	SO:0001583	missense	221393				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:47681561C>A	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.580C>A	6.37:g.47681561C>A	ENSP00000283303:p.Leu194Ile					GPR115_uc003oyz.1_Missense_Mutation_p.L251I|GPR115_uc003ozb.1_Missense_Mutation_p.L192I	p.L194I	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN			6	838	+			194			Extracellular (Potential).		B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	ENST00000283303.2	37	c.580C>A	CCDS4922.2	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930533	0.34096	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.41758	1.21;0.99;0.99	5.42	4.54	0.55810	.	0.000000	0.64402	D	0.000019	T	0.50480	0.1618	M	0.79258	2.445	0.30434	N	0.776836	D	0.89917	1.0	D	0.91635	0.999	T	0.54248	-0.8322	10	0.62326	D	0.03	-18.133	9.2226	0.37386	0.0:0.7772:0.1457:0.0771	.	194	Q8IZF3	GP115_HUMAN	I	251;194;194	ENSP00000360264:L251I;ENSP00000328319:L194I;ENSP00000283303:L194I	ENSP00000283303:L194I	L	+	1	0	GPR115	47789520	1.000000	0.71417	0.988000	0.46212	0.062000	0.15995	2.680000	0.46918	1.411000	0.46957	0.655000	0.94253	CTC		0.413	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838		59	63	1	0	7.82978e-24	0.01441	1.7356e-23	59	63				
CRISP2	7180	broad.mit.edu	37	6	49666177	49666177	+	Silent	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:49666177A>T	ENST00000339139.4	-	7	551	c.315T>A	c.(313-315)acT>acA	p.T105T		NM_001142407.2|NM_001142408.2|NM_001142417.2|NM_001142435.2|NM_001261822.1|NM_003296.3	NP_001135879.1|NP_001135880.1|NP_001135889.1|NP_001135907.1|NP_001248751.1|NP_003287.1	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2	105	SCP.				single organismal cell-cell adhesion (GO:0016337)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			AAGACCAGGAAGTAGGGTCAC	0.413																																							uc003ozq.2		NA																	0				skin(1)	1						c.(313-315)ACT>ACA		cysteine-rich secretory protein 2 precursor							163.0	148.0	153.0					6																	49666177		2203	4300	6503	SO:0001819	synonymous_variant	7180					extracellular space		g.chr6:49666177A>T	X95239	CCDS4928.1	6p12.3	2009-03-12	2003-09-03	2003-09-05	ENSG00000124490	ENSG00000124490			12024	protein-coding gene	gene with protein product	"""cancer/testis antigen 36"""	187430	"""testis specific protein 1 (probe H4-1 p3-1)"""	GAPDL5, TPX1		2613236, 8665901	Standard	NM_003296		Approved	CRISP-2, CT36	uc003ozo.3	P16562	OTTHUMG00000014822	ENST00000339139.4:c.315T>A	6.37:g.49666177A>T						CRISP2_uc003ozl.2_Silent_p.T105T|CRISP2_uc003ozn.2_Silent_p.T105T|CRISP2_uc003ozr.2_Silent_p.T105T|CRISP2_uc003ozo.2_Silent_p.T105T|CRISP2_uc003ozm.2_Silent_p.T105T|CRISP2_uc003ozp.2_Silent_p.T105T	p.T105T	NM_001142408	NP_001135880	P16562	CRIS2_HUMAN	KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)		7	571	-	Lung NSC(77;0.0161)		105					A8K8M0|Q53FF2|Q5U8Z9|Q7Z7B2	Silent	SNP	ENST00000339139.4	37	c.315T>A	CCDS4928.1																																																																																				0.413	CRISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040870.2	NM_003296		23	104	0	0	0	0.00333	0	23	104				
PKHD1	5314	broad.mit.edu	37	6	51483892	51483892	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:51483892T>C	ENST00000371117.3	-	67	12487	c.12212A>G	c.(12211-12213)cAg>cGg	p.Q4071R	RP3-335N17.2_ENST00000587000.1_RNA|RP3-335N17.2_ENST00000589278.2_RNA|RP3-335N17.2_ENST00000454361.1_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	4071					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CAGTTGCTCCTGAATAGTTTC	0.517																																							uc003pah.1		NA																	0				lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44						c.(12211-12213)CAG>CGG		fibrocystin isoform 1							67.0	67.0	67.0					6																	51483892		2203	4300	6503	SO:0001583	missense	5314				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	g.chr6:51483892T>C	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.12212A>G	6.37:g.51483892T>C	ENSP00000360158:p.Gln4071Arg						p.Q4071R	NM_138694	NP_619639	P08F94	PKHD1_HUMAN			67	12488	-	Lung NSC(77;0.0605)		4071			Cytoplasmic (Potential).		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	c.12212A>G	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.381371	0.42207	.	.	ENSG00000170927	ENST00000371117	D	0.85861	-2.04	5.38	1.72	0.24424	.	0.642206	0.13830	N	0.359808	T	0.68485	0.3006	M	0.66939	2.045	0.31648	N	0.647182	B	0.14438	0.01	B	0.08055	0.003	T	0.59904	-0.7366	10	0.87932	D	0	.	4.0624	0.09844	0.0:0.1909:0.204:0.6051	.	4071	P08F94	PKHD1_HUMAN	R	4071	ENSP00000360158:Q4071R	ENSP00000360158:Q4071R	Q	-	2	0	PKHD1	51591851	0.979000	0.34478	0.398000	0.26321	0.187000	0.23431	0.334000	0.19787	0.439000	0.26476	0.533000	0.62120	CAG		0.517	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		3	132	0	0	0	0.009096	0	3	132				
KHDRBS2	202559	broad.mit.edu	37	6	62757835	62757835	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:62757835G>T	ENST00000281156.4	-	3	562	c.284C>A	c.(283-285)aCa>aAa	p.T95K		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	95	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TTTAGCACCTGTTTCTTCCTG	0.378																																							uc003peg.2		NA																	0				skin(7)|ovary(3)|liver(1)	11						c.(283-285)ACA>AAA		KH domain-containing, RNA-binding, signal							181.0	170.0	174.0					6																	62757835		2203	4300	6503	SO:0001583	missense	202559				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding	g.chr6:62757835G>T	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.284C>A	6.37:g.62757835G>T	ENSP00000281156:p.Thr95Lys						p.T95K	NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.149)	3	531	-			95			KH.		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	ENST00000281156.4	37	c.284C>A	CCDS4963.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.938956	0.92526	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.46063	0.88	5.25	5.25	0.73442	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.050327	0.85682	D	0.000000	T	0.72922	0.3521	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81839	-0.0748	10	0.87932	D	0	-4.6325	19.2051	0.93726	0.0:0.0:1.0:0.0	.	95	Q5VWX1	KHDR2_HUMAN	K	95	ENSP00000281156:T95K	ENSP00000281156:T95K	T	-	2	0	KHDRBS2	62815794	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.809000	0.99208	2.597000	0.87782	0.460000	0.39030	ACA		0.378	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	NM_152688		52	99	1	0	2.0833e-19	0.01441	4.48711e-19	52	99				
COL12A1	1303	broad.mit.edu	37	6	75813479	75813479	+	Silent	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:75813479C>G	ENST00000322507.8	-	55	8622	c.8313G>C	c.(8311-8313)ggG>ggC	p.G2771G	COL12A1_ENST00000511023.1_5'Flank|COL12A1_ENST00000345356.6_Silent_p.G1607G|COL12A1_ENST00000483888.2_Silent_p.G2771G|COL12A1_ENST00000416123.2_Silent_p.G2695G	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2771	Collagen-like 1.|Triple-helical region (COL2) with 1 imperfection.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TTACAATTGCCCCACTGATAC	0.378																																							uc003phs.2		NA																	0				ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(8311-8313)GGG>GGC		collagen, type XII, alpha 1 long isoform							102.0	95.0	97.0					6																	75813479		1829	4088	5917	SO:0001819	synonymous_variant	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75813479C>G	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8313G>C	6.37:g.75813479C>G						COL12A1_uc003pht.2_Silent_p.G1607G	p.G2771G	NM_004370	NP_004361	Q99715	COCA1_HUMAN			55	8479	-			2771			Triple-helical region (COL2) with 1 imperfection.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	c.8313G>C	CCDS43482.1																																																																																				0.378	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		9	37	0	0	0	0.008291	0	9	37				
COL12A1	1303	broad.mit.edu	37	6	75825638	75825638	+	Splice_Site	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:75825638C>A	ENST00000322507.8	-	49	7868	c.7559G>T	c.(7558-7560)gGt>gTt	p.G2520V	COL12A1_ENST00000345356.6_Splice_Site_p.G1356V|COL12A1_ENST00000483888.2_Splice_Site_p.G2520V|COL12A1_ENST00000416123.2_Splice_Site_p.G2520V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2520	Laminin G-like.|Nonhelical region (NC3).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CATTTTAAAACCTTTACATCA	0.338																																							uc003phs.2		NA																	0				ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(7558-7560)GGT>GTT		collagen, type XII, alpha 1 long isoform							68.0	64.0	65.0					6																	75825638		1832	4085	5917	SO:0001630	splice_region_variant	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75825638C>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.7559-1G>T	6.37:g.75825638C>A						COL12A1_uc003pht.2_Missense_Mutation_p.G1356V	p.G2520V	NM_004370	NP_004361	Q99715	COCA1_HUMAN			49	7725	-			2520			TSP N-terminal.|Nonhelical region (NC3).		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.7559G>T	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784280	0.49997	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888;ENST00000493109	T;T;T;T;T;T	0.02216	4.39;4.39;4.39;4.39;4.39;4.39	4.84	4.84	0.62591	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.10337	0.0253	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.02411	-1.1163	10	0.87932	D	0	.	17.9733	0.89119	0.0:1.0:0.0:0.0	.	1356;2520	Q99715-2;Q99715	.;COCA1_HUMAN	V	2520;158;2520;1356;2520;2520;74	ENSP00000325146:G2520V;ENSP00000399812:G158V;ENSP00000305147:G1356V;ENSP00000412864:G2520V;ENSP00000421216:G2520V;ENSP00000423423:G74V	ENSP00000325146:G2520V	G	-	2	0	COL12A1	75882358	1.000000	0.71417	0.995000	0.50966	0.050000	0.14768	7.426000	0.80270	2.214000	0.71695	0.655000	0.94253	GGT		0.338	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	Missense_Mutation	29	56	1	0	5.77227e-19	0.008361	1.23327e-18	29	56				
SNAP91	9892	broad.mit.edu	37	6	84269919	84269919	+	Silent	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:84269919A>T	ENST00000439399.2	-	28	2851	c.2535T>A	c.(2533-2535)gcT>gcA	p.A845A	SNAP91_ENST00000520302.1_Silent_p.A815A|SNAP91_ENST00000369694.2_Silent_p.A845A|SNAP91_ENST00000437520.1_Silent_p.A538A|SNAP91_ENST00000195649.6_Silent_p.A840A|SNAP91_ENST00000428679.2_Silent_p.A845A|SNAP91_ENST00000521485.1_Silent_p.A840A|SNAP91_ENST00000520213.1_Silent_p.A538A|SNAP91_ENST00000521743.1_Silent_p.A845A	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	845	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TGCCTGTCCCAGCAGGAGGCT	0.542																																							uc011dze.1		NA																	0				ovary(1)	1						c.(2533-2535)GCT>GCA		synaptosomal-associated protein, 91kDa homolog							56.0	57.0	57.0					6																	84269919		1989	4158	6147	SO:0001819	synonymous_variant	9892				clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding	g.chr6:84269919A>T	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2535T>A	6.37:g.84269919A>T						SNAP91_uc011dzd.1_Silent_p.A343A|SNAP91_uc003pkb.2_Silent_p.A754A|SNAP91_uc003pkc.2_Silent_p.A815A|SNAP91_uc003pkd.2_Silent_p.A538A|SNAP91_uc003pka.2_Silent_p.A843A	p.A845A	NM_014841	NP_055656	O60641	AP180_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0967)	27	2852	-		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)	845			Pro-rich.		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Silent	SNP	ENST00000439399.2	37	c.2535T>A	CCDS47455.1																																																																																				0.542	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1			26	57	0	0	0	0.005443	0	26	57				
HTR1E	3354	broad.mit.edu	37	6	87725963	87725963	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:87725963G>T	ENST00000305344.5	+	2	1614	c.911G>T	c.(910-912)tGg>tTg	p.W304L		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	304	Agonist binding. {ECO:0000250}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	ATTTTATCCTGGCTGCCATTT	0.512																																							uc003pli.2		NA																	0				ovary(2)|skin(1)	3						c.(910-912)TGG>TTG		5-hydroxytryptamine (serotonin) receptor 1E	Eletriptan(DB00216)						155.0	155.0	155.0					6																	87725963		2203	4300	6503	SO:0001583	missense	3354				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity	g.chr6:87725963G>T		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.911G>T	6.37:g.87725963G>T	ENSP00000307766:p.Trp304Leu						p.W304L	NM_000865	NP_000856	P28566	5HT1E_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.055)	2	1614	+		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)	304			Helical; Name=6; (By similarity).		E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	c.911G>T	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.037860	0.54896	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.80909	-1.43;-1.43	4.38	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000014	D	0.91233	0.7237	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93837	0.7133	10	0.87932	D	0	.	16.9179	0.86156	0.0:0.0:1.0:0.0	.	304	P28566	5HT1E_HUMAN	L	304	ENSP00000307766:W304L;ENSP00000358597:W304L	ENSP00000307766:W304L	W	+	2	0	HTR1E	87782682	1.000000	0.71417	0.998000	0.56505	0.383000	0.30230	9.219000	0.95173	1.996000	0.58369	0.205000	0.17691	TGG		0.512	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		81	166	1	0	6.47592e-44	0.01441	1.73125e-43	81	166				
LAMA4	3910	broad.mit.edu	37	6	112455712	112455712	+	Missense_Mutation	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:112455712C>T	ENST00000230538.7	-	26	3911	c.3514G>A	c.(3514-3516)Gat>Aat	p.D1172N	LAMA4_ENST00000389463.4_Missense_Mutation_p.D1165N|LAMA4_ENST00000424408.2_Missense_Mutation_p.D1165N|LAMA4_ENST00000522006.1_Missense_Mutation_p.D1165N	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1172	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		ATGTATATATCTGTAAAAGGT	0.373																																							uc003pvu.2		NA																	0				ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(3514-3516)GAT>AAT		laminin, alpha 4 isoform 1 precursor							105.0	110.0	109.0					6																	112455712		2203	4300	6503	SO:0001583	missense	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112455712C>T		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3514G>A	6.37:g.112455712C>T	ENSP00000230538:p.Asp1172Asn					LAMA4_uc003pvv.2_Missense_Mutation_p.D1165N|LAMA4_uc003pvt.2_Missense_Mutation_p.D1165N	p.D1172N	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	26	3823	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	1172			Laminin G-like 2.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	c.3514G>A	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	32	5.136316	0.94517	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25	5.68	5.68	0.88126	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.83760	0.5324	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79720	-0.1685	10	0.30854	T	0.27	.	19.7923	0.96464	0.0:1.0:0.0:0.0	.	1172;1165	Q16363;Q16363-2	LAMA4_HUMAN;.	N	1172;1165;1165;1165	ENSP00000230538:D1172N;ENSP00000429488:D1165N;ENSP00000374114:D1165N;ENSP00000416470:D1165N	ENSP00000230538:D1172N	D	-	1	0	LAMA4	112562405	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.265000	0.78442	2.693000	0.91896	0.655000	0.94253	GAT		0.373	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		17	59	0	0	0	0.006122	0	17	59				
