#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRAMEF12	390999	broad.mit.edu	37	1	12837248	12837248	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:12837248C>A	ENST00000357726.4	+	3	985	c.958C>A	c.(958-960)Cag>Aag	p.Q320K		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	320					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCATCCGTCAGCTAAAAGA	0.582																																							uc001aui.2		NA																	0				ovary(3)	3						c.(958-960)CAG>AAG		PRAME family member 12							112.0	117.0	116.0					1																	12837248		2203	4300	6503	SO:0001583	missense	390999							g.chr1:12837248C>A		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.958C>A	1.37:g.12837248C>A	ENSP00000350358:p.Gln320Lys						p.Q320K	NM_001080830	NP_001074299	O95522	PRA12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	985	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	320			LRR 1.			Missense_Mutation	SNP	ENST00000357726.4	37	c.958C>A	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	14.30	2.493425	0.44352	.	.	ENSG00000116726	ENST00000357726	T	0.51817	0.69	2.83	0.753	0.18404	.	0.650375	0.15385	N	0.265113	T	0.63721	0.2535	M	0.82630	2.6	0.09310	N	1	D	0.69078	0.997	D	0.77557	0.99	T	0.50617	-0.8807	10	0.49607	T	0.09	.	5.1929	0.15218	0.0:0.3822:0.484:0.1339	.	320	O95522	PRA12_HUMAN	K	320	ENSP00000350358:Q320K	ENSP00000350358:Q320K	Q	+	1	0	PRAMEF12	12759835	0.000000	0.05858	0.001000	0.08648	0.288000	0.27193	-0.161000	0.10026	0.192000	0.20272	0.205000	0.17691	CAG		0.582	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760		33	130	1	0	8.4185e-14	0.012213	1.07738e-13	33	130				
PRDM2	7799	broad.mit.edu	37	1	14109132	14109132	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:14109132G>C	ENST00000235372.7	+	8	5698	c.4842G>C	c.(4840-4842)agG>agC	p.R1614S	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.R1614S|PRDM2_ENST00000413440.1_Missense_Mutation_p.R1413S|PRDM2_ENST00000343137.4_Missense_Mutation_p.R1413S	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1614					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TGCACGTGAGGGTACAGAAAA	0.458																																							uc001avi.2		NA																	0				ovary(1)	1						c.(4840-4842)AGG>AGC		retinoblastoma protein-binding zinc finger							72.0	74.0	73.0					1																	14109132		2203	4300	6503	SO:0001583	missense	7799					Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:14109132G>C	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.4842G>C	1.37:g.14109132G>C	ENSP00000235372:p.Arg1614Ser					PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.R1614S|PRDM2_uc001avj.2_Intron|PRDM2_uc001avk.2_Missense_Mutation_p.R1413S|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	p.R1614S	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)	8	5698	+	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	1614					B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	c.4842G>C	CCDS150.1	.	.	.	.	.	.	.	.	.	.	G	7.682	0.689290	0.14973	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01725	4.78;4.67;4.67;4.67	5.85	-1.37	0.09056	.	0.233723	0.44097	D	0.000499	T	0.02304	0.0071	M	0.62723	1.935	0.30359	N	0.783969	P;P;P	0.52842	0.956;0.682;0.787	B;B;B	0.44044	0.344;0.255;0.439	T	0.35525	-0.9785	10	0.54805	T	0.06	.	5.2686	0.15613	0.4292:0.2326:0.3382:0.0	.	1472;1614;1614	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	S	1614;1614;1614;1413;1413	ENSP00000235372:R1614S;ENSP00000312352:R1614S;ENSP00000411103:R1413S;ENSP00000341621:R1413S	ENSP00000235372:R1614S	R	+	3	2	PRDM2	13981719	1.000000	0.71417	0.012000	0.15200	0.185000	0.23345	0.928000	0.28831	-0.182000	0.10602	0.655000	0.94253	AGG		0.458	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231		12	60	0	0	0	0.013537	0	12	60				
CROCC	9696	broad.mit.edu	37	1	17250965	17250965	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:17250965C>T	ENST00000375541.5	+	3	411	c.342C>T	c.(340-342)gtC>gtT	p.V114V	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACAATGCGGTCAGCGAGAGGG	0.652																																							uc001azt.2		NA																	0				ovary(2)|breast(2)|central_nervous_system(1)	5						c.(340-342)GTC>GTT		ciliary rootlet coiled-coil							49.0	35.0	39.0					1																	17250965		2202	4300	6502	SO:0001819	synonymous_variant	9696				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity	g.chr1:17250965C>T	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.342C>T	1.37:g.17250965C>T						CROCC_uc009voy.1_Intron|CROCC_uc009voz.1_Intron	p.V114V	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	3	411	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)	114			Potential.			Silent	SNP	ENST00000375541.5	37	c.342C>T	CCDS30616.1																																																																																				0.652	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		12	22	0	0	0	0.010729	0	12	22				
EPHA8	2046	broad.mit.edu	37	1	22927868	22927868	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:22927868G>T	ENST00000166244.3	+	16	2877	c.2805G>T	c.(2803-2805)gtG>gtT	p.V935V		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	935	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCCTCACCGTGGGGGACTGGC	0.677																																							uc001bfx.1		NA																	0				central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13						c.(2803-2805)GTG>GTT		ephrin receptor EphA8 isoform 1 precursor							35.0	43.0	40.0					1																	22927868		2184	4265	6449	SO:0001819	synonymous_variant	2046					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr1:22927868G>T	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.2805G>T	1.37:g.22927868G>T							p.V935V	NM_020526	NP_065387	P29322	EPHA8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	16	2930	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	935			Cytoplasmic (Potential).|SAM.		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	37	c.2805G>T	CCDS225.1																																																																																				0.677	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526		28	59	1	0	9.39395e-14	0.00632	1.19231e-13	28	59				
FUCA1	2517	broad.mit.edu	37	1	24172269	24172269	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:24172269T>A	ENST00000374479.3	-	8	1344	c.1337A>T	c.(1336-1338)cAg>cTg	p.Q446L		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	446					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GGGTGGCAACTGGGGTAGAGA	0.463																																							uc001bie.2		NA																	0				breast(1)	1						c.(1336-1338)CAG>CTG		fucosidase, alpha-L-1, tissue precursor							111.0	112.0	111.0					1																	24172269		2203	4300	6503	SO:0001583	missense	2517				fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding	g.chr1:24172269T>A	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.1337A>T	1.37:g.24172269T>A	ENSP00000363603:p.Gln446Leu						p.Q446L	NM_000147	NP_000138	P04066	FUCO_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)	8	1382	-		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)	446					B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	c.1337A>T	CCDS244.2	.	.	.	.	.	.	.	.	.	.	T	12.58	1.981336	0.34942	.	.	ENSG00000179163	ENST00000374479;ENST00000374475	T	0.52057	0.68	5.46	0.101	0.14517	.	1.416360	0.04228	N	0.334816	T	0.36496	0.0969	L	0.38953	1.18	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16158	-1.0412	10	0.25751	T	0.34	-0.0368	6.3881	0.21572	0.2258:0.0:0.1749:0.5992	.	446	P04066	FUCO_HUMAN	L	446;235	ENSP00000363603:Q446L	ENSP00000363599:Q235L	Q	-	2	0	FUCA1	24044856	0.000000	0.05858	0.003000	0.11579	0.709000	0.40893	-0.933000	0.03959	0.112000	0.17975	0.528000	0.53228	CAG		0.463	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147		4	87	0	0	0	0.009096	0	4	87				
EXTL1	2134	broad.mit.edu	37	1	26357001	26357001	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:26357001G>T	ENST00000374280.3	+	4	1883	c.1016G>T	c.(1015-1017)cGg>cTg	p.R339L	EXTL1_ENST00000484339.1_3'UTR	NM_004455.2	NP_004446.2	Q92935	EXTL1_HUMAN	exostosin-like glycosyltransferase 1	339					protein glycosylation (GO:0006486)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|stomach(1)|urinary_tract(1)	23		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCCTGCACGGGTCCTCGCC	0.587																																							uc001blf.2		NA																	0				central_nervous_system(1)	1						c.(1015-1017)CGG>CTG		exostoses-like 1							92.0	89.0	90.0					1																	26357001		2203	4300	6503	SO:0001583	missense	2134				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding	g.chr1:26357001G>T	U67191	CCDS271.1	1p36.1	2013-03-01	2013-03-01		ENSG00000158008	ENSG00000158008	2.4.1.224	"""Exostosin glycosyltransferase family"""	3515	protein-coding gene	gene with protein product	"""glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""alpha-N-acetylglucosaminyltransferase II"", ""glucuronyl-N-acetylglucosaminylproteoglycan alpha-1,4-N- acetylglucosaminyltransferase"", ""exostosin-L"""	601738	"""exostoses (multiple)-like 1"""			9037597	Standard	NM_004455		Approved	EXTL, MGC70794	uc001blf.3	Q92935	OTTHUMG00000007509	ENST00000374280.3:c.1016G>T	1.37:g.26357001G>T	ENSP00000363398:p.Arg339Leu						p.R339L	NM_004455	NP_004446	Q92935	EXTL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)	4	1883	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	339			Lumenal (Potential).		Q6GSC1	Missense_Mutation	SNP	ENST00000374280.3	37	c.1016G>T	CCDS271.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812979	0.70912	.	.	ENSG00000158008	ENST00000374280	D	0.95788	-3.81	4.61	3.7	0.42460	.	0.000000	0.64402	D	0.000001	D	0.94899	0.8351	M	0.83223	2.63	0.52501	D	0.999956	P	0.47034	0.889	B	0.43194	0.411	D	0.94064	0.7329	10	0.66056	D	0.02	-27.9022	10.1962	0.43056	0.095:0.0:0.905:0.0	.	339	Q92935	EXTL1_HUMAN	L	339	ENSP00000363398:R339L	ENSP00000363398:R339L	R	+	2	0	EXTL1	26229588	0.059000	0.20769	0.735000	0.30896	0.985000	0.73830	0.404000	0.20999	1.177000	0.42855	-0.263000	0.10527	CGG		0.587	EXTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019749.1	NM_004455		19	65	1	0	8.04996e-18	0.012319	1.09385e-17	19	65				
DLGAP3	58512	broad.mit.edu	37	1	35351192	35351192	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:35351192G>C	ENST00000373347.1	-	7	2069	c.1801C>G	c.(1801-1803)Ccg>Gcg	p.P601A	DLGAP3_ENST00000235180.4_Missense_Mutation_p.P601A			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	601					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				GCCCGGGGCGGCACCGGCGCC	0.761																																							uc001byc.2		NA																	0				ovary(3)	3						c.(1801-1803)CCG>GCG		discs, large (Drosophila) homolog-associated							6.0	9.0	8.0					1																	35351192		2076	4167	6243	SO:0001583	missense	58512				cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane		g.chr1:35351192G>C	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1801C>G	1.37:g.35351192G>C	ENSP00000362444:p.Pro601Ala						p.P601A	NM_001080418	NP_001073887	O95886	DLGP3_HUMAN			5	1801	-		Myeloproliferative disorder(586;0.0393)	601					Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	c.1801C>G	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	G	7.183	0.589992	0.13812	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.25912	1.77;1.77	5.04	4.13	0.48395	.	0.622615	0.17476	N	0.172920	T	0.15132	0.0365	N	0.17312	0.475	0.27081	N	0.963084	B	0.34015	0.435	B	0.24974	0.057	T	0.07947	-1.0746	10	0.34782	T	0.22	-2.2629	13.8351	0.63404	0.0737:0.0:0.9263:0.0	.	601	O95886	DLGP3_HUMAN	A	601	ENSP00000362444:P601A;ENSP00000235180:P601A	ENSP00000235180:P601A	P	-	1	0	DLGAP3	35123779	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	3.912000	0.56386	1.343000	0.45638	0.561000	0.74099	CCG		0.761	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234		7	10	0	0	0	0.001984	0	7	10				
HIVEP3	59269	broad.mit.edu	37	1	41978898	41978898	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:41978898G>A	ENST00000372583.1	-	8	6879	c.5994C>T	c.(5992-5994)tcC>tcT	p.S1998S	HIVEP3_ENST00000247584.5_Silent_p.S1998S|HIVEP3_ENST00000429157.2_Silent_p.S1998S|HIVEP3_ENST00000372584.1_Silent_p.S1998S|HIVEP3_ENST00000460604.1_5'UTR	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1998					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTCGGGCCGGGGAGCATCGCT	0.627																																							uc001cgz.3		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)	6						c.(5992-5994)TCC>TCT		human immunodeficiency virus type I enhancer							53.0	62.0	59.0					1																	41978898		2203	4299	6502	SO:0001819	synonymous_variant	59269				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr1:41978898G>A	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5994C>T	1.37:g.41978898G>A						HIVEP3_uc001cha.3_Silent_p.S1998S|HIVEP3_uc001cgy.2_RNA	p.S1998S	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN			8	7207	-	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)	1998			4.		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	c.5994C>T	CCDS463.1																																																																																				0.627	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503		27	52	0	0	0	0.003954	0	27	52				
HIVEP3	59269	broad.mit.edu	37	1	41978901	41978901	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:41978901G>A	ENST00000372583.1	-	8	6876	c.5991C>T	c.(5989-5991)tgC>tgT	p.C1997C	HIVEP3_ENST00000247584.5_Silent_p.C1997C|HIVEP3_ENST00000429157.2_Silent_p.C1997C|HIVEP3_ENST00000372584.1_Silent_p.C1997C|HIVEP3_ENST00000460604.1_5'UTR	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1997					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GGGCCGGGGAGCATCGCTGGG	0.637																																							uc001cgz.3		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)	6						c.(5989-5991)TGC>TGT		human immunodeficiency virus type I enhancer							53.0	62.0	59.0					1																	41978901		2203	4299	6502	SO:0001819	synonymous_variant	59269				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr1:41978901G>A	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5991C>T	1.37:g.41978901G>A						HIVEP3_uc001cha.3_Silent_p.C1997C|HIVEP3_uc001cgy.2_RNA	p.C1997C	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN			8	7204	-	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)	1997					A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	c.5991C>T	CCDS463.1																																																																																				0.637	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503		29	54	0	0	0	0.005443	0	29	54				
TIE1	7075	broad.mit.edu	37	1	43775150	43775150	+	Missense_Mutation	SNP	G	G	A	rs550355457	byFrequency	TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:43775150G>A	ENST00000372476.3	+	9	1359	c.1280G>A	c.(1279-1281)cGt>cAt	p.R427H	TIE1_ENST00000433781.2_Missense_Mutation_p.R72H	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	427					angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R427H(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGGGAGTGCCGTGTGTCCACA	0.572																																							uc001ciu.2		NA																	1	Substitution - Missense(1)		prostate(1)	lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7						c.(1279-1281)CGT>CAT		tyrosine kinase with immunoglobulin-like and							119.0	102.0	107.0					1																	43775150		2203	4300	6503	SO:0001583	missense	7075				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:43775150G>A	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.1280G>A	1.37:g.43775150G>A	ENSP00000361554:p.Arg427His					TIE1_uc010okd.1_Missense_Mutation_p.R427H|TIE1_uc010oke.1_Missense_Mutation_p.R382H|TIE1_uc009vwq.2_Missense_Mutation_p.R383H|TIE1_uc010okf.1_Missense_Mutation_p.R72H|TIE1_uc010okg.1_Missense_Mutation_p.R72H|TIE1_uc010okc.1_3'UTR	p.R427H	NM_005424	NP_005415	P35590	TIE1_HUMAN			9	1359	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	427			Extracellular (Potential).		B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	c.1280G>A	CCDS482.1	.	.	.	.	.	.	.	.	.	.	G	34	5.367603	0.95900	.	.	ENSG00000066056	ENST00000372476;ENST00000433781	T;T	0.42900	2.48;0.96	4.93	4.93	0.64822	Immunoglobulin-like fold (1);	0.000000	0.36740	N	0.002437	T	0.65322	0.2680	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.997;0.999	T	0.69018	-0.5256	10	0.62326	D	0.03	.	18.1658	0.89724	0.0:0.0:1.0:0.0	.	72;382;427;72;427	E9PG63;B4DTW8;B5A952;B4DKW0;P35590	.;.;.;.;TIE1_HUMAN	H	427;72	ENSP00000361554:R427H;ENSP00000411728:R72H	ENSP00000361554:R427H	R	+	2	0	TIE1	43547737	1.000000	0.71417	0.947000	0.38551	0.995000	0.86356	9.188000	0.94921	2.288000	0.76882	0.563000	0.77884	CGT		0.572	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424		8	37	0	0	0	0.004482	0	8	37				
KLF17	128209	broad.mit.edu	37	1	44596220	44596220	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:44596220C>T	ENST00000372299.3	+	3	1020	c.962C>T	c.(961-963)tCa>tTa	p.S321L	KLF17_ENST00000476802.1_3'UTR	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	321					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					GAAAGTTGTTCATGGTCTTTC	0.463																																							uc001clp.2		NA																	0				ovary(1)|skin(1)	2						c.(961-963)TCA>TTA		zinc finger protein 393							141.0	130.0	134.0					1																	44596220		2203	4300	6503	SO:0001583	missense	128209				regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr1:44596220C>T	BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.962C>T	1.37:g.44596220C>T	ENSP00000361373:p.Ser321Leu						p.S321L	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN			3	1020	+	Acute lymphoblastic leukemia(166;0.155)		321			C2H2-type 2.		Q86VQ7|Q8N805	Missense_Mutation	SNP	ENST00000372299.3	37	c.962C>T	CCDS508.1	.	.	.	.	.	.	.	.	.	.	C	9.198	1.027694	0.19512	.	.	ENSG00000171872	ENST00000372299	T	0.70986	-0.53	4.47	-6.03	0.02185	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.107800	0.06948	N	0.814079	T	0.55097	0.1899	L	0.49640	1.575	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.37103	-0.9720	10	0.30854	T	0.27	.	3.0319	0.06109	0.5156:0.1711:0.2136:0.0997	.	321	Q5JT82	KLF17_HUMAN	L	321	ENSP00000361373:S321L	ENSP00000361373:S321L	S	+	2	0	KLF17	44368807	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.232000	0.02936	-1.128000	0.02922	-1.444000	0.01066	TCA		0.463	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026646.1	NM_173484		44	62	0	0	0	0.009718	0	44	62				
USP24	23358	broad.mit.edu	37	1	55590228	55590228	+	Missense_Mutation	SNP	C	C	T	rs368254067		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:55590228C>T	ENST00000294383.6	-	35	4033	c.4034G>A	c.(4033-4035)cGg>cAg	p.R1345Q	USP24_ENST00000407756.1_Missense_Mutation_p.R1185Q	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1345					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AAGATCAAGCCGTCCTGCAGC	0.428																																							uc001cyg.3		NA																	0				ovary(6)|kidney(6)|breast(1)	13						c.(3553-3555)CGG>CAG		ubiquitin specific protease 24		C	GLN/ARG	1,3921		0,1,1960	54.0	53.0	53.0		4034	4.9	1.0	1		53	0,8288		0,0,4144	no	missense	USP24	NM_015306.2	43	0,1,6104	TT,TC,CC		0.0,0.0255,0.0082	possibly-damaging	1345/2621	55590228	1,12209	1961	4144	6105	SO:0001583	missense	23358				ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr1:55590228C>T	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.4034G>A	1.37:g.55590228C>T	ENSP00000294383:p.Arg1345Gln						p.R1185Q	NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN			32	3554	-			1345					Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	c.3554G>A	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812667	0.70912	2.55E-4	0.0	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02301	4.37;4.35	4.93	4.93	0.64822	.	0.065961	0.64402	D	0.000006	T	0.02929	0.0087	L	0.40543	1.245	0.54753	D	0.999986	B	0.25955	0.138	B	0.14023	0.01	T	0.56739	-0.7929	10	0.20046	T	0.44	.	18.1407	0.89638	0.0:1.0:0.0:0.0	.	1185	B7WPF4	.	Q	1345;1185	ENSP00000294383:R1345Q;ENSP00000385700:R1185Q	ENSP00000294383:R1345Q	R	-	2	0	USP24	55362816	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	7.410000	0.80065	2.288000	0.76882	0.455000	0.32223	CGG		0.428	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			7	31	0	0	0	0.001984	0	7	31				
DOCK7	85440	broad.mit.edu	37	1	62961329	62961329	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:62961329G>A	ENST00000340370.5	-	38	4871	c.4854C>T	c.(4852-4854)ctC>ctT	p.L1618L	DOCK7_ENST00000251157.5_Silent_p.L1640L	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1649					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						GAATCATATGGAGATTGAAAA	0.333																																							uc001daq.2		NA																	0				ovary(2)	2						c.(4918-4920)CTC>CTT		dedicator of cytokinesis 7							75.0	77.0	76.0					1																	62961329		2203	4299	6502	SO:0001819	synonymous_variant	85440				activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding	g.chr1:62961329G>A		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4854C>T	1.37:g.62961329G>A						DOCK7_uc001dan.2_Silent_p.L1501L|DOCK7_uc001dao.2_Silent_p.L1501L|DOCK7_uc001dap.2_Silent_p.L1618L|DOCK7_uc001dam.2_Silent_p.L820L|DOCK7_uc010oov.1_Silent_p.L379L	p.L1640L	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN			39	4954	-			1649			DHR-2.		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	37	c.4920C>T	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	G	9.565	1.119588	0.20877	.	.	ENSG00000116641	ENST00000454575	.	.	.	6.02	-1.68	0.08212	.	.	.	.	.	T	0.40619	0.1124	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31194	-0.9952	4	.	.	.	.	2.5829	0.04823	0.2974:0.2731:0.3351:0.0944	.	.	.	.	S	812	.	.	P	-	1	0	DOCK7	62733917	0.451000	0.25705	0.999000	0.59377	0.997000	0.91878	-0.218000	0.09240	0.137000	0.18759	0.650000	0.86243	CCA		0.333	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407		3	20	0	0	0	0.004672	0	3	20				
LRRC7	57554	broad.mit.edu	37	1	70489004	70489004	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:70489004C>T	ENST00000035383.5	+	15	1657	c.1627C>T	c.(1627-1629)Cca>Tca	p.P543S	RP11-181B18.1_ENST00000425754.1_RNA|LRRC7_ENST00000310961.5_Missense_Mutation_p.P548S|RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000415775.2_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	543						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CATGTGTACTCCATTGCCAGT	0.542																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(1627-1629)CCA>TCA		leucine rich repeat containing 7							133.0	125.0	127.0					1																	70489004		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70489004C>T		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1627C>T	1.37:g.70489004C>T	ENSP00000035383:p.Pro543Ser					LRRC7_uc009wbg.2_Intron	p.P543S	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN			15	1657	+			543					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.1627C>T	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000727	0.35320	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.34667	1.35;1.42	5.86	5.86	0.93980	.	0.618321	0.16447	N	0.214050	T	0.08758	0.0217	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11966	-1.0566	10	0.07813	T	0.8	.	15.6849	0.77402	0.0:1.0:0.0:0.0	.	543	Q96NW7	LRRC7_HUMAN	S	548;543;366	ENSP00000309245:P548S;ENSP00000035383:P543S	ENSP00000035383:P543S	P	+	1	0	LRRC7	70261592	0.999000	0.42202	1.000000	0.80357	0.880000	0.50808	3.522000	0.53480	2.775000	0.95449	0.585000	0.79938	CCA		0.542	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		21	75	0	0	0	0.014323	0	21	75				
LMO4	8543	broad.mit.edu	37	1	87805833	87805833	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:87805833T>C	ENST00000370544.5	+	4	1217	c.437T>C	c.(436-438)aTc>aCc	p.I146T	LMO4_ENST00000370542.1_Missense_Mutation_p.I146T|LMO4_ENST00000489303.1_3'UTR	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4	146	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		ACAGCTCTCATCAATGGCCAT	0.438																																							uc001dmi.2		NA																	0					0						c.(436-438)ATC>ACC		LIM domain only 4							148.0	139.0	142.0					1																	87805833		2203	4300	6503	SO:0001583	missense	8543				neural tube closure|transcription from RNA polymerase II promoter	transcription factor complex	sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	g.chr1:87805833T>C	U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.437T>C	1.37:g.87805833T>C	ENSP00000359575:p.Ile146Thr					LMO4_uc001dmj.2_Missense_Mutation_p.I146T	p.I146T	NM_006769	NP_006760	P61968	LMO4_HUMAN		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)	4	1217	+		Lung NSC(277;0.179)	146			LIM zinc-binding 2.		D3DT23|O00158|O88894	Missense_Mutation	SNP	ENST00000370544.5	37	c.437T>C	CCDS713.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.610625	0.46527	.	.	ENSG00000143013	ENST00000370544;ENST00000370542	T;T	0.46451	0.87;0.87	6.02	6.02	0.97574	Zinc finger, LIM-type (1);	0.000000	0.85682	D	0.000000	T	0.14313	0.0346	N	0.14661	0.345	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.09862	-1.0655	10	0.18710	T	0.47	.	16.5446	0.84426	0.0:0.0:0.0:1.0	.	146	P61968	LMO4_HUMAN	T	146	ENSP00000359575:I146T;ENSP00000359573:I146T	ENSP00000359573:I146T	I	+	2	0	LMO4	87578421	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.311000	0.77944	0.533000	0.62120	ATC		0.438	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028264.2	NM_006769		18	58	0	0	0	0.008871	0	18	58				
PRMT6	55170	broad.mit.edu	37	1	107600045	107600045	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:107600045C>G	ENST00000370078.1	+	1	745	c.708C>G	c.(706-708)atC>atG	p.I236M	PRMT6_ENST00000361318.5_Missense_Mutation_p.I177M			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	236	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		ACTCGGAGATCGTTGTGCAGG	0.672																																							uc010ous.1		NA																	0					0						c.(706-708)ATC>ATG		protein arginine methyltransferase 6							47.0	53.0	51.0					1																	107600045		2089	4211	6300	SO:0001583	missense	55170				base-excision repair|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone binding|histone methyltransferase activity (H2A-R3 specific)|histone methyltransferase activity (H3-R2 specific)|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity	g.chr1:107600045C>G	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.708C>G	1.37:g.107600045C>G	ENSP00000359095:p.Ile236Met						p.I236M	NM_018137	NP_060607	Q96LA8	ANM6_HUMAN		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)	1	779	+		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)	236					A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Missense_Mutation	SNP	ENST00000370078.1	37	c.708C>G	CCDS41360.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.67|12.67	2.007324|2.007324	0.35415|0.35415	.|.	.|.	ENSG00000198890|ENSG00000198890	ENST00000361318;ENST00000370078|ENST00000540389	T;T|.	0.25085|.	1.82;1.82|.	5.51|5.51	4.59|4.59	0.56863|0.56863	.|.	0.477138|.	0.21489|.	N|.	0.073704|.	T|T	0.44540|0.44540	0.1298|0.1298	L|L	0.44542|0.44542	1.39|1.39	0.39225|0.39225	D|D	0.963572|0.963572	B|.	0.27732|.	0.187|.	B|.	0.35607|.	0.206|.	T|T	0.53648|0.53648	-0.8409|-0.8409	10|6	0.56958|0.87932	D|D	0.05|0	-22.7758|-22.7758	7.8705|7.8705	0.29563|0.29563	0.0:0.7513:0.1624:0.0864|0.0:0.7513:0.1624:0.0864	.|.	236|.	Q96LA8|.	ANM6_HUMAN|.	M|G	177;236|130	ENSP00000355145:I177M;ENSP00000359095:I236M|.	ENSP00000355145:I177M|ENSP00000440829:R130G	I|R	+|+	3|1	3|0	PRMT6|PRMT6	107401568|107401568	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	1.448000|1.448000	0.35112|0.35112	1.316000|1.316000	0.45131|0.45131	0.442000|0.442000	0.29010|0.29010	ATC|CGT		0.672	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137		10	70	0	0	0	0.010729	0	10	70				
SLC6A17	388662	broad.mit.edu	37	1	110714814	110714814	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:110714814G>T	ENST00000331565.4	+	3	904	c.419G>T	c.(418-420)gGg>gTg	p.G140V	RP5-1028L10.1_ENST00000443008.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	140					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CCCCGCCTGGGGGGCATCGGC	0.632																																							uc009wfq.2		NA																	0				ovary(1)|pancreas(1)	2						c.(418-420)GGG>GTG		solute carrier family 6, member 17							26.0	23.0	24.0					1																	110714814		2202	4299	6501	SO:0001583	missense	388662				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity	g.chr1:110714814G>T		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.419G>T	1.37:g.110714814G>T	ENSP00000330199:p.Gly140Val						p.G140V	NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)	3	880	+		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	140			Cytoplasmic (Potential).		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	c.419G>T	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063218	0.93898	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.74632	-0.86	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.82157	0.4976	M	0.78223	2.4	0.80722	D	1	D	0.54601	0.967	P	0.58391	0.838	D	0.84239	0.0471	10	0.62326	D	0.03	.	18.6986	0.91611	0.0:0.0:1.0:0.0	.	140	Q9H1V8	S6A17_HUMAN	V	140	ENSP00000330199:G140V	ENSP00000330199:G140V	G	+	2	0	SLC6A17	110516337	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.869000	0.99810	2.404000	0.81709	0.585000	0.79938	GGG		0.632	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280		6	10	1	0	3.59834e-05	0.001168	3.96762e-05	6	10				
NBPF10	100132406	broad.mit.edu	37	1	145367750	145367750	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:145367750G>T	ENST00000342960.5	+	83	10381	c.10346G>T	c.(10345-10347)gGa>gTa	p.G3449V	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	750						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		aaaagaaggggaagaagatca	0.418																																							uc001end.3		NA																	0					0						c.(10570-10572)GGA>GTA		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145367750G>T	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10346G>T	1.37:g.145367750G>T	ENSP00000345684:p.Gly3449Val					NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	p.G3524V	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	85	10606	+	all_hematologic(923;0.032)		3449					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	c.10571G>T	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	5.223	0.226660	0.09916	.	.	ENSG00000163386	ENST00000369339;ENST00000448873;ENST00000342960	T	0.06933	3.24	.	.	.	.	.	.	.	.	T	0.01976	0.0062	L	0.27053	0.805	0.09310	N	1	.	.	.	.	.	.	T	0.47935	-0.9078	4	0.27785	T	0.31	.	.	.	.	.	.	.	.	V	569;763;3449	ENSP00000345684:G3449V	ENSP00000345684:G3449V	G	+	2	0	NBPF10	144079107	0.001000	0.12720	.	.	.	.	-1.002000	0.03686	.	.	.	.	GGA		0.418	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		10	47	1	0	1.76689e-08	0.006214	2.06659e-08	10	47				
NBPF14	25832	broad.mit.edu	37	1	148017573	148017573	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:148017573G>A	ENST00000369219.1	-	6	726	c.710C>T	c.(709-711)tCg>tTg	p.S237L				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	237	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					AGACTTGTACGAGGCCAACAT	0.478																																							uc001eqf.2		NA																	0					0						c.(1729-1731)TCG>TTG		hypothetical protein LOC55672							41.0	43.0	43.0					1																	148017573		1500	2697	4197	SO:0001583	missense	200030					cytoplasm		g.chr1:148017573G>A	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.710C>T	1.37:g.148017573G>A	ENSP00000358221:p.Ser237Leu					LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_RNA|NBPF14_uc001eqq.2_Missense_Mutation_p.S237L|NBPF14_uc001eqs.1_Missense_Mutation_p.S116L	p.S577L	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN			12	1765	-			577			NBPF 3.		Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	37	c.1730C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.457|6.457	0.452483|0.452483	0.12283|0.12283	.|.	.|.	ENSG00000122497|ENSG00000122497	ENST00000310701;ENST00000444640;ENST00000431121;ENST00000436356;ENST00000448574;ENST00000458135;ENST00000392972;ENST00000426874|ENST00000369219	.|T	.|0.15017	.|2.46	.|.	.|.	.|.	.|DUF1220 (2);	.|.	.|.	.|.	.|.	T|T	0.07458|0.07458	0.0188|0.0188	L|L	0.46885|0.46885	1.475|1.475	0.09310|0.09310	N|N	1|1	.|P;D	.|0.55385	.|0.796;0.971	.|B;P	.|0.50405	.|0.34;0.64	T|T	0.10823|0.10823	-1.0613|-1.0613	3|7	.|0.44086	.|T	.|0.13	.|.	.|.	.|.	.|.	.|.	.|237;502	.|Q5TI25;Q5VTG7	.|NBPFE_HUMAN;.	C|L	243;248;248;248;248;248;248;248|237	.|ENSP00000358221:S237L	.|ENSP00000358221:S237L	R|S	-|-	1|2	0|0	NBPF14|NBPF14	146484197|146484197	0.006000|0.006000	0.16342|0.16342	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	-1.709000|-1.709000	0.01890|0.01890	-0.709000|-0.709000	0.05008|0.05008	-0.713000|-0.713000	0.03633|0.03633	CGT|TCG		0.478	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383		25	459	0	0	0	0.01441	0	25	459				
FLG	2312	broad.mit.edu	37	1	152280700	152280700	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:152280700C>A	ENST00000368799.1	-	3	6697	c.6662G>T	c.(6661-6663)aGa>aTa	p.R2221I	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2221	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGTGAGTGTCTAGAGCTGTC	0.547									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(6661-6663)AGA>ATA		filaggrin							287.0	272.0	277.0					1																	152280700		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152280700C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6662G>T	1.37:g.152280700C>A	ENSP00000357789:p.Arg2221Ile						p.R2221I	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6698	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2221			Ser-rich.|Filaggrin 13.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.6662G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	c	4.698	0.129776	0.08981	.	.	ENSG00000143631	ENST00000368799	T	0.08193	3.12	1.82	-0.363	0.12556	.	.	.	.	.	T	0.05135	0.0137	M	0.81802	2.56	0.09310	N	1	P	0.52842	0.956	P	0.48840	0.592	T	0.19192	-1.0313	9	0.32370	T	0.25	.	2.0739	0.03619	0.3133:0.4811:0.0:0.2056	.	2221	P20930	FILA_HUMAN	I	2221	ENSP00000357789:R2221I	ENSP00000357789:R2221I	R	-	2	0	FLG	150547324	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.159000	0.16442	-0.071000	0.12886	0.430000	0.28490	AGA		0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		138	203	1	0	2.30743e-64	0.01441	3.37353e-64	138	203				
UBAP2L	9898	broad.mit.edu	37	1	154207096	154207096	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:154207096G>T	ENST00000361546.2	+	4	351	c.309G>T	c.(307-309)aaG>aaT	p.K103N	UBAP2L_ENST00000428931.1_Missense_Mutation_p.K103N|UBAP2L_ENST00000271877.7_Missense_Mutation_p.K103N|UBAP2L_ENST00000343815.6_Missense_Mutation_p.K103N			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	103					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGAAGAAGAAGGGAGTCTCAG	0.507																																							uc001fep.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(307-309)AAG>AAT		ubiquitin associated protein 2-like isoform a							79.0	74.0	75.0					1																	154207096		2203	4300	6503	SO:0001583	missense	9898				binding of sperm to zona pellucida		protein binding	g.chr1:154207096G>T	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.309G>T	1.37:g.154207096G>T	ENSP00000355343:p.Lys103Asn					UBAP2L_uc009wot.2_Missense_Mutation_p.K103N|UBAP2L_uc010pek.1_Missense_Mutation_p.K102N|UBAP2L_uc010pel.1_Missense_Mutation_p.K102N|UBAP2L_uc001fen.1_Missense_Mutation_p.K102N|UBAP2L_uc010pem.1_Missense_Mutation_p.K102N|UBAP2L_uc010pen.1_Missense_Mutation_p.K6N	p.K103N	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		5	476	+	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		103					B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	c.309G>T	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960945	0.74016	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000441890;ENST00000271877;ENST00000412596;ENST00000368504;ENST00000437652;ENST00000456325;ENST00000361546	T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.24	3.24	0.37175	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.37100	0.0991	M	0.69523	2.12	0.53688	D	0.999978	D;D;D;D;D	0.76494	0.991;0.999;0.99;0.99;0.983	P;D;P;P;P	0.83275	0.766;0.996;0.801;0.801;0.656	T	0.31052	-0.9957	10	0.87932	D	0	-7.8889	5.9808	0.19405	0.4967:0.0:0.5033:0.0	.	6;103;103;103;103	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	N	103	ENSP00000345308:K103N;ENSP00000389445:K103N;ENSP00000399920:K103N;ENSP00000271877:K103N;ENSP00000389052:K103N;ENSP00000357490:K103N;ENSP00000389717:K103N;ENSP00000415310:K103N;ENSP00000355343:K103N	ENSP00000271877:K103N	K	+	3	2	UBAP2L	152473720	0.996000	0.38824	1.000000	0.80357	0.999000	0.98932	0.412000	0.21131	0.644000	0.30656	0.650000	0.86243	AAG		0.507	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847		14	29	1	0	4.93089e-13	0.00245	6.17364e-13	14	29				
NES	10763	broad.mit.edu	37	1	156639370	156639370	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:156639370C>T	ENST00000368223.3	-	4	4742	c.4610G>A	c.(4609-4611)gGc>gAc	p.G1537D		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1537	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGACCCTGGCCATTAACACC	0.582																																							uc001fpq.2		NA																	0				ovary(6)	6						c.(4609-4611)GGC>GAC		nestin							101.0	85.0	90.0					1																	156639370		2203	4300	6503	SO:0001583	missense	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156639370C>T	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.4610G>A	1.37:g.156639370C>T	ENSP00000357206:p.Gly1537Asp						p.G1537D	NM_006617	NP_006608	P48681	NEST_HUMAN			4	4743	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		1537			Tail.		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	c.4610G>A	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886279	0.51908	.	.	ENSG00000132688	ENST00000368223	D	0.96992	-4.2	4.55	3.63	0.41609	.	.	.	.	.	D	0.90239	0.6948	L	0.59436	1.845	0.22330	N	0.999196	P	0.37955	0.612	B	0.30943	0.122	D	0.86572	0.1848	9	0.87932	D	0	.	9.6119	0.39668	0.0:0.8967:0.0:0.1033	.	1537	P48681	NEST_HUMAN	D	1537	ENSP00000357206:G1537D	ENSP00000357206:G1537D	G	-	2	0	NES	154905994	0.724000	0.28038	0.916000	0.36221	0.482000	0.33219	4.492000	0.60334	2.081000	0.62600	0.313000	0.20887	GGC		0.582	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		26	69	0	0	0	0.003954	0	26	69				
ARHGEF11	9826	broad.mit.edu	37	1	156910211	156910211	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:156910211C>T	ENST00000361409.2	-	35	4143	c.3401G>A	c.(3400-3402)gGg>gAg	p.G1134E	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.G1174E|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.G550E	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1134					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G1174V(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGCTGGGACCCAGTGCCTGT	0.602																																							uc001fqo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9						c.(3400-3402)GGG>GAG		Rho guanine nucleotide exchange factor (GEF) 11							56.0	51.0	52.0					1																	156910211		2203	4300	6503	SO:0001583	missense	9826				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:156910211C>T	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3401G>A	1.37:g.156910211C>T	ENSP00000354644:p.Gly1134Glu					ARHGEF11_uc010phu.1_Missense_Mutation_p.G550E|ARHGEF11_uc001fqn.2_Missense_Mutation_p.G1174E	p.G1134E	NM_014784	NP_055599	O15085	ARHGB_HUMAN			35	4441	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1134					D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	c.3401G>A	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	8.542	0.873482	0.17322	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.67698	-0.28;-0.28;-0.2	4.16	3.25	0.37280	.	0.141964	0.32548	N	0.005947	T	0.49150	0.1540	L	0.32530	0.975	0.09310	N	1	D;D;D	0.63880	0.993;0.989;0.993	P;P;P	0.59889	0.854;0.719;0.865	T	0.41215	-0.9521	10	0.18710	T	0.47	-10.2255	9.3278	0.38003	0.0:0.8968:0.0:0.1032	.	550;1134;1174	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	E	1174;1134;550	ENSP00000357177:G1174E;ENSP00000354644:G1134E;ENSP00000313470:G550E	ENSP00000313470:G550E	G	-	2	0	ARHGEF11	155176835	0.001000	0.12720	0.046000	0.18839	0.151000	0.21798	0.049000	0.14099	0.952000	0.37798	-0.291000	0.09656	GGG		0.602	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236		8	53	0	0	0	0.004482	0	8	53				
OR10Z1	128368	broad.mit.edu	37	1	158576407	158576407	+	Missense_Mutation	SNP	A	A	T	rs201009930		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:158576407A>T	ENST00000361284.1	+	1	179	c.179A>T	c.(178-180)tAc>tTc	p.Y60F		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					ACCCCCATGTACCTCTTCCTT	0.517																																							uc010pio.1		NA																	0				pancreas(1)|skin(1)	2						c.(178-180)TAC>TTC		olfactory receptor, family 10, subfamily Z,							254.0	246.0	248.0					1																	158576407		2203	4300	6503	SO:0001583	missense	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158576407A>T	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.179A>T	1.37:g.158576407A>T	ENSP00000354707:p.Tyr60Phe						p.Y60F	NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN			1	179	+	all_hematologic(112;0.0378)		60			Helical; Name=2; (Potential).		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	ENST00000361284.1	37	c.179A>T	CCDS30901.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.185196	0.78677	.	.	ENSG00000198967	ENST00000361284	T	0.14391	2.51	5.36	5.36	0.76844	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37393	N	0.002103	T	0.36908	0.0984	M	0.90425	3.115	0.45216	D	0.998225	D	0.89917	1.0	D	0.87578	0.998	T	0.46569	-0.9182	10	0.87932	D	0	.	14.4836	0.67599	1.0:0.0:0.0:0.0	.	60	Q8NGY1	O10Z1_HUMAN	F	60	ENSP00000354707:Y60F	ENSP00000354707:Y60F	Y	+	2	0	OR10Z1	156843031	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	5.008000	0.63991	2.246000	0.74042	0.533000	0.62120	TAC		0.517	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		45	195	0	0	0	0.01441	0	45	195				
SPTA1	6708	broad.mit.edu	37	1	158613152	158613152	+	Nonsense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:158613152T>A	ENST00000368147.4	-	31	4582	c.4402A>T	c.(4402-4404)Aaa>Taa	p.K1468*		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1468					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ATCTCTTCTTTGGCATAGTGT	0.443																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4402-4404)AAA>TAA		spectrin, alpha, erythrocytic 1							139.0	137.0	137.0					1																	158613152		1941	4146	6087	SO:0001587	stop_gained	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158613152T>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4402A>T	1.37:g.158613152T>A	ENSP00000357129:p.Lys1468*						p.K1468*	NM_003126	NP_003117	P02549	SPTA1_HUMAN			31	4601	-	all_hematologic(112;0.0378)		1468			Spectrin 14.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Nonsense_Mutation	SNP	ENST00000368147.4	37	c.4402A>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	45	11.891249	0.99614	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.22	1.56	0.23342	.	0.244121	0.21324	N	0.076418	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	6.8809	0.24173	0.0:0.0757:0.2873:0.637	.	.	.	.	X	1468	.	ENSP00000357129:K1468X	K	-	1	0	SPTA1	156879776	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	2.937000	0.48979	0.102000	0.17638	0.533000	0.62120	AAA		0.443	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		20	36	0	0	0	0.012319	0	20	36				
SPTA1	6708	broad.mit.edu	37	1	158646039	158646039	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:158646039G>T	ENST00000368147.4	-	8	1184	c.1004C>A	c.(1003-1005)cCt>cAt	p.P335H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	335					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGCATCTGAAGGATGGGAAAG	0.483																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(1003-1005)CCT>CAT		spectrin, alpha, erythrocytic 1							220.0	206.0	211.0					1																	158646039		1922	4142	6064	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158646039G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1004C>A	1.37:g.158646039G>T	ENSP00000357129:p.Pro335His						p.P335H	NM_003126	NP_003117	P02549	SPTA1_HUMAN			8	1203	-	all_hematologic(112;0.0378)		335			Spectrin 4.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.1004C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262516	0.80358	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34859	1.34;1.34	5.24	5.24	0.73138	.	0.272209	0.19787	N	0.106061	T	0.42131	0.1189	L	0.41824	1.3	0.45914	D	0.99875	D	0.71674	0.998	D	0.70935	0.971	T	0.06058	-1.0848	10	0.33141	T	0.24	.	17.5758	0.87949	0.0:0.0:1.0:0.0	.	335	P02549	SPTA1_HUMAN	H	335	ENSP00000357130:P335H;ENSP00000357129:P335H	ENSP00000357129:P335H	P	-	2	0	SPTA1	156912663	1.000000	0.71417	0.661000	0.29709	0.942000	0.58702	8.383000	0.90157	2.706000	0.92434	0.655000	0.94253	CCT		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		42	82	1	0	3.4345e-17	0.011902	4.59924e-17	42	82				
OR6K6	128371	broad.mit.edu	37	1	158725561	158725561	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:158725561T>A	ENST00000368144.2	+	1	1052	c.956T>A	c.(955-957)cTg>cAg	p.L319Q		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	319						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					ATCTATAGCCTGAAAAACAAG	0.433																																							uc001fsw.1		NA																	0				skin(1)	1						c.(955-957)CTG>CAG		olfactory receptor, family 6, subfamily K,							124.0	125.0	124.0					1																	158725561		2203	4300	6503	SO:0001583	missense	128371				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158725561T>A	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.956T>A	1.37:g.158725561T>A	ENSP00000357126:p.Leu319Gln						p.L319Q	NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN			1	956	+	all_hematologic(112;0.0378)		319			Helical; Name=7; (Potential).		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	c.956T>A	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.969918	0.74246	.	.	ENSG00000180433	ENST00000368144	T	0.49720	0.77	5.26	5.26	0.73747	.	0.000000	0.32386	N	0.006178	T	0.68375	0.2994	M	0.89840	3.065	0.39712	D	0.971345	D	0.89917	1.0	D	0.79108	0.992	T	0.76906	-0.2786	10	0.87932	D	0	-9.3594	14.2771	0.66187	0.0:0.0:0.0:1.0	.	319	Q8NGW6	OR6K6_HUMAN	Q	319	ENSP00000357126:L319Q	ENSP00000357126:L319Q	L	+	2	0	OR6K6	156992185	0.973000	0.33851	1.000000	0.80357	0.970000	0.65996	7.712000	0.84684	2.205000	0.71048	0.533000	0.62120	CTG		0.433	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184		17	65	0	0	0	0.006122	0	17	65				
PYHIN1	149628	broad.mit.edu	37	1	158911901	158911901	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:158911901G>A	ENST00000368140.1	+	5	959	c.714G>A	c.(712-714)atG>atA	p.M238I	PYHIN1_ENST00000392254.2_Missense_Mutation_p.M238I|PYHIN1_ENST00000392252.3_Missense_Mutation_p.M229I|PYHIN1_ENST00000368138.3_Missense_Mutation_p.M229I|PYHIN1_ENST00000485134.1_3'UTR	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	238	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AAAGAAGAATGTTTCATGCTA	0.328																																							uc001ftb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(712-714)ATG>ATA		pyrin and HIN domain family, member 1 alpha 1							69.0	72.0	71.0					1																	158911901		2203	4300	6503	SO:0001583	missense	149628				cell cycle	nuclear speck		g.chr1:158911901G>A	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.714G>A	1.37:g.158911901G>A	ENSP00000357122:p.Met238Ile					PYHIN1_uc001ftc.2_Missense_Mutation_p.M229I|PYHIN1_uc001ftd.2_Missense_Mutation_p.M238I|PYHIN1_uc001fte.2_Missense_Mutation_p.M229I	p.M238I	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN			5	959	+	all_hematologic(112;0.0378)		238			HIN-200.		Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	c.714G>A	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408744	0.62399	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	2.85	2.85	0.33270	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.28300	0.0699	M	0.64404	1.975	0.80722	D	1	D;P;D;D	0.76494	0.994;0.888;0.994;0.999	D;P;D;D	0.71870	0.923;0.686;0.923;0.975	T	0.04781	-1.0927	9	0.87932	D	0	.	9.2705	0.37668	0.0:0.0:1.0:0.0	.	229;238;229;238	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	I	238;229;238;229	ENSP00000357122:M238I;ENSP00000357120:M229I;ENSP00000376083:M238I;ENSP00000376082:M229I	ENSP00000357120:M229I	M	+	3	0	PYHIN1	157178525	1.000000	0.71417	0.905000	0.35620	0.407000	0.30961	0.964000	0.29306	1.577000	0.49804	0.655000	0.94253	ATG		0.328	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		14	21	0	0	0	0.003163	0	14	21				
IFI16	3428	broad.mit.edu	37	1	158986358	158986358	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:158986358C>A	ENST00000295809.7	+	4	672	c.417C>A	c.(415-417)ccC>ccA	p.P139P	IFI16_ENST00000368131.4_Silent_p.P139P|IFI16_ENST00000359709.3_Intron|IFI16_ENST00000430894.2_Intron|IFI16_ENST00000368132.3_Silent_p.P139P|IFI16_ENST00000448393.2_Silent_p.P139P|IFI16_ENST00000340979.6_Silent_p.P139P			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	139	Lys-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					AGGCTGGACCCAAAGGGAGTA	0.478																																							uc001ftf.1		NA																	0				ovary(1)	1						c.(415-417)CCC>CCA		interferon, gamma-inducible protein 16							70.0	68.0	69.0					1																	158986358		2203	4300	6503	SO:0001819	synonymous_variant	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:158986358C>A	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.417C>A	1.37:g.158986358C>A						IFI16_uc001ftg.2_Silent_p.P139P|IFI16_uc010pis.1_Intron	p.P139P	NM_005531	NP_005522	Q16666	IF16_HUMAN			5	1024	+	all_hematologic(112;0.0429)		139			Lys-rich.		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Silent	SNP	ENST00000295809.7	37	c.417C>A																																																																																					0.478	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		18	27	1	0	6.94344e-10	0.006122	8.35383e-10	18	27				
LAMC1	3915	broad.mit.edu	37	1	183090875	183090875	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:183090875G>C	ENST00000258341.4	+	12	2265	c.2008G>C	c.(2008-2010)Gat>Cat	p.D670H		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	670	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						ATATTTGGATGATGTCACCCT	0.473																																							uc001gpy.3		NA																	0				ovary(3)|large_intestine(1)|kidney(1)	5						c.(2008-2010)GAT>CAT		laminin, gamma 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						117.0	105.0	110.0					1																	183090875		2203	4300	6503	SO:0001583	missense	3915				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent	g.chr1:183090875G>C	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2008G>C	1.37:g.183090875G>C	ENSP00000258341:p.Asp670His						p.D670H	NM_002293	NP_002284	P11047	LAMC1_HUMAN			12	2265	+			670			Laminin IV type A.		Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	c.2008G>C	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013343	0.75161	.	.	ENSG00000135862	ENST00000258341	T	0.45276	0.9	5.13	5.13	0.70059	Laminin B type IV (2);Laminin B, subgroup (1);	0.097095	0.64402	D	0.000001	T	0.64294	0.2585	M	0.73217	2.22	0.80722	D	1	D	0.60160	0.987	D	0.66351	0.943	T	0.68153	-0.5484	10	0.72032	D	0.01	.	18.665	0.91486	0.0:0.0:1.0:0.0	.	670	P11047	LAMC1_HUMAN	H	670	ENSP00000258341:D670H	ENSP00000258341:D670H	D	+	1	0	LAMC1	181357498	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.515000	0.67049	2.398000	0.81561	0.650000	0.86243	GAT		0.473	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293		3	29	0	0	0	0.009096	0	3	29				
TPR	7175	broad.mit.edu	37	1	186344044	186344044	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:186344044C>T	ENST00000367478.4	-	1	413	c.117G>A	c.(115-117)ctG>ctA	p.L39L	C1orf27_ENST00000287859.6_5'Flank|C1orf27_ENST00000367470.3_5'Flank|TPR_ENST00000474852.1_5'UTR|C1orf27_ENST00000419367.3_5'Flank	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	39	Necessary for interaction with HSF1.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCCGCCCCTTCAGGCCATCGA	0.537			T	NTRK1	papillary thyroid																																		uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		0				ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(115-117)CTG>CTA		nuclear pore complex-associated protein TPR							112.0	124.0	120.0					1																	186344044		1918	4131	6049	SO:0001819	synonymous_variant	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186344044C>T	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.117G>A	1.37:g.186344044C>T						C1orf27_uc001grw.2_5'Flank|C1orf27_uc010poq.1_5'Flank|C1orf27_uc010por.1_5'Flank|TPR_uc010pop.1_Silent_p.L115L	p.L39L	NM_003292	NP_003283	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	1	414	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	39			Potential.		Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	37	c.117G>A	CCDS41446.1																																																																																				0.537	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		34	39	0	0	0	0.003755	0	34	39				
CFH	3075	broad.mit.edu	37	1	196712628	196712628	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:196712628G>T	ENST00000367429.4	+	20	3420	c.3180G>T	c.(3178-3180)gtG>gtT	p.V1060V		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1060	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CTTATATAGTGTCGAGACAGA	0.388																																							uc001gtj.3		NA																	0				skin(4)|ovary(1)|breast(1)	6						c.(3178-3180)GTG>GTT		complement factor H isoform a precursor							197.0	185.0	189.0					1																	196712628		2203	4300	6503	SO:0001819	synonymous_variant	3075				complement activation, alternative pathway	extracellular space		g.chr1:196712628G>T	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3180G>T	1.37:g.196712628G>T							p.V1060V	NM_000186	NP_000177	P08603	CFAH_HUMAN			20	3420	+			1060			Sushi 18.		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000367429.4	37	c.3180G>T	CCDS1385.1																																																																																				0.388	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186		29	28	1	0	3.99451e-17	0.009535	5.33371e-17	29	28				
F13B	2165	broad.mit.edu	37	1	197021789	197021789	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:197021789C>T	ENST00000367412.1	-	9	1573	c.1530G>A	c.(1528-1530)gtG>gtA	p.V510V	F13B_ENST00000490002.1_5'Flank	NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	510	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						AAGGATATTTCACTTCTCCTC	0.323																																							uc001gtt.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1528-1530)GTG>GTA		coagulation factor XIII B subunit precursor							79.0	80.0	80.0					1																	197021789		2203	4295	6498	SO:0001819	synonymous_variant	2165				blood coagulation	extracellular region		g.chr1:197021789C>T	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1530G>A	1.37:g.197021789C>T							p.V510V	NM_001994	NP_001985	P05160	F13B_HUMAN			9	1574	-			510			Sushi 8.		A8K3E5|Q5VYL5	Silent	SNP	ENST00000367412.1	37	c.1530G>A	CCDS1388.1																																																																																				0.323	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		5	44	0	0	0	0.000602	0	5	44				