DSE	29940	broad.mit.edu	37	6	116757507	116757507	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:116757507G>C	ENST00000331677.3	+	7	2320	c.1876G>C	c.(1876-1878)Gag>Cag	p.E626Q	DSE_ENST00000537543.1_Missense_Mutation_p.E645Q|DSE_ENST00000452085.3_Missense_Mutation_p.E626Q|DSE_ENST00000359564.2_Missense_Mutation_p.E626Q			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	626					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TGGCTACAGCGAGAAAGCAAC	0.493																																							uc003pws.2		NA																	0				ovary(1)	1						c.(1876-1878)GAG>CAG		dermatan sulfate epimerase precursor							137.0	119.0	126.0					6																	116757507		2203	4300	6503	SO:0001583	missense	29940				dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity	g.chr6:116757507G>C	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1876G>C	6.37:g.116757507G>C	ENSP00000332151:p.Glu626Gln					DSE_uc011ebg.1_Missense_Mutation_p.E645Q|DSE_uc003pwt.2_Missense_Mutation_p.E626Q|DSE_uc003pwu.2_Missense_Mutation_p.E293Q	p.E626Q	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)	6	2070	+		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)	626					Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	c.1876G>C	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	g	12.55	1.972731	0.34848	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	6.01	4.25	0.50352	.	0.213049	0.51477	D	0.000082	T	0.39937	0.1097	L	0.54323	1.7	0.37062	D	0.898136	B;B	0.31485	0.325;0.325	B;B	0.29077	0.098;0.098	T	0.30822	-0.9965	10	0.33141	T	0.24	-12.0286	13.1708	0.59597	0.129:0.0:0.871:0.0	.	645;626	B7Z765;Q9UL01	.;DSE_HUMAN	Q	626;645;626;626	ENSP00000404049:E626Q;ENSP00000441152:E645Q;ENSP00000332151:E626Q;ENSP00000352567:E626Q	ENSP00000332151:E626Q	E	+	1	0	DSE	116864200	1.000000	0.71417	0.997000	0.53966	0.862000	0.49288	3.918000	0.56432	0.897000	0.36392	-0.127000	0.14921	GAG		0.493	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352		24	68	0	0	0	0.004656	0	24	68				
GPRC6A	222545	broad.mit.edu	37	6	117130692	117130692	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:117130692G>T	ENST00000310357.3	-	2	304	c.283C>A	c.(283-285)Ctg>Atg	p.L95M	GPRC6A_ENST00000368549.3_Missense_Mutation_p.L95M|GPRC6A_ENST00000530250.1_Missense_Mutation_p.L95M	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	95					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TCATACCCCAGTTTGACTCCA	0.408																																							uc003pxj.1		NA																	0				ovary(4)|skin(2)	6						c.(283-285)CTG>ATG		G protein-coupled receptor, family C, group 6,							115.0	106.0	109.0					6																	117130692		2203	4300	6503	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117130692G>T	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.283C>A	6.37:g.117130692G>T	ENSP00000309493:p.Leu95Met					GPRC6A_uc003pxk.1_Missense_Mutation_p.L95M|GPRC6A_uc003pxl.1_Missense_Mutation_p.L95M	p.L95M	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	2	305	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	95			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.283C>A	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305807	0.60305	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.92397	-3.03;-3.03;-3.03	4.81	3.94	0.45596	Extracellular ligand-binding receptor (1);	0.000000	0.53938	D	0.000055	D	0.95560	0.8557	M	0.91196	3.185	0.24688	N	0.993321	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.91027	0.4861	10	0.87932	D	0	.	13.2985	0.60311	0.0767:0.0:0.9233:0.0	.	95;95;95	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	M	95	ENSP00000309493:L95M;ENSP00000357537:L95M;ENSP00000433465:L95M	ENSP00000309493:L95M	L	-	1	2	GPRC6A	117237385	0.975000	0.34042	1.000000	0.80357	0.947000	0.59692	1.644000	0.37228	1.245000	0.43885	-0.157000	0.13467	CTG		0.408	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			17	47	1	0	8.60227e-14	0.004007	1.69497e-13	17	47				
LPA	4018	broad.mit.edu	37	6	161007518	161007518	+	Silent	SNP	C	C	A	rs376480107		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:161007518C>A	ENST00000316300.5	-	25	4136	c.4092G>T	c.(4090-4092)gtG>gtT	p.V1364V	LPA_ENST00000447678.1_Silent_p.V1364V			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3872	Kringle 12. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GAACTGGGACCACCGTGGGAG	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		20094	0.0		0.0	False		,,,				2504	0.001						uc003qtl.2		NA																	0				ovary(3)|skin(2)|pancreas(1)	6						c.(4090-4092)GTG>GTT		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)	C		1,4039		0,1,2019	127.0	125.0	126.0		4092	-4.5	0.0	6		126	0,8442		0,0,4221	no	coding-synonymous	LPA	NM_005577.2		0,1,6240	AA,AC,CC		0.0,0.0248,0.0080		1364/2041	161007518	1,12481	2020	4221	6241	SO:0001819	synonymous_variant	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:161007518C>A	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4092G>T	6.37:g.161007518C>A							p.V1364V	NM_005577	NP_005568	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	26	4212	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	3872			Kringle 34.		Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	37	c.4092G>T	CCDS43523.1																																																																																				0.493	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		32	108	1	0	4.34311e-12	0.003271	8.34127e-12	32	108				
PDE10A	10846	broad.mit.edu	37	6	165842178	165842178	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr6:165842178C>A	ENST00000366882.1	-	11	947	c.793G>T	c.(793-795)Gtt>Ttt	p.V265F	PDE10A_ENST00000539869.2_Missense_Mutation_p.V275F|PDE10A_ENST00000354448.4_Missense_Mutation_p.V265F			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	265					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TCTATTGCAACTATGTTATCA	0.308																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	0				ovary(3)|skin(2)	5						c.(793-795)GTT>TTT		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						77.0	72.0	74.0					6																	165842178		2196	4290	6486	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165842178C>A	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.793G>T	6.37:g.165842178C>A	ENSP00000355847:p.Val265Phe					PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.V195F|PDE10A_uc003quo.2_Missense_Mutation_p.V275F	p.V265F	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	11	1034	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	265					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.793G>T		.	.	.	.	.	.	.	.	.	.	C	25.7	4.665799	0.88251	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69561	-0.41;-0.41	5.41	5.41	0.78517	.	0.163091	0.53938	D	0.000048	T	0.68613	0.3020	L	0.36672	1.1	0.80722	D	1	D;P	0.65815	0.995;0.892	P;P	0.60886	0.88;0.715	T	0.70461	-0.4865	10	0.59425	D	0.04	.	19.5385	0.95264	0.0:1.0:0.0:0.0	.	275;265	Q9ULW9;Q9Y233	.;PDE10_HUMAN	F	265;293;275;265;264	ENSP00000355847:V265F;ENSP00000346435:V265F	ENSP00000341187:V275F	V	-	1	0	PDE10A	165762168	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.955000	0.76007	2.698000	0.92095	0.585000	0.79938	GTT		0.308	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			11	23	1	0	1.58986e-06	0.008291	2.74613e-06	11	23				
ABCA13	154664	broad.mit.edu	37	7	48390325	48390325	+	Nonsense_Mutation	SNP	C	C	A	rs371675186		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:48390325C>A	ENST00000435803.1	+	30	10314	c.10290C>A	c.(10288-10290)tgC>tgA	p.C3430*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3430					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCTCTTCCTGCGTGGCACTGA	0.522																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(10288-10290)TGC>TGA		ATP binding cassette, sub-family A (ABC1),							134.0	132.0	132.0					7																	48390325		2060	4211	6271	SO:0001587	stop_gained	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48390325C>A	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.10290C>A	7.37:g.48390325C>A	ENSP00000411096:p.Cys3430*					ABCA13_uc010kys.1_Nonsense_Mutation_p.C504*|ABCA13_uc003tos.1_Nonsense_Mutation_p.C256*	p.C3430*	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			30	10315	+			3430					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	c.10290C>A	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	51	17.409103	0.99885	.	.	ENSG00000179869	ENST00000435803	.	.	.	4.66	-7.29	0.01451	.	0.000000	0.50627	D	0.000107	.	.	.	.	.	.	0.53688	D	0.999979	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6676	0.62405	0.0:0.1713:0.0:0.8287	.	.	.	.	X	3430	.	ENSP00000411096:C3430X	C	+	3	2	ABCA13	48360871	0.929000	0.31497	0.004000	0.12327	0.757000	0.42996	-0.343000	0.07791	-1.825000	0.01207	-0.150000	0.13652	TGC		0.522	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		79	98	1	0	8.41775e-28	0.01441	1.96414e-27	79	98				
ELN	2006	broad.mit.edu	37	7	73456964	73456964	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:73456964G>T	ENST00000252034.7	+	6	652	c.253G>T	c.(253-255)Gtt>Ttt	p.V85F	ELN_ENST00000414324.1_Missense_Mutation_p.V75F|ELN_ENST00000429192.1_Missense_Mutation_p.V85F|ELN_ENST00000380562.4_Missense_Mutation_p.V85F|ELN_ENST00000358929.4_Missense_Mutation_p.V85F|ELN_ENST00000380575.4_Missense_Mutation_p.V75F|ELN_ENST00000380584.4_Missense_Mutation_p.V85F|ELN_ENST00000380553.4_Intron|ELN_ENST00000458204.1_Missense_Mutation_p.V75F|ELN_ENST00000357036.5_Missense_Mutation_p.V85F|ELN_ENST00000320492.7_Missense_Mutation_p.V73F|ELN_ENST00000445912.1_Missense_Mutation_p.V85F|ELN_ENST00000380576.5_Missense_Mutation_p.V85F|ELN_ENST00000320399.6_Missense_Mutation_p.V85F	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	85					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CTTCCCCGCAGTTACCTTTCC	0.632			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																uc003tzw.2		NA		Dom	yes		7	7q11.23	2006	T	elastin	yes	Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome	L	PAX5		B-ALL		0				ovary(3)|pancreas(2)	5						c.(253-255)GTT>TTT		elastin isoform a precursor	Rofecoxib(DB00533)						62.0	62.0	62.0					7																	73456964		2203	4300	6503	SO:0001583	missense	2006				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding	g.chr7:73456964G>T		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.253G>T	7.37:g.73456964G>T	ENSP00000252034:p.Val85Phe					RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_RNA|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Missense_Mutation_p.V85F|ELN_uc003tzz.2_Missense_Mutation_p.V73F|ELN_uc003tzo.2_Missense_Mutation_p.V85F|ELN_uc003tzp.2_Missense_Mutation_p.V75F|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_RNA|ELN_uc003tzs.2_Missense_Mutation_p.V85F|ELN_uc003tzt.2_Missense_Mutation_p.V85F|ELN_uc003tzu.2_Missense_Mutation_p.V85F|ELN_uc003tzv.2_Missense_Mutation_p.V75F|ELN_uc003tzx.2_Missense_Mutation_p.V75F|ELN_uc011kff.1_Missense_Mutation_p.V85F|ELN_uc003tzy.2_Missense_Mutation_p.V75F	p.V85F	NM_000501	NP_001075224	P15502	ELN_HUMAN			6	344	+		Lung NSC(55;0.159)	85					B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	c.253G>T	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	G	8.246	0.807892	0.16467	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000431562;ENST00000320492;ENST00000438906;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000417091;ENST00000429192;ENST00000442310;ENST00000380576;ENST00000428787;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.45276	1.5;1.5;1.47;1.49;0.9;1.48;1.5;1.48;1.5;1.48;1.5;1.49;1.5;1.49	4.07	3.17	0.36434	.	.	.	.	.	T	0.26629	0.0651	L	0.29908	0.895	0.19775	N	0.99995	P;P;P;P;P;P;P;P;P;P;P;P	0.42620	0.785;0.589;0.785;0.785;0.785;0.785;0.785;0.785;0.785;0.785;0.589;0.785	B;B;B;B;B;B;B;B;B;B;B;B	0.34779	0.189;0.189;0.189;0.189;0.189;0.189;0.189;0.189;0.189;0.189;0.189;0.189	T	0.06826	-1.0805	9	0.45353	T	0.12	0.0035	7.9103	0.29787	0.1155:0.0:0.8845:0.0	.	85;73;75;75;85;75;85;85;85;75;85;85	E7ENM0;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.	F	85;85;85;63;73;73;75;85;75;85;75;85;85;85;85;85;85;85	ENSP00000389857:V85F;ENSP00000252034:V85F;ENSP00000351807:V85F;ENSP00000315607:V73F;ENSP00000406949:V73F;ENSP00000392575:V75F;ENSP00000369936:V85F;ENSP00000369949:V75F;ENSP00000369958:V85F;ENSP00000403162:V75F;ENSP00000349540:V85F;ENSP00000391129:V85F;ENSP00000369950:V85F;ENSP00000313565:V85F	ENSP00000252034:V85F	V	+	1	0	ELN	73094900	0.811000	0.29063	0.008000	0.14137	0.008000	0.06430	2.163000	0.42377	0.913000	0.36797	0.462000	0.41574	GTT		0.632	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501		59	88	1	0	1.69475e-38	0.01441	4.27303e-38	59	88				
GTF2IRD1	9569	broad.mit.edu	37	7	73969507	73969507	+	Silent	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:73969507C>T	ENST00000265755.3	+	18	2313	c.1920C>T	c.(1918-1920)ccC>ccT	p.P640P	GTF2IRD1_ENST00000476977.1_Silent_p.P640P|GTF2IRD1_ENST00000455841.2_Silent_p.P672P|GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000424337.2_Silent_p.P640P	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	640					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TTTCCAGGCCCGAGCTGCTCA	0.622																																							uc003uaq.2		NA																	0				ovary(4)	4						c.(1918-1920)CCC>CCT		GTF2I repeat domain containing 1 isoform 1							77.0	79.0	79.0					7																	73969507		2203	4300	6503	SO:0001819	synonymous_variant	9569					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr7:73969507C>T	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1920C>T	7.37:g.73969507C>T						GTF2IRD1_uc010lbq.2_Silent_p.P672P|GTF2IRD1_uc003uap.2_Silent_p.P640P|GTF2IRD1_uc003uar.1_Silent_p.P640P	p.P640P	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN			18	2313	+			640			GTF2I-like 3.		O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Silent	SNP	ENST00000265755.3	37	c.1920C>T	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.273310	0.23221	.	.	ENSG00000006704	ENST00000470715	.	.	.	3.58	-7.06	0.01568	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.734	3.5715	0.07918	0.1063:0.1547:0.1156:0.6234	.	.	.	.	X	18	.	.	R	+	1	2	GTF2IRD1	73607443	0.000000	0.05858	0.892000	0.35008	0.874000	0.50279	-3.732000	0.00380	-1.689000	0.01434	-0.355000	0.07637	CGA		0.622	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		14	137	0	0	0	0.004007	0	14	137				
NPTX2	4885	broad.mit.edu	37	7	98254413	98254413	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:98254413C>A	ENST00000265634.3	+	3	988	c.823C>A	c.(823-825)Cag>Aag	p.Q275K		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	275	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.Q275K(1)		breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GGTGCCAGGGCAGGCCAACGA	0.642																																							uc003upl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(823-825)CAG>AAG		neuronal pentraxin II precursor							106.0	88.0	94.0					7																	98254413		2203	4300	6503	SO:0001583	missense	4885				synaptic transmission	extracellular region	metal ion binding|sugar binding	g.chr7:98254413C>A		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.823C>A	7.37:g.98254413C>A	ENSP00000265634:p.Gln275Lys						p.Q275K	NM_002523	NP_002514	P47972	NPTX2_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		3	1000	+	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		275			Pentaxin.		A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	c.823C>A	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046970	0.75846	.	.	ENSG00000106236	ENST00000265634	T	0.05513	3.43	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.27454	0.0674	M	0.77313	2.365	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.00253	-1.1875	10	0.40728	T	0.16	-18.2745	18.7465	0.91795	0.0:1.0:0.0:0.0	.	275	P47972	NPTX2_HUMAN	K	275	ENSP00000265634:Q275K	ENSP00000265634:Q275K	Q	+	1	0	NPTX2	98092349	1.000000	0.71417	1.000000	0.80357	0.184000	0.23303	7.776000	0.85560	2.667000	0.90743	0.561000	0.74099	CAG		0.642	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523		24	105	1	0	3.10358e-05	0.014323	5.27509e-05	24	105				