ASPM	259266	broad.mit.edu	37	1	197074087	197074087	+	Silent	SNP	T	T	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:197074087T>G	ENST00000367409.4	-	18	4550	c.4294A>C	c.(4294-4296)Aga>Cga	p.R1432R	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1432					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTCCATTTTCTGAACATAGAT	0.313																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(4294-4296)AGA>CGA		asp (abnormal spindle)-like, microcephaly							121.0	111.0	114.0					1																	197074087		2202	4299	6501	SO:0001819	synonymous_variant	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197074087T>G	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.4294A>C	1.37:g.197074087T>G						ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	p.R1432R	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			18	4551	-			1432					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	37	c.4294A>C	CCDS1389.1																																																																																				0.313	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		9	48	0	0	0	0.004482	0	9	48				
IPO9	55705	broad.mit.edu	37	1	201839778	201839778	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:201839778A>G	ENST00000361565.4	+	18	2270	c.2201A>G	c.(2200-2202)gAg>gGg	p.E734G		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	734					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TGGCATGATGAGCAGGGCCAC	0.582																																							uc001gwz.2		NA																	0				ovary(2)	2						c.(2200-2202)GAG>GGG		importin 9							95.0	78.0	84.0					1																	201839778		2203	4300	6503	SO:0001583	missense	55705				protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity	g.chr1:201839778A>G	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2201A>G	1.37:g.201839778A>G	ENSP00000354742:p.Glu734Gly						p.E734G	NM_018085	NP_060555	Q96P70	IPO9_HUMAN			18	2251	+			734					B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	37	c.2201A>G	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	A	9.232	1.036113	0.19590	.	.	ENSG00000198700	ENST00000361565	.	.	.	5.59	5.59	0.84812	Armadillo-like helical (1);Armadillo-type fold (1);	0.045675	0.85682	D	0.000000	T	0.39009	0.1062	N	0.12746	0.255	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22800	-1.0206	9	0.23302	T	0.38	-2.9273	13.723	0.62740	1.0:0.0:0.0:0.0	.	734	Q96P70	IPO9_HUMAN	G	734	.	ENSP00000354742:E734G	E	+	2	0	IPO9	200106401	1.000000	0.71417	0.976000	0.42696	0.994000	0.84299	8.831000	0.92068	2.124000	0.65301	0.482000	0.46254	GAG		0.582	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085		15	51	0	0	0	0.00245	0	15	51				
LGR6	59352	broad.mit.edu	37	1	202287145	202287145	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:202287145G>A	ENST00000367278.3	+	18	1803	c.1714G>A	c.(1714-1716)Gtg>Atg	p.V572M	LGR6_ENST00000255432.7_Missense_Mutation_p.V520M|LGR6_ENST00000439764.2_Missense_Mutation_p.V433M	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	572					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						GTGGGCCATCGTGTTGCTCTC	0.612																																							uc001gxu.2		NA																	0				large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(1714-1716)GTG>ATG		leucine-rich repeat-containing G protein-coupled							117.0	107.0	111.0					1																	202287145		2203	4300	6503	SO:0001583	missense	59352					integral to membrane|plasma membrane	protein-hormone receptor activity	g.chr1:202287145G>A	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.1714G>A	1.37:g.202287145G>A	ENSP00000356247:p.Val572Met					LGR6_uc001gxv.2_Missense_Mutation_p.V520M|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Missense_Mutation_p.V433M	p.V572M	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN			18	1714	+			572			Helical; Name=1; (Potential).		Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	37	c.1714G>A	CCDS30971.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699057	0.68501	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	D;D;D	0.88277	-2.36;-2.36;-2.36	5.64	5.64	0.86602	.	0.190539	0.47455	D	0.000224	D	0.91109	0.7201	M	0.61703	1.905	0.39470	D	0.967702	D;D;D	0.67145	0.996;0.988;0.991	P;P;P	0.54706	0.759;0.616;0.514	D	0.91509	0.5225	10	0.51188	T	0.08	.	13.9833	0.64317	0.0727:0.0:0.9273:0.0	.	433;520;572	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	M	572;520;433	ENSP00000356247:V572M;ENSP00000255432:V520M;ENSP00000387869:V433M	ENSP00000255432:V520M	V	+	1	0	LGR6	200553768	0.983000	0.35010	0.994000	0.49952	0.988000	0.76386	3.579000	0.53900	2.681000	0.91329	0.485000	0.47835	GTG		0.612	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636		18	73	0	0	0	0.00499	0	18	73				
CENPF	1063	broad.mit.edu	37	1	214818194	214818194	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:214818194G>C	ENST00000366955.3	+	13	5449	c.5281G>C	c.(5281-5283)Gat>Cat	p.D1761H		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1857					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGTACCTATGGATTTCCTGGG	0.408																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	0				ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(5281-5283)GAT>CAT		centromere protein F							45.0	47.0	46.0					1																	214818194		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214818194G>C	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5281G>C	1.37:g.214818194G>C	ENSP00000355922:p.Asp1761His						p.D1761H	NM_016343	NP_057427	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	13	5455	+			1857					Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.5281G>C	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	9.286	1.049296	0.19827	.	.	ENSG00000117724	ENST00000366955	T	0.06142	3.34	5.56	3.7	0.42460	.	0.188685	0.26052	N	0.026639	T	0.15782	0.0380	M	0.73598	2.24	0.21933	N	0.99946	D	0.65815	0.995	P	0.57371	0.819	T	0.08911	-1.0699	10	0.66056	D	0.02	.	5.3318	0.15936	0.2234:0.0:0.6342:0.1424	.	1857	P49454	CENPF_HUMAN	H	1761	ENSP00000355922:D1761H	ENSP00000355922:D1761H	D	+	1	0	CENPF	212884817	0.990000	0.36364	0.038000	0.18304	0.029000	0.11900	2.077000	0.41557	0.726000	0.32339	0.609000	0.83330	GAT		0.408	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		13	39	0	0	0	0.00245	0	13	39				
ZNF678	339500	broad.mit.edu	37	1	227843036	227843036	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:227843036C>G	ENST00000343776.5	+	4	1430	c.1085C>G	c.(1084-1086)tCa>tGa	p.S362*	ZNF678_ENST00000397097.3_Nonsense_Mutation_p.S417*|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				ACTCAATTCTCAAACCTCACT	0.383																																							uc001hqw.1		NA																	0				pancreas(1)	1						c.(1084-1086)TCA>TGA		zinc finger protein 678							34.0	38.0	37.0					1																	227843036		2193	4296	6489	SO:0001587	stop_gained	339500				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr1:227843036C>G	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1085C>G	1.37:g.227843036C>G	ENSP00000344828:p.Ser362*					ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	p.S362*	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN			4	1430	+		Prostate(94;0.0885)	417					Q8IVQ9	Nonsense_Mutation	SNP	ENST00000343776.5	37	c.1085C>G		.	.	.	.	.	.	.	.	.	.	C	12.68	2.011241	0.35511	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	.	.	.	1.22	1.22	0.21188	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.2644	0.31804	0.0:1.0:0.0:0.0	.	.	.	.	X	362;417	.	ENSP00000344828:S362X	S	+	2	0	ZNF678	225909659	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.084000	0.14891	0.508000	0.28173	0.511000	0.50034	TCA		0.383	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549		5	37	0	0	0	0.000602	0	5	37				
WNT9A	7483	broad.mit.edu	37	1	228112026	228112026	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:228112026G>T	ENST00000272164.5	-	3	438	c.428C>A	c.(427-429)gCg>gAg	p.A143E		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	143					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				CATGCGGCCCGCGCTGCACGC	0.652																																							uc001hri.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(427-429)GCG>GAG		wingless-type MMTV integration site family,							73.0	73.0	73.0					1																	228112026		2203	4299	6502	SO:0001583	missense	7483				anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|cornea development in camera-type eye|embryonic arm morphogenesis|embryonic skeletal joint morphogenesis|endoderm development|iris morphogenesis|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|neuron differentiation|positive regulation of smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding|signal transducer activity	g.chr1:228112026G>T	AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.428C>A	1.37:g.228112026G>T	ENSP00000272164:p.Ala143Glu						p.A143E	NM_003395	NP_003386	O14904	WNT9A_HUMAN			3	516	-		Prostate(94;0.0405)	143					A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Missense_Mutation	SNP	ENST00000272164.5	37	c.428C>A	CCDS31045.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579798	0.46006	.	.	ENSG00000143816	ENST00000272164	T	0.74526	-0.85	4.89	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	N	0.16368	0.405	0.51233	D	0.999914	P	0.37781	0.608	P	0.45998	0.5	T	0.57740	-0.7759	10	0.02654	T	1	.	8.2292	0.31589	0.0841:0.1568:0.7592:0.0	.	143	O14904	WNT9A_HUMAN	E	143	ENSP00000272164:A143E	ENSP00000272164:A143E	A	-	2	0	WNT9A	226178649	1.000000	0.71417	0.098000	0.21074	0.902000	0.53008	4.567000	0.60850	1.067000	0.40740	0.491000	0.48974	GCG		0.652	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091646.1	NM_003395		30	67	1	0	7.38237e-10	0.00632	8.85884e-10	30	67				
SIPA1L2	57568	broad.mit.edu	37	1	232601073	232601074	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:232601073_232601074TC>AA	ENST00000366630.1	-	8	2690_2691	c.2332_2333GA>TT	c.(2332-2334)GAc>TTc	p.D778F	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.D778F|SIPA1L2_ENST00000308942.4_5'Flank			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	778	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TAAAAGGAAGTCCCGGAACACG	0.45																																							uc001hvg.2		NA																	0				ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(2332-2334)GAC>TTC		signal-induced proliferation-associated 1 like																																				SO:0001583	missense	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232601073_232601074TC>AA	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2332_2333delinsAA	1.37:g.232601073_232601074delinsAA	ENSP00000355589:p.Asp778Phe					SIPA1L2_uc001hvf.2_5'Flank	p.D778F	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN			7	2490_2491	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	778			Rap-GAP.		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	DNP	ENST00000366630.1	37	c.2332_2333GA>TT	CCDS41474.1																																																																																				0.450	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		16	94	0	0	0	0.004672	0	16	94				
PCNXL2	80003	broad.mit.edu	37	1	233394715	233394715	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:233394715C>T	ENST00000258229.9	-	5	1127	c.893G>A	c.(892-894)cGg>cAg	p.R298Q	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	298						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GCTTTGTACCCGTTCCCTTAT	0.552																																							uc001hvl.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(892-894)CGG>CAG		pecanex-like 2							70.0	72.0	71.0					1																	233394715		2021	4179	6200	SO:0001583	missense	80003					integral to membrane		g.chr1:233394715C>T	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.893G>A	1.37:g.233394715C>T	ENSP00000258229:p.Arg298Gln					PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	p.R298Q	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN			5	1128	-		all_cancers(173;0.0347)|Prostate(94;0.137)	298					O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	c.893G>A	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	0.562	-0.844852	0.02671	.	.	ENSG00000135749	ENST00000258229	T	0.62364	0.03	4.34	0.294	0.15747	.	.	.	.	.	T	0.27241	0.0668	N	0.01576	-0.805	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.24977	-1.0145	9	0.06757	T	0.87	.	8.4137	0.32659	0.0:0.3584:0.0:0.6416	.	298	A6NKB5	PCX2_HUMAN	Q	298	ENSP00000258229:R298Q	ENSP00000258229:R298Q	R	-	2	0	PCNXL2	231461338	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.634000	0.05477	-0.001000	0.14495	-0.474000	0.04947	CGG		0.552	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		7	83	0	0	0	0.001984	0	7	83				
ARID4B	51742	broad.mit.edu	37	1	235359370	235359370	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:235359370C>A	ENST00000264183.3	-	18	2399	c.1902G>T	c.(1900-1902)aaG>aaT	p.K634N	ARID4B_ENST00000366603.2_Missense_Mutation_p.K634N|ARID4B_ENST00000349213.3_Missense_Mutation_p.K548N	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	634					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			GATGTTTTATCTTTGGCACAT	0.269																																							uc001hwq.2		NA																	0				ovary(2)|lung(1)	3						c.(1900-1902)AAG>AAT		AT rich interactive domain 4B isoform 1							127.0	122.0	124.0					1																	235359370		2200	4300	6500	SO:0001583	missense	51742				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding	g.chr1:235359370C>A	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.1902G>T	1.37:g.235359370C>A	ENSP00000264183:p.Lys634Asn					ARID4B_uc001hwr.2_Missense_Mutation_p.K548N|ARID4B_uc001hws.3_Missense_Mutation_p.K548N|ARID4B_uc001hwp.2_5'Flank|ARID4B_uc001hwt.3_Missense_Mutation_p.K315N	p.K634N	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)		18	2400	-	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	634					A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	c.1902G>T	CCDS31061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.45|19.45	3.829536|3.829536	0.71258|0.71258	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183;ENST00000439834|ENST00000444620	T;T;T|.	0.46451|.	0.87;0.87;0.87|.	5.45|5.45	1.82|1.82	0.25136|0.25136	Chromo domain-like (1);Chromo domain/shadow (1);|.	0.101452|.	0.64402|.	D|.	0.000003|.	T|T	0.49355|0.49355	0.1552|0.1552	L|L	0.36672|0.36672	1.1|1.1	0.49051|0.49051	D|D	0.999745|0.999745	D;P;P;P|.	0.55605|.	0.972;0.873;0.952;0.799|.	P;B;B;B|.	0.49752|.	0.621;0.385;0.385;0.162|.	T|T	0.25328|0.25328	-1.0135|-1.0135	10|5	0.87932|.	D|.	0|.	-19.0984|-19.0984	7.8247|7.8247	0.29307|0.29307	0.0:0.2401:0.0:0.7599|0.0:0.2401:0.0:0.7599	.|.	315;634;548;634|.	Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39|.	.;.;.;ARI4B_HUMAN|.	N|I	634;548;634;634;634|34	ENSP00000264184:K548N;ENSP00000355562:K634N;ENSP00000264183:K634N|.	ENSP00000264183:K634N|.	K|R	-|-	3|2	2|0	ARID4B|ARID4B	233425993|233425993	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.534000|3.534000	0.53568|0.53568	0.147000|0.147000	0.19030|0.19030	0.585000|0.585000	0.79938|0.79938	AAG|AGA		0.269	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374		4	18	1	0	0.00909568	0.009096	0.00942198	4	18				
RYR2	6262	broad.mit.edu	37	1	237756921	237756921	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:237756921G>T	ENST00000366574.2	+	33	4738	c.4421G>T	c.(4420-4422)gGa>gTa	p.G1474V	RYR2_ENST00000542537.1_Missense_Mutation_p.G1458V|RYR2_ENST00000360064.6_Missense_Mutation_p.G1472V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1474	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GATGAAAAAGGAAAAGTGCAT	0.383																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(4420-4422)GGA>GTA		cardiac muscle ryanodine receptor							70.0	64.0	66.0					1																	237756921		1868	4103	5971	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237756921G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4421G>T	1.37:g.237756921G>T	ENSP00000355533:p.Gly1474Val						p.G1474V	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		33	4541	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1474			Cytoplasmic (By similarity).|B30.2/SPRY 3.|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.4421G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302171	0.81136	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.64260	-0.09;-0.09;-0.09	4.9	4.9	0.64082	SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000009	T	0.77003	0.4067	M	0.65498	2.005	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	T	0.78745	-0.2084	10	0.56958	D	0.05	.	18.2798	0.90096	0.0:0.0:1.0:0.0	.	1474	Q92736	RYR2_HUMAN	V	1474;1472;1458	ENSP00000355533:G1474V;ENSP00000353174:G1472V;ENSP00000443798:G1458V	ENSP00000353174:G1472V	G	+	2	0	RYR2	235823544	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.652000	0.98499	2.517000	0.84864	0.650000	0.86243	GGA		0.383	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		11	38	1	0	3.07112e-06	0.010729	3.47759e-06	11	38				
RYR2	6262	broad.mit.edu	37	1	237774159	237774159	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:237774159T>G	ENST00000366574.2	+	36	5098	c.4781T>G	c.(4780-4782)gTc>gGc	p.V1594G	RYR2_ENST00000542537.1_Missense_Mutation_p.V1578G|RYR2_ENST00000360064.6_Missense_Mutation_p.V1592G	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1594	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGTCACACGTCCTGTGGAGC	0.547																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(4780-4782)GTC>GGC		cardiac muscle ryanodine receptor							64.0	63.0	64.0					1																	237774159		1967	4144	6111	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237774159T>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4781T>G	1.37:g.237774159T>G	ENSP00000355533:p.Val1594Gly						p.V1594G	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		36	4901	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1594			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.4781T>G	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.368080	0.42003	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97016	-4.21;-4.18;-4.2	5.24	5.24	0.73138	.	0.100135	0.38217	N	0.001763	D	0.96156	0.8747	M	0.71581	2.175	0.80722	D	1	D	0.60575	0.988	P	0.48840	0.592	D	0.95393	0.8483	10	0.35671	T	0.21	.	15.3062	0.73992	0.0:0.0:0.0:1.0	.	1594	Q92736	RYR2_HUMAN	G	1594;1592;1578	ENSP00000355533:V1594G;ENSP00000353174:V1592G;ENSP00000443798:V1578G	ENSP00000353174:V1592G	V	+	2	0	RYR2	235840782	1.000000	0.71417	0.672000	0.29872	0.897000	0.52465	6.015000	0.70791	2.192000	0.70111	0.533000	0.62120	GTC		0.547	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		4	19	0	0	0	0.000602	0	4	19				
ZP4	57829	broad.mit.edu	37	1	238050811	238050811	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:238050811T>C	ENST00000366570.4	-	5	762	c.604A>G	c.(604-606)Aac>Gac	p.N202D	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	202	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GAGGTCACGTTCCGAGACACA	0.527																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	0				ovary(2)|skin(1)	3						c.(604-606)AAC>GAC		zona pellucida glycoprotein 4 preproprotein							142.0	125.0	131.0					1																	238050811		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238050811T>C	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.604A>G	1.37:g.238050811T>C	ENSP00000355529:p.Asn202Asp					LOC100130331_uc010pyc.1_Intron	p.N202D	NM_021186	NP_067009	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		5	604	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	202			ZP.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.604A>G	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	T	5.179	0.218632	0.09810	.	.	ENSG00000116996	ENST00000366570	T	0.79554	-1.28	4.86	1.18	0.20946	Zona pellucida sperm-binding protein (3);	0.185021	0.46145	N	0.000314	T	0.54062	0.1835	N	0.16016	0.355	0.20873	N	0.999837	B	0.06786	0.001	B	0.13407	0.009	T	0.39761	-0.9598	10	0.02654	T	1	-10.6138	3.3685	0.07212	0.167:0.2809:0.0:0.5521	.	202	Q12836	ZP4_HUMAN	D	202	ENSP00000355529:N202D	ENSP00000355529:N202D	N	-	1	0	ZP4	236117434	0.493000	0.26035	0.774000	0.31636	0.621000	0.37620	1.196000	0.32198	0.280000	0.22209	0.533000	0.62120	AAC		0.527	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			43	74	0	0	0	0.01441	0	43	74				
ZP4	57829	broad.mit.edu	37	1	238051760	238051760	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:238051760T>C	ENST00000366570.4	-	4	609	c.451A>G	c.(451-453)Aga>Gga	p.R151G	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	151	P-type. {ECO:0000255|PROSITE- ProRule:PRU00779}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CATGGCAGTCTGTCCCGTGCT	0.478																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	0				ovary(2)|skin(1)	3						c.(451-453)AGA>GGA		zona pellucida glycoprotein 4 preproprotein							128.0	117.0	121.0					1																	238051760		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238051760T>C	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.451A>G	1.37:g.238051760T>C	ENSP00000355529:p.Arg151Gly					LOC100130331_uc010pyc.1_Intron	p.R151G	NM_021186	NP_067009	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		4	451	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	151			P-type.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.451A>G	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.069603	0.55539	.	.	ENSG00000116996	ENST00000366570	T	0.77489	-1.1	4.96	-2.67	0.06059	P-type trefoil, conserved site (1);P-type trefoil (5);	0.053332	0.64402	D	0.000001	D	0.86585	0.5968	M	0.90082	3.085	0.21697	N	0.999585	D	0.76494	0.999	D	0.87578	0.998	T	0.78802	-0.2061	10	0.87932	D	0	-17.9981	8.8118	0.34971	0.1277:0.0:0.5247:0.3476	.	151	Q12836	ZP4_HUMAN	G	151	ENSP00000355529:R151G	ENSP00000355529:R151G	R	-	1	2	ZP4	236118383	0.033000	0.19621	0.001000	0.08648	0.018000	0.09664	0.273000	0.18662	-0.402000	0.07633	0.459000	0.35465	AGA		0.478	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			22	60	0	0	0	0.00278	0	22	60				
OR6F1	343169	broad.mit.edu	37	1	247875228	247875228	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:247875228A>T	ENST00000302084.2	-	1	877	c.830T>A	c.(829-831)cTg>cAg	p.L277Q	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CACAGTGTTCAGGACGTGGAC	0.453																																							uc001idj.1		NA																	0					0						c.(829-831)CTG>CAG		olfactory receptor, family 6, subfamily F,							121.0	117.0	118.0					1																	247875228		2203	4300	6503	SO:0001583	missense	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875228A>T	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.830T>A	1.37:g.247875228A>T	ENSP00000305640:p.Leu277Gln						p.L277Q	NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	830	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		277			Helical; Name=7; (Potential).		B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	c.830T>A	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.020652	0.54576	.	.	ENSG00000169214	ENST00000302084	T	0.00269	8.37	3.32	3.32	0.38043	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34700	N	0.003741	T	0.00468	0.0015	M	0.72894	2.215	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.43556	-0.9384	10	0.87932	D	0	-25.6438	10.9724	0.47446	1.0:0.0:0.0:0.0	.	277	Q8NGZ6	OR6F1_HUMAN	Q	277	ENSP00000305640:L277Q	ENSP00000305640:L277Q	L	-	2	0	OR6F1	245941851	0.095000	0.21747	0.004000	0.12327	0.011000	0.07611	4.046000	0.57376	1.504000	0.48704	0.383000	0.25322	CTG		0.453	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		31	63	0	0	0	0.008361	0	31	63				
OR2AK2	391191	broad.mit.edu	37	1	248129095	248129095	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:248129095G>T	ENST00000366480.3	+	1	561	c.462G>T	c.(460-462)aaG>aaT	p.K154N	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TGAGCAAGAAGATCTGCTGCC	0.443																																					Melanoma(45;390 1181 23848 28461 41504)	Melanoma(45;390 1181 23848 28461 41504)	uc010pzd.1		NA																	0				ovary(1)|breast(1)	2						c.(460-462)AAG>AAT		olfactory receptor, family 2, subfamily AK,							263.0	234.0	244.0					1																	248129095		2203	4300	6503	SO:0001583	missense	391191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248129095G>T	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.462G>T	1.37:g.248129095G>T	ENSP00000355436:p.Lys154Asn					OR2L13_uc001ids.2_Intron	p.K154N	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	462	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		154			Cytoplasmic (Potential).		B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	37	c.462G>T	CCDS31102.1	.	.	.	.	.	.	.	.	.	.	.	6.793	0.515306	0.12944	.	.	ENSG00000187080	ENST00000366480	T	0.40225	1.04	2.91	-5.81	0.02340	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.28300	0.0699	L	0.48642	1.525	0.09310	N	1	B	0.16802	0.019	B	0.24848	0.056	T	0.29427	-1.0012	9	0.59425	D	0.04	.	0.5743	0.00701	0.3231:0.11:0.2328:0.3341	.	154	Q8NG84	O2AK2_HUMAN	N	154	ENSP00000355436:K154N	ENSP00000355436:K154N	K	+	3	2	OR2AK2	246195718	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-1.452000	0.02385	-2.809000	0.00348	-0.681000	0.03757	AAG		0.443	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491		67	121	1	0	2.18419e-29	0.01441	3.12414e-29	67	121				
OR2T2	401992	broad.mit.edu	37	1	248616271	248616271	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:248616271C>A	ENST00000342927.3	+	1	195	c.173C>A	c.(172-174)aCa>aAa	p.T58K		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T58K(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CGCCTCCACACACCCATGTAC	0.512																																							uc001iek.1		NA																	1	Substitution - Missense(1)		skin(1)	skin(1)	1						c.(172-174)ACA>AAA		olfactory receptor, family 2, subfamily T,							95.0	106.0	102.0					1																	248616271		2202	4281	6483	SO:0001583	missense	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616271C>A	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.173C>A	1.37:g.248616271C>A	ENSP00000343062:p.Thr58Lys						p.T58K	NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	173	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		58			Cytoplasmic (Potential).		B2RNM1|B9EH01	Missense_Mutation	SNP	ENST00000342927.3	37	c.173C>A	CCDS31116.1	.	.	.	.	.	.	.	.	.	.	c	11.43	1.636150	0.29068	.	.	ENSG00000196240	ENST00000342927	T	0.00478	7.13	3.15	2.23	0.28157	GPCR, rhodopsin-like superfamily (1);	0.135212	0.33834	N	0.004503	T	0.00815	0.0027	M	0.86953	2.85	0.09310	N	0.999997	P	0.49961	0.93	P	0.47827	0.558	T	0.38478	-0.9659	10	0.72032	D	0.01	.	9.0362	0.36289	0.0:0.883:0.0:0.117	.	58	Q6IF00	OR2T2_HUMAN	K	58	ENSP00000343062:T58K	ENSP00000343062:T58K	T	+	2	0	OR2T2	246682894	0.000000	0.05858	0.111000	0.21465	0.437000	0.31866	-0.059000	0.11731	0.519000	0.28406	0.298000	0.19748	ACA		0.512	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		26	128	1	0	1.22674e-20	0.00874	1.72266e-20	26	128				
SLC39A12	221074	broad.mit.edu	37	10	18331726	18331726	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr10:18331726G>T	ENST00000377369.2	+	13	2313	c.2040G>T	c.(2038-2040)ctG>ctT	p.L680L	SLC39A12_ENST00000539911.1_Silent_p.L546L|SLC39A12_ENST00000377371.3_Silent_p.L679L|SLC39A12_ENST00000377374.4_Silent_p.L643L	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	680	Poly-Leu.				regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						TTTCTCTCCTGCTCTTGGCTA	0.343																																							uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(2038-2040)CTG>CTT		solute carrier family 39 (zinc transporter),							93.0	89.0	90.0					10																	18331726		2203	4300	6503	SO:0001819	synonymous_variant	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18331726G>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.2040G>T	10.37:g.18331726G>T						SLC39A12_uc001ipn.2_Silent_p.L643L|SLC39A12_uc001ipp.2_Silent_p.L679L|SLC39A12_uc010qck.1_Silent_p.L546L	p.L680L	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN			13	2313	+			680			Poly-Leu.|Helical; (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Silent	SNP	ENST00000377369.2	37	c.2040G>T	CCDS44362.1																																																																																				0.343	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		6	27	1	0	4.096e-09	0.001168	4.8898e-09	6	27				
PTCHD3	374308	broad.mit.edu	37	10	27687694	27687694	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr10:27687694C>G	ENST00000438700.3	-	4	1950	c.1833G>C	c.(1831-1833)ttG>ttC	p.L611F		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	611					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TTATGATGTACAAAACATATA	0.368																																							uc001itu.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1831-1833)TTG>TTC		patched domain containing 3							67.0	68.0	67.0					10																	27687694		2203	4300	6503	SO:0001583	missense	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27687694C>G	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1833G>C	10.37:g.27687694C>G	ENSP00000417658:p.Leu611Phe						p.L611F	NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN			4	1951	-			611			Helical; (Potential).		I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	c.1833G>C	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.866923	0.00063	.	.	ENSG00000182077	ENST00000438700	D	0.85861	-2.04	4.19	1.2	0.21068	.	0.955621	0.08583	N	0.924167	T	0.70945	0.3282	L	0.27053	0.805	0.09310	N	0.999999	B	0.10296	0.003	B	0.21546	0.035	T	0.53394	-0.8445	10	0.13108	T	0.6	-5.4263	1.2205	0.01923	0.1458:0.3689:0.1423:0.343	.	611	Q3KNS1	PTHD3_HUMAN	F	611	ENSP00000417658:L611F	ENSP00000417658:L611F	L	-	3	2	PTCHD3	27727700	0.000000	0.05858	0.043000	0.18650	0.026000	0.11368	-1.927000	0.01561	0.419000	0.25927	-0.439000	0.05793	TTG		0.368	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		5	26	0	0	0	0.000602	0	5	26				
ANKRD30A	91074	broad.mit.edu	37	10	37454056	37454056	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr10:37454056C>A	ENST00000602533.1	+	18	1968	c.1869C>A	c.(1867-1869)gaC>gaA	p.D623E	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.D623E|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.D623E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	679					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AACAAAAGGACTATGAAGAAA	0.294																																							uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(1867-1869)GAC>GAA		ankyrin repeat domain 30A							132.0	126.0	128.0					10																	37454056		1814	4066	5880	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37454056C>A	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1869C>A	10.37:g.37454056C>A	ENSP00000473551:p.Asp623Glu						p.D623E	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			18	1968	+			679					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.1869C>A		.	.	.	.	.	.	.	.	.	.	.	0.641	-0.813271	0.02798	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.06608	3.28;3.28	1.01	-2.02	0.07388	.	.	.	.	.	T	0.05914	0.0154	N	0.12746	0.255	0.09310	N	1	P	0.44690	0.841	P	0.55824	0.785	T	0.20438	-1.0275	9	0.21540	T	0.41	.	3.6455	0.08182	0.3039:0.4892:0.2069:0.0	.	679	Q9BXX3	AN30A_HUMAN	E	623	ENSP00000354432:D623E;ENSP00000363792:D623E	ENSP00000354432:D623E	D	+	3	2	ANKRD30A	37494062	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	-2.637000	0.00866	-1.753000	0.01323	-0.816000	0.03127	GAC		0.294	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		12	25	1	0	7.03913e-09	0.013537	8.36009e-09	12	25				
NRG3	10718	broad.mit.edu	37	10	84711230	84711230	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr10:84711230G>A	ENST00000404547.1	+	5	1060	c.1060G>A	c.(1060-1062)Gaa>Aaa	p.E354K	NRG3_ENST00000556918.1_Missense_Mutation_p.E184K|NRG3_ENST00000372142.2_Missense_Mutation_p.E133K|NRG3_ENST00000537893.1_Missense_Mutation_p.E4K|NRG3_ENST00000545131.1_Missense_Mutation_p.E4K|NRG3_ENST00000372141.2_Missense_Mutation_p.E354K|NRG3_ENST00000404576.2_Missense_Mutation_p.E158K			P56975	NRG3_HUMAN	neuregulin 3	354					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CACAGAGAGTGAAGAAGTTTA	0.403																																							uc001kco.2		NA																	0				lung(5)|breast(1)	6						c.(1060-1062)GAA>AAA		neuregulin 3 isoform 1							187.0	174.0	179.0					10																	84711230		2203	4300	6503	SO:0001583	missense	10718				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	g.chr10:84711230G>A	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1060G>A	10.37:g.84711230G>A	ENSP00000384796:p.Glu354Lys					NRG3_uc010qlz.1_Missense_Mutation_p.E353K|NRG3_uc001kcp.2_Missense_Mutation_p.E133K|NRG3_uc001kcq.2_Missense_Mutation_p.E4K|NRG3_uc001kcr.2_Missense_Mutation_p.E4K	p.E354K	NM_001010848	NP_001010848	P56975	NRG3_HUMAN		GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)	5	1087	+			354			Extracellular (Potential).		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	c.1060G>A	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600108	0.87055	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.61742	1.28;1.32;0.08;0.08;0.08;0.08;0.08	5.65	5.65	0.86999	.	0.397140	0.24657	N	0.036674	T	0.69931	0.3166	L	0.40543	1.245	0.58432	D	0.999994	D;B;D;D	0.76494	0.999;0.379;0.998;0.996	D;B;D;D	0.85130	0.997;0.187;0.994;0.987	T	0.70464	-0.4864	10	0.66056	D	0.02	-8.2422	17.5708	0.87933	0.0:0.0:1.0:0.0	.	353;354;133;354	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	K	354;354;353;133;158;184;4;4	ENSP00000361214:E354K;ENSP00000384796:E354K;ENSP00000361215:E133K;ENSP00000385804:E158K;ENSP00000451376:E184K;ENSP00000441201:E4K;ENSP00000440377:E4K	ENSP00000361214:E354K	E	+	1	0	NRG3	84701210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.074000	0.64401	2.822000	0.97130	0.637000	0.83480	GAA		0.403	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086		9	23	0	0	0	0.006214	0	9	23				
PSD	5662	broad.mit.edu	37	10	104174961	104174961	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr10:104174961G>A	ENST00000020673.5	-	4	1309	c.783C>T	c.(781-783)ccC>ccT	p.P261P	PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_Silent_p.P261P	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	261					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GTGGAGATGGGGGGGCCTGCT	0.622																																							uc001kvg.1		NA																	0				breast(2)|urinary_tract(1)	3						c.(781-783)CCC>CCT		pleckstrin and Sec7 domain containing							26.0	30.0	29.0					10																	104174961		2194	4282	6476	SO:0001819	synonymous_variant	5662				regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr10:104174961G>A	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.783C>T	10.37:g.104174961G>A						PSD_uc001kvh.1_5'UTR|PSD_uc009xxd.1_Silent_p.P261P	p.P261P	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN		Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)	4	1310	-			261					B1AKX7|D3DR87|Q15673|Q8IVG0	Silent	SNP	ENST00000020673.5	37	c.783C>T	CCDS31272.1																																																																																				0.622	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2			27	13	0	0	0	0.00632	0	27	13				
SLC25A22	79751	broad.mit.edu	37	11	799896	799896	+	5'Flank	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:799896C>A	ENST00000531214.1	-	0	0				PIDD_ENST00000411829.2_Missense_Mutation_p.R781L|PIDD_ENST00000347755.5_Missense_Mutation_p.R798L	NM_001191060.1	NP_001177989.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22						L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGACCCAGACGCCCAGCCAC	0.692																																					Colon(93;848 1468 3270 23355 49636)		uc001lro.1		NA																	0					0						c.(2392-2394)CGT>CTT		leucine rich repeat and death domain containing							20.0	23.0	22.0					11																	799896		2180	4280	6460	SO:0001631	upstream_gene_variant	55367				apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding	g.chr11:799896C>A	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310		11.37:g.799896C>A	Exception_encountered					SLC25A22_uc009yci.2_5'Flank|SLC25A22_uc001lrj.2_5'Flank|LRDD_uc009yck.1_RNA|LRDD_uc001lrk.1_Missense_Mutation_p.R781L|LRDD_uc001lrl.1_Missense_Mutation_p.R641L|LRDD_uc001lrm.1_Missense_Mutation_p.R485L|LRDD_uc001lrn.1_Missense_Mutation_p.R641L|LRDD_uc001lrp.1_3'UTR	p.R798L	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	15	2535	-		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)	798			Death.		A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000531214.1	37	c.2393G>T	CCDS7715.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096783	0.56075	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	D;D	0.83992	-1.79;-1.79	4.1	4.1	0.47936	Death (3);DEATH-like (2);	0.076750	0.53938	D	0.000056	D	0.88149	0.6359	L	0.50333	1.59	0.42369	D	0.99244	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.975;0.996;0.942	D	0.87684	0.2549	10	0.37606	T	0.19	.	16.4819	0.84160	0.0:1.0:0.0:0.0	.	798;641;781	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	L	781;798	ENSP00000416801:R781L;ENSP00000337797:R798L	ENSP00000337797:R798L	R	-	2	0	PIDD	789896	1.000000	0.71417	0.986000	0.45419	0.121000	0.20230	3.868000	0.56055	2.103000	0.63969	0.462000	0.41574	CGT		0.692	SLC25A22-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384124.1			3	28	1	0	6.4e-05	0.004672	7.00664e-05	3	28				
OR51V1	283111	broad.mit.edu	37	11	5221760	5221760	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:5221760C>A	ENST00000321255.1	-	1	170	c.171G>T	c.(169-171)gtG>gtT	p.V57V		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	57					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGTCCATATCACATGGAGAA	0.527																																							uc010qyz.1		NA																	0				skin(1)	1						c.(169-171)GTG>GTT		olfactory receptor, family 51, subfamily V,							128.0	111.0	117.0					11																	5221760		2201	4298	6499	SO:0001819	synonymous_variant	283111				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5221760C>A	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.171G>T	11.37:g.5221760C>A							p.V57V	NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	171	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	57			Cytoplasmic (Potential).			Silent	SNP	ENST00000321255.1	37	c.171G>T	CCDS31375.1																																																																																				0.527	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760		22	21	1	0	5.35356e-11	0.00278	6.54324e-11	22	21				
OR52B2	255725	broad.mit.edu	37	11	6190980	6190980	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:6190980C>T	ENST00000530810.1	-	1	658	c.577G>A	c.(577-579)Gac>Aac	p.D193N	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACAGTGATGTCAGCACAGGCT	0.488																																					NSCLC(5;186 261 1778 7098 14207)	NSCLC(5;186 261 1778 7098 14207)	uc010qzy.1		NA																	0					0						c.(577-579)GAC>AAC		olfactory receptor, family 52, subfamily B,							49.0	50.0	50.0					11																	6190980		2078	4216	6294	SO:0001583	missense	255725				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6190980C>T	AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.577G>A	11.37:g.6190980C>T	ENSP00000432011:p.Asp193Asn						p.D193N	NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	577	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	193			Extracellular (Potential).		Q8NGM7	Missense_Mutation	SNP	ENST00000530810.1	37	c.577G>A	CCDS53598.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437433	0.43224	.	.	ENSG00000255307	ENST00000530810	T	0.00231	8.49	5.32	5.32	0.75619	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00241	0.0007	M	0.67569	2.06	0.32566	N	0.530441	B	0.29162	0.235	B	0.29524	0.103	T	0.57406	-0.7817	9	0.08179	T	0.78	.	18.162	0.89710	0.0:1.0:0.0:0.0	.	193	Q96RD2	O52B2_HUMAN	N	193	ENSP00000432011:D193N	ENSP00000432011:D193N	D	-	1	0	OR52B2	6147556	0.872000	0.30054	1.000000	0.80357	0.997000	0.91878	1.692000	0.37731	2.770000	0.95276	0.551000	0.68910	GAC		0.488	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385977.1	NM_001004052		11	5	0	0	0	0.008291	0	11	5				
HPX	3263	broad.mit.edu	37	11	6462124	6462124	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:6462124T>A	ENST00000265983.3	-	1	170	c.70A>T	c.(70-72)Acc>Tcc	p.T24S	HPX_ENST00000525057.1_Intron	NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	24					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		GGAAGAGGGGTGGCAATGGCC	0.572																																							uc001mdg.2		NA																	0					0						c.(70-72)ACC>TCC		hemopexin precursor							61.0	58.0	59.0					11																	6462124		2201	4296	6497	SO:0001583	missense	3263				cellular iron ion homeostasis|interspecies interaction between organisms	extracellular space	heme transporter activity|metal ion binding|protein binding	g.chr11:6462124T>A	J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.70A>T	11.37:g.6462124T>A	ENSP00000265983:p.Thr24Ser					HPX_uc009yfc.2_RNA|HPX_uc010rai.1_Missense_Mutation_p.T24S	p.T24S	NM_000613	NP_000604	P02790	HEMO_HUMAN		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)	1	131	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	24			O-glycosylated at one, two and three sites.		B2R957	Missense_Mutation	SNP	ENST00000265983.3	37	c.70A>T	CCDS7763.1	.	.	.	.	.	.	.	.	.	.	T	6.519	0.463890	0.12402	.	.	ENSG00000110169	ENST00000265983;ENST00000537154	T	0.07800	3.16	4.39	-0.229	0.13094	.	0.667620	0.14490	N	0.316398	T	0.03305	0.0096	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.0	T	0.47355	-0.9124	10	0.13108	T	0.6	-37.6982	6.443	0.21861	0.1075:0.0:0.2671:0.6253	.	24;24	B7Z8Q4;P02790	.;HEMO_HUMAN	S	24	ENSP00000265983:T24S	ENSP00000265983:T24S	T	-	1	0	HPX	6418700	0.808000	0.29022	0.249000	0.24280	0.786000	0.44442	0.040000	0.13905	-0.133000	0.11537	0.397000	0.26171	ACC		0.572	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257256.1	NM_000613		9	10	0	0	0	0.010729	0	9	10				
BTBD10	84280	broad.mit.edu	37	11	13443224	13443224	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:13443224C>T	ENST00000278174.5	-	3	508	c.263G>A	c.(262-264)aGa>aAa	p.R88K	BTBD10_ENST00000532261.1_5'UTR|BTBD10_ENST00000528120.1_Missense_Mutation_p.R40K|BTBD10_ENST00000530907.1_Missense_Mutation_p.R96K	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	88						nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		AGTCACATTTCTAATACAAGG	0.398																																							uc001mkz.2		NA																	0					0						c.(262-264)AGA>AAA		K+ channel tetramerization protein							138.0	116.0	124.0					11																	13443224		2200	4294	6494	SO:0001583	missense	84280					nucleus		g.chr11:13443224C>T	AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.263G>A	11.37:g.13443224C>T	ENSP00000278174:p.Arg88Lys					BTBD10_uc010rcl.1_Missense_Mutation_p.R96K|BTBD10_uc001mla.2_Missense_Mutation_p.R72K|BTBD10_uc009ygn.2_RNA|BTBD10_uc010rcm.1_Missense_Mutation_p.R40K|BTBD10_uc010rcn.1_Missense_Mutation_p.R57K|BTBD10_uc009ygo.2_Missense_Mutation_p.R40K	p.R88K	NM_032320	NP_115696	Q9BSF8	BTBDA_HUMAN		Epithelial(150;0.0214)	3	520	-			88					B7Z228|Q86WG1	Missense_Mutation	SNP	ENST00000278174.5	37	c.263G>A	CCDS7811.1	.	.	.	.	.	.	.	.	.	.	C	34	5.365572	0.95900	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000528120	T;T;T	0.34275	1.37;1.38;1.43	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.46367	0.1389	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.56035	0.974;0.974;0.974;0.974	D;D;D;D	0.70487	0.969;0.969;0.969;0.969	T	0.15178	-1.0446	10	0.06365	T	0.9	-49.9994	18.0084	0.89216	0.0:1.0:0.0:0.0	.	57;96;88;88	B7Z2J1;B7Z228;D3DQW7;Q9BSF8	.;.;.;BTBDA_HUMAN	K	88;96;40	ENSP00000278174:R88K;ENSP00000431186:R96K;ENSP00000435257:R40K	ENSP00000278174:R88K	R	-	2	0	BTBD10	13399800	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.651000	0.83577	2.578000	0.87016	0.655000	0.94253	AGA		0.398	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386200.1	NM_032320		6	24	0	0	0	0.001984	0	6	24				
INSC	387755	broad.mit.edu	37	11	15260566	15260566	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:15260566C>A	ENST00000379554.3	+	11	1526	c.1480C>A	c.(1480-1482)Ctg>Atg	p.L494M	INSC_ENST00000530161.1_Missense_Mutation_p.L447M|INSC_ENST00000528567.1_Missense_Mutation_p.L447M|INSC_ENST00000379556.3_Missense_Mutation_p.L447M|INSC_ENST00000424273.1_Missense_Mutation_p.L405M|INSC_ENST00000525218.1_Missense_Mutation_p.L405M|INSC_ENST00000447214.2_3'UTR	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	494					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						TGCAGTGACCCTGGCTCGTCT	0.602																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(1480-1482)CTG>ATG		inscuteable isoform a							54.0	55.0	55.0					11																	15260566		2076	4194	6270	SO:0001583	missense	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15260566C>A	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1480C>A	11.37:g.15260566C>A	ENSP00000368872:p.Leu494Met					INSC_uc001mlz.2_Missense_Mutation_p.L447M|INSC_uc001mma.2_Missense_Mutation_p.L447M|INSC_uc010rcs.1_Missense_Mutation_p.L482M|INSC_uc001mmb.2_Missense_Mutation_p.L447M|INSC_uc001mmc.2_Missense_Mutation_p.L405M	p.L494M	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN			11	1526	+			494					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	c.1480C>A	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.883738	0.72410	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	5.66	3.8	0.43715	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.77824	0.4188	M	0.61703	1.905	0.53688	D	0.999978	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.999	T	0.78283	-0.2264	10	0.72032	D	0.01	-11.9197	11.5888	0.50933	0.0:0.8577:0.0:0.1423	.	482;405;447;494	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	M	494;447;405;447;447;405	ENSP00000368872:L494M;ENSP00000368874:L447M;ENSP00000389161:L405M;ENSP00000435022:L447M;ENSP00000436194:L447M;ENSP00000436113:L405M	ENSP00000368872:L494M	L	+	1	2	INSC	15217142	0.889000	0.30405	1.000000	0.80357	0.996000	0.88848	1.781000	0.38644	0.757000	0.33036	0.655000	0.94253	CTG		0.602	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		23	7	1	0	1.90627e-21	0.012319	2.68505e-21	23	7				
PLEKHA7	144100	broad.mit.edu	37	11	16863110	16863110	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:16863110G>A	ENST00000355661.3	-	9	866	c.856C>T	c.(856-858)Cga>Tga	p.R286*	PLEKHA7_ENST00000448080.2_Nonsense_Mutation_p.R286*|PLEKHA7_ENST00000532079.1_Intron|RN7SKP90_ENST00000363013.1_RNA|PLEKHA7_ENST00000531066.1_Nonsense_Mutation_p.R286*			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	286					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						AGTGACGATCGAGACAGCACC	0.567																																							uc001mmo.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(856-858)CGA>TGA		pleckstrin homology domain containing, family A							146.0	125.0	132.0					11																	16863110		2200	4294	6494	SO:0001587	stop_gained	144100				epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding	g.chr11:16863110G>A	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.856C>T	11.37:g.16863110G>A	ENSP00000347883:p.Arg286*					PLEKHA7_uc010rcu.1_Nonsense_Mutation_p.R286*	p.R286*	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN			9	871	-			286					B4DK33|B4DWC3|Q86VZ7	Nonsense_Mutation	SNP	ENST00000355661.3	37	c.856C>T	CCDS31434.1	.	.	.	.	.	.	.	.	.	.	G	37	6.436734	0.97564	.	.	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080	.	.	.	5.08	5.08	0.68730	.	0.520658	0.22058	N	0.065211	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-11.0613	19.0402	0.92995	0.0:0.0:1.0:0.0	.	.	.	.	X	286	.	ENSP00000347883:R286X	R	-	1	2	PLEKHA7	16819686	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.492000	0.66893	2.814000	0.96858	0.655000	0.94253	CGA		0.567	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058		6	55	0	0	0	0.004482	0	6	55				
FANCF	2188	broad.mit.edu	37	11	22646799	22646799	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:22646799G>A	ENST00000327470.3	-	1	588	c.558C>T	c.(556-558)gcC>gcT	p.A186A	AC103801.2_ENST00000428556.2_5'Flank	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	186					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						TGAGAAACCTGGCGGGACGCT	0.622			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001mql.1		NA	yes	Rec		Fanconi anaemia F	11	11p15	2188	N|F	"""Fanconi anemia, complementation group F"""			L		AML|leukemia			0				skin(1)	1						c.(556-558)GCC>GCT	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group F							58.0	69.0	65.0					11																	22646799		2203	4300	6503	SO:0001819	synonymous_variant	2188	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm	protein binding	g.chr11:22646799G>A		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.558C>T	11.37:g.22646799G>A			OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	757		p.A186A	NM_022725	NP_073562	Q9NPI8	FANCF_HUMAN			1	589	-			186					Q52LM0	Silent	SNP	ENST00000327470.3	37	c.558C>T	CCDS7857.1																																																																																				0.622	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725		54	42	0	0	0	0.01441	0	54	42				
PHF21A	51317	broad.mit.edu	37	11	45967443	45967443	+	Missense_Mutation	SNP	G	G	A	rs371948562		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:45967443G>A	ENST00000418153.2	-	14	1596	c.1397C>T	c.(1396-1398)aCt>aTt	p.T466I	PHF21A_ENST00000257821.4_Missense_Mutation_p.T467I|PHF21A_ENST00000323180.6_Intron|PHF21A_ENST00000527753.1_Intron			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	466					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						TGCAGGGAAAGTGAATGTGGT	0.507																																							uc001ncc.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1396-1398)ACT>ATT		BRAF35/HDAC2 complex isoform a		G	ILE/THR,	0,4350		0,0,2175	107.0	125.0	119.0		1397,	5.9	1.0	11		119	1,8557		0,1,4278	no	missense,intron	PHF21A	NM_001101802.1,NM_016621.3	89,	0,1,6453	AA,AG,GG		0.0117,0.0,0.0077	possibly-damaging,	466/681,	45967443	1,12907	2175	4279	6454	SO:0001583	missense	51317				blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding	g.chr11:45967443G>A	AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.1397C>T	11.37:g.45967443G>A	ENSP00000398824:p.Thr466Ile					PHF21A_uc001ncb.3_Intron|PHF21A_uc009ykx.2_Intron|PHF21A_uc001nce.2_Missense_Mutation_p.T467I|PHF21A_uc001nca.1_Missense_Mutation_p.T202I	p.T466I	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN			14	2021	-			466					D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	ENST00000418153.2	37	c.1397C>T	CCDS44578.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996110	0.54147	0.0	1.17E-4	ENSG00000135365	ENST00000257821;ENST00000418153	D;D	0.92911	-3.12;-3.13	5.94	5.94	0.96194	.	0.189147	0.46442	D	0.000282	D	0.83207	0.5204	N	0.08118	0	0.39817	D	0.972788	P;P	0.38335	0.627;0.557	B;B	0.38683	0.139;0.279	T	0.82623	-0.0366	10	0.13853	T	0.58	-8.2295	15.1295	0.72511	0.0:0.0:0.8587:0.1413	.	466;467	Q96BD5;Q96BD5-3	PF21A_HUMAN;.	I	467;466	ENSP00000257821:T467I;ENSP00000398824:T466I	ENSP00000257821:T467I	T	-	2	0	PHF21A	45924019	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.658000	0.61497	2.820000	0.97059	0.650000	0.86243	ACT		0.507	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621		7	64	0	0	0	0.001984	0	7	64				
OR4A47	403253	broad.mit.edu	37	11	48510625	48510625	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:48510625C>G	ENST00000446524.1	+	1	357	c.281C>G	c.(280-282)tCt>tGt	p.S94C		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TCCTTCCAATCTTGCATGGCC	0.438																																							uc010rhx.1		NA																	0				ovary(1)|skin(1)	2						c.(280-282)TCT>TGT		olfactory receptor, family 4, subfamily A,							107.0	104.0	105.0					11																	48510625		2201	4298	6499	SO:0001583	missense	403253				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48510625C>G	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.281C>G	11.37:g.48510625C>G	ENSP00000412752:p.Ser94Cys						p.S94C	NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN			1	281	+			94			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000446524.1	37	c.281C>G	CCDS31490.1	.	.	.	.	.	.	.	.	.	.	N	4.487	0.090338	0.08632	.	.	ENSG00000237388	ENST00000446524	T	0.03152	4.03	4.84	-9.68	0.00528	GPCR, rhodopsin-like superfamily (1);	1.519390	0.04017	N	0.299175	T	0.02304	0.0071	N	0.25380	0.74	0.09310	N	1	B	0.14012	0.009	B	0.14023	0.01	T	0.43605	-0.9381	10	0.87932	D	0	.	1.3008	0.02078	0.1793:0.2455:0.1572:0.418	.	94	Q6IF82	O4A47_HUMAN	C	94	ENSP00000412752:S94C	ENSP00000412752:S94C	S	+	2	0	OR4A47	48467201	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-2.052000	0.01401	-1.818000	0.01218	-0.350000	0.07774	TCT		0.438	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		17	120	0	0	0	0.007413	0	17	120				
OR4A47	403253	broad.mit.edu	37	11	48510902	48510902	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:48510902C>T	ENST00000446524.1	+	1	634	c.558C>T	c.(556-558)gtC>gtT	p.V186V		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TGAAACTGGTCTGCACTGACA	0.433																																							uc010rhx.1		NA																	0				ovary(1)|skin(1)	2						c.(556-558)GTC>GTT		olfactory receptor, family 4, subfamily A,							163.0	156.0	159.0					11																	48510902		2201	4298	6499	SO:0001819	synonymous_variant	403253				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48510902C>T	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.558C>T	11.37:g.48510902C>T							p.V186V	NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN			1	558	+			186			Extracellular (Potential).			Silent	SNP	ENST00000446524.1	37	c.558C>T	CCDS31490.1																																																																																				0.433	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		22	125	0	0	0	0.00278	0	22	125				
OR4A16	81327	broad.mit.edu	37	11	55111023	55111023	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:55111023T>A	ENST00000314721.2	+	1	397	c.347T>A	c.(346-348)aTg>aAg	p.M116K		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M116T(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TTGGTGGTGATGGCCTATGAT	0.458																																							uc010rie.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	large_intestine(2)|pancreas(1)	3						c.(346-348)ATG>AAG		olfactory receptor, family 4, subfamily A,							193.0	179.0	184.0					11																	55111023		2201	4296	6497	SO:0001583	missense	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55111023T>A	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.347T>A	11.37:g.55111023T>A	ENSP00000325128:p.Met116Lys						p.M116K	NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN			1	347	+			116			Helical; Name=3; (Potential).		Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	c.347T>A	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	t	14.69	2.612096	0.46631	.	.	ENSG00000181961	ENST00000314721	T	0.01159	5.25	2.57	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.11623	0.0283	H	0.99058	4.415	0.39660	D	0.970595	D	0.76494	0.999	D	0.72075	0.976	T	0.01444	-1.1353	9	0.87932	D	0	.	8.6087	0.33789	0.0:0.0:0.0:1.0	.	116	Q8NH70	O4A16_HUMAN	K	116	ENSP00000325128:M116K	ENSP00000325128:M116K	M	+	2	0	OR4A16	54867599	1.000000	0.71417	0.988000	0.46212	0.453000	0.32348	6.516000	0.73755	1.186000	0.42985	0.346000	0.21813	ATG		0.458	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		29	124	0	0	0	0.008361	0	29	124				