AASS	10157	broad.mit.edu	37	7	121758465	121758465	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:121758465C>A	ENST00000393376.1	-	5	678	c.583G>T	c.(583-585)Gtg>Ttg	p.V195L	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.V195L			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	195	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						ACAGCTTGCACAGCCTGACTG	0.408																																							uc003vka.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(583-585)GTG>TTG		aminoadipate-semialdehyde synthase precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						120.0	109.0	113.0					7																	121758465		2203	4300	6503	SO:0001583	missense	10157				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity	g.chr7:121758465C>A	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.583G>T	7.37:g.121758465C>A	ENSP00000377040:p.Val195Leu					AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.V195L|AASS_uc011knw.1_Intron	p.V195L	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN			5	679	-			195			Lysine-ketoglutarate reductase.		O95462	Missense_Mutation	SNP	ENST00000393376.1	37	c.583G>T	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	.	6.034	0.374650	0.11409	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	4.83	3.95	0.45737	.	0.178929	0.50627	D	0.000109	T	0.23054	0.0557	N	0.02539	-0.55	0.46725	D	0.999171	B	0.02656	0.0	B	0.04013	0.001	T	0.22103	-1.0226	9	0.02654	T	1	-11.8438	12.9952	0.58642	0.0:0.9224:0.0:0.0776	.	195	Q9UDR5	AASS_HUMAN	L	195	.	ENSP00000351834:V195L	V	-	1	0	AASS	121545701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.589000	0.46145	1.280000	0.44463	0.650000	0.86243	GTG		0.408	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763		61	70	1	0	7.82978e-24	0.01441	1.7356e-23	61	70				
GRM8	2918	broad.mit.edu	37	7	126544704	126544704	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:126544704G>T	ENST00000339582.2	-	4	1569	c.761C>A	c.(760-762)cCa>cAa	p.P254Q	GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000405249.1_Missense_Mutation_p.P254Q|GRM8_ENST00000444921.2_Missense_Mutation_p.P254Q|GRM8_ENST00000358373.3_Missense_Mutation_p.P254Q			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	254					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TGGTTCACGTGGGATTTTCTG	0.393										HNSCC(24;0.065)																													uc003vlr.2		NA																	0				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(760-762)CCA>CAA		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						89.0	90.0	89.0					7																	126544704		2203	4300	6503	SO:0001583	missense	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126544704G>T		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.761C>A	7.37:g.126544704G>T	ENSP00000344173:p.Pro254Gln	HNSCC(24;0.065)				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.P254Q|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_5'UTR	p.P254Q	NM_000845	NP_000836	O00222	GRM8_HUMAN			3	1072	-		Prostate(267;0.186)	254			Extracellular (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	c.761C>A	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303138	0.81136	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830	D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42	5.24	5.24	0.73138	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.95872	0.8656	M	0.92923	3.36	0.80722	D	1	D;P	0.76494	0.999;0.892	D;P	0.83275	0.996;0.771	D	0.96569	0.9421	10	0.62326	D	0.03	.	17.8349	0.88693	0.0:0.0:1.0:0.0	.	254;254	O00222-2;O00222	.;GRM8_HUMAN	Q	254	ENSP00000344173:P254Q;ENSP00000409790:P254Q;ENSP00000351142:P254Q;ENSP00000385731:P254Q;ENSP00000415522:P254Q	ENSP00000344173:P254Q	P	-	2	0	GRM8	126331940	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.779000	0.99018	2.445000	0.82738	0.557000	0.71058	CCA		0.393	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			30	101	1	0	6.04164e-23	0.010818	1.33367e-22	30	101				
LRRC4	64101	broad.mit.edu	37	7	127670542	127670542	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:127670542G>T	ENST00000249363.3	-	2	409	c.152C>A	c.(151-153)tCg>tAg	p.S51*	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	51	LRRNT.				postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		GTTACTGCACGAGCAGACGGA	0.647																																							uc003vmk.2		NA																	0				large_intestine(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						c.(151-153)TCG>TAG		leucine rich repeat containing 4 precursor							83.0	90.0	88.0					7																	127670542		2203	4300	6503	SO:0001587	stop_gained	64101					cell junction|integral to membrane|postsynaptic membrane		g.chr7:127670542G>T	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.152C>A	7.37:g.127670542G>T	ENSP00000249363:p.Ser51*					SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron	p.S51*	NM_022143	NP_071426	Q9HBW1	LRRC4_HUMAN		Lung(243;0.124)	2	289	-			51			LRRNT.|Extracellular (Potential).		A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Nonsense_Mutation	SNP	ENST00000249363.3	37	c.152C>A	CCDS5799.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357485	0.82243	.	.	ENSG00000128594	ENST00000249363;ENST00000476782	.	.	.	4.66	3.78	0.43462	.	0.085211	0.48767	D	0.000163	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4208	0.44348	0.0953:0.0:0.9047:0.0	.	.	.	.	X	51	.	ENSP00000249363:S51X	S	-	2	0	LRRC4	127457778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.652000	0.98499	1.146000	0.42352	0.655000	0.94253	TCG		0.647	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349170.1	NM_022143		79	92	1	0	7.63117e-38	0.01441	1.91499e-37	79	92				
AHCYL2	23382	broad.mit.edu	37	7	129043237	129043237	+	Silent	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:129043237G>C	ENST00000325006.3	+	7	990	c.936G>C	c.(934-936)ggG>ggC	p.G312G	RNU7-16P_ENST00000516471.1_RNA|AHCYL2_ENST00000531335.2_Silent_p.G231G|AHCYL2_ENST00000474594.1_Silent_p.G209G|AHCYL2_ENST00000446544.2_Silent_p.G311G|AHCYL2_ENST00000446212.1_Silent_p.G210G|AHCYL2_ENST00000490911.1_Silent_p.G209G	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	312					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						ATGATGGAGGGGATCTTACCC	0.408																																					Pancreas(160;1736 1964 29875 40941 45605)	Pancreas(160;1736 1964 29875 40941 45605)	uc011kov.1		NA																	0				ovary(2)	2						c.(934-936)GGG>GGC		S-adenosylhomocysteine hydrolase-like 2 isoform							136.0	135.0	135.0					7																	129043237		2203	4300	6503	SO:0001819	synonymous_variant	23382				one-carbon metabolic process		adenosylhomocysteinase activity	g.chr7:129043237G>C	AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.936G>C	7.37:g.129043237G>C						AHCYL2_uc003vot.2_Silent_p.G311G|AHCYL2_uc003vov.2_Silent_p.G209G|AHCYL2_uc011kow.1_Silent_p.G210G|AHCYL2_uc011kox.1_Silent_p.G209G	p.G312G	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN			7	990	+			312					B4DIZ5|D9N155|O94917	Silent	SNP	ENST00000325006.3	37	c.936G>C	CCDS5812.1	.	.	.	.	.	.	.	.	.	.	G	8.774	0.926573	0.18056	.	.	ENSG00000158467	ENST00000466924	D	0.86097	-2.07	5.16	3.34	0.38264	.	0.097320	0.64402	D	0.000001	D	0.85839	0.5790	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.83753	0.0210	7	0.87932	D	0	-14.6246	4.8265	0.13419	0.181:0.0:0.6482:0.1707	.	.	.	.	A	219	ENSP00000419346:G219A	ENSP00000419346:G219A	G	+	2	0	AHCYL2	128830473	0.972000	0.33761	1.000000	0.80357	0.998000	0.95712	0.048000	0.14078	0.659000	0.30945	0.655000	0.94253	GGG		0.408	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1			93	118	0	0	0	0.01441	0	93	118				
KDM7A	80853	broad.mit.edu	37	7	139827360	139827360	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:139827360T>C	ENST00000397560.2	-	5	680	c.583A>G	c.(583-585)Att>Gtt	p.I195V	JHDM1D_ENST00000006967.5_Missense_Mutation_p.I195V	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		195					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					GCCACATCAATGACATCTATC	0.353																																							uc003vvm.2		NA																	0				ovary(1)	1						c.(583-585)ATT>GTT		jumonji C domain containing histone demethylase							153.0	151.0	152.0					7																	139827360		1941	4146	6087	SO:0001583	missense	80853				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr7:139827360T>C																												ENST00000397560.2:c.583A>G	7.37:g.139827360T>C	ENSP00000380692:p.Ile195Val						p.I195V	NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN			5	587	-	Melanoma(164;0.0142)		195					A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	ENST00000397560.2	37	c.583A>G	CCDS43658.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.569885	0.86542	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.18502	2.43;2.21	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.39410	0.1077	M	0.63208	1.945	0.80722	D	1	D	0.60575	0.988	D	0.67103	0.949	T	0.06338	-1.0832	10	0.49607	T	0.09	-19.4436	16.4614	0.84056	0.0:0.0:0.0:1.0	.	195	Q6ZMT4	KDM7_HUMAN	V	195	ENSP00000380692:I195V;ENSP00000006967:I195V	ENSP00000006967:I195V	I	-	1	0	JHDM1D	139473829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.905000	0.87416	2.285000	0.76669	0.533000	0.62120	ATT		0.353	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1			67	210	0	0	0	0.01441	0	67	210				
PIP	5304	broad.mit.edu	37	7	142832325	142832326	+	Nonsense_Mutation	DNP	CA	CA	AG			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:142832325_142832326CA>AG	ENST00000291009.3	+	2	174_175	c.134_135CA>AG	c.(133-135)tCA>tAG	p.S45*		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	45					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		ATTCCCAAGTCAGTACGTCCAA	0.446																																							uc003wcf.1		NA																	0				ovary(1)	1						c.(133-135)TCA>TAG		prolactin-induced protein precursor																																				SO:0001587	stop_gained	5304					extracellular region	actin binding	g.chr7:142832325_142832326CA>AG		CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	Exception_encountered	7.37:g.142832325_142832326delinsAG	ENSP00000291009:p.Ser45*						p.S45*	NM_002652	NP_002643	P12273	PIP_HUMAN		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)	2	170_171	+	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)	45					A0A963|A0A9C3|A0A9F3|A4D2I1	Nonsense_Mutation	DNP	ENST00000291009.3	37	c.134_135CA>AG	CCDS34768.1																																																																																				0.446	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327089.1	NM_002652		13	17	0	0	0	0.004672	0	13	17				
SSPO	23145	broad.mit.edu	37	7	149502627	149502627	+	RNA	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:149502627G>T	ENST00000378016.2	+	0	8440							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ATCCTGCCCAGGAGATGCCAC	0.682																																							uc010lpk.2		NA																	0					0						c.(8440-8442)GGA>TGA		SCO-spondin precursor							36.0	43.0	41.0					7																	149502627		1896	4105	6001			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149502627G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149502627G>T							p.G2814*	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		58	8440	+	Melanoma(164;0.165)|Ovarian(565;0.177)		2814			TSP type-1 7.		Q76B61	Nonsense_Mutation	SNP	ENST00000378016.2	37	c.8440G>T																																																																																					0.682	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				23	53	1	0	2.52088e-20	0.00278	5.45165e-20	23	53				
GIMAP4	55303	broad.mit.edu	37	7	150269516	150269516	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:150269516G>T	ENST00000255945.2	+	3	533	c.358G>T	c.(358-360)Gtg>Ttg	p.V120L	GIMAP4_ENST00000461940.1_Missense_Mutation_p.V134L|GIMAP4_ENST00000494750.1_3'UTR	NM_018326.2	NP_060796.1	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	120	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTGCTTCTGGTGGTTCCACT	0.493																																							uc003whl.2		NA																	0				ovary(1)	1						c.(358-360)GTG>TTG		GTPase, IMAP family member 4							89.0	83.0	85.0					7																	150269516		2203	4300	6503	SO:0001583	missense	55303						GTP binding	g.chr7:150269516G>T	AK001972	CCDS5904.1	7q36.1	2014-04-04			ENSG00000133574	ENSG00000133574		"""GTPases, IMAP"""	21872	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 1"""	608087				15474311, 18701445	Standard	NM_018326		Approved	HIMAP4, FLJ11110, IMAP4, IAN1	uc003whl.3	Q9NUV9	OTTHUMG00000157475	ENST00000255945.2:c.358G>T	7.37:g.150269516G>T	ENSP00000255945:p.Val120Leu					GIMAP4_uc011kuu.1_Intron|GIMAP4_uc011kuv.1_Missense_Mutation_p.V134L	p.V120L	NM_018326	NP_060796	Q9NUV9	GIMA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	440	+			120						Missense_Mutation	SNP	ENST00000255945.2	37	c.358G>T	CCDS5904.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.561252	0.45590	.	.	ENSG00000133574	ENST00000255945;ENST00000461940;ENST00000479232	T;T;T	0.12984	2.63;2.63;2.63	4.72	4.72	0.59763	AIG1 (1);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	M	0.84948	2.725	0.38756	D	0.954216	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.46205	-0.9208	10	0.59425	D	0.04	.	13.0417	0.58904	0.0:0.0:1.0:0.0	.	134;120	G5E9W9;Q9NUV9	.;GIMA4_HUMAN	L	120;134;134	ENSP00000255945:V120L;ENSP00000419545:V134L;ENSP00000418615:V134L	ENSP00000255945:V120L	V	+	1	0	GIMAP4	149900449	1.000000	0.71417	0.957000	0.39632	0.005000	0.04900	4.072000	0.57563	2.473000	0.83533	0.655000	0.94253	GTG		0.493	GIMAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348927.1	NM_018326		22	71	1	0	7.87624e-14	0.00278	1.56349e-13	22	71				
ATG9B	285973	broad.mit.edu	37	7	150720252	150720252	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:150720252C>A	ENST00000377974.2	-	4	776	c.701G>T	c.(700-702)cGa>cTa	p.R234L	ATG9B_ENST00000444312.1_5'UTR|ATG9B_ENST00000605952.1_Missense_Mutation_p.R234L|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605938.1_Missense_Mutation_p.R234L			Q674R7	ATG9B_HUMAN	autophagy related 9B	234					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATCCACGCATCGAAGGAGGAA	0.542																																							uc011kvc.1		NA																	0				ovary(1)	1						c.(700-702)CGA>CTA		ATG9 autophagy related 9 homolog B							251.0	253.0	253.0					7																	150720252		2045	4196	6241	SO:0001583	missense	285973				autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane		g.chr7:150720252C>A	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.701G>T	7.37:g.150720252C>A	ENSP00000475005:p.Arg234Leu					ATG9B_uc003wig.3_RNA	p.R234L	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	4	777	-	all_neural(206;0.219)		234			Lumenal (By similarity).		A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	ENST00000377974.2	37	c.701G>T		.	.	.	.	.	.	.	.	.	.	C	15.32	2.797507	0.50208	.	.	ENSG00000248602	ENST00000377974;ENST00000397266;ENST00000545613	.	.	.	5.42	5.42	0.78866	.	0.107611	0.64402	D	0.000006	T	0.32793	0.0841	.	.	.	.	.	.	B	0.15930	0.015	B	0.17433	0.018	T	0.38564	-0.9655	7	0.11485	T	0.65	-41.8169	10.1983	0.43067	0.0:0.9097:0.0:0.0903	.	234	Q674R7	ATG9B_HUMAN	L	234	.	ENSP00000444232:R234L	R	-	2	0	AC010973.1	150351185	1.000000	0.71417	0.728000	0.30774	0.936000	0.57629	2.994000	0.49433	2.538000	0.85594	0.655000	0.94253	CGA		0.542	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681		85	200	1	0	5.92634e-42	0.01441	1.55311e-41	85	200				