OR4C6	219432	broad.mit.edu	37	11	55433179	55433179	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:55433179G>T	ENST00000314259.3	+	1	566	c.537G>T	c.(535-537)ttG>ttT	p.L179F		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						TATGTGATTTGTTTCAGTTGT	0.433																																							uc001nht.3		NA																	0				skin(2)	2						c.(535-537)TTG>TTT		olfactory receptor, family 4, subfamily C,							131.0	121.0	125.0					11																	55433179		2200	4296	6496	SO:0001583	missense	219432				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55433179G>T	CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.537G>T	11.37:g.55433179G>T	ENSP00000324769:p.Leu179Phe					OR4C6_uc010rik.1_Missense_Mutation_p.L179F	p.L179F	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN			3	802	+			179			Extracellular (Potential).		B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	37	c.537G>T	CCDS31506.1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464892	0.26335	.	.	ENSG00000181903	ENST00000314259	T	0.38077	1.16	4.07	1.95	0.26073	GPCR, rhodopsin-like superfamily (1);	0.265961	0.20031	N	0.100719	T	0.32823	0.0842	L	0.51853	1.615	0.20074	N	0.999932	B	0.24368	0.102	B	0.33339	0.162	T	0.34675	-0.9819	10	0.66056	D	0.02	.	7.1109	0.25390	0.0:0.1649:0.5039:0.3312	.	179	Q8NH72	OR4C6_HUMAN	F	179	ENSP00000324769:L179F	ENSP00000324769:L179F	L	+	3	2	OR4C6	55189755	0.000000	0.05858	0.990000	0.47175	0.474000	0.32979	-3.823000	0.00357	0.676000	0.31285	0.543000	0.68304	TTG		0.433	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704		35	60	1	0	9.04072e-19	0.003271	1.2431e-18	35	60				
OR10AG1	282770	broad.mit.edu	37	11	55735495	55735495	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:55735495C>G	ENST00000312345.2	-	1	495	c.445G>C	c.(445-447)Ggg>Cgg	p.G149R		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					CATGTTTCCCCAATTACTACA	0.408																																							uc010rit.1		NA																	0				skin(2)	2						c.(445-447)GGG>CGG		olfactory receptor, family 10, subfamily AG,							81.0	78.0	79.0					11																	55735495		2201	4296	6497	SO:0001583	missense	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735495C>G	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.445G>C	11.37:g.55735495C>G	ENSP00000311477:p.Gly149Arg						p.G149R	NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN			1	445	-	Esophageal squamous(21;0.0137)		149			Helical; Name=4; (Potential).		B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	c.445G>C	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406653	0.25378	.	.	ENSG00000174970	ENST00000312345	T	0.37235	1.21	4.95	3.07	0.35406	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000030	T	0.43656	0.1257	M	0.89095	3.005	0.09310	N	0.999999	B	0.33694	0.421	B	0.39027	0.288	T	0.33954	-0.9848	10	0.25751	T	0.34	.	6.8049	0.23772	0.0:0.7281:0.1774:0.0945	.	149	Q8NH19	O10AG_HUMAN	R	149	ENSP00000311477:G149R	ENSP00000311477:G149R	G	-	1	0	OR10AG1	55492071	0.000000	0.05858	0.015000	0.15790	0.469000	0.32828	-1.172000	0.03112	0.717000	0.32145	0.477000	0.44152	GGG		0.408	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		13	34	0	0	0	0.013537	0	13	34				
OR8K3	219473	broad.mit.edu	37	11	56085854	56085854	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:56085854G>T	ENST00000312711.1	+	1	72	c.72G>T	c.(70-72)caG>caT	p.Q24H		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					CTGAGCTGCAGGCACCATTAT	0.433																																							uc010rjf.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(70-72)CAG>CAT		olfactory receptor, family 8, subfamily K,							188.0	169.0	175.0					11																	56085854		2201	4296	6497	SO:0001583	missense	219473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56085854G>T	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.72G>T	11.37:g.56085854G>T	ENSP00000323555:p.Gln24His						p.Q24H	NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN			1	72	+	Esophageal squamous(21;0.00448)		24			Extracellular (Potential).		Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	c.72G>T	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698444	0.30142	.	.	ENSG00000181689	ENST00000312711	T	0.00601	6.29	4.84	2.93	0.34026	.	0.000000	0.56097	D	0.000037	T	0.01730	0.0055	M	0.68728	2.09	0.26337	N	0.977424	D	0.67145	0.996	D	0.65233	0.933	T	0.31447	-0.9943	10	0.87932	D	0	.	8.3136	0.32086	0.2551:0.0:0.7449:0.0	.	24	Q8NH51	OR8K3_HUMAN	H	24	ENSP00000323555:Q24H	ENSP00000323555:Q24H	Q	+	3	2	OR8K3	55842430	0.000000	0.05858	0.985000	0.45067	0.005000	0.04900	-0.770000	0.04705	1.364000	0.46038	0.637000	0.83480	CAG		0.433	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202		32	62	1	0	1.88708e-17	0.008361	2.54922e-17	32	62				
CLP1	10978	broad.mit.edu	37	11	57428602	57428602	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:57428602G>A	ENST00000302731.4	+	3	900	c.780G>A	c.(778-780)gtG>gtA	p.V260V	CLP1_ENST00000533682.1_Silent_p.V324V|CLP1_ENST00000525602.1_Silent_p.V324V|CLP1_ENST00000529430.1_Silent_p.V335V	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	631					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						TTTCAGATGTGAAAATCTACA	0.468																																							uc001nkw.2		NA																	0				ovary(1)	1						c.(970-972)GTG>GTA		ATP/GTP-binding protein isoform 1							142.0	150.0	147.0					11																	57428602		2201	4296	6497	SO:0001819	synonymous_variant	10978				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|siRNA loading onto RISC involved in RNA interference|targeting of mRNA for destruction involved in RNA interference|termination of RNA polymerase II transcription|tRNA splicing, via endonucleolytic cleavage and ligation	nucleoplasm|tRNA-intron endonuclease complex	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|ATP-dependent polyribonucleotide 5'-hydroxyl-kinase activity	g.chr11:57428602G>A	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.780G>A	11.37:g.57428602G>A						CLP1_uc010rjw.1_Silent_p.V260V|CLP1_uc009yml.2_Silent_p.V324V	p.V324V	NM_006831	NP_006822	Q92989	CLP1_HUMAN			3	1111	+			324					Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000302731.4	37	c.972G>A	CCDS44600.1																																																																																				0.468	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000393465.1	NM_006831		32	152	0	0	0	0.003271	0	32	152				
OR6Q1	219952	broad.mit.edu	37	11	57799084	57799084	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:57799084G>T	ENST00000302622.3	+	1	683	c.660G>T	c.(658-660)gtG>gtT	p.V220V	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				TCATTGCTGTGTCCTATGGCA	0.562																																							uc010rjz.1		NA																	0				kidney(1)	1						c.(658-660)GTG>GTT		olfactory receptor, family 6, subfamily Q,							191.0	157.0	168.0					11																	57799084		2201	4296	6497	SO:0001819	synonymous_variant	219952				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57799084G>T	AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.660G>T	11.37:g.57799084G>T						OR9Q1_uc001nmj.2_Intron	p.V220V	NM_001005186	NP_001005186	Q8NGQ2	OR6Q1_HUMAN			1	660	+		Breast(21;0.0707)|all_epithelial(135;0.142)	220			Helical; Name=5; (Potential).		B9EKW1|Q6IFH1|Q96R34	Silent	SNP	ENST00000302622.3	37	c.660G>T	CCDS31541.1																																																																																				0.562	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401257.1	NM_001005186		26	80	1	0	7.92952e-12	0.003954	9.76917e-12	26	80				
OR10W1	81341	broad.mit.edu	37	11	58034596	58034596	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:58034596G>T	ENST00000395079.2	-	1	1136	c.735C>A	c.(733-735)tgC>tgA	p.C245*		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C245*(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				TGAAGGCACAGCAGCCATACT	0.592																																							uc001nmq.1		NA																	1	Substitution - Nonsense(1)	p.C245*(1)	ovary(1)	ovary(1)	1						c.(733-735)TGC>TGA		olfactory receptor, family 10, subfamily W,							80.0	76.0	77.0					11																	58034596		2201	4295	6496	SO:0001587	stop_gained	81341				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58034596G>T	AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.735C>A	11.37:g.58034596G>T	ENSP00000378516:p.Cys245*						p.C245*	NM_207374	NP_997257	Q8NGF6	O10W1_HUMAN			1	1137	-		Breast(21;0.0589)	245			Helical; Name=6; (Potential).		A2RUD2|A8MTE1|Q6UXQ2	Nonsense_Mutation	SNP	ENST00000395079.2	37	c.735C>A	CCDS7968.1	.	.	.	.	.	.	.	.	.	.	G	32	5.131378	0.94473	.	.	ENSG00000172772	ENST00000395079	.	.	.	5.8	-6.83	0.01693	.	0.000000	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	16.7264	0.85423	0.469:0.0:0.531:0.0	.	.	.	.	X	245	.	ENSP00000378516:C245X	C	-	3	2	OR10W1	57791172	0.000000	0.05858	0.231000	0.23993	0.641000	0.38312	-3.462000	0.00463	-1.412000	0.02030	-0.122000	0.15005	TGC		0.592	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374		17	64	1	0	4.14922e-12	0.004007	5.1255e-12	17	64				
OR5A1	219982	broad.mit.edu	37	11	59211268	59211268	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:59211268C>T	ENST00000302030.2	+	1	652	c.627C>T	c.(625-627)gtC>gtT	p.V209V		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						TGGTCACTGTCGGAGGAACAT	0.527																																							uc001nnx.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(625-627)GTC>GTT		olfactory receptor, family 5, subfamily A,							212.0	203.0	206.0					11																	59211268		2201	4295	6496	SO:0001819	synonymous_variant	219982				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59211268C>T	AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.627C>T	11.37:g.59211268C>T							p.V209V	NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN			1	627	+			209			Helical; Name=5; (Potential).		B9EH58|Q6IFF2|Q96RB1	Silent	SNP	ENST00000302030.2	37	c.627C>T	CCDS31561.1																																																																																				0.527	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728		39	146	0	0	0	0.004289	0	39	146				
PRPF19	27339	broad.mit.edu	37	11	60658701	60658701	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:60658701C>G	ENST00000227524.4	-	16	1657	c.1452G>C	c.(1450-1452)ggG>ggC	p.G484G		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						TGGCGTGATGCCCGAAGGCCA	0.542																																							uc001nqf.2		NA																	0				ovary(1)	1						c.(1450-1452)GGG>GGC		PRP19/PSO4 pre-mRNA processing factor 19							80.0	68.0	72.0					11																	60658701		2203	4299	6502	SO:0001819	synonymous_variant	27339				DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity	g.chr11:60658701C>G	BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.1452G>C	11.37:g.60658701C>G							p.G484G	NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN			16	1659	-			484			WD 7.			Silent	SNP	ENST00000227524.4	37	c.1452G>C	CCDS7995.1																																																																																				0.542	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502		15	22	0	0	0	0.004007	0	15	22				
PRPF19	27339	broad.mit.edu	37	11	60666723	60666723	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:60666723G>A	ENST00000227524.4	-	11	1087	c.882C>T	c.(880-882)ccC>ccT	p.P294P		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						AAGAGGCATTGGGGACCGACC	0.517											OREG0020994	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001nqf.2		NA																	0				ovary(1)	1						c.(880-882)CCC>CCT		PRP19/PSO4 pre-mRNA processing factor 19							63.0	56.0	58.0					11																	60666723		2203	4299	6502	SO:0001819	synonymous_variant	27339				DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity	g.chr11:60666723G>A	BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.882C>T	11.37:g.60666723G>A			OREG0020994	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1047		p.P294P	NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN			11	1089	-			294			WD 2.			Silent	SNP	ENST00000227524.4	37	c.882C>T	CCDS7995.1																																																																																				0.517	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502		10	47	0	0	0	0.008291	0	10	47				
DAK	26007	broad.mit.edu	37	11	61110123	61110123	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:61110123G>A	ENST00000394900.3	+	9	997	c.768G>A	c.(766-768)gtG>gtA	p.V256V		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	256	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						ATGTGCCTGTGCAGCCCGGTG	0.607																																							uc001nre.2		NA																	0					0						c.(766-768)GTG>GTA		dihydroxyacetone kinase 2							101.0	97.0	98.0					11																	61110123		2203	4299	6502	SO:0001819	synonymous_variant	26007				glycerol metabolic process	cytosol	ATP binding|FAD-AMP lyase (cyclizing) activity|glycerone kinase activity|metal ion binding	g.chr11:61110123G>A		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.768G>A	11.37:g.61110123G>A						DDB1_uc010rlf.1_5'Flank|DAK_uc009ynm.1_Silent_p.V186V	p.V256V	NM_015533	NP_056348	Q3LXA3	DHAK_HUMAN			9	1025	+			256			DhaK.		Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Silent	SNP	ENST00000394900.3	37	c.768G>A	CCDS8003.1																																																																																				0.607	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533		21	51	0	0	0	0.010504	0	21	51				
NRXN2	9379	broad.mit.edu	37	11	64418777	64418777	+	Silent	SNP	C	C	A	rs116802246		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:64418777C>A	ENST00000377551.1	-	13	3079	c.2868G>T	c.(2866-2868)ctG>ctT	p.L956L	AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000265459.6_Silent_p.L956L|NRXN2_ENST00000409571.1_Silent_p.L949L|NRXN2_ENST00000377559.3_Silent_p.L916L			Q9P2S2	NRX2A_HUMAN	neurexin 2	956	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CCGAGTTGAACAGAAGAAGCC	0.592											OREG0004037|OREG0021057	type=REGULATORY REGION|Gene=AL137356|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001oar.2		NA																	0				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						c.(2866-2868)CTG>CTT		neurexin 2 isoform alpha-1 precursor							70.0	57.0	61.0					11																	64418777		2201	4297	6498	SO:0001819	synonymous_variant	9379				cell adhesion	integral to membrane		g.chr11:64418777C>A		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2868G>T	11.37:g.64418777C>A			OREG0004037|OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=REGULATORY REGION|Gene=AL137356|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1076	NRXN2_uc001oas.2_Silent_p.L916L|NRXN2_uc001oaq.2_Silent_p.L623L	p.L956L	NM_015080	NP_055895	P58401	NRX2B_HUMAN			15	3307	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	c.2868G>T	CCDS8077.1																																																																																				0.592	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		17	40	1	0	6.49762e-13	0.006122	8.06962e-13	17	40				
C11orf30	56946	broad.mit.edu	37	11	76227220	76227220	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:76227220C>G	ENST00000529032.1	+	10	1548	c.1548C>G	c.(1546-1548)agC>agG	p.S516R	C11orf30_ENST00000525038.1_Missense_Mutation_p.S531R|C11orf30_ENST00000525919.1_Missense_Mutation_p.S517R|C11orf30_ENST00000524767.1_Missense_Mutation_p.S531R|C11orf30_ENST00000343878.3_Missense_Mutation_p.S516R|C11orf30_ENST00000524490.1_Missense_Mutation_p.S432R|C11orf30_ENST00000334736.3_Missense_Mutation_p.S516R|C11orf30_ENST00000533248.1_Missense_Mutation_p.S530R			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	516	Thr-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						CAACAGTGAGCCCATCCATTG	0.443																																							uc001oxl.2		NA																	0				ovary(5)|skin(1)	6						c.(1546-1548)AGC>AGG		EMSY protein							115.0	111.0	112.0					11																	76227220		2200	4292	6492	SO:0001583	missense	56946				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr11:76227220C>G	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1548C>G	11.37:g.76227220C>G	ENSP00000432327:p.Ser516Arg					C11orf30_uc001oxm.2_Missense_Mutation_p.S432R|C11orf30_uc010rsb.1_Missense_Mutation_p.S531R|C11orf30_uc010rsc.1_Missense_Mutation_p.S531R|C11orf30_uc001oxn.2_Missense_Mutation_p.S517R|C11orf30_uc010rsd.1_Missense_Mutation_p.S530R	p.S516R	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN			11	1691	+			516			Thr-rich.		B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	c.1548C>G	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118781	0.37436	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000533972;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032;ENST00000531998	.	.	.	5.38	2.45	0.29901	.	0.041673	0.85682	D	0.000000	T	0.61590	0.2359	L	0.29908	0.895	0.51233	D	0.999914	D;D;D;D;D;D	0.71674	0.995;0.995;0.995;0.998;0.995;0.998	D;D;D;D;D;D	0.75484	0.969;0.969;0.969;0.986;0.979;0.986	T	0.60732	-0.7205	9	0.52906	T	0.07	-4.6316	10.7625	0.46272	0.0:0.7889:0.0:0.2111	.	530;531;531;517;432;516	B7ZKT8;B7ZKU2;B7ZKU0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;EMSY_HUMAN	R	432;516;516;85;531;530;517;531;516;58	.	ENSP00000334130:S516R	S	+	3	2	C11orf30	75904868	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.582000	0.36568	0.637000	0.30526	0.557000	0.71058	AGC		0.443	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193		15	89	0	0	0	0.00499	0	15	89				
TENM4	26011	broad.mit.edu	37	11	78431415	78431415	+	Splice_Site	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:78431415C>T	ENST00000278550.7	-	25	4283	c.3821G>A	c.(3820-3822)aGt>aAt	p.S1274N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1274					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GTTGGCTTACCTATGTCTGAA	0.443																																							uc001ozl.3		NA																	0				ovary(2)|pancreas(2)	4						c.(3820-3822)AGT>AAT		odz, odd Oz/ten-m homolog 4							150.0	154.0	153.0					11																	78431415		1911	4110	6021	SO:0001630	splice_region_variant	26011				signal transduction	integral to membrane		g.chr11:78431415C>T	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3821+1G>A	11.37:g.78431415C>T							p.S1274N	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN			25	4284	-			1274			NHL 2.|Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	c.3821G>A	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005503	0.74932	.	.	ENSG00000149256	ENST00000278550	D	0.90324	-2.65	5.78	4.86	0.63082	.	0.083838	0.85682	D	0.000000	D	0.86887	0.6041	L	0.49126	1.545	0.58432	D	0.999999	P	0.37466	0.596	B	0.32211	0.142	D	0.85420	0.1142	9	.	.	.	.	16.6269	0.84974	0.1311:0.8689:0.0:0.0	.	1274	Q6N022	TEN4_HUMAN	N	1274	ENSP00000278550:S1274N	.	S	-	2	0	ODZ4	78109063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	1.569000	0.49696	0.655000	0.94253	AGT		0.443	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		Missense_Mutation	21	58	0	0	0	0.014323	0	21	58				
HEPHL1	341208	broad.mit.edu	37	11	93834393	93834393	+	Missense_Mutation	SNP	G	G	A	rs142611571	byFrequency	TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:93834393G>A	ENST00000315765.9	+	14	2475	c.2467G>A	c.(2467-2469)Gtc>Atc	p.V823I		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	823	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GGGCAACACCGTCCTGATCAT	0.448													G|||	2	0.000399361	0.0	0.0	5008	,	,		19921	0.001		0.0	False		,,,				2504	0.001						uc001pep.2		NA																	0				ovary(3)	3						c.(2467-2469)GTC>ATC		hephaestin-like 1 precursor		G	ILE/VAL	0,3808		0,0,1904	146.0	140.0	142.0		2467	-3.2	1.0	11	dbSNP_134	142	3,8225		0,3,4111	yes	missense	HEPHL1	NM_001098672.1	29	0,3,6015	AA,AG,GG		0.0365,0.0,0.0249	benign	823/1160	93834393	3,12033	1904	4114	6018	SO:0001583	missense	341208				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity	g.chr11:93834393G>A	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2467G>A	11.37:g.93834393G>A	ENSP00000313699:p.Val823Ile					uc001pen.1_Intron	p.V823I	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN			14	2624	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	823			Plastocyanin-like 5.|Extracellular (Potential).		Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	c.2467G>A	CCDS44710.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.010	-1.754582	0.00663	0.0	3.65E-4	ENSG00000181333	ENST00000315765	D	0.99194	-5.54	5.55	-3.21	0.05140	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.293568	0.38326	N	0.001739	D	0.93779	0.8011	N	0.04959	-0.14	0.22112	N	0.999352	B	0.09022	0.002	B	0.15052	0.012	D	0.85331	0.1090	10	0.10636	T	0.68	.	14.1256	0.65217	0.491:0.0:0.509:0.0	.	823	Q6MZM0	HPHL1_HUMAN	I	823	ENSP00000313699:V823I	ENSP00000313699:V823I	V	+	1	0	HEPHL1	93474041	0.005000	0.15991	0.981000	0.43875	0.011000	0.07611	0.109000	0.15417	-0.424000	0.07382	-2.049000	0.00408	GTC		0.448	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947		20	86	0	0	0	0.010504	0	20	86				
DSCAML1	57453	broad.mit.edu	37	11	117376278	117376278	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:117376278C>A	ENST00000321322.6	-	9	2134	c.2133G>T	c.(2131-2133)atG>atT	p.M711I	DSCAML1_ENST00000527706.1_Missense_Mutation_p.M441I	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	651	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCAGGGAGCTCATGAATTCCT	0.602																																							uc001prh.1		NA																	0				ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(2131-2133)ATG>ATT		Down syndrome cell adhesion molecule like 1							220.0	174.0	189.0					11																	117376278		2201	4296	6497	SO:0001583	missense	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117376278C>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2133G>T	11.37:g.117376278C>A	ENSP00000315465:p.Met711Ile						p.M711I	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	9	2135	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	651			Extracellular (Potential).|Ig-like C2-type 7.		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	c.2133G>T	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053557	0.55218	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.64803	-0.12;-0.12	4.91	4.91	0.64330	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54615	0.1869	N	0.13140	0.3	0.80722	D	1	B	0.29270	0.24	B	0.39771	0.309	T	0.55438	-0.8141	9	0.39692	T	0.17	.	18.2851	0.90112	0.0:1.0:0.0:0.0	.	651	Q8TD84	DSCL1_HUMAN	I	441;711;418	ENSP00000434335:M441I;ENSP00000315465:M711I	ENSP00000315465:M711I	M	-	3	0	DSCAML1	116881488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.872000	0.56085	2.541000	0.85698	0.491000	0.48974	ATG		0.602	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		13	42	1	0	5.50884e-06	0.013537	6.17739e-06	13	42				
IL10RA	3587	broad.mit.edu	37	11	117869812	117869812	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:117869812A>T	ENST00000227752.3	+	7	1313	c.1193A>T	c.(1192-1194)cAg>cTg	p.Q398L	IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000545409.1_Missense_Mutation_p.Q249L|IL10RA_ENST00000541785.1_Missense_Mutation_p.Q378L	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	398					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		AGCAGGGGCCAGGATGACAGT	0.647																																							uc001prv.2		NA																	0				ovary(1)	1						c.(1192-1194)CAG>CTG		interleukin 10 receptor, alpha precursor							45.0	47.0	46.0					11																	117869812		2200	4296	6496	SO:0001583	missense	3587					integral to membrane|plasma membrane	interleukin-10 receptor activity	g.chr11:117869812A>T	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.1193A>T	11.37:g.117869812A>T	ENSP00000227752:p.Gln398Leu					IL10RA_uc010rxl.1_Missense_Mutation_p.Q378L|IL10RA_uc010rxm.1_Missense_Mutation_p.Q378L|IL10RA_uc010rxn.1_Missense_Mutation_p.Q249L|IL10RA_uc001prw.2_Missense_Mutation_p.Q249L	p.Q398L	NM_001558	NP_001549	Q13651	I10R1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)	7	1270	+	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	398			Cytoplasmic (Potential).		A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	c.1193A>T	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.665292	0.88251	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.24350	1.86;1.86;1.86	5.73	-0.902	0.10537	.	0.813014	0.11172	N	0.591897	T	0.29850	0.0746	M	0.64997	1.995	0.28105	N	0.931235	D;D	0.56746	0.977;0.961	P;P	0.53593	0.73;0.617	T	0.19778	-1.0295	10	0.42905	T	0.14	-13.5007	1.2656	0.02010	0.406:0.2528:0.2188:0.1225	.	378;398	F5GYV8;Q13651	.;I10R1_HUMAN	L	398;378;249;378	ENSP00000227752:Q398L;ENSP00000441397:Q378L;ENSP00000443019:Q249L	ENSP00000227752:Q398L	Q	+	2	0	IL10RA	117375022	0.799000	0.28903	0.233000	0.24025	0.651000	0.38670	0.618000	0.24373	-0.125000	0.11703	0.460000	0.39030	CAG		0.647	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1			19	23	0	0	0	0.010504	0	19	23				
BSX	390259	broad.mit.edu	37	11	122848574	122848574	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:122848574C>T	ENST00000343035.2	-	3	533	c.485G>A	c.(484-486)cGg>cAg	p.R162Q		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	162					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		ATGCTTCATCCGCCGGTTCTG	0.532																																							uc010rzs.1		NA																	0					0						c.(484-486)CGG>CAG		brain specific homeobox							57.0	62.0	60.0					11																	122848574		1899	4136	6035	SO:0001583	missense	390259							g.chr11:122848574C>T		CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.485G>A	11.37:g.122848574C>T	ENSP00000344285:p.Arg162Gln						p.R162Q	NM_001098169	NP_001091639	Q3C1V8	BSH_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)	3	485	-		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	162			Homeobox.			Missense_Mutation	SNP	ENST00000343035.2	37	c.485G>A	CCDS41728.1	.	.	.	.	.	.	.	.	.	.	C	36	5.809959	0.96975	.	.	ENSG00000188909	ENST00000343035	D	0.99143	-5.48	5.4	5.4	0.78164	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99661	0.9874	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97332	0.9951	10	0.87932	D	0	.	19.1718	0.93581	0.0:1.0:0.0:0.0	.	162	Q3C1V8	BSH_HUMAN	Q	162	ENSP00000344285:R162Q	ENSP00000344285:R162Q	R	-	2	0	BSX	122353784	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.219000	0.78000	2.516000	0.84829	0.561000	0.74099	CGG		0.532	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317076.1	NM_001098169		15	64	0	0	0	0.00245	0	15	64				
HSPA8	3312	broad.mit.edu	37	11	122930391	122930391	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:122930391C>T	ENST00000532636.1	-	5	1029	c.910G>A	c.(910-912)Gaa>Aaa	p.E304K	HSPA8_ENST00000227378.3_Missense_Mutation_p.E304K|HSPA8_ENST00000526110.1_Missense_Mutation_p.E285K|HSPA8_ENST00000534319.1_Missense_Mutation_p.E68K|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000533540.1_Missense_Mutation_p.E158K|HSPA8_ENST00000526862.1_5'UTR|SNORD14C_ENST00000365382.1_RNA|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000534624.1_Missense_Mutation_p.E304K|HSPA8_ENST00000453788.2_Missense_Mutation_p.E304K			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	304	Interaction with BAG1.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GCATTCAGTTCTTCAAATCGG	0.488																																					Colon(21;486 594 5900 6733 14272)	Colon(21;486 594 5900 6733 14272)	uc001pyo.2		NA																	0				central_nervous_system(7)|lung(1)	8						c.(910-912)GAA>AAA		heat shock 70kDa protein 8 isoform 1							48.0	49.0	49.0					11																	122930391		2202	4299	6501	SO:0001583	missense	3312				cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding	g.chr11:122930391C>T	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.910G>A	11.37:g.122930391C>T	ENSP00000437125:p.Glu304Lys					HSPA8_uc009zbc.2_Missense_Mutation_p.E68K|HSPA8_uc001pyp.2_Missense_Mutation_p.E304K|HSPA8_uc010rzu.1_Missense_Mutation_p.E227K|HSPA8_uc009zbd.1_Missense_Mutation_p.E304K	p.E304K	NM_006597	NP_006588	P11142	HSP7C_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)	5	988	-		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	304			Interaction with BAG1.		Q9H3R6	Missense_Mutation	SNP	ENST00000532636.1	37	c.910G>A	CCDS8440.1	.	.	.	.	.	.	.	.	.	.	C	35	5.575171	0.96553	.	.	ENSG00000109971	ENST00000532636;ENST00000533540;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000534319;ENST00000526110;ENST00000528292	T;T;T;T;T;T;T;T	0.01113	5.32;5.32;5.32;5.32;5.32;5.32;5.32;5.32	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.09642	0.0237	M	0.90019	3.08	0.80722	D	1	P;D;D;P	0.59357	0.604;0.985;0.981;0.604	B;D;D;B	0.69824	0.374;0.966;0.943;0.374	T	0.01549	-1.1327	10	0.72032	D	0.01	-17.9682	17.9506	0.89052	0.0:1.0:0.0:0.0	.	304;304;304;304	Q53GZ6;E7ET08;P11142-2;P11142	.;.;.;HSP7C_HUMAN	K	304;158;304;304;304;68;285;244	ENSP00000437125:E304K;ENSP00000437189:E158K;ENSP00000432083:E304K;ENSP00000404372:E304K;ENSP00000227378:E304K;ENSP00000433316:E68K;ENSP00000433584:E285K;ENSP00000432884:E244K	ENSP00000227378:E304K	E	-	1	0	HSPA8	122435601	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.672000	0.83956	2.308000	0.77769	0.556000	0.70494	GAA		0.488	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1			13	51	0	0	0	0.013537	0	13	51				
OR8B8	26493	broad.mit.edu	37	11	124310805	124310805	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:124310805C>A	ENST00000328064.2	-	1	249	c.177G>T	c.(175-177)atG>atT	p.M59I		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	59					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GGAAGAAGTACATAGGGGTGT	0.448																																							uc010sal.1		NA																	0				ovary(1)	1						c.(175-177)ATG>ATT		olfactory receptor, family 8, subfamily B,							121.0	124.0	123.0					11																	124310805		2201	4299	6500	SO:0001583	missense	26493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124310805C>A	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.177G>T	11.37:g.124310805C>A	ENSP00000330280:p.Met59Ile						p.M59I	NM_012378	NP_036510	Q15620	OR8B8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)	1	177	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	59			Helical; Name=2; (Potential).		A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	c.177G>T	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.884277	0.72410	.	.	ENSG00000197125	ENST00000328064	T	0.09350	2.99	3.8	3.8	0.43715	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000011	T	0.47507	0.1449	H	0.96633	3.855	0.41118	D	0.985799	D	0.71674	0.998	D	0.79784	0.993	T	0.68988	-0.5264	10	0.87932	D	0	.	16.5769	0.84704	0.0:1.0:0.0:0.0	.	59	Q15620	OR8B8_HUMAN	I	59	ENSP00000330280:M59I	ENSP00000330280:M59I	M	-	3	0	OR8B8	123816015	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.666000	0.54540	2.399000	0.81585	0.557000	0.71058	ATG		0.448	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378		7	57	1	0	0.000157383	0.00308	0.000170683	7	57				
NFRKB	4798	broad.mit.edu	37	11	129746708	129746708	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr11:129746708C>T	ENST00000446488.3	-	16	1758	c.1655G>A	c.(1654-1656)gGc>gAc	p.G552D	NFRKB_ENST00000524794.1_Missense_Mutation_p.G577D|NFRKB_ENST00000524746.1_Missense_Mutation_p.G552D|NFRKB_ENST00000304521.5_Missense_Mutation_p.G552D	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	552					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GTCAAACACGCCCTTCACTGG	0.582																																							uc001qfi.2		NA																	0				ovary(3)	3						c.(1654-1656)GGC>GAC		nuclear factor related to kappaB binding protein							106.0	84.0	92.0					11																	129746708		2201	4297	6498	SO:0001583	missense	4798				DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding	g.chr11:129746708C>T		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.1655G>A	11.37:g.129746708C>T	ENSP00000400476:p.Gly552Asp					NFRKB_uc001qfg.2_Missense_Mutation_p.G577D|NFRKB_uc001qfh.2_Missense_Mutation_p.G575D|NFRKB_uc010sbw.1_Missense_Mutation_p.G562D|NFRKB_uc009zcr.2_5'Flank	p.G552D	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)	17	1856	-	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	552					Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	37	c.1655G>A	CCDS44770.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.835275	0.91117	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746;ENST00000531755	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.84138	0.5406	M	0.81802	2.56	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;1.0	D	0.84593	0.0668	9	0.87932	D	0	-18.6779	20.6439	0.99570	0.0:1.0:0.0:0.0	.	562;552;552;577	B4DSL1;Q6P4R8;Q6P4R8-3;Q6P4R8-2	.;NFRKB_HUMAN;.;.	D	552;552;577;552;562	.	ENSP00000303800:G552D	G	-	2	0	NFRKB	129251918	1.000000	0.71417	0.980000	0.43619	0.997000	0.91878	7.416000	0.80143	2.884000	0.98904	0.655000	0.94253	GGC		0.582	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165		30	40	0	0	0	0.008361	0	30	40				
KCNA6	3742	broad.mit.edu	37	12	4920657	4920657	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:4920657C>T	ENST00000280684.3	+	1	2316	c.1450C>T	c.(1450-1452)Cag>Tag	p.Q484*	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Nonsense_Mutation_p.Q484*			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	484					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CACTTGTGGGCAGCCTGCGCC	0.607										HNSCC(72;0.22)																													uc001qng.2		NA																	0				skin(2)|ovary(1)	3						c.(1450-1452)CAG>TAG		potassium voltage-gated channel, shaker-related							107.0	103.0	104.0					12																	4920657		2203	4300	6503	SO:0001587	stop_gained	3742					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:4920657C>T	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.1450C>T	12.37:g.4920657C>T	ENSP00000280684:p.Gln484*	HNSCC(72;0.22)					p.Q484*	NM_002235	NP_002226	P17658	KCNA6_HUMAN			1	2316	+			484						Nonsense_Mutation	SNP	ENST00000280684.3	37	c.1450C>T	CCDS8534.1	.	.	.	.	.	.	.	.	.	.	C	45	11.436885	0.99560	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	17.6514	0.88165	0.0:1.0:0.0:0.0	.	.	.	.	X	484	.	ENSP00000280684:Q484X	Q	+	1	0	KCNA6	4790918	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	4.448000	0.60027	2.641000	0.89580	0.591000	0.81541	CAG		0.607	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235		14	33	0	0	0	0.00245	0	14	33				
A2ML1	144568	broad.mit.edu	37	12	8995922	8995922	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:8995922G>A	ENST00000299698.7	+	12	1621	c.1441G>A	c.(1441-1443)Gca>Aca	p.A481T	A2ML1_ENST00000539547.1_5'Flank	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CCCGGCCGATGCAAGCCCTGA	0.562																																							uc001quz.3		NA																	0				ovary(2)|skin(1)	3						c.(1441-1443)GCA>ACA		alpha-2-macroglobulin-like 1 precursor							54.0	54.0	54.0					12																	8995922		1946	4133	6079	SO:0001583	missense	144568					extracellular space	endopeptidase inhibitor activity	g.chr12:8995922G>A	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1441G>A	12.37:g.8995922G>A	ENSP00000299698:p.Ala481Thr					A2ML1_uc001qva.1_Missense_Mutation_p.A61T|A2ML1_uc010sgm.1_5'Flank	p.A481T	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN			12	1539	+			325						Missense_Mutation	SNP	ENST00000299698.7	37	c.1441G>A	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	G	8.774	0.926547	0.18056	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459	T;T	0.30981	1.51;1.64	4.24	1.43	0.22495	Alpha-2-macroglobulin, N-terminal 2 (1);	0.679722	0.12903	N	0.429640	T	0.23014	0.0556	L	0.38838	1.175	0.09310	N	0.999999	P	0.37731	0.607	B	0.43155	0.41	T	0.14282	-1.0478	10	0.33940	T	0.23	.	1.4929	0.02460	0.1884:0.168:0.4705:0.1731	.	481	A8K2U0	A2ML1_HUMAN	T	481;481;31	ENSP00000299698:A481T;ENSP00000443174:A31T	ENSP00000299698:A481T	A	+	1	0	A2ML1	8887189	0.002000	0.14202	0.065000	0.19835	0.001000	0.01503	0.795000	0.26972	0.331000	0.23511	-0.258000	0.10820	GCA		0.562	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670		12	24	0	0	0	0.010729	0	12	24				
FAM60A	58516	broad.mit.edu	37	12	31440662	31440662	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:31440662T>C	ENST00000337682.4	-	5	780	c.412A>G	c.(412-414)Agt>Ggt	p.S138G	FAM60A_ENST00000539409.1_5'UTR|FAM60A_ENST00000454658.2_Missense_Mutation_p.S138G|FAM60A_ENST00000395766.1_5'UTR|FAM60A_ENST00000542983.1_5'UTR	NM_001135812.1	NP_001129284.1	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	138					negative regulation of cell migration (GO:0030336)	Sin3 complex (GO:0016580)				large_intestine(1)|lung(2)	3	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					GACTGGTTACTGTAACAAGGA	0.378																																							uc010sjz.1		NA																	0					0						c.(412-414)AGT>GGT		family with sequence similarity 60, member A							79.0	77.0	77.0					12																	31440662		2203	4300	6503	SO:0001583	missense	58516							g.chr12:31440662T>C	AF212220	CCDS8723.1	12p11.21	2012-11-30	2005-04-07	2005-04-07	ENSG00000139146	ENSG00000139146			30702	protein-coding gene	gene with protein product		615027	"""chromosome 12 open reading frame 14"""	C12orf14		11042152, 22984288, 22865885	Standard	NM_021238		Approved	TERA	uc001rke.3	Q9NP50	OTTHUMG00000168586	ENST00000337682.4:c.412A>G	12.37:g.31440662T>C	ENSP00000337477:p.Ser138Gly					FAM60A_uc001rkd.2_Missense_Mutation_p.S138G|FAM60A_uc010ska.1_Missense_Mutation_p.S138G|FAM60A_uc001rke.2_Missense_Mutation_p.S138G|FAM60A_uc010skb.1_RNA|FAM60A_uc001rkc.2_Missense_Mutation_p.S163G	p.S138G	NM_021238	NP_067061	Q9NP50	FA60A_HUMAN			5	651	-	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)		138					D3DUV8|Q9BSZ8	Missense_Mutation	SNP	ENST00000337682.4	37	c.412A>G	CCDS8723.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.256711	0.80246	.	.	ENSG00000139146	ENST00000337682;ENST00000454658;ENST00000398170	T;T	0.52295	0.67;0.67	4.47	4.47	0.54385	.	0.073856	0.85682	D	0.000000	T	0.67297	0.2878	M	0.78637	2.42	0.80722	D	1	D;D	0.63880	0.974;0.993	D;P	0.67725	0.953;0.876	T	0.72214	-0.4358	10	0.62326	D	0.03	-8.8739	14.0496	0.64727	0.0:0.0:0.0:1.0	.	138;179	Q9NP50;B7Z287	FA60A_HUMAN;.	G	138;138;179	ENSP00000337477:S138G;ENSP00000393279:S138G	ENSP00000337477:S138G	S	-	1	0	FAM60A	31331929	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.536000	0.82023	1.794000	0.52575	0.402000	0.26972	AGT		0.378	FAM60A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400347.1	NM_021238		10	8	0	0	0	0.008291	0	10	8				
ADAMTS20	80070	broad.mit.edu	37	12	43896082	43896082	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:43896082C>G	ENST00000389420.3	-	4	739	c.740G>C	c.(739-741)aGa>aCa	p.R247T	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.R247T	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	247					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CCTGGAATGTCTTCTTTCATC	0.338																																							uc010skx.1		NA																	0				central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(739-741)AGA>ACA		a disintegrin-like and metalloprotease with							177.0	173.0	174.0					12																	43896082		2203	4299	6502	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43896082C>G	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.740G>C	12.37:g.43896082C>G	ENSP00000374071:p.Arg247Thr						p.R247T	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	4	740	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	247					A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.740G>C	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	1.693	-0.503548	0.04261	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.62364	0.21;0.03	4.66	3.77	0.43336	.	0.293891	0.29133	N	0.013045	T	0.32071	0.0817	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11036	-1.0604	10	0.09338	T	0.73	.	8.5681	0.33552	0.0:0.7676:0.0:0.2324	.	247	P59510	ATS20_HUMAN	T	247	ENSP00000374071:R247T;ENSP00000448341:R247T	ENSP00000374068:R247T	R	-	2	0	ADAMTS20	42182349	1.000000	0.71417	0.234000	0.24042	0.648000	0.38561	2.840000	0.48215	1.273000	0.44346	0.655000	0.94253	AGA		0.338	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		12	42	0	0	0	0.010729	0	12	42				
SLC4A8	9498	broad.mit.edu	37	12	51856190	51856190	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:51856190G>C	ENST00000453097.2	+	10	1415	c.1198G>C	c.(1198-1200)Gag>Cag	p.E400Q	SLC4A8_ENST00000535225.2_Missense_Mutation_p.E347Q|SLC4A8_ENST00000514353.3_Missense_Mutation_p.E347Q|SLC4A8_ENST00000358657.3_Missense_Mutation_p.E427Q|SLC4A8_ENST00000394856.1_Missense_Mutation_p.E347Q	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		CCCTCCAGGAGAGTGGGATCC	0.493																																							uc001rys.1		NA																	0				ovary(3)|pancreas(1)|skin(1)	5						c.(1198-1200)GAG>CAG		solute carrier family 4, sodium bicarbonate							108.0	101.0	104.0					12																	51856190		2203	4300	6503	SO:0001583	missense	9498				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity	g.chr12:51856190G>C	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1198G>C	12.37:g.51856190G>C	ENSP00000405812:p.Glu400Gln					SLC4A8_uc010sni.1_Missense_Mutation_p.E347Q|SLC4A8_uc001rym.2_Missense_Mutation_p.E347Q|SLC4A8_uc001ryn.2_Missense_Mutation_p.E347Q|SLC4A8_uc001ryo.2_Missense_Mutation_p.E347Q|SLC4A8_uc001ryp.1_3'UTR|SLC4A8_uc010snj.1_Missense_Mutation_p.E427Q|SLC4A8_uc001ryq.3_Missense_Mutation_p.E400Q|SLC4A8_uc001ryr.2_Missense_Mutation_p.E400Q|SLC4A8_uc010snk.1_Missense_Mutation_p.E347Q	p.E400Q	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.15)	10	1376	+			400			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000453097.2	37	c.1198G>C	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	G	33	5.220930	0.95139	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	5.21	5.21	0.72293	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.045412	0.85682	D	0.000000	D	0.92642	0.7662	M	0.88377	2.95	0.80722	D	1	D;P;D;D;D;D	0.89917	0.999;0.928;1.0;1.0;0.995;0.998	D;P;D;D;D;D	0.97110	0.996;0.771;0.996;1.0;0.986;0.994	D	0.93521	0.6861	10	0.87932	D	0	.	18.3993	0.90510	0.0:0.0:1.0:0.0	.	347;427;347;400;400;400	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	Q	347;427;400;347;400;347;347	ENSP00000441520:E347Q;ENSP00000351483:E427Q;ENSP00000405812:E400Q;ENSP00000378325:E347Q;ENSP00000442561:E347Q	ENSP00000315789:E400Q	E	+	1	0	SLC4A8	50142457	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.809000	0.99208	2.807000	0.96579	0.650000	0.86243	GAG		0.493	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858		10	41	0	0	0	0.008291	0	10	41				
ESYT1	23344	broad.mit.edu	37	12	56536636	56536636	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:56536636C>T	ENST00000394048.5	+	27	3170	c.2906C>T	c.(2905-2907)gCc>gTc	p.A969V	ESYT1_ENST00000550878.1_3'UTR|ESYT1_ENST00000267113.4_Missense_Mutation_p.A979V|ESYT1_ENST00000541590.1_Missense_Mutation_p.A979V	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	969					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						GAGGCTCCAGCCGGGCCTCTG	0.522																																							uc001sjq.2		NA																	0				ovary(4)|skin(1)	5						c.(2905-2907)GCC>GTC		extended synaptotagmin-like protein 1							61.0	66.0	64.0					12																	56536636		2203	4300	6503	SO:0001583	missense	23344					integral to membrane		g.chr12:56536636C>T	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2906C>T	12.37:g.56536636C>T	ENSP00000377612:p.Ala969Val					ESYT1_uc001sjr.2_Missense_Mutation_p.A979V	p.A969V	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN			27	2956	+			969					A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	c.2906C>T	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970911	0.34754	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.07021	3.23;3.23;3.23	5.08	2.96	0.34315	C2 calcium/lipid-binding domain, CaLB (1);	0.543605	0.19442	N	0.114159	T	0.03348	0.0097	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.44019	-0.9355	10	0.26408	T	0.33	-0.2461	6.6483	0.22947	0.0:0.7813:0.0:0.2187	.	979;969	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	V	969;923;979;979	ENSP00000377612:A969V;ENSP00000267113:A979V;ENSP00000445952:A979V	ENSP00000267113:A979V	A	+	2	0	ESYT1	54822903	0.000000	0.05858	0.001000	0.08648	0.420000	0.31355	0.299000	0.19138	0.421000	0.25980	0.561000	0.74099	GCC		0.522	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292		3	48	0	0	0	0.004672	0	3	48				
SDR9C7	121214	broad.mit.edu	37	12	57327928	57327928	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:57327928G>T	ENST00000293502.1	-	1	261	c.118C>A	c.(118-120)Ctg>Atg	p.L40M		NM_148897.2	NP_683695.1	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C, member 7	40					oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	retinol dehydrogenase activity (GO:0004745)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)	7						TTGGCCAGCAGGTTCCCGAAG	0.537																																							uc010sqw.1		NA																	0				central_nervous_system(1)	1						c.(118-120)CTG>ATG		short chain dehydrogenase/reductase family 9C,							72.0	68.0	69.0					12																	57327928		2203	4300	6503	SO:0001583	missense	121214					cytoplasm	binding|oxidoreductase activity	g.chr12:57327928G>T	AY044434	CCDS8926.1	12q13.3	2014-09-04			ENSG00000170426	ENSG00000170426	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29958	protein-coding gene	gene with protein product		609769				12234675, 19027726	Standard	NM_148897		Approved	SDR-O, RDHS	uc010sqw.2	Q8NEX9	OTTHUMG00000171004	ENST00000293502.1:c.118C>A	12.37:g.57327928G>T	ENSP00000293502:p.Leu40Met						p.L40M	NM_148897	NP_683695	Q8NEX9	DR9C7_HUMAN			1	118	-			40			NADP (By similarity).		B3KVB4	Missense_Mutation	SNP	ENST00000293502.1	37	c.118C>A	CCDS8926.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429746	0.43122	.	.	ENSG00000170426	ENST00000293502	T	0.52057	0.68	5.18	2.25	0.28309	NAD(P)-binding domain (1);	0.448961	0.17982	N	0.155494	T	0.44074	0.1276	L	0.48877	1.53	0.39640	D	0.970308	B	0.25169	0.119	B	0.35312	0.2	T	0.37478	-0.9704	10	0.48119	T	0.1	.	10.1407	0.42734	0.0:0.1331:0.5908:0.2761	.	40	Q8NEX9	DR9C7_HUMAN	M	40	ENSP00000293502:L40M	ENSP00000293502:L40M	L	-	1	2	SDR9C7	55614195	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	1.990000	0.40717	0.296000	0.22592	-0.182000	0.12963	CTG		0.537	SDR9C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411211.1	NM_148897		9	18	1	0	1.76689e-08	0.006214	2.06659e-08	9	18				
GPR182	11318	broad.mit.edu	37	12	57389146	57389146	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:57389146C>A	ENST00000300098.1	+	2	372	c.153C>A	c.(151-153)acC>acA	p.T51T	HBCBP_ENST00000600202.1_5'Flank|RP11-474N8.5_ENST00000556850.1_RNA	NM_007264.3	NP_009195.1	O15218	GP182_HUMAN	G protein-coupled receptor 182	51					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	15						GCCAGAGCACCAAGCGCGTGG	0.592																																							uc001smk.2		NA																	0				lung(1)	1						c.(151-153)ACC>ACA		G protein-coupled receptor 182							205.0	182.0	190.0					12																	57389146		2203	4300	6503	SO:0001819	synonymous_variant	11318					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:57389146C>A	Y13583	CCDS8927.1	12q13.3	2012-08-21	2007-09-24	2007-09-24		ENSG00000166856		"""GPCR / Class A : Orphans"""	13708	protein-coding gene	gene with protein product		605307	"""adrenomedullin receptor"""	ADMR		9367907, 9535752	Standard	NM_007264		Approved	hrhAMR, G10D, AM-R	uc001smk.3	O15218		ENST00000300098.1:c.153C>A	12.37:g.57389146C>A						RDH16_uc010sqx.1_Intron	p.T51T	NM_007264	NP_009195	O15218	GP182_HUMAN			2	247	+			51			Extracellular (Potential).			Silent	SNP	ENST00000300098.1	37	c.153C>A	CCDS8927.1																																																																																				0.592	GPR182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411212.1	NM_007264		36	70	1	0	2.47316e-13	0.003271	3.10489e-13	36	70				
STAT6	6778	broad.mit.edu	37	12	57490729	57490729	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:57490729G>A	ENST00000300134.3	-	21	2583	c.2258C>T	c.(2257-2259)gCt>gTt	p.A753V	STAT6_ENST00000543873.2_Missense_Mutation_p.A753V|STAT6_ENST00000556155.1_Missense_Mutation_p.A753V|STAT6_ENST00000538913.2_Missense_Mutation_p.A643V|STAT6_ENST00000537215.2_Missense_Mutation_p.A643V|STAT6_ENST00000454075.3_Missense_Mutation_p.A753V	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	753					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						GCTGGACACAGCATGCTCCTG	0.612																																							uc009zpe.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(2257-2259)GCT>GTT		signal transducer and activator of transcription							53.0	57.0	56.0					12																	57490729		2203	4300	6503	SO:0001583	missense	6778				regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr12:57490729G>A	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.2258C>T	12.37:g.57490729G>A	ENSP00000300134:p.Ala753Val					STAT6_uc009zpf.2_Missense_Mutation_p.A753V|STAT6_uc001sna.2_Missense_Mutation_p.A753V|STAT6_uc010srb.1_Missense_Mutation_p.A643V|STAT6_uc010src.1_Missense_Mutation_p.A643V|STAT6_uc010srd.1_Missense_Mutation_p.A643V|STAT6_uc009zpg.2_Missense_Mutation_p.A802V	p.A753V	NM_003153	NP_003144	P42226	STAT6_HUMAN			21	2509	-			753					A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	c.2258C>T	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901924	0.72754	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721	D;D;D;D;D;D	0.92199	-2.73;-2.99;-2.73;-2.73;-2.99;-2.73	4.3	4.3	0.51218	.	0.578710	0.15555	N	0.256204	D	0.92103	0.7497	N	0.24115	0.695	0.32587	N	0.527681	D;D	0.63880	0.993;0.993	D;D	0.68192	0.956;0.956	D	0.92237	0.5797	10	0.72032	D	0.01	-5.9859	12.4621	0.55736	0.0:0.0:1.0:0.0	.	753;753	A8K4S9;P42226	.;STAT6_HUMAN	V	753;643;643;753;753;643;753;643	ENSP00000300134:A753V;ENSP00000445409:A643V;ENSP00000438451:A753V;ENSP00000451742:A753V;ENSP00000444530:A643V;ENSP00000401486:A753V	ENSP00000300134:A753V	A	-	2	0	STAT6	55776996	0.983000	0.35010	0.999000	0.59377	0.687000	0.40016	2.622000	0.46427	2.395000	0.81488	0.561000	0.74099	GCT		0.612	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153		3	51	0	0	0	0.009096	0	3	51				
INHBE	83729	broad.mit.edu	37	12	57850009	57850009	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:57850009G>T	ENST00000266646.2	+	2	647	c.431G>T	c.(430-432)cGa>cTa	p.R144L	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	144					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						AGGATCTTCCGATGGGGACCA	0.617											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(191;1808 2166 15720 36624 50371)	GBM(191;1808 2166 15720 36624 50371)	uc001snw.2		NA																	0				breast(2)|central_nervous_system(1)	3						c.(430-432)CGA>CTA		activin beta E precursor							139.0	137.0	138.0					12																	57850009		2203	4300	6503	SO:0001583	missense	83729				growth	extracellular region	growth factor activity|hormone activity	g.chr12:57850009G>T		CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.431G>T	12.37:g.57850009G>T	ENSP00000266646:p.Arg144Leu		OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1026		p.R144L	NM_031479	NP_113667	P58166	INHBE_HUMAN			2	655	+			144						Missense_Mutation	SNP	ENST00000266646.2	37	c.431G>T	CCDS8939.1	.	.	.	.	.	.	.	.	.	.	G	2.210	-0.381024	0.05000	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	T;T	0.81330	-1.48;-0.23	4.5	-0.407	0.12385	Transforming growth factor-beta, N-terminal (1);	0.695488	0.14000	N	0.348218	T	0.60676	0.2287	L	0.28274	0.84	0.09310	N	1	P	0.42908	0.793	B	0.35607	0.206	T	0.54146	-0.8337	10	0.11794	T	0.64	-4.7828	8.6129	0.33813	0.4425:0.0:0.5575:0.0	.	144	P58166	INHBE_HUMAN	L	89;144	ENSP00000450212:R89L;ENSP00000266646:R144L	ENSP00000266646:R144L	R	+	2	0	INHBE	56136276	0.719000	0.27986	0.004000	0.12327	0.203000	0.24098	0.535000	0.23114	0.015000	0.14971	-0.136000	0.14681	CGA		0.617	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406773.1	NM_031479		32	154	1	0	3.80469e-20	0.009535	5.29448e-20	32	154				
FRS2	10818	broad.mit.edu	37	12	69967839	69967839	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:69967839A>G	ENST00000550389.1	+	7	877	c.631A>G	c.(631-633)Agt>Ggt	p.S211G	FRS2_ENST00000397997.2_Missense_Mutation_p.S211G|FRS2_ENST00000549921.1_Missense_Mutation_p.S211G|FRS2_ENST00000299293.2_Missense_Mutation_p.S211G	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	211					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			AAACCGCACAAGTGTGCATGT	0.408																																							uc001suy.2		NA																	0				prostate(1)|kidney(1)	2						c.(631-633)AGT>GGT		fibroblast growth factor receptor substrate 2							87.0	84.0	85.0					12																	69967839		1906	4115	6021	SO:0001583	missense	10818				activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr12:69967839A>G	AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.631A>G	12.37:g.69967839A>G	ENSP00000447241:p.Ser211Gly					FRS2_uc001suz.2_Missense_Mutation_p.S211G|FRS2_uc009zrj.2_Missense_Mutation_p.S211G|FRS2_uc009zrk.2_Missense_Mutation_p.S211G	p.S211G	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)		10	1141	+	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		211					B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	ENST00000550389.1	37	c.631A>G	CCDS41809.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.339679	0.24339	.	.	ENSG00000166225	ENST00000299293;ENST00000549921;ENST00000550389;ENST00000397997	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.9	3.59	0.41128	.	0.439888	0.30501	N	0.009481	T	0.11750	0.0286	N	0.08118	0	0.23186	N	0.998154	B	0.02656	0.0	B	0.01281	0.0	T	0.26815	-1.0092	9	.	.	.	-3.1294	9.6937	0.40145	0.8614:0.0:0.1386:0.0	.	211	Q8WU20	FRS2_HUMAN	G	211	ENSP00000299293:S211G;ENSP00000450048:S211G;ENSP00000447241:S211G;ENSP00000381083:S211G	.	S	+	1	0	FRS2	68254106	1.000000	0.71417	0.603000	0.28903	0.771000	0.43674	4.966000	0.63715	1.069000	0.40788	0.529000	0.55759	AGT		0.408	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403760.1	NM_006654		7	44	0	0	0	0.001984	0	7	44				