WDR60	55112	broad.mit.edu	37	7	158715218	158715218	+	Missense_Mutation	SNP	A	A	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr7:158715218A>C	ENST00000407559.3	+	16	2230	c.2072A>C	c.(2071-2073)aAa>aCa	p.K691T		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	691					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		GGGCCACAGAAAGTTCTGATA	0.552																																							uc003woe.3		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(2071-2073)AAA>ACA		WD repeat domain 60							59.0	59.0	59.0					7																	158715218		2143	4245	6388	SO:0001583	missense	55112							g.chr7:158715218A>C		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.2072A>C	7.37:g.158715218A>C	ENSP00000384290:p.Lys691Thr					WDR60_uc010lqv.2_Intron|WDR60_uc010lqw.2_Missense_Mutation_p.K323T	p.K691T	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)	16	2230	+	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	691					Q9NW58	Missense_Mutation	SNP	ENST00000407559.3	37	c.2072A>C	CCDS47757.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.780013	0.70222	.	.	ENSG00000126870	ENST00000407559	T	0.78707	-1.2	5.27	5.27	0.74061	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.88303	0.6400	M	0.85197	2.74	0.51767	D	0.99993	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.979	D	0.89436	0.3720	10	0.54805	T	0.06	-34.4777	13.1284	0.59368	1.0:0.0:0.0:0.0	.	174;691	A4D230;Q8WVS4	.;WDR60_HUMAN	T	691	ENSP00000384290:K691T	ENSP00000384290:K691T	K	+	2	0	WDR60	158407979	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.456000	0.66665	1.974000	0.57490	0.482000	0.46254	AAA		0.552	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051		11	38	0	0	0	0.008291	0	11	38				
LZTS1	11178	broad.mit.edu	37	8	20110358	20110358	+	Nonsense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:20110358T>A	ENST00000381569.1	-	3	1441	c.1084A>T	c.(1084-1086)Aag>Tag	p.K362*	LZTS1_ENST00000265801.6_Nonsense_Mutation_p.K362*|LZTS1_ENST00000522290.1_Nonsense_Mutation_p.K362*			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	362					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GACCTGAGCTTGGTCTCCAGC	0.642																																							uc003wzr.2		NA																	0				ovary(1)	1						c.(1084-1086)AAG>TAG		leucine zipper, putative tumor suppressor 1							33.0	34.0	34.0					8																	20110358		2203	4300	6503	SO:0001587	stop_gained	11178				cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:20110358T>A	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1084A>T	8.37:g.20110358T>A	ENSP00000370981:p.Lys362*					LZTS1_uc010ltg.1_Nonsense_Mutation_p.K362*	p.K362*	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN		Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)	2	1195	-			362			Potential.		D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Nonsense_Mutation	SNP	ENST00000381569.1	37	c.1084A>T	CCDS6015.1	.	.	.	.	.	.	.	.	.	.	T	36	5.787462	0.96945	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	.	.	.	5.45	5.45	0.79879	.	0.045716	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-43.7941	14.3373	0.66600	0.0:0.0:0.0:1.0	.	.	.	.	X	362	.	ENSP00000265801:K362X	K	-	1	0	LZTS1	20154638	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.370000	0.52372	2.068000	0.61886	0.459000	0.35465	AAG		0.642	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020		23	63	0	0	0	0.014323	0	23	63				
CLU	1191	broad.mit.edu	37	8	27466544	27466544	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:27466544C>A	ENST00000316403.10	-	3	562	c.157G>T	c.(157-159)Gtg>Ttg	p.V53L	CLU_ENST00000560366.1_Missense_Mutation_p.V105L|CLU_ENST00000523500.1_Missense_Mutation_p.V53L|CLU_ENST00000405140.3_Missense_Mutation_p.V53L|CLU_ENST00000546343.1_Missense_Mutation_p.V64L			P10909	CLUS_HUMAN	clusterin	53					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		ATCTGTTTCACCCCGTTGACA	0.443																																							uc003xfw.1		NA																	0				ovary(2)	2						c.(157-159)GTG>TTG		clusterin isoform 2							170.0	157.0	162.0					8																	27466544		2203	4300	6503	SO:0001583	missense	1191				chaperone-mediated protein folding|complement activation, classical pathway|innate immune response|lipid metabolic process|negative regulation of apoptosis|negative regulation of protein homooligomerization|platelet activation|platelet degranulation|positive regulation of NF-kappaB transcription factor activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|response to misfolded protein|response to virus|reverse cholesterol transport	chromaffin granule|cytosol|endoplasmic reticulum|microsome|mitochondrial membrane|nucleus|perinuclear region of cytoplasm|platelet alpha granule lumen|spherical high-density lipoprotein particle	misfolded protein binding|ubiquitin protein ligase binding	g.chr8:27466544C>A	M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.157G>T	8.37:g.27466544C>A	ENSP00000315130:p.Val53Leu					CLU_uc010lux.1_Intron|CLU_uc003xfx.1_Missense_Mutation_p.V53L|CLU_uc003xfy.1_Missense_Mutation_p.V64L|CLU_uc003xfz.1_Missense_Mutation_p.V105L	p.V53L	NM_203339	NP_976084	P10909	CLUS_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)	2	215	-		Ovarian(32;2.61e-05)	53					B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	ENST00000316403.10	37	c.157G>T	CCDS47832.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266299	0.59540	.	.	ENSG00000120885	ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000523589;ENST00000520796;ENST00000519742;ENST00000520491;ENST00000522413;ENST00000519472;ENST00000523396	T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.58	3.71	0.42584	Clusterin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.46328	0.1387	M	0.82517	2.595	0.50813	D	0.999893	P;P;D	0.53745	0.952;0.952;0.962	P;P;P	0.51866	0.554;0.554;0.682	T	0.49504	-0.8933	10	0.72032	D	0.01	-38.5153	9.9415	0.41583	0.0:0.8611:0.0:0.1389	.	105;64;53	P10909-2;P10909-5;P10909	.;.;CLUS_HUMAN	L	105;64;53;53;53;53;53;53;53;53;53	ENSP00000446413:V64L;ENSP00000385419:V53L;ENSP00000429620:V53L;ENSP00000431070:V53L;ENSP00000429336:V53L;ENSP00000431026:V53L;ENSP00000429881:V53L;ENSP00000428779:V53L;ENSP00000427868:V53L;ENSP00000428526:V53L	ENSP00000315130:V105L	V	-	1	0	CLU	27522461	0.991000	0.36638	0.526000	0.27913	0.782000	0.44232	2.915000	0.48805	0.650000	0.30769	0.655000	0.94253	GTG		0.443	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	NM_001831		77	166	1	0	6.20995e-33	0.01441	1.51546e-32	77	166				
UNC5D	137970	broad.mit.edu	37	8	35616958	35616958	+	Missense_Mutation	SNP	T	T	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:35616958T>C	ENST00000404895.2	+	14	2612	c.2284T>C	c.(2284-2286)Tgg>Cgg	p.W762R	UNC5D_ENST00000416672.1_Missense_Mutation_p.W767R|UNC5D_ENST00000287272.2_Missense_Mutation_p.W693R|UNC5D_ENST00000449677.1_Missense_Mutation_p.W338R|UNC5D_ENST00000420357.1_Missense_Mutation_p.W695R|UNC5D_ENST00000453357.2_Missense_Mutation_p.W757R	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	762					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCCATTCCTCTGGAGAATTAA	0.458																																							uc003xjr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(2284-2286)TGG>CGG		unc-5 homolog D precursor							192.0	180.0	184.0					8																	35616958		2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35616958T>C	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2284T>C	8.37:g.35616958T>C	ENSP00000385143:p.Trp762Arg					UNC5D_uc003xjs.1_Missense_Mutation_p.W757R|UNC5D_uc003xju.1_Missense_Mutation_p.W338R	p.W762R	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	14	2612	+			762			Cytoplasmic (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.2284T>C	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391757	0.83011	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.61742	0.11;0.52;0.49;0.11;0.08;1.97	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.78065	0.4225	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.997	T	0.81942	-0.0702	10	0.87932	D	0	-12.8852	15.675	0.77311	0.0:0.0:0.0:1.0	.	338;757;762	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	R	762;695;693;767;757;338	ENSP00000385143:W762R;ENSP00000392739:W695R;ENSP00000287272:W693R;ENSP00000412652:W767R;ENSP00000394303:W757R;ENSP00000397211:W338R	ENSP00000287272:W693R	W	+	1	0	UNC5D	35736500	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.941000	0.87700	2.155000	0.67459	0.459000	0.35465	TGG		0.458	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			4	411	0	0	0	0.000602	0	4	411				
HTRA4	203100	broad.mit.edu	37	8	38845496	38845496	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:38845496G>A	ENST00000302495.4	+	9	1410	c.1310G>A	c.(1309-1311)gGg>gAg	p.G437E		NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	437	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			AACATAAATGGGAAACCTATT	0.383																																							uc003xmj.2		NA																	0					0						c.(1309-1311)GGG>GAG		HtrA serine peptidase 4 precursor							125.0	105.0	111.0					8																	38845496		2203	4300	6503	SO:0001583	missense	203100				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity	g.chr8:38845496G>A	AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.1310G>A	8.37:g.38845496G>A	ENSP00000305919:p.Gly437Glu						p.G437E	NM_153692	NP_710159	P83105	HTRA4_HUMAN	LUSC - Lung squamous cell carcinoma(45;1.5e-07)		9	1425	+		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	437			PDZ.		Q542Z4|Q6PF13	Missense_Mutation	SNP	ENST00000302495.4	37	c.1310G>A	CCDS6110.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224164	0.79576	.	.	ENSG00000169495	ENST00000302495	D	0.86297	-2.1	6.07	6.07	0.98685	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000001	D	0.94398	0.8198	M	0.85099	2.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93779	0.7082	10	0.52906	T	0.07	-0.4412	19.4308	0.94765	0.0:0.0:1.0:0.0	.	437	P83105	HTRA4_HUMAN	E	437	ENSP00000305919:G437E	ENSP00000305919:G437E	G	+	2	0	HTRA4	38964653	1.000000	0.71417	0.999000	0.59377	0.606000	0.37113	6.280000	0.72626	2.885000	0.99019	0.655000	0.94253	GGG		0.383	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377077.1	NM_153692		31	61	0	0	0	0.010818	0	31	61				
SNTG1	54212	broad.mit.edu	37	8	51465741	51465741	+	Splice_Site	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:51465741T>A	ENST00000522124.1	+	12	1471		c.e12+2		SNTG1_ENST00000518864.1_Splice_Site|SNTG1_ENST00000276467.5_Splice_Site|SNTG1_ENST00000517473.1_Splice_Site	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				AAGCACAATGTAAGTAATGAT	0.408																																							uc010lxy.1		NA																	0				ovary(5)	5						c.e13+2		syntrophin, gamma 1							98.0	88.0	91.0					8																	51465741		2203	4300	6503	SO:0001630	splice_region_variant	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51465741T>A	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.810+2T>A	8.37:g.51465741T>A						SNTG1_uc003xqs.1_Splice_Site_p.N270_splice|SNTG1_uc010lxz.1_Splice_Site_p.N270_splice|SNTG1_uc011ldl.1_Splice_Site	p.N270_splice	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			13	1181	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)						Q2M3Q0|Q9NY98	Splice_Site	SNP	ENST00000522124.1	37	c.810_splice	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.533813	0.64972	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.301	0.66352	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SNTG1	51628294	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	7.181000	0.77682	1.972000	0.57404	0.456000	0.33151	.		0.408	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		Intron	29	42	0	0	0	0.010818	0	29	42				
PXDNL	137902	broad.mit.edu	37	8	52359687	52359687	+	Missense_Mutation	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:52359687G>A	ENST00000356297.4	-	12	1502	c.1402C>T	c.(1402-1404)Ctc>Ttc	p.L468F	PXDNL_ENST00000543296.1_Missense_Mutation_p.L468F	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	468	Ig-like C2-type 3.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCAGAGGAGAGAACTGTATGC	0.507																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(1402-1404)CTC>TTC		peroxidasin homolog-like precursor							121.0	118.0	119.0					8																	52359687		2030	4197	6227	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52359687G>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1402C>T	8.37:g.52359687G>A	ENSP00000348645:p.Leu468Phe						p.L468F	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN			12	1503	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	468			Ig-like C2-type 3.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.1402C>T	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334721	0.24253	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.67698	-0.28;-0.28	4.02	3.14	0.36123	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67505	0.2900	L	0.43701	1.375	0.25467	N	0.987867	D	0.56287	0.975	P	0.56823	0.807	T	0.54642	-0.8263	9	0.33940	T	0.23	.	7.6026	0.28085	0.1243:0.0:0.8757:0.0	.	468	A1KZ92	PXDNL_HUMAN	F	468	ENSP00000348645:L468F;ENSP00000444865:L468F	ENSP00000348645:L468F	L	-	1	0	PXDNL	52522240	0.878000	0.30173	0.003000	0.11579	0.043000	0.13939	1.369000	0.34227	0.667000	0.31107	0.467000	0.42956	CTC		0.507	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		33	228	0	0	0	0.009535	0	33	228				
RP1	6101	broad.mit.edu	37	8	55537428	55537428	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:55537428G>T	ENST00000220676.1	+	4	1134	c.986G>T	c.(985-987)gGc>gTc	p.G329V		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	329					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AATCAAGACGGCACTATGACA	0.323																																					Colon(91;1014 1389 7634 14542 40420)	Colon(91;1014 1389 7634 14542 40420)	uc003xsd.1		NA																	0				skin(7)|ovary(4)|pancreas(1)	12						c.(985-987)GGC>GTC		retinitis pigmentosa RP1 protein							65.0	66.0	66.0					8																	55537428		2203	4299	6502	SO:0001583	missense	6101				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding	g.chr8:55537428G>T	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.986G>T	8.37:g.55537428G>T	ENSP00000220676:p.Gly329Val					RP1_uc011ldy.1_Intron	p.G329V	NM_006269	NP_006260	P56715	RP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)		4	1134	+		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	329						Missense_Mutation	SNP	ENST00000220676.1	37	c.986G>T	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898134	0.72639	.	.	ENSG00000104237	ENST00000220676	T	0.76709	-1.04	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000016	D	0.89241	0.6659	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90896	0.4765	10	0.87932	D	0	.	18.4969	0.90867	0.0:0.0:1.0:0.0	.	329	P56715	RP1_HUMAN	V	329	ENSP00000220676:G329V	ENSP00000220676:G329V	G	+	2	0	RP1	55699981	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.864000	0.99589	2.361000	0.80049	0.655000	0.94253	GGC		0.323	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		20	65	1	0	5.03518e-11	0.007413	9.5328e-11	20	65				
CRISPLD1	83690	broad.mit.edu	37	8	75924705	75924706	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:75924705_75924706GG>TT	ENST00000262207.4	+	3	764_765	c.296_297GG>TT	c.(295-297)tGG>tTT	p.W99F	CRISPLD1_ENST00000523524.1_5'UTR|CRISPLD1_ENST00000517786.1_5'UTR|CRISPLD1_ENST00000519798.1_3'UTR	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	99	SCP.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			GCAGAATCCTGGGCTGAAAGTT	0.441																																							uc003yan.2		NA																	0		p.W99R(1)		ovary(1)|central_nervous_system(1)	2						c.(295-297)TGG>TTT		cysteine-rich secretory protein LCCL domain																																				SO:0001583	missense	83690					extracellular region		g.chr8:75924705_75924706GG>TT	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	Exception_encountered	8.37:g.75924705_75924706delinsTT	ENSP00000262207:p.Trp99Phe					CRISPLD1_uc011lfk.1_5'UTR|CRISPLD1_uc011lfl.1_5'UTR	p.W99F	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)		3	671_672	+	Breast(64;0.0799)		99					B2RA60|B7Z929	Missense_Mutation	DNP	ENST00000262207.4	37	c.296_297GG>TT	CCDS6219.1																																																																																				0.441	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461		58	96	0	0	0	0.004672	0	58	96				