TPH2	121278	broad.mit.edu	37	12	72388341	72388341	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:72388341C>A	ENST00000333850.3	+	8	1205	c.1064C>A	c.(1063-1065)gCc>gAc	p.A355D		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	355					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	CAGAAACTAGCCACGGTGAGT	0.393																																							uc009zrw.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1063-1065)GCC>GAC		tryptophan hydroxylase 2	L-Tryptophan(DB00150)						103.0	100.0	101.0					12																	72388341		2203	4300	6503	SO:0001583	missense	121278				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr12:72388341C>A	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1064C>A	12.37:g.72388341C>A	ENSP00000329093:p.Ala355Asp					TPH2_uc001swy.2_Missense_Mutation_p.A265D	p.A355D	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN			8	1205	+			355					A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	c.1064C>A	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	C	35	5.486422	0.96323	.	.	ENSG00000139287	ENST00000333850	D	0.99674	-6.36	5.91	5.91	0.95273	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99802	0.9915	H	0.96889	3.9	0.80722	D	1	P	0.50066	0.931	P	0.56514	0.8	D	0.97228	0.9882	10	0.87932	D	0	-8.9393	20.2985	0.98592	0.0:1.0:0.0:0.0	.	355	Q8IWU9	TPH2_HUMAN	D	355	ENSP00000329093:A355D	ENSP00000329093:A355D	A	+	2	0	TPH2	70674608	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.793000	0.96121	0.655000	0.94253	GCC		0.393	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353		17	15	1	0	4.7546e-09	0.004007	5.66141e-09	17	15				
LRRIQ1	84125	broad.mit.edu	37	12	85438563	85438563	+	Silent	SNP	A	A	G	rs202039164		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:85438563A>G	ENST00000393217.2	+	4	373	c.312A>G	c.(310-312)gaA>gaG	p.E104E		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	104										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CTGAATATGAAGAAAGTTCAG	0.264																																							uc001tac.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(310-312)GAA>GAG		leucine-rich repeats and IQ motif containing 1							51.0	56.0	54.0					12																	85438563		2187	4256	6443	SO:0001819	synonymous_variant	84125							g.chr12:85438563A>G	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.312A>G	12.37:g.85438563A>G						LRRIQ1_uc001tab.1_Silent_p.E104E|LRRIQ1_uc001taa.1_Silent_p.E104E|LRRIQ1_uc001tad.2_Silent_p.E12E	p.E104E	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	4	423	+			104					Q567P4|Q9BS17|Q9HA36	Silent	SNP	ENST00000393217.2	37	c.312A>G	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	0.104	-1.148622	0.01714	.	.	ENSG00000133640	ENST00000533414	.	.	.	4.79	-0.435	0.12279	.	.	.	.	.	T	0.21674	0.0522	.	.	.	0.27150	N	0.961424	.	.	.	.	.	.	T	0.25882	-1.0119	4	.	.	.	.	3.1195	0.06386	0.5213:0.0:0.2991:0.1796	.	.	.	.	R	2	.	.	K	+	2	0	LRRIQ1	83962694	0.998000	0.40836	0.160000	0.22671	0.126000	0.20510	0.786000	0.26844	0.106000	0.17784	0.377000	0.23210	AAG		0.264	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		5	12	0	0	0	0.000602	0	5	12				
FGD6	55785	broad.mit.edu	37	12	95603981	95603981	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:95603981T>A	ENST00000343958.4	-	2	1302	c.1079A>T	c.(1078-1080)aAa>aTa	p.K360I	FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000546711.1_Missense_Mutation_p.K360I|FGD6_ENST00000549499.1_Missense_Mutation_p.K360I	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	360					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						AACACTGATTTTATTGATTTT	0.373																																							uc001tdp.3		NA																	0				ovary(2)|breast(1)	3						c.(1078-1080)AAA>ATA		FYVE, RhoGEF and PH domain containing 6							91.0	93.0	93.0					12																	95603981		2203	4300	6503	SO:0001583	missense	55785				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr12:95603981T>A	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1079A>T	12.37:g.95603981T>A	ENSP00000344446:p.Lys360Ile					FGD6_uc009zsx.2_Intron	p.K360I	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN			2	1303	-			360					Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	c.1079A>T	CCDS31878.1	.	.	.	.	.	.	.	.	.	.	T	7.377	0.628084	0.14257	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.71222	-0.45;-0.55;-0.48	5.71	5.71	0.89125	.	0.436887	0.19629	N	0.109716	T	0.62901	0.2466	L	0.54323	1.7	0.09310	N	1	P	0.42409	0.779	B	0.33690	0.168	T	0.65142	-0.6240	10	0.87932	D	0	-0.1806	11.8478	0.52395	0.0:0.0698:0.0:0.9302	.	360	Q6ZV73	FGD6_HUMAN	I	360	ENSP00000344446:K360I;ENSP00000450342:K360I;ENSP00000449005:K360I	ENSP00000344446:K360I	K	-	2	0	FGD6	94128112	0.916000	0.31088	0.013000	0.15412	0.129000	0.20672	2.195000	0.42677	2.168000	0.68352	0.459000	0.35465	AAA		0.373	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351		18	45	0	0	0	0.00499	0	18	45				
UHRF1BP1L	23074	broad.mit.edu	37	12	100453175	100453175	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:100453175A>C	ENST00000279907.7	-	14	2092	c.1880T>G	c.(1879-1881)tTt>tGt	p.F627C	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.F277C	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	627										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						AAAGTCTTGAAACAAAGCTTC	0.358																																							uc001tgq.2		NA																	0				ovary(2)	2						c.(1879-1881)TTT>TGT		UHRF1 (ICBP90) binding protein 1-like isoform a							45.0	48.0	47.0					12																	100453175		2202	4297	6499	SO:0001583	missense	23074							g.chr12:100453175A>C		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1880T>G	12.37:g.100453175A>C	ENSP00000279907:p.Phe627Cys					UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.F277C	p.F627C	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN			14	2109	-			627					A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	37	c.1880T>G	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.886510	0.33348	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.11277	2.81;2.79	5.56	4.39	0.52855	.	0.114641	0.64402	N	0.000010	T	0.14614	0.0353	M	0.63843	1.955	0.80722	D	1	B	0.18863	0.031	B	0.23018	0.043	T	0.01762	-1.1279	10	0.51188	T	0.08	-11.3896	12.9394	0.58333	0.865:0.135:0.0:0.0	.	627	A0JNW5	UH1BL_HUMAN	C	627;277	ENSP00000279907:F627C;ENSP00000444824:F277C	ENSP00000279907:F627C	F	-	2	0	UHRF1BP1L	98977306	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.275000	0.78548	0.912000	0.36772	0.528000	0.53228	TTT		0.358	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947		5	25	0	0	0	0.001168	0	5	25				
ARL1	400	broad.mit.edu	37	12	101790284	101790284	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:101790284G>A	ENST00000261636.8	-	5	582	c.408C>T	c.(406-408)tcC>tcT	p.S136S	ARL1_ENST00000551688.1_Silent_p.S7S|ARL1_ENST00000551828.1_Silent_p.S119S|ARL1_ENST00000551671.1_Silent_p.S136S|ARL1_ENST00000539055.1_Silent_p.S90S|ARL1_ENST00000536227.1_Silent_p.S119S	NM_001177.4	NP_001168.1	P40616	ARL1_HUMAN	ADP-ribosylation factor-like 1	136					activation of phospholipase D activity (GO:0031584)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)|toxin metabolic process (GO:0009404)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	enzyme activator activity (GO:0008047)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			central_nervous_system(1)|upper_aerodigestive_tract(1)	2		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)		CCATCTCTGAGGAAGTCATGG	0.413																																							uc001tib.2		NA																	0				central_nervous_system(1)	1						c.(406-408)TCC>TCT		ADP-ribosylation factor-like 1							189.0	184.0	185.0					12																	101790284		1933	4130	6063	SO:0001819	synonymous_variant	400				small GTPase mediated signal transduction	Golgi membrane	enzyme activator activity|GTP binding|GTPase activity|metal ion binding|protein binding	g.chr12:101790284G>A	BX537387	CCDS44958.1, CCDS73510.1	12q23.3	2014-05-09						"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	692	protein-coding gene	gene with protein product		603425					Standard	XM_005268869		Approved	ARFL1	uc001tib.3	P40616	OTTHUMG00000170271	ENST00000261636.8:c.408C>T	12.37:g.101790284G>A						ARL1_uc010svn.1_Silent_p.S90S|ARL1_uc010svo.1_Intron|ARL1_uc001tic.2_Silent_p.S136S	p.S136S	NM_001177	NP_001168	P40616	ARL1_HUMAN		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)	5	557	-		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)	136					B4DWW1|P80417|Q53XB1	Silent	SNP	ENST00000261636.8	37	c.408C>T	CCDS44958.1																																																																																				0.413	ARL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408246.1	NM_001177		15	74	0	0	0	0.00499	0	15	74				
ALDH1L2	160428	broad.mit.edu	37	12	105467760	105467760	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:105467760C>T	ENST00000258494.9	-	2	212	c.72G>A	c.(70-72)aaG>aaA	p.K24K	ALDH1L2_ENST00000424857.2_Silent_p.K24K|RP11-61E11.1_ENST00000547750.1_RNA	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	24	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						TTAGTGCCAACTTCAGCTTGT	0.453																																							uc001tlc.2		NA																	0				skin(1)	1						c.(70-72)AAG>AAA		aldehyde dehydrogenase 1 family, member L2							116.0	111.0	113.0					12																	105467760		2203	4300	6503	SO:0001819	synonymous_variant	160428				10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding	g.chr12:105467760C>T	AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.72G>A	12.37:g.105467760C>T						ALDH1L2_uc009zup.2_RNA	p.K24K	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN			2	199	-			24			GART.		Q3SY68|Q68D62|Q6AI55|Q8N922	Silent	SNP	ENST00000258494.9	37	c.72G>A	CCDS31891.1																																																																																				0.453	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294		15	55	0	0	0	0.004007	0	15	55				
POLR3B	55703	broad.mit.edu	37	12	106786859	106786859	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:106786859G>T	ENST00000228347.4	+	10	996	c.774G>T	c.(772-774)gaG>gaT	p.E258D	POLR3B_ENST00000539066.1_Missense_Mutation_p.E200D	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	258				E -> A (in Ref. 1; AAM18214). {ECO:0000305}.	defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						TTGGAACAGAGGAGCACGTGA	0.463																																							uc001tlp.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(772-774)GAG>GAT		DNA-directed RNA polymerase III B isoform 1							217.0	202.0	207.0					12																	106786859		2203	4300	6503	SO:0001583	missense	55703				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding	g.chr12:106786859G>T	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.774G>T	12.37:g.106786859G>T	ENSP00000228347:p.Glu258Asp					POLR3B_uc001tlq.2_Missense_Mutation_p.E200D	p.E258D	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN			10	996	+			258	E -> A (in Ref. 1; AAM18214).				A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	c.774G>T	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	G	3.924	-0.017568	0.07681	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066;ENST00000549569	T;T;T	0.74947	-0.89;-0.89;-0.89	5.74	4.86	0.63082	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.095267	0.64402	D	0.000001	T	0.47322	0.1439	N	0.04132	-0.27	0.58432	D	0.999999	B	0.02656	0.0	B	0.08055	0.003	T	0.46721	-0.9171	10	0.02654	T	1	-26.8414	11.159	0.48505	0.1462:0.0:0.8538:0.0	.	258	Q9NW08	RPC2_HUMAN	D	258;258;200;16	ENSP00000228347:E258D;ENSP00000445721:E200D;ENSP00000448398:E16D	ENSP00000228347:E258D	E	+	3	2	POLR3B	105310989	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.076000	0.41548	1.438000	0.47492	-0.140000	0.14226	GAG		0.463	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082		26	62	1	0	6.32553e-13	0.004656	7.89837e-13	26	62				
ACAD10	80724	broad.mit.edu	37	12	112182571	112182571	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:112182571G>T	ENST00000313698.4	+	13	1994	c.1839G>T	c.(1837-1839)ccG>ccT	p.P613P	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000392636.2_Silent_p.P215P|ACAD10_ENST00000549590.1_Silent_p.P613P|ACAD10_ENST00000455480.2_Silent_p.P644P	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	613						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TCACAAATCCGTTAACAAGGT	0.532																																							uc001tsq.2		NA																	0				ovary(2)	2						c.(1837-1839)CCG>CCT		acyl-Coenzyme A dehydrogenase family, member 10							80.0	72.0	75.0					12																	112182571		2203	4300	6503	SO:0001819	synonymous_variant	80724						acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups	g.chr12:112182571G>T	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1839G>T	12.37:g.112182571G>T						ACAD10_uc001tsp.2_Silent_p.P613P|ACAD10_uc009zvx.2_Silent_p.P644P|ACAD10_uc001tss.1_RNA	p.P613P	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN			13	2039	+			613					G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Silent	SNP	ENST00000313698.4	37	c.1839G>T	CCDS31903.1																																																																																				0.532	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247		19	41	1	0	1.67942e-08	0.006122	1.97931e-08	19	41				
RASAL1	8437	broad.mit.edu	37	12	113559399	113559399	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:113559399C>A	ENST00000261729.5	-	6	658	c.343G>T	c.(343-345)Gaa>Taa	p.E115*	RASAL1_ENST00000548055.1_Nonsense_Mutation_p.E115*|RASAL1_ENST00000446861.3_Nonsense_Mutation_p.E115*|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000546530.1_Nonsense_Mutation_p.E115*			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	115					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CCCTGCACTTCTGCATCTGGG	0.557																																							uc001tum.1		NA																	0				ovary(2)|skin(2)	4						c.(343-345)GAA>TAA		RAS protein activator like 1							110.0	82.0	91.0					12																	113559399		2203	4300	6503	SO:0001587	stop_gained	8437				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity	g.chr12:113559399C>A	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.343G>T	12.37:g.113559399C>A	ENSP00000261729:p.Glu115*					RASAL1_uc010syp.1_Nonsense_Mutation_p.E115*|RASAL1_uc001tul.2_Nonsense_Mutation_p.E115*|RASAL1_uc001tun.1_Nonsense_Mutation_p.E115*|RASAL1_uc010syq.1_Nonsense_Mutation_p.E115*|RASAL1_uc001tuo.3_Nonsense_Mutation_p.E115*|RASAL1_uc010syr.1_Nonsense_Mutation_p.E115*	p.E115*	NM_004658	NP_004649	O95294	RASL1_HUMAN			6	636	-			115					B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Nonsense_Mutation	SNP	ENST00000261729.5	37	c.343G>T	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	C	37	6.199353	0.97371	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	.	.	.	5.43	5.43	0.79202	.	0.107275	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.0296	0.89279	0.0:1.0:0.0:0.0	.	.	.	.	X	115	.	ENSP00000261729:E115X	E	-	1	0	RASAL1	112043782	1.000000	0.71417	0.950000	0.38849	0.268000	0.26511	7.374000	0.79633	2.547000	0.85894	0.655000	0.94253	GAA		0.557	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		4	58	1	0	0.00909568	0.009096	0.00942198	4	58				
FBXO21	23014	broad.mit.edu	37	12	117595761	117595761	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:117595761C>G	ENST00000330622.5	-	10	1454	c.1455G>C	c.(1453-1455)gaG>gaC	p.E485D	FBXO21_ENST00000427718.2_Missense_Mutation_p.E478D			O94952	FBX21_HUMAN	F-box protein 21	485					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		CTACGCCCACCTCCTCCTTTT	0.577																																					GBM(168;452 2038 13535 17701 43680)	GBM(168;452 2038 13535 17701 43680)	uc001twk.2		NA																	0				kidney(1)	1						c.(1453-1455)GAG>GAC		F-box only protein 21 isoform 1							225.0	196.0	206.0					12																	117595761		2203	4300	6503	SO:0001583	missense	23014				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr12:117595761C>G	AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1455G>C	12.37:g.117595761C>G	ENSP00000328187:p.Glu485Asp					FBXO21_uc001twj.2_Missense_Mutation_p.E478D|FBXO21_uc009zwq.2_Missense_Mutation_p.E418D|FBXO21_uc001twl.1_Missense_Mutation_p.E98D	p.E485D	NM_033624	NP_296373	O94952	FBX21_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0291)	10	1494	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		485					B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	ENST00000330622.5	37	c.1455G>C	CCDS9184.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.58|10.58	1.389562|1.389562	0.25118|0.25118	.|.	.|.	ENSG00000135108|ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622;ENST00000548840|ENST00000550180	T;T|.	0.51817|.	0.69;0.78|.	5.02|5.02	4.12|4.12	0.48240|0.48240	F-box domain, Skp2-like (1);|.	0.201281|.	0.44902|.	N|.	0.000410|.	T|T	0.49830|0.49830	0.1580|0.1580	N|N	0.19112|0.19112	0.55|0.55	0.43734|0.43734	D|D	0.996229|0.996229	B;B;B;P|.	0.39311|.	0.0;0.011;0.001;0.667|.	B;B;B;B|.	0.35727|.	0.0;0.014;0.003;0.209|.	T|T	0.43861|0.43861	-0.9365|-0.9365	10|5	0.30854|.	T|.	0.27|.	-15.6762|-15.6762	15.2993|15.2993	0.73933|0.73933	0.0:0.8446:0.1554:0.0|0.0:0.8446:0.1554:0.0	.|.	334;228;485;478|.	Q8IUQ5;B3KQC8;O94952;O94952-1|.	.;.;FBX21_HUMAN;.|.	D|R	478;394;334;485;137|362	ENSP00000414468:E478D;ENSP00000328187:E485D|.	ENSP00000257563:E394D|.	E|G	-|-	3|1	2|0	FBXO21|FBXO21	116080144|116080144	0.952000|0.952000	0.32445|0.32445	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	0.323000|0.323000	0.19593|0.19593	1.303000|1.303000	0.44873|0.44873	0.655000|0.655000	0.94253|0.94253	GAG|GGT		0.577	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404409.1	NM_033624		33	150	0	0	0	0.004289	0	33	150				
RAB35	11021	broad.mit.edu	37	12	120546238	120546238	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:120546238G>A	ENST00000229340.5	-	2	274	c.86C>T	c.(85-87)gCa>gTa	p.A29V	RAB35_ENST00000534951.1_Missense_Mutation_p.A29V	NM_001167606.1|NM_006861.6	NP_001161078.1|NP_006852.1	Q15286	RAB35_HUMAN	RAB35, member RAS oncogene family	29					antigen processing and presentation (GO:0019882)|cellular response to nerve growth factor stimulus (GO:1990090)|cytokinesis (GO:0000910)|endosomal transport (GO:0016197)|GTP catabolic process (GO:0006184)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|protein localization (GO:0008104)|protein localization to endosome (GO:0036010)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cell projection membrane (GO:0031253)|clathrin-coated endocytic vesicle (GO:0045334)|coated pit (GO:0005905)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)		AGTGTTGTCTGCAAAACGCAA	0.572																																							uc001txm.1		NA																	0					0						c.(85-87)GCA>GTA		RAB35, member RAS oncogene family							62.0	63.0	63.0					12																	120546238		1973	4156	6129	SO:0001583	missense	11021				cytokinesis|endosome transport|protein transport|small GTPase mediated signal transduction	cell projection membrane|clathrin-coated endocytic vesicle|coated pit|endosome|intercellular bridge|melanosome	GTP binding|GTPase activity|phosphatidylinositol-4,5-bisphosphate binding	g.chr12:120546238G>A	X79781	CCDS41846.1, CCDS53836.1	12q24	2008-07-28			ENSG00000111737	ENSG00000111737		"""RAB, member RAS oncogene"""	9774	protein-coding gene	gene with protein product		604199					Standard	NM_001167606		Approved	H-ray	uc009zww.2	Q15286	OTTHUMG00000169159	ENST00000229340.5:c.86C>T	12.37:g.120546238G>A	ENSP00000229340:p.Ala29Val					RAB35_uc009zww.1_5'UTR|RAB35_uc010szh.1_Missense_Mutation_p.A29V	p.A29V	NM_006861	NP_006852	Q15286	RAB35_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.248)	2	231	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		29					B2R6E0|B4E390	Missense_Mutation	SNP	ENST00000229340.5	37	c.86C>T	CCDS41846.1	.	.	.	.	.	.	.	.	.	.	G	34	5.329071	0.95733	.	.	ENSG00000111737	ENST00000229340;ENST00000427416;ENST00000534951;ENST00000538903	T;T;T	0.74842	-0.88;-0.88;-0.88	5.73	5.73	0.89815	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.73345	0.3575	N	0.05306	-0.075	0.80722	D	1	D;D	0.69078	0.997;0.969	P;P	0.62560	0.904;0.751	T	0.80341	-0.1423	10	0.87932	D	0	.	19.9046	0.97002	0.0:0.0:1.0:0.0	.	29;29	B4E390;Q15286	.;RAB35_HUMAN	V	29	ENSP00000229340:A29V;ENSP00000441883:A29V;ENSP00000443994:A29V	ENSP00000229340:A29V	A	-	2	0	RAB35	119030621	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	9.395000	0.97266	2.719000	0.93026	0.557000	0.71058	GCA		0.572	RAB35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402599.2			3	27	0	0	0	0.009096	0	3	27				
RSRC2	65117	broad.mit.edu	37	12	123003488	123003488	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:123003488C>G	ENST00000331738.7	-	4	441	c.296G>C	c.(295-297)aGa>aCa	p.R99T	RSRC2_ENST00000354654.2_Missense_Mutation_p.R51T	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	99	Ser-rich.						poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TAGTCGCTCTCTTCCTTTATC	0.378																																							uc001ucr.2		NA																	0				ovary(1)	1						c.(295-297)AGA>ACA		arginine/serine-rich coiled-coil 2 isoform a							343.0	316.0	325.0					12																	123003488		2203	4300	6503	SO:0001583	missense	65117							g.chr12:123003488C>G	AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.296G>C	12.37:g.123003488C>G	ENSP00000330188:p.Arg99Thr					RSRC2_uc001uco.2_5'UTR|RSRC2_uc001ucp.2_Missense_Mutation_p.R40T|RSRC2_uc001ucq.2_5'UTR|RSRC2_uc001ucs.2_5'UTR|RSRC2_uc001uct.2_Missense_Mutation_p.R51T|RSRC2_uc001ucu.2_Missense_Mutation_p.R99T	p.R99T	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)	4	442	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		99			Ser-rich.		Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	ENST00000331738.7	37	c.296G>C	CCDS31920.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919283	0.73098	.	.	ENSG00000111011	ENST00000331738;ENST00000354654;ENST00000418773;ENST00000344591	T;T;T	0.23950	1.88;1.88;1.88	5.7	5.7	0.88788	.	0.050263	0.85682	D	0.000000	T	0.39145	0.1067	N	0.24115	0.695	0.51767	D	0.999932	D;P;D;P	0.57899	0.981;0.945;0.981;0.945	D;D;D;D	0.66351	0.943;0.943;0.943;0.943	T	0.12863	-1.0531	10	0.52906	T	0.07	.	20.1864	0.98220	0.0:1.0:0.0:0.0	.	99;51;99;40	F5GXM2;Q7L4I2-2;Q7L4I2;E1B6W4	.;.;RSRC2_HUMAN;.	T	99;51;99;40	ENSP00000330188:R99T;ENSP00000346678:R51T;ENSP00000343315:R40T	ENSP00000330188:R99T	R	-	2	0	RSRC2	121569441	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.671000	0.54576	2.836000	0.97738	0.655000	0.94253	AGA		0.378	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3	NM_023012		4	152	0	0	0	0.009096	0	4	152				
DHX37	57647	broad.mit.edu	37	12	125449154	125449154	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:125449154C>G	ENST00000308736.2	-	15	1929	c.1831G>C	c.(1831-1833)Gag>Cag	p.E611Q	DHX37_ENST00000544745.1_Missense_Mutation_p.E398Q	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	611	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CGAGTCCCCTCCGGTGGAGGC	0.542																																							uc001ugy.2		NA																	0				skin(1)	1						c.(1831-1833)GAG>CAG		DEAH (Asp-Glu-Ala-His) box polypeptide 37							63.0	61.0	61.0					12																	125449154		2203	4300	6503	SO:0001583	missense	57647						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr12:125449154C>G	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1831G>C	12.37:g.125449154C>G	ENSP00000311135:p.Glu611Gln						p.E611Q	NM_032656	NP_116045	Q8IY37	DHX37_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)	15	1930	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		611			Helicase C-terminal.		Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	c.1831G>C	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.903855	0.52333	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.75367	-0.93;-0.93	5.17	5.17	0.71159	Helicase, C-terminal (3);	0.172074	0.49305	D	0.000145	T	0.81283	0.4790	L	0.55213	1.73	0.34148	D	0.667232	D	0.69078	0.997	D	0.65010	0.931	D	0.86162	0.1594	10	0.51188	T	0.08	-31.8098	13.1958	0.59738	0.0:0.7094:0.2906:0.0	.	611	Q8IY37	DHX37_HUMAN	Q	611;398	ENSP00000311135:E611Q;ENSP00000439009:E398Q	ENSP00000311135:E611Q	E	-	1	0	DHX37	124015107	0.999000	0.42202	0.962000	0.40283	0.510000	0.34073	3.222000	0.51223	2.419000	0.82065	0.462000	0.41574	GAG		0.542	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656		5	65	0	0	0	0.000602	0	5	65				
PIWIL1	9271	broad.mit.edu	37	12	130845802	130845802	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr12:130845802C>A	ENST00000245255.3	+	15	2015	c.1743C>A	c.(1741-1743)acC>acA	p.T581T		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	581	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.|RNA-binding. {ECO:0000250}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ATTGCCCTACCCCAAGTCAGT	0.453																																							uc001uik.2		NA																	0				ovary(2)	2						c.(1741-1743)ACC>ACA		piwi-like 1							96.0	90.0	92.0					12																	130845802		2203	4300	6503	SO:0001819	synonymous_variant	9271				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding	g.chr12:130845802C>A	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1743C>A	12.37:g.130845802C>A						PIWIL1_uc001uij.1_Silent_p.T581T	p.T581T	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)	15	1833	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		581			RNA-binding (By similarity).|Piwi.		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	ENST00000245255.3	37	c.1743C>A	CCDS9268.1																																																																																				0.453	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			7	33	1	0	5.18039e-06	0.00308	5.83742e-06	7	33				
FLT3	2322	broad.mit.edu	37	13	28588591	28588591	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr13:28588591C>T	ENST00000241453.7	-	23	2938	c.2857G>A	c.(2857-2859)Gcg>Acg	p.A953T	FLT3_ENST00000469894.1_5'UTR|FLT3_ENST00000537084.1_Missense_Mutation_p.A912T|FLT3_ENST00000380982.4_Missense_Mutation_p.A956T	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	953					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTACATACCGCTTCTTCTGCA	0.418			"""Mis, O"""		"""AML, ALL"""																																		uc001urw.2		NA		Dom	yes		13	13q12	2322	Mis|O	fms-related tyrosine kinase 3			L			AML|ALL		0		p.A953V(1)		haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549						c.(2857-2859)GCG>ACG		fms-related tyrosine kinase 3 precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						83.0	77.0	79.0					13																	28588591		2203	4300	6503	SO:0001583	missense	2322				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	g.chr13:28588591C>T	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2857G>A	13.37:g.28588591C>T	ENSP00000241453:p.Ala953Thr					FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.A912T	p.A953T	NM_004119	NP_004110	P36888	FLT3_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	23	2939	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	953			Cytoplasmic (Potential).		A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	37	c.2857G>A	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385302	0.25031	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.78003	-1.07;-1.14;-0.84	5.79	5.79	0.91817	.	0.000000	0.56097	D	0.000032	T	0.64505	0.2604	L	0.27053	0.805	0.37519	D	0.917462	P;B	0.51933	0.949;0.085	B;B	0.43301	0.415;0.03	T	0.65376	-0.6183	10	0.23891	T	0.37	.	8.8936	0.35449	0.15:0.7749:0.0:0.0751	.	912;953	P36888-2;P36888	.;FLT3_HUMAN	T	953;956;912	ENSP00000241453:A953T;ENSP00000370369:A956T;ENSP00000438139:A912T	ENSP00000241453:A953T	A	-	1	0	FLT3	27486591	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	1.600000	0.36762	2.727000	0.93392	0.591000	0.81541	GCG		0.418	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2			5	10	0	0	0	0.001168	0	5	10				