ZFHX4	79776	broad.mit.edu	37	8	77775684	77775684	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:77775684C>A	ENST00000521891.2	+	11	10182	c.9734C>A	c.(9733-9735)gCa>gAa	p.A3245E	ZFHX4_ENST00000455469.2_Missense_Mutation_p.A3200E|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A3219E|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A3196E	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGTTGCAGGCATTACAGAAT	0.438										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(9598-9600)GCA>GAA		zinc finger homeodomain 4							161.0	153.0	155.0					8																	77775684		1895	4121	6016	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77775684C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9734C>A	8.37:g.77775684C>A	ENSP00000430497:p.Ala3245Glu	HNSCC(33;0.089)					p.A3200E	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	9986	+			3196					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.9599C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703590	0.48412	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.69685	-0.42;-0.34;-0.29;-0.36	4.55	4.55	0.56014	.	0.000000	0.42053	U	0.000763	T	0.80048	0.4552	M	0.64170	1.965	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.82277	-0.0537	10	0.72032	D	0.01	.	17.8708	0.88810	0.0:1.0:0.0:0.0	.	3200	Q86UP3-4	.	E	3245;3229;3200;3196;3219	ENSP00000430497:A3245E;ENSP00000399605:A3200E;ENSP00000050961:A3196E;ENSP00000430848:A3219E	ENSP00000050961:A3196E	A	+	2	0	ZFHX4	77938239	1.000000	0.71417	0.979000	0.43373	0.997000	0.91878	7.563000	0.82314	2.525000	0.85131	0.561000	0.74099	GCA		0.438	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		119	215	1	0	2.06061e-42	0.01441	5.42696e-42	119	215				
ZBTB10	65986	broad.mit.edu	37	8	81399761	81399761	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:81399761C>A	ENST00000430430.1	+	2	1495	c.716C>A	c.(715-717)cCc>cAc	p.P239H	ZBTB10_ENST00000379091.4_Intron|Y_RNA_ENST00000605948.1_RNA|ZBTB10_ENST00000455036.3_Missense_Mutation_p.P239H|ZBTB10_ENST00000426744.2_Missense_Mutation_p.P239H	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	239					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			CTCGCGCGGCCCAAGTCTCTA	0.617																																							uc003ybx.3		NA																	0				lung(1)	1						c.(715-717)CCC>CAC		zinc finger and BTB domain containing 10 isoform							27.0	31.0	30.0					8																	81399761		1994	4170	6164	SO:0001583	missense	65986				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:81399761C>A	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.716C>A	8.37:g.81399761C>A	ENSP00000387462:p.Pro239His					ZBTB10_uc003ybv.3_Intron|ZBTB10_uc003ybw.3_Missense_Mutation_p.P239H|ZBTB10_uc010lzt.2_Missense_Mutation_p.P239H	p.P239H	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)		1	1314	+	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		239					A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	37	c.716C>A	CCDS47880.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103085	0.56183	.	.	ENSG00000205189	ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T	0.12039	2.74;2.74;2.72	4.52	3.63	0.41609	.	0.287586	0.28109	N	0.016565	T	0.10594	0.0259	N	0.24115	0.695	0.51233	D	0.999919	B;B;P	0.38078	0.266;0.266;0.617	B;B;B	0.36289	0.046;0.077;0.221	T	0.11179	-1.0598	10	0.87932	D	0	.	13.5356	0.61644	0.1575:0.8425:0.0:0.0	.	95;239;239	A8E4L4;Q96DT7;Q96DT7-2	.;ZBT10_HUMAN;.	H	239;239;239;67	ENSP00000387462:P239H;ENSP00000412036:P239H;ENSP00000416134:P239H	ENSP00000416134:P239H	P	+	2	0	ZBTB10	81562316	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	4.434000	0.59935	1.079000	0.41038	-0.181000	0.13052	CCC		0.617	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929		8	8	1	0	0.00307968	0.00308	0.00507241	8	8				
CA1	759	broad.mit.edu	37	8	86249258	86249258	+	Missense_Mutation	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:86249258C>G	ENST00000523953.1	-	5	1316	c.270G>C	c.(268-270)agG>agC	p.R90S	CA1_ENST00000431316.1_Missense_Mutation_p.R90S|CA1_ENST00000256119.5_Missense_Mutation_p.R90S|CA1_ENST00000523022.1_Missense_Mutation_p.R90S|CA1_ENST00000432364.2_Missense_Mutation_p.R90S|CA1_ENST00000542576.1_Missense_Mutation_p.R90S|CA1_ENST00000518341.1_5'UTR|CA1_ENST00000522389.1_Intron			P00915	CAH1_HUMAN	carbonic anhydrase I	90					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	13		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methocarbamol(DB00423)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	ACTGAAAGAGCCTGTAGCTGT	0.423																																							uc003ydh.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(268-270)AGG>AGC		carbonic anhydrase I	Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)						108.0	104.0	105.0					8																	86249258		2203	4300	6503	SO:0001583	missense	759				one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding	g.chr8:86249258C>G	M33987	CCDS6237.1	8q21.2	2006-03-10				ENSG00000133742	4.2.1.1	"""Carbonic anhydrases"""	1368	protein-coding gene	gene with protein product		114800				1916821	Standard	NM_001164830		Approved	Car1	uc003ydi.3	P00915		ENST00000523953.1:c.270G>C	8.37:g.86249258C>G	ENSP00000430656:p.Arg90Ser					CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Missense_Mutation_p.R90S|CA1_uc003ydi.2_Missense_Mutation_p.R90S	p.R90S	NM_001738	NP_001729	P00915	CAH1_HUMAN			5	470	-		all_lung(136;4.89e-06)	90						Missense_Mutation	SNP	ENST00000523953.1	37	c.270G>C	CCDS6237.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.81|16.81	3.226999|3.226999	0.58668|0.58668	.|.	.|.	ENSG00000133742|ENSG00000133742	ENST00000521679|ENST00000523953;ENST00000256119;ENST00000431316;ENST00000542576;ENST00000432364;ENST00000523022;ENST00000524324;ENST00000517618;ENST00000517590;ENST00000521846;ENST00000522579;ENST00000522814;ENST00000522662;ENST00000523858	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.70631	.|-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.44|5.44	2.59|2.59	0.31030|0.31030	.|Carbonic anhydrase, alpha-class, catalytic domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80221|0.80221	0.4583|0.4583	M|M	0.72353|0.72353	2.195|2.195	0.53688|0.53688	D|D	0.999973|0.999973	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.78165|0.78165	-0.2310|-0.2310	5|10	.|0.87932	.|D	.|0	-20.6621|-20.6621	8.3992|8.3992	0.32574|0.32574	0.0:0.6577:0.0:0.3423|0.0:0.6577:0.0:0.3423	.|.	.|90	.|P00915	.|CAH1_HUMAN	P|S	27|90;90;90;90;90;90;24;90;90;90;90;90;90;90	.|ENSP00000430656:R90S;ENSP00000256119:R90S;ENSP00000392338:R90S;ENSP00000443517:R90S;ENSP00000401551:R90S;ENSP00000429798:R90S;ENSP00000428923:R24S;ENSP00000430861:R90S;ENSP00000429843:R90S;ENSP00000430471:R90S;ENSP00000427852:R90S;ENSP00000430737:R90S;ENSP00000430372:R90S;ENSP00000430975:R90S	.|ENSP00000256119:R90S	A|R	-|-	1|3	0|2	CA1|CA1	86436510|86436510	0.018000|0.018000	0.18449|0.18449	0.404000|0.404000	0.26397|0.26397	0.011000|0.011000	0.07611|0.07611	-0.705000|-0.705000	0.05052|0.05052	0.230000|0.230000	0.21059|0.21059	0.650000|0.650000	0.86243|0.86243	GCT|AGG		0.423	CA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381067.1	NM_001738		72	106	0	0	0	0.01441	0	72	106				
RUNX1T1	862	broad.mit.edu	37	8	93003958	93003958	+	Nonsense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:93003958G>T	ENST00000523629.1	-	7	1354	c.900C>A	c.(898-900)taC>taA	p.Y300*	RUNX1T1_ENST00000360348.2_Nonsense_Mutation_p.Y263*|RUNX1T1_ENST00000436581.2_Nonsense_Mutation_p.Y311*|RUNX1T1_ENST00000396218.1_Nonsense_Mutation_p.Y273*|RUNX1T1_ENST00000518844.1_Nonsense_Mutation_p.Y273*|RUNX1T1_ENST00000520724.1_Nonsense_Mutation_p.Y263*|RUNX1T1_ENST00000265814.3_Nonsense_Mutation_p.Y300*|RUNX1T1_ENST00000422361.2_Nonsense_Mutation_p.Y263*	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	300					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CATCCAAACGGTAATGCTGAG	0.557																																							uc003yfd.2		NA																	0				lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(898-900)TAC>TAA		acute myelogenous leukemia 1 translocation 1							233.0	188.0	204.0					8																	93003958		2203	4300	6503	SO:0001587	stop_gained	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:93003958G>T	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.900C>A	8.37:g.93003958G>T	ENSP00000428543:p.Tyr300*					RUNX1T1_uc003yfc.1_Nonsense_Mutation_p.Y273*|RUNX1T1_uc003yfe.1_Nonsense_Mutation_p.Y263*|RUNX1T1_uc010mao.2_Nonsense_Mutation_p.Y273*|RUNX1T1_uc011lgi.1_Nonsense_Mutation_p.Y311*|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Nonsense_Mutation_p.Y263*	p.Y300*	NM_175634	NP_783552	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		6	984	-			300					B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Nonsense_Mutation	SNP	ENST00000523629.1	37	c.900C>A	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	35	5.444347	0.96187	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	.	.	.	6.17	4.18	0.49190	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.7768	7.3027	0.26430	0.3141:0.0:0.6859:0.0	.	.	.	.	X	300;273;300;263;263;263;311;273	.	ENSP00000265814:Y300X	Y	-	3	2	RUNX1T1	93073134	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.827000	0.48112	1.630000	0.50440	0.655000	0.94253	TAC		0.557	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		74	127	1	0	1.88737e-50	0.01441	5.09685e-50	74	127				
CCNE2	9134	broad.mit.edu	37	8	95897326	95897326	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:95897326T>A	ENST00000520509.1	-	9	1052	c.800A>T	c.(799-801)tAt>tTt	p.Y267F	CCNE2_ENST00000396133.3_Missense_Mutation_p.Y267F|RP11-347C18.5_ENST00000605911.1_RNA|CCNE2_ENST00000523476.1_5'Flank|CCNE2_ENST00000308108.4_Missense_Mutation_p.Y267F			O96020	CCNE2_HUMAN	cyclin E2	267					cell cycle checkpoint (GO:0000075)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|prostate(1)	11	Breast(36;8.75e-07)					TTCCTGAGAATACTGAGGTAG	0.323																																							uc003yhc.2		NA																	0					0						c.(799-801)TAT>TTT		cyclin E2							68.0	71.0	70.0					8																	95897326		2203	4300	6503	SO:0001583	missense	9134				cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding	g.chr8:95897326T>A	AF091433	CCDS6264.1	8q22.1	2005-10-18			ENSG00000175305	ENSG00000175305			1590	protein-coding gene	gene with protein product		603775				9840927, 9840943	Standard	NM_057749		Approved	CYCE2	uc003yhc.3	O96020	OTTHUMG00000164696	ENST00000520509.1:c.800A>T	8.37:g.95897326T>A	ENSP00000429089:p.Tyr267Phe					CCNE2_uc003yhd.2_Missense_Mutation_p.Y267F	p.Y267F	NM_057749	NP_477097	O96020	CCNE2_HUMAN			9	909	-	Breast(36;8.75e-07)		267					O95439	Missense_Mutation	SNP	ENST00000520509.1	37	c.800A>T	CCDS6264.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.81|13.81	2.348308|2.348308	0.41599|0.41599	.|.	.|.	ENSG00000175305|ENSG00000175305	ENST00000524224|ENST00000520509;ENST00000308108;ENST00000542725;ENST00000396133	.|T;T;T	.|0.25250	.|1.81;1.81;1.81	5.4|5.4	5.4|5.4	0.78164|0.78164	.|Cyclin, C-terminal (1);Cyclin-like (1);	.|0.050483	.|0.85682	.|D	.|0.000000	T|T	0.16896|0.16896	0.0406|0.0406	N|N	0.15975|0.15975	0.35|0.35	0.50467|0.50467	D|D	0.999875|0.999875	.|B;B	.|0.12630	.|0.006;0.002	.|B;B	.|0.21360	.|0.034;0.006	T|T	0.08186|0.08186	-1.0734|-1.0734	5|10	.|0.19590	.|T	.|0.45	.|.	15.4167|15.4167	0.74974|0.74974	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|267;267	.|Q8WUE3;O96020	.|.;CCNE2_HUMAN	F|F	131|267;267;159;267	.|ENSP00000429089:Y267F;ENSP00000309181:Y267F;ENSP00000379437:Y267F	.|ENSP00000309181:Y267F	I|Y	-|-	1|2	0|0	CCNE2|CCNE2	95966502|95966502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.466000|3.466000	0.53071|0.53071	2.041000|2.041000	0.60428|0.60428	0.528000|0.528000	0.53228|0.53228	ATT|TAT		0.323	CCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379808.1	NM_057749, NM_004702		22	74	0	0	0	0.012319	0	22	74				
PTDSS1	9791	broad.mit.edu	37	8	97311923	97311924	+	Splice_Site	DNP	TC	TC	AA			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:97311923_97311924TC>AA	ENST00000517309.1	+	6	928_929	c.602_603TC>AA	c.(601-603)cTC>cAA	p.L201Q	PTDSS1_ENST00000455950.2_Splice_Site_p.L55Q|PTDSS1_ENST00000518776.1_3'UTR|PTDSS1_ENST00000522072.1_5'UTR	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	201					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	GTTTCTCAGCTCTTCTTCATGC	0.436																																							uc003yht.1		NA																	0				ovary(1)	1						c.(601-603)CTC>CAA		phosphatidylserine synthase 1	Phosphatidylserine(DB00144)																																			SO:0001630	splice_region_variant	9791				phosphatidylserine biosynthetic process	integral to membrane	transferase activity	g.chr8:97311923_97311924TC>AA	D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	Exception_encountered	8.37:g.97311923_97311924delinsAA						PTDSS1_uc003yhu.1_Missense_Mutation_p.L55Q	p.L201Q	NM_014754	NP_055569	P48651	PTSS1_HUMAN			6	704_705	+	Breast(36;6.18e-05)		201			Helical; (Potential).		E5RFC5|Q9BUQ5	Missense_Mutation	DNP	ENST00000517309.1	37	c.602_603TC>AA	CCDS6271.1																																																																																				0.436	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2		Missense_Mutation	57	253	0	0	0	0.004672	0	57	253				
CPQ	10404	broad.mit.edu	37	8	97797326	97797327	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:97797326_97797327GG>AA	ENST00000220763.5	+	2	411_412	c.201_202GG>AA	c.(199-204)ttGGca>ttAAca	p.A68T		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	68					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										ATGAGCGATTGGCACTTCTGGT	0.436																																							uc003yhw.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(199-204)TTGGCA>TTAACA		plasma glutamate carboxypeptidase precursor																																				SO:0001583	missense	10404				peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity	g.chr8:97797326_97797327GG>AA	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	Exception_encountered	8.37:g.97797326_97797327delinsAA	ENSP00000220763:p.Ala68Thr					PGCP_uc010mbe.2_Missense_Mutation_p.A68T	p.A68T	NM_016134	NP_057218	Q9Y646	PGCP_HUMAN			2	367_368	+	Breast(36;1.86e-05)		68					B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	DNP	ENST00000220763.5	37	c.201_202GG>AA	CCDS6273.1																																																																																				0.436	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134		50	97	0	0	0	0.004672	0	50	97				
CSMD3	114788	broad.mit.edu	37	8	113293408	113293408	+	Missense_Mutation	SNP	C	C	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:113293408C>G	ENST00000297405.5	-	59	9747	c.9503G>C	c.(9502-9504)tGt>tCt	p.C3168S	CSMD3_ENST00000343508.3_Missense_Mutation_p.C3128S|CSMD3_ENST00000352409.3_Missense_Mutation_p.C3098S|CSMD3_ENST00000455883.2_Missense_Mutation_p.C2999S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3168	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTACTTGTACAGTTAGGTAA	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(9502-9504)TGT>TCT		CUB and Sushi multiple domains 3 isoform 1							79.0	79.0	79.0					8																	113293408		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113293408C>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9503G>C	8.37:g.113293408C>G	ENSP00000297405:p.Cys3168Ser	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.C2370S|CSMD3_uc003ynt.2_Missense_Mutation_p.C3128S|CSMD3_uc011lhx.1_Missense_Mutation_p.C2999S	p.C3168S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			59	9662	-			3168			Extracellular (Potential).|Sushi 23.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.9503G>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988929	0.74589	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	D;D;D;D;D	0.99778	-6.73;-6.73;-6.73;-6.73;-6.73	5.67	5.67	0.87782	Complement control module (2);Sushi/SCR/CCP (3);	0.125052	0.56097	D	0.000037	D	0.99869	0.9938	H	0.99590	4.645	0.80722	D	1	D;P;P	0.55385	0.971;0.526;0.624	P;P;P	0.53549	0.729;0.648;0.46	D	0.96742	0.9547	10	0.87932	D	0	.	19.8397	0.96678	0.0:1.0:0.0:0.0	.	2999;3168;3128	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	3128;3168;2438;2999;3098	ENSP00000345799:C3128S;ENSP00000297405:C3168S;ENSP00000341558:C2438S;ENSP00000412263:C2999S;ENSP00000343124:C3098S	ENSP00000297405:C3168S	C	-	2	0	CSMD3	113362584	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.726000	0.84824	2.687000	0.91594	0.644000	0.83932	TGT		0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		25	65	0	0	0	0.003954	0	25	65				
CSMD3	114788	broad.mit.edu	37	8	113668416	113668416	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:113668416G>C	ENST00000297405.5	-	18	3215	c.2971C>G	c.(2971-2973)Cgt>Ggt	p.R991G	CSMD3_ENST00000343508.3_Missense_Mutation_p.R951G|CSMD3_ENST00000352409.3_Missense_Mutation_p.R991G|CSMD3_ENST00000455883.2_Missense_Mutation_p.R887G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	991	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTATTGGAACGACTGTTGTCT	0.328										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2971-2973)CGT>GGT		CUB and Sushi multiple domains 3 isoform 1							64.0	70.0	68.0					8																	113668416		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113668416G>C	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2971C>G	8.37:g.113668416G>C	ENSP00000297405:p.Arg991Gly	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.R263G|CSMD3_uc003ynt.2_Missense_Mutation_p.R951G|CSMD3_uc011lhx.1_Missense_Mutation_p.R887G	p.R991G	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			18	3130	-			991			Extracellular (Potential).|CUB 5.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.2971C>G	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845353	0.32606	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26	5.28	4.39	0.52855	CUB (5);	0.000000	0.64402	D	0.000003	T	0.56790	0.2009	N	0.05441	-0.05	0.33740	D	0.619309	D;D;D	0.76494	0.999;0.999;0.987	D;D;D	0.91635	0.998;0.999;0.954	T	0.66252	-0.5970	10	0.24483	T	0.36	.	16.1847	0.81942	0.0:0.1337:0.8663:0.0	.	887;991;951	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	G	951;991;331;887;991	ENSP00000345799:R951G;ENSP00000297405:R991G;ENSP00000341558:R331G;ENSP00000412263:R887G;ENSP00000343124:R991G	ENSP00000297405:R991G	R	-	1	0	CSMD3	113737592	1.000000	0.71417	0.999000	0.59377	0.690000	0.40134	9.813000	0.99286	1.337000	0.45525	-0.312000	0.09012	CGT		0.328	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		37	105	0	0	0	0.00623	0	37	105				
ZFAT	57623	broad.mit.edu	37	8	135614646	135614646	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:135614646T>A	ENST00000377838.3	-	6	1490	c.1316A>T	c.(1315-1317)cAt>cTt	p.H439L	ZFAT_ENST00000520356.1_Missense_Mutation_p.H427L|ZFAT_ENST00000523399.1_Missense_Mutation_p.H377L|ZFAT_ENST00000520727.1_Missense_Mutation_p.H427L|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000429442.2_Missense_Mutation_p.H427L|ZFAT_ENST00000520214.1_Missense_Mutation_p.H427L	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	439					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GGTGGCCCCATGGCCACAGAG	0.587																																							uc003yup.2		NA																	0				central_nervous_system(1)	1						c.(1315-1317)CAT>CTT		zinc finger protein 406 isoform ZFAT-1							46.0	49.0	48.0					8																	135614646		2076	4213	6289	SO:0001583	missense	57623				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding	g.chr8:135614646T>A	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1316A>T	8.37:g.135614646T>A	ENSP00000367069:p.His439Leu					ZFAT_uc003yun.2_Missense_Mutation_p.H427L|ZFAT_uc003yuo.2_Missense_Mutation_p.H427L|ZFAT_uc010meh.2_Missense_Mutation_p.H427L|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Missense_Mutation_p.H427L|ZFAT_uc010mej.2_Missense_Mutation_p.H377L|ZFAT_uc003yur.2_Missense_Mutation_p.H427L	p.H439L	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0432)		6	1491	-	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		439			C2H2-type 8.		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	c.1316A>T	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.822940	0.90873	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21;3.21	5.74	5.74	0.90152	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	N	0.11154	0.105	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.996;0.999;0.983;0.984	T	0.32929	-0.9888	10	0.44086	T	0.13	-24.8729	15.228	0.73364	0.0:0.0:0.0:1.0	.	377;427;427;439	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	L	427;427;427;439;427;377;427	ENSP00000427879:H427L;ENSP00000427831:H427L;ENSP00000394501:H427L;ENSP00000367069:H439L;ENSP00000428483:H427L;ENSP00000429091:H377L	ENSP00000367069:H439L	H	-	2	0	ZFAT	135683828	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.040000	0.89188	2.194000	0.70268	0.460000	0.39030	CAT		0.587	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939		19	88	0	0	0	0.008871	0	19	88				
PYCRL	65263	broad.mit.edu	37	8	144687961	144687961	+	Missense_Mutation	SNP	A	A	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:144687961A>T	ENST00000220966.6	-	6	799	c.770T>A	c.(769-771)cTc>cAc	p.L257H	RP11-661A12.14_ENST00000606452.1_lincRNA|PYCRL_ENST00000495276.1_5'UTR|PYCRL_ENST00000377579.3_Missense_Mutation_p.L108H	NM_023078.3	NP_075566.2	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	245					L-proline biosynthetic process (GO:0055129)		pyrroline-5-carboxylate reductase activity (GO:0004735)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		L-Proline(DB00172)	CAGGGCGTGGAGTCCATAGAT	0.682																																							uc003yyy.2		NA																	0					0						c.(769-771)CTC>CAC		pyrroline-5-carboxylate reductase-like							55.0	56.0	56.0					8																	144687961		2203	4299	6502	SO:0001583	missense	65263				proline biosynthetic process		pyrroline-5-carboxylate reductase activity	g.chr8:144687961A>T	AF086378	CCDS6407.2	8q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000104524	ENSG00000104524			25846	protein-coding gene	gene with protein product							Standard	NM_023078		Approved	FLJ13852	uc003yyy.3	Q53H96	OTTHUMG00000157010	ENST00000220966.6:c.770T>A	8.37:g.144687961A>T	ENSP00000220966:p.Leu257His					PYCRL_uc011lkm.1_Missense_Mutation_p.L237H|PYCRL_uc011lkn.1_RNA	p.L257H	NM_023078	NP_075566	Q53H96	P5CR3_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		6	780	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		245					B3KMB5|B4DVT6|H0Y6C3|Q8N3N9|Q96HX4|Q9H896	Missense_Mutation	SNP	ENST00000220966.6	37	c.770T>A	CCDS6407.2	.	.	.	.	.	.	.	.	.	.	A	17.42	3.386158	0.61956	.	.	ENSG00000104524	ENST00000220966;ENST00000377579;ENST00000433751	D;D;D	0.88664	-2.41;-2.41;-2.41	5.0	5.0	0.66597	6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.391329	0.21274	N	0.077269	D	0.95799	0.8633	H	0.94964	3.605	0.47547	D	0.99945	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.962	D	0.96686	0.9507	10	0.87932	D	0	-10.5981	13.5301	0.61617	1.0:0.0:0.0:0.0	.	257;245	D3DWK4;Q53H96	.;P5CR3_HUMAN	H	257;108;232	ENSP00000220966:L257H;ENSP00000366802:L108H;ENSP00000404493:L232H	ENSP00000220966:L257H	L	-	2	0	PYCRL	144759104	1.000000	0.71417	0.365000	0.25901	0.168000	0.22595	9.157000	0.94714	1.893000	0.54813	0.459000	0.35465	CTC		0.682	PYCRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347081.2	NM_023078		19	104	0	0	0	0.010504	0	19	104				
FAM83H	286077	broad.mit.edu	37	8	144808765	144808765	+	Missense_Mutation	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:144808765T>A	ENST00000388913.3	-	5	2991	c.2866A>T	c.(2866-2868)Agc>Tgc	p.S956C		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	956					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ATGGGGCCGCTCGGCCCCTCC	0.711																																							uc003yzk.2		NA																	0				lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(2866-2868)AGC>TGC		FAM83H							9.0	11.0	10.0					8																	144808765		1728	3819	5547	SO:0001583	missense	286077				biomineral tissue development			g.chr8:144808765T>A	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2866A>T	8.37:g.144808765T>A	ENSP00000373565:p.Ser956Cys					FAM83H_uc010mfk.1_RNA	p.S956C	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		5	2935	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		956					A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	c.2866A>T	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	t	6.532	0.466453	0.12402	.	.	ENSG00000180921	ENST00000388913	T	0.15256	2.44	5.01	-0.0698	0.13750	.	6.380780	0.00166	N	0.000008	T	0.13457	0.0326	N	0.19112	0.55	0.09310	N	1	B	0.30664	0.289	B	0.28305	0.088	T	0.34254	-0.9836	10	0.66056	D	0.02	.	8.987	0.35999	0.0:0.581:0.0:0.419	.	956	Q6ZRV2	FA83H_HUMAN	C	956	ENSP00000373565:S956C	ENSP00000373565:S956C	S	-	1	0	FAM83H	144880753	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	0.238000	0.18004	-0.335000	0.08451	-0.383000	0.06682	AGC		0.711	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488		18	34	0	0	0	0.007413	0	18	34				
EPPK1	83481	broad.mit.edu	37	8	144940476	144940476	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:144940476C>A	ENST00000525985.1	-	2	7017	c.6946G>T	c.(6946-6948)Ggg>Tgg	p.G2316W				P58107	EPIPL_HUMAN	epiplakin 1	2316						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.G2316W(2)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ATCTGCTGCCCGGTGTAGGGG	0.706																																							uc003zaa.1		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	pancreas(1)|skin(1)	2						c.(14956-14958)GGG>TGG		epiplakin 1							199.0	189.0	192.0					8																	144940476		2180	4265	6445	SO:0001583	missense	83481					cytoplasm|cytoskeleton	protein binding|structural molecule activity	g.chr8:144940476C>A	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6946G>T	8.37:g.144940476C>A	ENSP00000436337:p.Gly2316Trp						p.G4986W	NM_031308	NP_112598	P58107	EPIPL_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		2	14969	-	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		4986			Plectin 63.		Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37	c.14956G>T		.	.	.	.	.	.	.	.	.	.	C	21.4	4.148241	0.78001	.	.	ENSG00000227184	ENST00000525985	T	0.73363	-0.74	4.33	4.33	0.51752	.	.	.	.	.	D	0.84224	0.5425	M	0.69358	2.11	0.38970	D	0.958726	D	0.89917	1.0	D	0.91635	0.999	D	0.86963	0.2093	9	0.87932	D	0	.	14.7817	0.69772	0.0:1.0:0.0:0.0	.	2316	E9PPU0	.	W	2316	ENSP00000436337:G2316W	ENSP00000436337:G2316W	G	-	1	0	EPPK1	145012464	0.990000	0.36364	1.000000	0.80357	0.996000	0.88848	4.882000	0.63121	2.416000	0.81992	0.586000	0.80456	GGG		0.706	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308		49	594	1	0	4.00472e-15	0.01441	8.16287e-15	49	594				
CPSF1	29894	broad.mit.edu	37	8	145622562	145622562	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr8:145622562G>T	ENST00000349769.3	-	23	2546	c.2452C>A	c.(2452-2454)Ctt>Att	p.L818I	CPSF1_ENST00000531727.1_5'Flank|MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	818					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CTGTCCACAAGGACCCGCTGC	0.662																																					NSCLC(133;1088 1848 27708 34777 35269)	NSCLC(133;1088 1848 27708 34777 35269)	uc003zcj.2		NA																	0				skin(1)	1						c.(2452-2454)CTT>ATT		cleavage and polyadenylation specific factor 1,							11.0	13.0	12.0					8																	145622562		2179	4271	6450	SO:0001583	missense	29894				mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding	g.chr8:145622562G>T	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2452C>A	8.37:g.145622562G>T	ENSP00000339353:p.Leu818Ile						p.L818I	NM_013291	NP_037423	Q10570	CPSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)		23	2527	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		818					Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	c.2452C>A	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	g	16.91	3.254003	0.59212	.	.	ENSG00000071894	ENST00000349769	T	0.62105	0.05	4.94	3.13	0.36017	.	0.089772	0.47093	D	0.000249	T	0.59404	0.2191	L	0.48877	1.53	0.51482	D	0.999929	P	0.46142	0.873	P	0.48089	0.566	T	0.57757	-0.7756	10	0.56958	D	0.05	-10.7908	8.8382	0.35126	0.1861:0.0:0.8139:0.0	.	818	Q10570	CPSF1_HUMAN	I	818	ENSP00000339353:L818I	ENSP00000339353:L818I	L	-	1	0	CPSF1	145593370	1.000000	0.71417	0.973000	0.42090	0.621000	0.37620	4.002000	0.57053	0.501000	0.28013	0.486000	0.48141	CTT		0.662	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291		5	6	1	0	1.6384e-10	0.001984	3.02649e-10	5	6				
MPDZ	8777	broad.mit.edu	37	9	13192152	13192152	+	Missense_Mutation	SNP	C	C	G	rs377294494		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr9:13192152C>G	ENST00000319217.7	-	15	2193	c.1946G>C	c.(1945-1947)tGt>tCt	p.C649S	MPDZ_ENST00000546205.1_Missense_Mutation_p.C649S|MPDZ_ENST00000381015.4_Missense_Mutation_p.C649S|MPDZ_ENST00000447879.1_Missense_Mutation_p.C649S|MPDZ_ENST00000536827.1_Missense_Mutation_p.C649S|MPDZ_ENST00000541718.1_Missense_Mutation_p.C649S|MPDZ_ENST00000381022.2_Missense_Mutation_p.C649S	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	649					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CTCAATATCACATAAGTCCAG	0.378																																							uc010mia.1		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(1945-1947)TGT>TCT		multiple PDZ domain protein							119.0	112.0	114.0					9																	13192152		1915	4131	6046	SO:0001583	missense	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13192152C>G	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.1946G>C	9.37:g.13192152C>G	ENSP00000320006:p.Cys649Ser					MPDZ_uc010mhy.2_Missense_Mutation_p.C649S|MPDZ_uc010mhz.2_Missense_Mutation_p.C649S|MPDZ_uc011lmn.1_Missense_Mutation_p.C649S|MPDZ_uc003zlb.3_Missense_Mutation_p.C649S	p.C649S	NM_003829	NP_003820	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	14	2003	-			649					A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37	c.1946G>C		.	.	.	.	.	.	.	.	.	.	C	4.654	0.121630	0.08881	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000546205	T;T;T;T;T;T;T	0.09445	3.03;2.98;2.98;2.99;3.04;3.03;3.03	5.77	2.77	0.32553	.	0.822449	0.10528	N	0.664204	T	0.04497	0.0123	N	0.04508	-0.205	0.54753	D	0.999982	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.30504	-0.9976	10	0.09338	T	0.73	.	7.9216	0.29850	0.0:0.4216:0.4792:0.0992	.	649;649;649	B7ZMI4;O75970-3;O75970-2	.;.;.	S	649	ENSP00000320006:C649S;ENSP00000439807:C649S;ENSP00000370410:C649S;ENSP00000444151:C649S;ENSP00000415208:C649S;ENSP00000370403:C649S;ENSP00000446358:C649S	ENSP00000320006:C649S	C	-	2	0	MPDZ	13182152	0.903000	0.30736	0.835000	0.33067	0.926000	0.56050	2.786000	0.47790	0.737000	0.32582	0.655000	0.94253	TGT		0.378	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		7	8	0	0	0	0.001984	0	7	8				
BNC2	54796	broad.mit.edu	37	9	16727855	16727855	+	Silent	SNP	T	T	A	rs79432515		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr9:16727855T>A	ENST00000380672.4	-	3	327	c.270A>T	c.(268-270)ccA>ccT	p.P90P	BNC2_ENST00000380666.2_Silent_p.P90P|BNC2_ENST00000380667.2_Intron|RP11-62F24.2_ENST00000450445.1_RNA|BNC2_ENST00000545497.1_Intron	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CCATGAACCCTGGTTCAGCCG	0.423																																							uc003zml.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(268-270)CCA>CCT		basonuclin 2							256.0	232.0	240.0					9																	16727855		2203	4300	6503	SO:0001819	synonymous_variant	54796				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding	g.chr9:16727855T>A	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.270A>T	9.37:g.16727855T>A						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Silent_p.P48P|BNC2_uc003zmq.1_Silent_p.P104P|BNC2_uc003zmr.1_Silent_p.P90P|BNC2_uc003zmp.1_Silent_p.P90P|BNC2_uc010mij.1_Silent_p.P12P|BNC2_uc003zmu.1_RNA|BNC2_uc010mim.1_RNA|BNC2_uc010min.1_Intron|BNC2_uc003zmo.1_Silent_p.P12P	p.P90P	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN		GBM - Glioblastoma multiforme(50;9.01e-08)	3	410	-			90						Silent	SNP	ENST00000380672.4	37	c.270A>T	CCDS6482.2																																																																																				0.423	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637		62	171	0	0	0	0.01441	0	62	171				
PIGO	84720	broad.mit.edu	37	9	35095491	35095491	+	Silent	SNP	G	G	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr9:35095491G>A	ENST00000378617.3	-	2	466	c.72C>T	c.(70-72)ttC>ttT	p.F24F	PIGO_ENST00000361778.2_Silent_p.F24F|RP11-182N22.8_ENST00000431804.1_RNA|PIGO_ENST00000298004.5_Silent_p.F24F|PIGO_ENST00000492770.1_5'UTR|PIGO_ENST00000341666.3_Silent_p.F24F	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	24					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGCCACTGGTGAAGAGGGCAA	0.582																																							uc003zwd.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(70-72)TTC>TTT		phosphatidylinositol glycan anchor biosynthesis,							27.0	27.0	27.0					9																	35095491		2202	4300	6502	SO:0001819	synonymous_variant	84720				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity	g.chr9:35095491G>A	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.72C>T	9.37:g.35095491G>A						PIGO_uc003zwc.1_Silent_p.F24F|PIGO_uc003zwe.2_Silent_p.F24F|PIGO_uc003zwf.2_Silent_p.F24F|PIGO_uc003zwg.1_5'UTR	p.F24F	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		2	468	-			24			Helical; (Potential).		B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	ENST00000378617.3	37	c.72C>T	CCDS6575.1																																																																																				0.582	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634		7	8	0	0	0	0.00308	0	7	8				
ECM2	1842	broad.mit.edu	37	9	95284981	95284981	+	Silent	SNP	C	C	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr9:95284981C>T	ENST00000344604.5	-	2	317	c.168G>A	c.(166-168)caG>caA	p.Q56Q	ECM2_ENST00000444490.2_Silent_p.Q56Q|ECM2_ENST00000375540.1_Silent_p.Q56Q|CENPP_ENST00000375587.3_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	56			Q -> P (in dbSNP:rs10120210). {ECO:0000269|PubMed:17974005}.		cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						CTGTTGTTTGCTGAATTCCAA	0.388																																							uc004ash.2		NA																	0				ovary(1)|skin(1)	2						c.(166-168)CAG>CAA		extracellular matrix protein 2 precursor							196.0	212.0	207.0					9																	95284981		2203	4300	6503	SO:0001819	synonymous_variant	1842				cell-matrix adhesion		integrin binding	g.chr9:95284981C>T	AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.168G>A	9.37:g.95284981C>T						CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Silent_p.Q56Q|ECM2_uc011lty.1_Silent_p.Q56Q|ECM2_uc004asg.2_Silent_p.Q56Q|ECM2_uc011ltz.1_Silent_p.Q56Q|ECM2_uc004asi.2_Silent_p.Q56Q	p.Q56Q	NM_001393	NP_001384	O94769	ECM2_HUMAN			2	233	-			56					B2R730|E2PU11|Q5T9F2|Q7Z3D0	Silent	SNP	ENST00000344604.5	37	c.168G>A	CCDS6698.1																																																																																				0.388	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393		75	78	0	0	0	0.01441	0	75	78				
OR13C8	138802	broad.mit.edu	37	9	107331760	107331760	+	Silent	SNP	T	T	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr9:107331760T>A	ENST00000335040.1	+	1	312	c.312T>A	c.(310-312)tcT>tcA	p.S104S		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						TGTTTATTTCTTTTGCCATGG	0.483																																							uc011lvo.1		NA																	0				ovary(1)|skin(1)	2						c.(310-312)TCT>TCA		olfactory receptor, family 13, subfamily C,							115.0	109.0	111.0					9																	107331760		2203	4300	6503	SO:0001819	synonymous_variant	138802				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107331760T>A		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.312T>A	9.37:g.107331760T>A							p.S104S	NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN			1	312	+			104			Helical; Name=3; (Potential).		Q5VVG0|Q96R44	Silent	SNP	ENST00000335040.1	37	c.312T>A	CCDS35090.1																																																																																				0.483	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1			97	58	0	0	0	0.01441	0	97	58				
FAM47A	158724	broad.mit.edu	37	X	34148697	34148697	+	Missense_Mutation	SNP	G	G	T			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chrX:34148697G>T	ENST00000346193.3	-	1	1750	c.1699C>A	c.(1699-1701)Cat>Aat	p.H567N		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	567										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GAGAATTGATGGGACTCTGGA	0.547																																							uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1699-1701)CAT>AAT		hypothetical protein LOC158724							69.0	66.0	67.0					X																	34148697		2165	4269	6434	SO:0001583	missense	158724							g.chrX:34148697G>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1699C>A	X.37:g.34148697G>T	ENSP00000345029:p.His567Asn						p.H567N	NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN			1	1732	-			567					A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.1699C>A	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	8.031	0.761722	0.15914	.	.	ENSG00000185448	ENST00000346193	T	0.18960	2.18	0.207	0.207	0.15214	.	.	.	.	.	T	0.12518	0.0304	N	0.24115	0.695	0.09310	N	1	P	0.40834	0.73	B	0.41202	0.35	T	0.25572	-1.0128	8	0.18276	T	0.48	.	.	.	.	.	567	Q5JRC9	FA47A_HUMAN	N	567	ENSP00000345029:H567N	ENSP00000345029:H567N	H	-	1	0	FAM47A	34058618	0.000000	0.05858	0.007000	0.13788	0.017000	0.09413	-0.179000	0.09768	0.275000	0.22094	0.279000	0.19357	CAT		0.547	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		63	16	1	0	7.73544e-29	0.01441	1.82091e-28	63	16				
ZCCHC5	203430	broad.mit.edu	37	X	77913138	77913138	+	Silent	SNP	A	A	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chrX:77913138A>G	ENST00000321110.1	-	2	1075	c.780T>C	c.(778-780)agT>agC	p.S260S		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	260							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						CTCTCATGTAACTATACAGCT	0.507																																							uc004edc.1		NA																	0		p.S260T(1)		ovary(1)	1						c.(778-780)AGT>AGC		zinc finger, CCHC domain containing 5							31.0	28.0	29.0					X																	77913138		2203	4300	6503	SO:0001819	synonymous_variant	203430						nucleic acid binding|zinc ion binding	g.chrX:77913138A>G	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.780T>C	X.37:g.77913138A>G							p.S260S	NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN			2	1076	-			260					B2RMZ0|Q5JQE9	Silent	SNP	ENST00000321110.1	37	c.780T>C	CCDS14440.1																																																																																				0.507	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		5	16	0	0	0	0.000602	0	5	16				
CYLC1	1538	broad.mit.edu	37	X	83128348	83128348	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chrX:83128348C>A	ENST00000329312.4	+	4	669	c.632C>A	c.(631-633)aCt>aAt	p.T211N		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	211					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AAGACAAACACTGAATTCCTA	0.308																																							uc004eei.1		NA																	0				ovary(4)|skin(1)	5						c.(631-633)ACT>AAT		cylicin, basic protein of sperm head							25.0	24.0	24.0					X																	83128348		2191	4277	6468	SO:0001583	missense	1538				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity	g.chrX:83128348C>A	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.632C>A	X.37:g.83128348C>A	ENSP00000331556:p.Thr211Asn					CYLC1_uc004eeh.1_Missense_Mutation_p.T210N	p.T211N	NM_021118	NP_066941	P35663	CYLC1_HUMAN			4	653	+			211					A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	c.632C>A	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	c	2.355	-0.348007	0.05208	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.41758	0.99	4.69	0.287	0.15714	.	.	.	.	.	T	0.17023	0.0409	N	0.13098	0.295	0.09310	N	1	B;B	0.27882	0.192;0.192	B;B	0.23018	0.043;0.043	T	0.23655	-1.0182	9	0.06365	T	0.9	-0.0649	2.9801	0.05951	0.3734:0.3856:0.0:0.241	.	211;211	P35663;F5H4V5	CYLC1_HUMAN;.	N	211	ENSP00000331556:T211N	ENSP00000331556:T211N	T	+	2	0	CYLC1	83015004	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.215000	0.09279	-0.200000	0.10300	0.513000	0.50165	ACT		0.308	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118		21	10	1	0	1.01871e-10	0.008871	1.9016e-10	21	10				
GPR50	9248	broad.mit.edu	37	X	150349641	150349641	+	Missense_Mutation	SNP	C	C	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chrX:150349641C>A	ENST00000218316.3	+	2	1655	c.1586C>A	c.(1585-1587)cCt>cAt	p.P529H	AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	529	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					ACCAGCCACCCTAAGCCCACT	0.612																																							uc010ntg.1		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(1585-1587)CCT>CAT		G protein-coupled receptor 50							79.0	90.0	86.0					X																	150349641		2178	4260	6438	SO:0001583	missense	9248				cell-cell signaling	integral to plasma membrane	melatonin receptor activity	g.chrX:150349641C>A	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1586C>A	X.37:g.150349641C>A	ENSP00000218316:p.Pro529His						p.P529H	NM_004224	NP_004215	Q13585	MTR1L_HUMAN			2	1721	+	Acute lymphoblastic leukemia(192;6.56e-05)		529			Cytoplasmic (Potential).|Pro-rich.		Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	c.1586C>A	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684370	0.29872	.	.	ENSG00000102195	ENST00000218316	T	0.73258	-0.73	2.63	1.75	0.24633	.	0.849606	0.09481	N	0.796345	T	0.51753	0.1693	N	0.14661	0.345	0.09310	N	1	P	0.50943	0.94	B	0.40741	0.339	T	0.43637	-0.9379	10	0.87932	D	0	0.4045	7.3101	0.26469	0.0:0.8531:0.0:0.1469	.	529	Q13585	MTR1L_HUMAN	H	529	ENSP00000218316:P529H	ENSP00000218316:P529H	P	+	2	0	GPR50	150100299	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.474000	0.06607	0.524000	0.28502	0.523000	0.50628	CCT		0.612	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		89	25	1	0	2.39224e-78	0.01441	6.84232e-78	89	25				
MAGEA12	4111	broad.mit.edu	37	X	151899994	151899994	+	Nonsense_Mutation	SNP	G	G	T	rs147399924	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chrX:151899994G>T	ENST00000357916.4	-	2	962	c.807C>A	c.(805-807)taC>taA	p.Y269*	CSAG4_ENST00000361201.4_RNA|MAGEA12_ENST00000393869.3_Nonsense_Mutation_p.Y269*|MAGEA12_ENST00000393900.3_Nonsense_Mutation_p.Y269*	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	269	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					ACAGGAACTCGTAGCATGCAG	0.542																																							uc010ntp.2		NA																	0				skin(1)	1						c.(805-807)TAC>TAA		melanoma antigen family A, 12							150.0	144.0	146.0					X																	151899994		2203	4300	6503	SO:0001587	stop_gained	4111							g.chrX:151899994G>T		CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.807C>A	X.37:g.151899994G>T	ENSP00000350592:p.Tyr269*					MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Nonsense_Mutation_p.Y269*	p.Y269*	NM_005367	NP_005358	P43365	MAGAC_HUMAN			3	1161	-	Acute lymphoblastic leukemia(192;6.56e-05)		269			MAGE.		Q9NSD3	Nonsense_Mutation	SNP	ENST00000357916.4	37	c.807C>A	CCDS14710.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141490	0.57044	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	.	.	.	0.809	-1.18	0.09617	.	0.244803	0.42420	D	0.000712	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	269	.	ENSP00000350592:Y269X	Y	-	3	2	MAGEA12	151650650	0.120000	0.22244	0.464000	0.27143	0.072000	0.16883	-0.751000	0.04803	-0.402000	0.07633	0.181000	0.17075	TAC		0.542	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367		25	341	1	0	9.57634e-11	0.00333	1.79388e-10	25	341				
DUSP9	1852	broad.mit.edu	37	X	152915633	152915633	+	Missense_Mutation	SNP	G	G	C			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chrX:152915633G>C	ENST00000342782.3	+	4	1293	c.1028G>C	c.(1027-1029)aGc>aCc	p.S343T	DUSP9_ENST00000370167.4_Missense_Mutation_p.S343T			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	343	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TTTGAGCGCAGCTTGCGGCTG	0.602																																							uc004fhx.3		NA																	0				ovary(2)	2						c.(1027-1029)AGC>ACC		dual specificity phosphatase 9							153.0	135.0	141.0					X																	152915633		2203	4300	6503	SO:0001583	missense	1852				inactivation of MAPK activity|JNK cascade	cytosol|endoplasmic reticulum|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chrX:152915633G>C	Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.1028G>C	X.37:g.152915633G>C	ENSP00000345853:p.Ser343Thr					DUSP9_uc004fhy.3_Missense_Mutation_p.S343T	p.S343T	NM_001395	NP_001386	Q99956	DUS9_HUMAN			4	1232	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		343			Tyrosine-protein phosphatase.		D3DWU5	Missense_Mutation	SNP	ENST00000342782.3	37	c.1028G>C	CCDS14724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	1.689|1.689	-0.504556|-0.504556	0.04261|0.04261	.|.	.|.	ENSG00000130829|ENSG00000130829	ENST00000433144|ENST00000370167;ENST00000342782	.|T;T	.|0.60171	.|0.21;0.21	4.53|4.53	3.63|3.63	0.41609|0.41609	.|Dual specificity phosphatase, subgroup, catalytic domain (2);	.|0.069666	.|0.56097	.|N	.|0.000021	T|T	0.33294|0.33294	0.0858|0.0858	N|N	0.12663|0.12663	0.25|0.25	0.37806|0.37806	D|D	0.927862|0.927862	.|B	.|0.16603	.|0.018	.|B	.|0.16722	.|0.016	T|T	0.25984|0.25984	-1.0116|-1.0116	5|10	.|0.02654	.|T	.|1	.|.	11.9009|11.9009	0.52682|0.52682	0.0:0.3288:0.6712:0.0|0.0:0.3288:0.6712:0.0	.|.	.|343	.|Q99956	.|DUS9_HUMAN	P|T	314|343	.|ENSP00000359186:S343T;ENSP00000345853:S343T	.|ENSP00000345853:S343T	A|S	+|+	1|2	0|0	DUSP9|DUSP9	152568827|152568827	1.000000|1.000000	0.71417|0.71417	0.914000|0.914000	0.36105|0.36105	0.775000|0.775000	0.43874|0.43874	2.827000|2.827000	0.48112|0.48112	0.999000|0.999000	0.39023|0.39023	0.529000|0.529000	0.55759|0.55759	GCT|AGC		0.602	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061022.3	NM_001395		142	43	0	0	0	0.01441	0	142	43				
MST1L	11223	broad.mit.edu	37	1	17086085	17086086	+	RNA	INS	-	-	C	rs200532237		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr1:17086085_17086086insC	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GGCAAGGTACGCCGCGGTGGTG	0.649																																							uc010ock.1		NA																	0					0						c.(811-813)GCGfs		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17086085_17086086insC	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086087_17086087dupC						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.A271fs	NR_002729						7	811_812	-								B7WPB1|Q13209	Frame_Shift_Ins	INS	ENST00000455405.2	37	c.811_812insG																																																																																					0.649	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		3	4	NA	NA	NA	NA	NA	3	4	---	---	---	---
PPFIBP2	8495	broad.mit.edu	37	11	7661015	7661020	+	In_Frame_Del	DEL	CAGGAG	CAGGAG	-	rs553604362|rs137855547	byFrequency	TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	CAGGAG	CAGGAG	-	-	CAGGAG	CAGGAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr11:7661015_7661020delCAGGAG	ENST00000299492.4	+	15	1677_1682	c.1289_1294delCAGGAG	c.(1288-1296)tcaggagcc>tcc	p.GA431del	PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_In_Frame_Del_p.GA319del|PPFIBP2_ENST00000533792.1_In_Frame_Del_p.GA273del|PPFIBP2_ENST00000530181.1_In_Frame_Del_p.GA288del	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	431					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGGAAGCTTTCAGGAGCCACGCCCAA	0.568																																							uc001mfj.3		NA																	0				ovary(2)|breast(2)	4						c.(1288-1296)TCAGGAGCC>TCC		PTPRF interacting protein, binding protein 2																																				SO:0001651	inframe_deletion	8495				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding	g.chr11:7661015_7661020delCAGGAG	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1289_1294delCAGGAG	11.37:g.7661015_7661020delCAGGAG	ENSP00000299492:p.Gly431_Ala432del					PPFIBP2_uc010rbb.1_In_Frame_Del_p.GA354del|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_In_Frame_Del_p.GA354del|PPFIBP2_uc010rbd.1_In_Frame_Del_p.GA273del|PPFIBP2_uc010rbe.1_In_Frame_Del_p.GA319del|PPFIBP2_uc001mfl.3_In_Frame_Del_p.GA288del|PPFIBP2_uc009yfj.1_In_Frame_Del_p.GA75del	p.GA431del	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN		Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)	15	1677_1682	+			431_432					B7Z433|E9PK77|O75337|Q8WW26	In_Frame_Del	DEL	ENST00000299492.4	37	c.1289_1294delCAGGAG	CCDS31419.1																																																																																				0.568	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621		53	245	NA	NA	NA	NA	NA	53	245	---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85449548	85449549	+	Frame_Shift_Ins	INS	-	-	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr12:85449548_85449549insA	ENST00000393217.2	+	8	1038_1039	c.977_978insA	c.(976-981)gcaaaafs	p.AK326fs		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	326	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		gaaaaggaagcaaaaatacgac	0.332																																							uc001tac.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(976-978)GCAfs		leucine-rich repeats and IQ motif containing 1																																				SO:0001589	frameshift_variant	84125							g.chr12:85449548_85449549insA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.982dupA	12.37:g.85449553_85449553dupA	ENSP00000376910:p.Ala326fs					LRRIQ1_uc001tab.1_Frame_Shift_Ins_p.A326fs|LRRIQ1_uc001taa.1_Frame_Shift_Ins_p.A301fs	p.A326fs	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	8	1088_1089	+			326			Glu-rich.		Q567P4|Q9BS17|Q9HA36	Frame_Shift_Ins	INS	ENST00000393217.2	37	c.977_978insA	CCDS41816.1																																																																																				0.332	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		17	59	NA	NA	NA	NA	NA	17	59	---	---	---	---
CHRNA3	1136	broad.mit.edu	37	15	78913068	78913070	+	In_Frame_Del	DEL	CAG	CAG	-	rs60706203|rs66793222|rs143833222		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:78913068_78913070delCAG	ENST00000326828.5	-	1	451_453	c.67_69delCTG	c.(67-69)ctgdel	p.L23del	CHRNA3_ENST00000348639.3_In_Frame_Del_p.L23del|CHRNA3_ENST00000559941.1_5'Flank	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	23			Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8906617, ECO:0000269|PubMed:9009220, ECO:0000269|PubMed:9921897}.		activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	gcagcagagacagcagcagcagc	0.768																																							uc002bec.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(67-69)CTGdel		cholinergic receptor, nicotinic, alpha 3																																				SO:0001651	inframe_deletion	1136				activation of transmembrane receptor protein tyrosine kinase activity|behavioral response to nicotine|locomotory behavior|regulation of acetylcholine secretion|regulation of dendrite morphogenesis|regulation of excitatory postsynaptic membrane potential|regulation of smooth muscle contraction|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|dendrite|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic density|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr15:78913068_78913070delCAG		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.67_69delCTG	15.37:g.78913077_78913079delCAG	ENSP00000315602:p.Leu23del					CHRNA3_uc002bea.2_RNA|CHRNA3_uc002beb.2_In_Frame_Del_p.L23del	p.L23del	NM_000743	NP_000734	P32297	ACHA3_HUMAN			1	253_255	-			23		Missing.			Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	In_Frame_Del	DEL	ENST00000326828.5	37	c.67_69delCTG	CCDS10305.1																																																																																				0.768	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3			4	3	NA	NA	NA	NA	NA	4	3	---	---	---	---
CERS3	204219	broad.mit.edu	37	15	101013174	101013174	+	Frame_Shift_Del	DEL	C	C	-			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr15:101013174delC	ENST00000394113.1	-	11	1383	c.693delG	c.(691-693)gggfs	p.G231fs	CERS3_ENST00000538112.2_Frame_Shift_Del_p.G231fs|CERS3_ENST00000284382.4_Frame_Shift_Del_p.G231fs|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	231	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TCACGAGGGTCCCACTGCGAA	0.433																																						NSCLC(135;1149 2482 10680 49908)	uc002bvz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(691-693)GGGfs		LAG1 longevity assurance homolog 3							118.0	101.0	107.0					15																	101013174		2203	4300	6503	SO:0001589	frameshift_variant	204219					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity	g.chr15:101013174delC		CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.693delG	15.37:g.101013174delC	ENSP00000377672:p.Gly231fs					LASS3_uc002bwa.2_Frame_Shift_Del_p.G242fs|LASS3_uc002bwb.2_Frame_Shift_Del_p.G231fs	p.G231fs	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)		10	1195	-	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		231			TLC.		Q8NE64|Q8NEN6	Frame_Shift_Del	DEL	ENST00000394113.1	37	c.693delG	CCDS10384.1																																																																																				0.433	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842		24	129	NA	NA	NA	NA	NA	24	129	---	---	---	---
MPP3	4356	broad.mit.edu	37	17	41905182	41905182	+	Frame_Shift_Del	DEL	C	C	-			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr17:41905182delC	ENST00000398389.4	-	8	625	c.460delG	c.(460-462)gacfs	p.D154fs	MPP3_ENST00000398393.1_Frame_Shift_Del_p.D179fs	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	154	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		GAGTGCTCGTCCCGCCGGATG	0.627																																							uc002iei.3		NA																	0				large_intestine(1)|skin(1)	2						c.(460-462)GACfs		palmitoylated membrane protein 3							51.0	62.0	58.0					17																	41905182		2136	4240	6376	SO:0001589	frameshift_variant	4356				signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity	g.chr17:41905182delC		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.460delG	17.37:g.41905182delC	ENSP00000381425:p.Asp154fs					MPP3_uc002ieh.2_Frame_Shift_Del_p.D179fs|MPP3_uc002iej.2_RNA|MPP3_uc010czi.1_Frame_Shift_Del_p.D154fs|MPP3_uc010wik.1_Frame_Shift_Del_p.D179fs	p.D154fs	NM_001932	NP_001923	Q13368	MPP3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.119)	8	626	-		Breast(137;0.00394)	154			PDZ.		B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Frame_Shift_Del	DEL	ENST00000398389.4	37	c.460delG	CCDS42344.1																																																																																				0.627	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932		41	156	NA	NA	NA	NA	NA	41	156	---	---	---	---
ATP9B	374868	broad.mit.edu	37	18	77102279	77102289	+	Frame_Shift_Del	DEL	AACAGGCGATA	AACAGGCGATA	-	rs370138340|rs374495132		TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	AACAGGCGATA	AACAGGCGATA	-	-	AACAGGCGATA	AACAGGCGATA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr18:77102279_77102289delAACAGGCGATA	ENST00000426216.2	+	20	2312_2322	c.2295_2305delAACAGGCGATA	c.(2293-2307)ctaacaggcgataaafs	p.TGDK766fs	ATP9B_ENST00000307671.7_Frame_Shift_Del_p.TGDK766fs|RP11-800A18.4_ENST00000592906.1_RNA|ATP9B_ENST00000543761.1_Frame_Shift_Del_p.TGDK87fs	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	766					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TATGGATGCTAACAGGCGATAAACTCGAGAC	0.379																																							uc002lmx.2		NA																	0				ovary(3)	3						c.(2293-2307)CTAACAGGCGATAAAfs		ATPase, class II, type 9B																																				SO:0001589	frameshift_variant	374868				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr18:77102279_77102289delAACAGGCGATA	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.2295_2305delAACAGGCGATA	18.37:g.77102279_77102289delAACAGGCGATA	ENSP00000398076:p.Thr766fs					ATP9B_uc002lmw.1_Frame_Shift_Del_p.L765fs|ATP9B_uc002lmz.1_Frame_Shift_Del_p.L459fs|ATP9B_uc002lna.2_5'Flank	p.L765fs	NM_198531	NP_940933	O43861	ATP9B_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)	20	2309_2319	+		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)	765_769			Cytoplasmic (Potential).		O60872|Q08AD8|Q08AD9	Frame_Shift_Del	DEL	ENST00000426216.2	37	c.2295_2305delAACAGGCGATA	CCDS12014.1																																																																																				0.379	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531		16	124	NA	NA	NA	NA	NA	16	124	---	---	---	---
SPRED2	200734	broad.mit.edu	37	2	65540928	65540928	+	Frame_Shift_Del	DEL	G	G	-			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr2:65540928delG	ENST00000356388.4	-	6	1153	c.964delC	c.(964-966)cgcfs	p.R323fs	SPRED2_ENST00000443619.2_Frame_Shift_Del_p.R320fs|SPRED2_ENST00000474228.1_5'Flank	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	323	SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						TGGCCCCGGCGGTTCTCCTCG	0.662																																							uc002sdr.3		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(964-966)CGCfs		sprouty-related protein with EVH-1 domain 2							78.0	80.0	80.0					2																	65540928		2203	4299	6502	SO:0001589	frameshift_variant	200734				inactivation of MAPK activity|multicellular organismal development	transport vesicle membrane	stem cell factor receptor binding	g.chr2:65540928delG	AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.964delC	2.37:g.65540928delG	ENSP00000348753:p.Arg323fs					SPRED2_uc010fcw.2_Frame_Shift_Del_p.R319fs	p.R322fs	NM_181784	NP_861449	Q7Z698	SPRE2_HUMAN			6	1499	-			322			SPR.		A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Frame_Shift_Del	DEL	ENST00000356388.4	37	c.964delC	CCDS33211.1																																																																																				0.662	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1			94	260	NA	NA	NA	NA	NA	94	260	---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45808534	45808535	+	Frame_Shift_Ins	INS	-	-	A			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr20:45808534_45808535insA	ENST00000327619.5	+	13	1661_1662	c.1287_1288insA	c.(1288-1290)aagfs	p.K430fs	EYA2_ENST00000357410.3_Intron|EYA2_ENST00000317304.6_Frame_Shift_Ins_p.K400fs	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	430					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)	p.L429L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				CCCACTCCCTGAAGGCACTAAA	0.559																																					Pancreas(120;56 1725 18501 25218 43520)	Pancreas(120;56 1725 18501 25218 43520)	uc002xsm.2		NA																	1	Substitution - coding silent(1)		NS(1)	ovary(1)	1						c.(1285-1290)CTGAAGfs		eyes absent 2 isoform a																																				SO:0001589	frameshift_variant	2139				DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity	g.chr20:45808534_45808535insA		CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.1289dupA	20.37:g.45808536_45808536dupA	ENSP00000333640:p.Lys430fs					EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Frame_Shift_Ins_p.L434fs|EYA2_uc002xso.2_Frame_Shift_Ins_p.L429fs|EYA2_uc002xsp.2_Frame_Shift_Ins_p.L429fs|EYA2_uc002xsq.2_Frame_Shift_Ins_p.L399fs	p.L429fs	NM_005244	NP_005235	O00167	EYA2_HUMAN			13	1661_1662	+		Myeloproliferative disorder(115;0.0241)	429_430					Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Frame_Shift_Ins	INS	ENST00000327619.5	37	c.1287_1288insA	CCDS13403.1																																																																																				0.559	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244		47	64	NA	NA	NA	NA	NA	47	64	---	---	---	---
YTHDC1	91746	broad.mit.edu	37	4	69199072	69199073	+	Frame_Shift_Ins	INS	-	-	G			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr4:69199072_69199073insG	ENST00000344157.4	-	5	1261_1262	c.926_927insC	c.(925-927)ccafs	p.P309fs	YTHDC1_ENST00000355665.3_Frame_Shift_Ins_p.P309fs|YTHDC1_ENST00000579690.1_Frame_Shift_Ins_p.P309fs	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	309					mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						CAAAAACAATTGGAGATATGCC	0.332																																							uc003hdx.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(925-927)CCAfs		splicing factor YT521-B isoform 1																																				SO:0001589	frameshift_variant	91746							g.chr4:69199072_69199073insG	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.927dupC	4.37:g.69199074_69199074dupG	ENSP00000339245:p.Pro309fs					YTHDC1_uc003hdy.2_Frame_Shift_Ins_p.P309fs	p.P309fs	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN			5	1279_1280	-			309					Q4W5Q3|Q7Z622|Q8TF35	Frame_Shift_Ins	INS	ENST00000344157.4	37	c.926_927insC	CCDS33992.1																																																																																				0.332	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370		75	260	NA	NA	NA	NA	NA	75	260	---	---	---	---
RICTOR	253260	broad.mit.edu	37	5	38959321	38959325	+	Frame_Shift_Del	DEL	GGAAA	GGAAA	-			TCGA-75-7027-01A-11D-1945-08	TCGA-75-7027-10A-01D-1946-08	GGAAA	GGAAA	-	-	GGAAA	GGAAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b9b8d0a7-d8a2-4806-a5f4-6dcb072b510d	af6b81ce-4107-4511-a892-41fa763fd576	g.chr5:38959321_38959325delGGAAA	ENST00000357387.3	-	22	2180_2184	c.2150_2154delTTTCC	c.(2149-2154)ctttccfs	p.LS717fs	RICTOR_ENST00000503698.1_5'UTR|RICTOR_ENST00000296782.5_Frame_Shift_Del_p.LS717fs	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TTAAAATTTTGGAAAGGATGACTCT	0.337																																							uc003jlp.2		NA																	0				ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10						c.(2149-2154)CTTTCCfs		rapamycin-insensitive companion of mTOR																																				SO:0001589	frameshift_variant	253260				actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding	g.chr5:38959321_38959325delGGAAA		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2150_2154delTTTCC	5.37:g.38959321_38959325delGGAAA	ENSP00000349959:p.Leu717fs					RICTOR_uc003jlo.2_Frame_Shift_Del_p.L717fs|RICTOR_uc010ivf.2_Frame_Shift_Del_p.L432fs	p.L717fs	NM_152756	NP_689969	Q6R327	RICTR_HUMAN			22	2174_2178	-	all_lung(31;0.000396)		717_718						Frame_Shift_Del	DEL	ENST00000357387.3	37	c.2150_2154delTTTCC	CCDS34148.1																																																																																				0.337	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		8	109	NA	NA	NA	NA	NA	8	109	---	---	---	---