TRPC4	7223	broad.mit.edu	37	13	38211107	38211107	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr13:38211107C>T	ENST00000379705.3	-	11	3724	c.2867G>A	c.(2866-2868)aGt>aAt	p.S956N	TRPC4_ENST00000358477.2_Missense_Mutation_p.S872N|TRPC4_ENST00000379679.1_Missense_Mutation_p.S783N|TRPC4_ENST00000355779.2_Missense_Mutation_p.S815N|TRPC4_ENST00000379681.3_Missense_Mutation_p.S961N|TRPC4_ENST00000379673.2_Missense_Mutation_p.S807N|TRPC4_ENST00000338947.5_Missense_Mutation_p.S783N|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000447043.1_Missense_Mutation_p.S815N			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	956	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		ATAGTCTATACTAGAGTCCTC	0.438																																							uc001uws.2		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(2866-2868)AGT>AAT		transient receptor potential cation channel,							158.0	141.0	147.0					13																	38211107		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38211107C>T	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2867G>A	13.37:g.38211107C>T	ENSP00000369027:p.Ser956Asn					TRPC4_uc010abv.2_Missense_Mutation_p.S536N|TRPC4_uc001uwt.2_Missense_Mutation_p.S872N|TRPC4_uc010tey.1_Missense_Mutation_p.S815N|TRPC4_uc010abw.2_Missense_Mutation_p.S783N|TRPC4_uc010abx.2_Missense_Mutation_p.S961N|TRPC4_uc010aby.2_Missense_Mutation_p.S807N	p.S956N	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	11	3102	-			956			Binds to ITPR1, ITPR2 and ITPR3.|Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.2867G>A	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	C	2.044	-0.419277	0.04766	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T;T	0.70986	-0.1;-0.1;0.1;0.1;0.13;-0.27;-0.53;0.13	5.56	2.77	0.32553	.	2.057480	0.01655	N	0.024782	T	0.67126	0.2860	N	0.08118	0	0.09310	N	1	B;B;P;B;B;B	0.39044	0.0;0.0;0.656;0.0;0.0;0.0	B;B;P;B;B;B	0.57776	0.0;0.0;0.827;0.001;0.002;0.0	T	0.65298	-0.6202	10	0.33141	T	0.24	-12.6422	3.8492	0.08948	0.1447:0.5784:0.1407:0.1361	.	815;807;961;783;872;956	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	N	956;961;783;783;815;872;807;815	ENSP00000369027:S956N;ENSP00000369003:S961N;ENSP00000342580:S783N;ENSP00000369001:S783N;ENSP00000348025:S815N;ENSP00000351264:S872N;ENSP00000368995:S807N;ENSP00000414316:S815N	ENSP00000342580:S783N	S	-	2	0	TRPC4	37109107	0.000000	0.05858	0.011000	0.14972	0.013000	0.08279	0.303000	0.19210	2.633000	0.89246	0.655000	0.94253	AGT		0.438	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		14	22	0	0	0	0.001855	0	14	22				
SLITRK1	114798	broad.mit.edu	37	13	84455574	84455574	+	Silent	SNP	A	A	T	rs536419290		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr13:84455574A>T	ENST00000377084.2	-	1	954	c.69T>A	c.(67-69)gtT>gtA	p.V23V		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	23	LRRNT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TCTCTTTGCAAACGTCCCCTG	0.473																																							uc001vlk.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(67-69)GTT>GTA		slit and trk like 1 protein precursor							91.0	90.0	90.0					13																	84455574		2203	4300	6503	SO:0001819	synonymous_variant	114798					integral to membrane		g.chr13:84455574A>T	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.69T>A	13.37:g.84455574A>T							p.V23V	NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	955	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	23			LRRNT.|Extracellular (Potential).		Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	c.69T>A	CCDS9464.1																																																																																				0.473	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		21	17	0	0	0	0.014323	0	21	17				
RAP2A	5911	broad.mit.edu	37	13	98086961	98086961	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr13:98086961C>T	ENST00000245304.4	+	1	486	c.237C>T	c.(235-237)atC>atT	p.I79I		NM_021033.6	NP_066361.1	P10114	RAP2A_HUMAN	RAP2A, member of RAS oncogene family	79					actin cytoskeleton reorganization (GO:0031532)|cellular protein localization (GO:0034613)|establishment of protein localization (GO:0045184)|negative regulation of cell migration (GO:0030336)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of dendrite morphogenesis (GO:0048814)|regulation of JNK cascade (GO:0046328)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.166)			AGGGCTTCATCCTCGTCTACA	0.632																																							uc001vnd.2		NA																	0				central_nervous_system(1)	1						c.(235-237)ATC>ATT		RAP2A, member of RAS oncogene family precursor							101.0	92.0	95.0					13																	98086961		2203	4300	6503	SO:0001819	synonymous_variant	5911				actin cytoskeleton reorganization|cellular protein localization|establishment of protein localization|positive regulation of protein autophosphorylation|Rap protein signal transduction|regulation of dendrite morphogenesis|regulation of JNK cascade	recycling endosome membrane	GTP binding|GTPase activity|protein binding	g.chr13:98086961C>T	AF205602	CCDS9485.1	13q34	2014-05-09			ENSG00000125249	ENSG00000125249			9861	protein-coding gene	gene with protein product		179540		RAP2			Standard	NM_021033		Approved	K-REV	uc001vnd.3	P10114	OTTHUMG00000017240	ENST00000245304.4:c.237C>T	13.37:g.98086961C>T							p.I79I	NM_021033	NP_066361	P10114	RAP2A_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.166)		1	487	+	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		79					B2RCJ1|Q5JSC1|Q5JSC2	Silent	SNP	ENST00000245304.4	37	c.237C>T	CCDS9485.1																																																																																				0.632	RAP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045528.4			11	49	0	0	0	0.008291	0	11	49				
OR4M1	441670	broad.mit.edu	37	14	20249415	20249415	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr14:20249415G>T	ENST00000315957.4	+	1	1015	c.934G>T	c.(934-936)Gag>Tag	p.E312*		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTGTGTGAAGAGAAGTGAAA	0.358																																							uc010tku.1		NA																	0					0						c.(934-936)GAG>TAG		olfactory receptor, family 4, subfamily M,							38.0	39.0	39.0					14																	20249415		2183	4290	6473	SO:0001587	stop_gained	441670				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20249415G>T		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.934G>T	14.37:g.20249415G>T	ENSP00000319654:p.Glu312*						p.E312*	NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	934	+	all_cancers(95;0.00108)		312			Cytoplasmic (Potential).		B9EH18|Q6IFA3	Nonsense_Mutation	SNP	ENST00000315957.4	37	c.934G>T	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	16.88	3.245638	0.59103	.	.	ENSG00000176299	ENST00000315957	.	.	.	4.27	3.3	0.37823	.	0.128975	0.35466	N	0.003191	.	.	.	.	.	.	0.27628	N	0.948138	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8967	9.0322	0.36264	0.0:0.0:0.6743:0.3257	.	.	.	.	X	312	.	ENSP00000319654:E312X	E	+	1	0	OR4M1	19319255	0.998000	0.40836	1.000000	0.80357	0.571000	0.35966	1.789000	0.38724	2.391000	0.81399	0.506000	0.49869	GAG		0.358	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1			8	16	1	0	0.00307968	0.00308	0.00325586	8	16				
OR10G2	26534	broad.mit.edu	37	14	22102534	22102534	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr14:22102534G>T	ENST00000542433.1	-	1	562	c.465C>A	c.(463-465)gtC>gtA	p.V155V		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		TGGAGCCGGCGACCCAAGCTC	0.562																																							uc010tmc.1		NA																	0				skin(1)	1						c.(463-465)GTC>GTA		olfactory receptor, family 10, subfamily G,							40.0	43.0	42.0					14																	22102534		2203	4300	6503	SO:0001819	synonymous_variant	26534				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22102534G>T		CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.465C>A	14.37:g.22102534G>T							p.V155V	NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN		GBM - Glioblastoma multiforme(265;0.0142)	1	465	-	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	155			Helical; Name=4; (Potential).		B2RPD0	Silent	SNP	ENST00000542433.1	37	c.465C>A	CCDS32047.1																																																																																				0.562	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1			33	33	1	0	2.85442e-18	0.010818	3.89009e-18	33	33				
CMTM5	116173	broad.mit.edu	37	14	23847972	23847972	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr14:23847972C>T	ENST00000339180.4	+	3	590	c.374C>T	c.(373-375)cCc>cTc	p.P125L	CMTM5_ENST00000555731.1_Intron|CMTM5_ENST00000359320.3_Intron|CMTM5_ENST00000342473.4_Intron|CMTM5_ENST00000397227.3_Intron|CMTM5_ENST00000382809.2_Intron			Q96DZ9	CKLF5_HUMAN	CKLF-like MARVEL transmembrane domain containing 5	125	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	8	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		GGCTTGACCCCCCCGGGCTGG	0.647																																							uc010akm.2		NA																	0					0						c.(373-375)CCC>CTC		chemokine-like factor superfamily 5 isoform a							27.0	29.0	28.0					14																	23847972		876	1991	2867	SO:0001583	missense	116173				chemotaxis	extracellular space|integral to membrane	cytokine activity	g.chr14:23847972C>T	BC013109	CCDS9598.1, CCDS32050.1, CCDS73617.1, CCDS73618.1, CCDS73619.1	14q11.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000166091	ENSG00000166091			19176	protein-coding gene	gene with protein product		607888	"""chemokine-like factor super family 5"", ""chemokine-like factor superfamily 5"""	CKLFSF5			Standard	NM_138460		Approved	FLJ37521	uc001wjs.3	Q96DZ9	OTTHUMG00000028751	ENST00000339180.4:c.374C>T	14.37:g.23847972C>T	ENSP00000344819:p.Pro125Leu					CMTM5_uc001wjs.2_Intron|CMTM5_uc001wjt.2_Intron|CMTM5_uc010akn.2_Intron|CMTM5_uc001wju.2_Intron|CMTM5_uc010ako.2_Intron	p.P125L	NM_138460	NP_612469	Q96DZ9	CKLF5_HUMAN		GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)	3	818	+	all_cancers(95;2e-05)		125			MARVEL.		E9PH91|Q5PY48	Missense_Mutation	SNP	ENST00000339180.4	37	c.374C>T		.	.	.	.	.	.	.	.	.	.	C	14.21	2.466214	0.43839	.	.	ENSG00000166091	ENST00000339180	T	0.25250	1.81	3.56	-1.5	0.08691	Marvel (1);	964.188000	0.00166	N	0.000000	T	0.18551	0.0445	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27938	-1.0059	9	0.59425	D	0.04	-0.7048	4.7812	0.13202	0.0:0.4472:0.235:0.3179	.	125	Q96DZ9	CKLF5_HUMAN	L	125	ENSP00000344819:P125L	ENSP00000344819:P125L	P	+	2	0	CMTM5	22917812	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.163000	0.09997	-0.294000	0.08973	-0.379000	0.06801	CCC		0.647	CMTM5-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000133708.2			4	19	0	0	0	0.009096	0	4	19				
NFATC4	4776	broad.mit.edu	37	14	24839538	24839538	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr14:24839538C>T	ENST00000250373.4	+	2	1075	c.934C>T	c.(934-936)Cct>Tct	p.P312S	NFATC4_ENST00000557451.1_Missense_Mutation_p.P242S|NFATC4_ENST00000554050.1_Missense_Mutation_p.P312S|NFATC4_ENST00000556279.1_Missense_Mutation_p.P344S|NFATC4_ENST00000554473.1_5'Flank|NFATC4_ENST00000554966.1_Missense_Mutation_p.P325S|NFATC4_ENST00000422617.3_Missense_Mutation_p.P300S|NFATC4_ENST00000554344.1_Missense_Mutation_p.P242S|NFATC4_ENST00000554661.1_Missense_Mutation_p.P242S|NFATC4_ENST00000553879.1_Missense_Mutation_p.P242S|NFATC4_ENST00000555453.1_Missense_Mutation_p.P300S|NFATC4_ENST00000556169.1_Missense_Mutation_p.P300S|NFATC4_ENST00000555167.1_5'Flank|NFATC4_ENST00000440487.2_3'UTR|NFATC4_ENST00000554591.1_Missense_Mutation_p.P375S|NFATC4_ENST00000553708.1_Missense_Mutation_p.P312S|NFATC4_ENST00000413692.2_Missense_Mutation_p.P375S|NFATC4_ENST00000539237.2_Missense_Mutation_p.P344S|NFATC4_ENST00000556759.1_5'Flank|NFATC4_ENST00000424781.2_Missense_Mutation_p.P325S|NFATC4_ENST00000553469.1_Missense_Mutation_p.P344S|NFATC4_ENST00000555590.1_Missense_Mutation_p.P325S	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	312	Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CCCGGGCTCCCCTGGTCCCTT	0.677																																							uc001wpc.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(934-936)CCT>TCT		nuclear factor of activated T-cells,							21.0	28.0	26.0					14																	24839538		2197	4286	6483	SO:0001583	missense	4776				cell differentiation|inflammatory response|transcription from RNA polymerase II promoter	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr14:24839538C>T	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.934C>T	14.37:g.24839538C>T	ENSP00000250373:p.Pro312Ser					NFATC4_uc010tok.1_Missense_Mutation_p.P375S|NFATC4_uc010tol.1_Missense_Mutation_p.P375S|NFATC4_uc010alr.2_Missense_Mutation_p.P375S|NFATC4_uc010als.2_Missense_Mutation_p.P325S|NFATC4_uc010tom.1_Missense_Mutation_p.P325S|NFATC4_uc010ton.1_Missense_Mutation_p.P325S|NFATC4_uc010too.1_Missense_Mutation_p.P325S|NFATC4_uc010alt.2_Missense_Mutation_p.P344S|NFATC4_uc010top.1_Missense_Mutation_p.P344S|NFATC4_uc010toq.1_Missense_Mutation_p.P344S|NFATC4_uc010alu.2_Intron|NFATC4_uc010tor.1_Missense_Mutation_p.P312S|NFATC4_uc010tos.1_Missense_Mutation_p.P242S|NFATC4_uc010tot.1_Missense_Mutation_p.P300S|NFATC4_uc010tou.1_Missense_Mutation_p.P242S|NFATC4_uc010tov.1_Missense_Mutation_p.P300S|NFATC4_uc010tow.1_Missense_Mutation_p.P242S|NFATC4_uc010alv.2_Missense_Mutation_p.P300S|NFATC4_uc010tox.1_Missense_Mutation_p.P242S|NFATC4_uc001wpd.2_5'Flank|NFATC4_uc010toy.1_5'Flank|NFATC4_uc010toz.1_5'Flank	p.P312S	NM_004554	NP_004545	Q14934	NFAC4_HUMAN		GBM - Glioblastoma multiforme(265;0.018)	2	1255	+			312			Pro-rich.		B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	37	c.934C>T	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	C	1.765	-0.485917	0.04352	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69	4.26	3.35	0.38373	.	0.166557	0.41294	N	0.000919	T	0.08044	0.0201	N	0.11673	0.155	0.80722	D	1	B;B;B;B;P;B;B;B;B;B;B;B;B;B	0.50443	0.0;0.0;0.191;0.0;0.935;0.002;0.0;0.0;0.0;0.0;0.004;0.0;0.323;0.001	B;B;B;B;P;B;B;B;B;B;B;B;B;B	0.46026	0.0;0.001;0.112;0.0;0.501;0.011;0.0;0.001;0.001;0.001;0.02;0.001;0.19;0.003	T	0.37572	-0.9700	10	0.21540	T	0.41	-3.8275	8.5271	0.33311	0.0:0.8905:0.0:0.1095	.	300;300;344;344;325;325;325;375;375;300;344;289;375;312	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;B4DU09;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	S	375;375;325;325;325;344;344;344;312;312;312;242;242;242;300;242;300;300	ENSP00000388910:P375S;ENSP00000452039:P375S;ENSP00000451224:P325S;ENSP00000450644:P325S;ENSP00000388668:P325S;ENSP00000439350:P344S;ENSP00000452270:P344S;ENSP00000451502:P344S;ENSP00000451151:P312S;ENSP00000250373:P312S;ENSP00000450590:P312S;ENSP00000452349:P242S;ENSP00000450469:P242S;ENSP00000450733:P242S;ENSP00000451454:P300S;ENSP00000451284:P242S;ENSP00000396788:P300S;ENSP00000450686:P300S	ENSP00000250373:P312S	P	+	1	0	NFATC4	23909378	0.527000	0.26306	0.994000	0.49952	0.328000	0.28507	1.773000	0.38563	1.109000	0.41680	0.467000	0.42956	CCT		0.677	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554		10	42	0	0	0	0.006214	0	10	42				
BAZ1A	11177	broad.mit.edu	37	14	35262077	35262077	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr14:35262077C>T	ENST00000382422.2	-	11	1741	c.1414G>A	c.(1414-1416)Gaa>Aaa	p.E472K	BAZ1A_ENST00000360310.1_Missense_Mutation_p.E472K|BAZ1A_ENST00000358716.4_Missense_Mutation_p.E472K			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	472	DDT. {ECO:0000255|PROSITE- ProRule:PRU00063}.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		AAAAGCAATTCACACAGTGGG	0.383																																							uc001wsk.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7						c.(1414-1416)GAA>AAA		bromodomain adjacent to zinc finger domain, 1A							136.0	126.0	129.0					14																	35262077		2203	4300	6503	SO:0001583	missense	11177				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding	g.chr14:35262077C>T	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.1414G>A	14.37:g.35262077C>T	ENSP00000371859:p.Glu472Lys					BAZ1A_uc001wsl.2_Missense_Mutation_p.E472K	p.E472K	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)	12	1982	-	Breast(36;0.0388)|Hepatocellular(127;0.158)		472			DDT.		Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	c.1414G>A	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	C	34	5.400470	0.96030	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	D;D;D	0.91295	-2.82;-2.82;-2.82	5.08	5.08	0.68730	DDT domain superfamily (1);DDT domain, subgroup (1);DDT domain (1);	0.000000	0.85682	D	0.000000	D	0.93822	0.8024	L	0.47716	1.5	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.83275	0.991;0.996	D	0.94342	0.7571	10	0.72032	D	0.01	.	18.8467	0.92210	0.0:1.0:0.0:0.0	.	472;472	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	K	472;472;472;156	ENSP00000351555:E472K;ENSP00000371859:E472K;ENSP00000353458:E472K	ENSP00000351555:E472K	E	-	1	0	BAZ1A	34331828	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.028000	0.76470	2.527000	0.85204	0.655000	0.94253	GAA		0.383	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1			7	34	0	0	0	0.00308	0	7	34				
ANGEL1	23357	broad.mit.edu	37	14	77255719	77255719	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr14:77255719T>C	ENST00000251089.2	-	10	1977	c.1865A>G	c.(1864-1866)tAt>tGt	p.Y622C	ANGEL1_ENST00000557179.1_Missense_Mutation_p.Y187C|RP11-488C13.5_ENST00000556072.1_lincRNA	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	622										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		TCCATCTCGATACAGCCTGTG	0.557																																							uc001xsv.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1864-1866)TAT>TGT		angel homolog 1							86.0	82.0	83.0					14																	77255719		2203	4300	6503	SO:0001583	missense	23357							g.chr14:77255719T>C	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.1865A>G	14.37:g.77255719T>C	ENSP00000251089:p.Tyr622Cys					uc001xsu.1_5'Flank|ANGEL1_uc010tvf.1_Intron	p.Y622C	NM_015305	NP_056120	Q9UNK9	ANGE1_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)	10	1978	-			622					B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	ENST00000251089.2	37	c.1865A>G	CCDS9852.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527229	0.44969	.	.	ENSG00000013523	ENST00000251089;ENST00000557179	T;T	0.80393	1.43;-1.37	5.64	-1.69	0.08186	Endonuclease/exonuclease/phosphatase (2);	0.872438	0.10343	N	0.686037	T	0.78207	0.4247	L	0.40543	1.245	0.09310	N	0.999997	B	0.33904	0.431	P	0.51918	0.684	T	0.69327	-0.5174	10	0.39692	T	0.17	-0.8519	2.2107	0.03947	0.1156:0.1323:0.2398:0.5122	.	622	Q9UNK9	ANGE1_HUMAN	C	622;187	ENSP00000251089:Y622C;ENSP00000451534:Y187C	ENSP00000251089:Y622C	Y	-	2	0	ANGEL1	76325472	0.002000	0.14202	0.667000	0.29798	0.720000	0.41350	0.152000	0.16302	-0.182000	0.10602	0.379000	0.24179	TAT		0.557	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305		40	24	0	0	0	0.00623	0	40	24				
NPAP1	23742	broad.mit.edu	37	15	24923368	24923368	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr15:24923368C>A	ENST00000329468.2	+	1	2828	c.2354C>A	c.(2353-2355)tCt>tAt	p.S785Y		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	785					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CAGAAAACCTCTCTCCCCAGT	0.547																																							uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2353-2355)TCT>TAT		hypothetical protein LOC23742							116.0	132.0	126.0					15																	24923368		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923368C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2354C>A	15.37:g.24923368C>A	ENSP00000333735:p.Ser785Tyr						p.S785Y	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	2828	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	785						Missense_Mutation	SNP	ENST00000329468.2	37	c.2354C>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	6.018	0.371669	0.11409	.	.	ENSG00000185823	ENST00000329468	T	0.08896	3.04	1.62	-3.24	0.05094	.	.	.	.	.	T	0.05547	0.0146	L	0.34521	1.04	0.09310	N	1	D	0.53462	0.96	B	0.41202	0.35	T	0.21484	-1.0244	9	0.72032	D	0.01	.	4.0375	0.09737	0.0:0.3387:0.4773:0.184	.	785	Q9NZP6	CO002_HUMAN	Y	785	ENSP00000333735:S785Y	ENSP00000333735:S785Y	S	+	2	0	C15orf2	22474461	0.002000	0.14202	0.000000	0.03702	0.010000	0.07245	-0.334000	0.07883	-0.806000	0.04398	-0.714000	0.03626	TCT		0.547	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		64	66	1	0	8.81991e-31	0.01441	1.26941e-30	64	66				
HERC2	8924	broad.mit.edu	37	15	28389852	28389852	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr15:28389852G>C	ENST00000261609.7	-	72	11215	c.11107C>G	c.(11107-11109)Cgc>Ggc	p.R3703G		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACGGTGAAGCGCCAGCCCCAG	0.567																																							uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(11107-11109)CGC>GGC		hect domain and RLD 2							107.0	86.0	93.0					15																	28389852		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28389852G>C	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11107C>G	15.37:g.28389852G>C	ENSP00000261609:p.Arg3703Gly						p.R3703G	NM_004667	NP_004658	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	72	11213	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3703						Missense_Mutation	SNP	ENST00000261609.7	37	c.11107C>G	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403861	0.83230	.	.	ENSG00000128731	ENST00000261609	T	0.49139	0.79	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.65238	0.2672	M	0.71206	2.165	0.80722	D	1	D	0.71674	0.998	D	0.64321	0.924	T	0.68413	-0.5415	10	0.87932	D	0	.	14.1958	0.65670	0.0:0.0:0.8504:0.1496	.	3703	O95714	HERC2_HUMAN	G	3703	ENSP00000261609:R3703G	ENSP00000261609:R3703G	R	-	1	0	HERC2	26063447	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.442000	0.80503	2.638000	0.89438	0.655000	0.94253	CGC		0.567	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		11	32	0	0	0	0.001855	0	11	32				
RPL4	6124	broad.mit.edu	37	15	66795792	66795792	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr15:66795792C>A	ENST00000307961.6	-	2	171	c.79G>T	c.(79-81)Gta>Tta	p.V27L	SNORD18A_ENST00000363753.1_RNA|RPL4_ENST00000564517.1_5'Flank|ZWILCH_ENST00000535141.2_5'Flank|SNORD18C_ENST00000362704.1_RNA|SNORD16_ENST00000362803.1_RNA|RPL4_ENST00000568588.1_5'UTR|SNORD18B_ENST00000365659.1_RNA|ZWILCH_ENST00000565627.1_5'Flank|ZWILCH_ENST00000446801.2_5'Flank|ZWILCH_ENST00000307897.5_5'Flank	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	27					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						GCCTTGAATACAGCAGGCAAA	0.443																																							uc002apv.2		NA																	0					0						c.(79-81)GTA>TTA		ribosomal protein L4							63.0	59.0	60.0					15																	66795792		2201	4298	6499	SO:0001583	missense	6124				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome	g.chr15:66795792C>A	AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.79G>T	15.37:g.66795792C>A	ENSP00000311430:p.Val27Leu					RPL4_uc010bhr.2_5'UTR|RPL4_uc002apw.2_5'UTR|RPL4_uc002apx.2_5'UTR|RPL4_uc010ujq.1_Missense_Mutation_p.V27L|SNORD18C_uc010bhs.1_5'Flank|SNORD18B_uc002apy.1_5'Flank|SNORD16_uc010bht.2_5'Flank|SNORD18A_uc002apz.1_5'Flank|ZWILCH_uc010bhu.1_5'Flank|ZWILCH_uc002aqb.2_5'Flank|ZWILCH_uc002aqa.2_5'Flank|ZWILCH_uc010bhv.2_5'Flank	p.V27L	NM_000968	NP_000959	P36578	RL4_HUMAN			2	135	-			27					A8K502|P39029|Q4VBR0|Q969Z9	Missense_Mutation	SNP	ENST00000307961.6	37	c.79G>T	CCDS10218.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.913688	0.72983	.	.	ENSG00000174444	ENST00000307961;ENST00000449253;ENST00000432669	.	.	.	4.51	4.51	0.55191	Ribosomal protein L4 domain (2);	0.000000	0.85682	D	0.000000	T	0.81394	0.4813	M	0.92833	3.35	0.80722	D	1	B;B	0.21381	0.0;0.055	B;B	0.34452	0.011;0.183	D	0.83494	0.0071	9	0.72032	D	0.01	-11.3325	17.4321	0.87542	0.0:1.0:0.0:0.0	.	27;27	B4DFI6;P36578	.;RL4_HUMAN	L	27	.	ENSP00000311430:V27L	V	-	1	0	RPL4	64582846	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.805000	0.69143	2.348000	0.79779	0.561000	0.74099	GTA		0.443	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2	NM_000968		13	21	1	0	6.81908e-15	0.00245	8.89947e-15	13	21				
C15orf59	388135	broad.mit.edu	37	15	74032288	74032288	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr15:74032288G>T	ENST00000569673.1	-	3	2056	c.852C>A	c.(850-852)gcC>gcA	p.A284A	C15orf59_ENST00000379822.4_Silent_p.A284A|C15orf59_ENST00000558834.1_5'UTR			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	284										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TCTGTCTAGTGGCTGTGTAGG	0.527																																							uc002avy.2		NA																	0				pancreas(1)	1						c.(850-852)GCC>GCA		hypothetical protein LOC388135							87.0	97.0	94.0					15																	74032288		2196	4296	6492	SO:0001819	synonymous_variant	388135							g.chr15:74032288G>T		CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.852C>A	15.37:g.74032288G>T							p.A284A	NM_001039614	NP_001034703	Q2T9L4	CO059_HUMAN			2	1197	-			284						Silent	SNP	ENST00000569673.1	37	c.852C>A	CCDS32289.1																																																																																				0.527	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614		57	97	1	0	1.3268e-25	0.01441	1.8861e-25	57	97				
FAM173A	65990	broad.mit.edu	37	16	771923	771923	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:771923C>T	ENST00000569529.1	+	3	690	c.390C>T	c.(388-390)cgC>cgT	p.R130R	FAM173A_ENST00000219535.3_Silent_p.R130R|FAM173A_ENST00000564000.1_Silent_p.R130R	NM_023933.2	NP_076422.1	Q9BQD7	F173A_HUMAN	family with sequence similarity 173, member A	130						integral component of membrane (GO:0016021)				pancreas(1)	1						TCTGCTATCGCCGCAAGGATC	0.721																																							uc002cje.2		NA																	0				pancreas(1)	1						c.(388-390)CGC>CGT		hypothetical protein LOC65990							5.0	8.0	7.0					16																	771923		2002	4082	6084	SO:0001819	synonymous_variant	65990					integral to membrane		g.chr16:771923C>T	BC002624	CCDS10423.1, CCDS59254.1	16p13.3	2008-06-19	2008-06-19	2008-06-19	ENSG00000103254	ENSG00000103254			14152	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 24"""	C16orf24			Standard	NM_023933		Approved	MGC2494	uc002cje.4	Q9BQD7	OTTHUMG00000121177	ENST00000569529.1:c.390C>T	16.37:g.771923C>T							p.R130R	NM_023933	NP_076422	Q9BQD7	F173A_HUMAN			3	507	+			130					A2IDD4	Silent	SNP	ENST00000569529.1	37	c.390C>T	CCDS10423.1																																																																																				0.721	FAM173A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241667.2	NM_023933		6	6	0	0	0	0.001168	0	6	6				
TPSAB1	7177	broad.mit.edu	37	16	1291244	1291244	+	Missense_Mutation	SNP	A	A	G	rs150845192	byFrequency	TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:1291244A>G	ENST00000338844.3	+	3	185	c.152A>G	c.(151-153)cAc>cGc	p.H51R	TPSAB1_ENST00000461509.2_Missense_Mutation_p.H58R	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	51	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		H -> R (in allele alpha; dbSNP:rs1060281).		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.H51R(1)		NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CTGAGAGTCCACGGCCCATAC	0.711													G|||	6	0.00119808	0.0038	0.0	5008	,	,		17027	0.0		0.0	False		,,,				2504	0.001						uc002ckz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(151-153)CAC>CGC		tryptase alpha/beta 1 precursor																																				SO:0001583	missense	7177				defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity	g.chr16:1291244A>G	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.152A>G	16.37:g.1291244A>G	ENSP00000343577:p.His51Arg					TPSAB1_uc010uux.1_5'UTR	p.H51R	NM_003294	NP_003285	Q15661	TRYB1_HUMAN			3	204	+		Hepatocellular(780;0.00369)	51			Peptidase S1.		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	37	c.152A>G	CCDS10431.1	.	.	.	.	.	.	.	.	.	.	G	4.011	-0.000521	0.07819	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.87729	-2.29;-2.29	3.9	-2.91	0.05631	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.935460	0.02380	N	0.078734	T	0.61887	0.2383	N	0.00413	-1.525	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.60662	-0.7219	10	0.13108	T	0.6	.	9.4252	0.38574	0.4176:0.0:0.5824:0.0	.	51	Q15661	TRYB1_HUMAN	R	51;58	ENSP00000343577:H51R;ENSP00000418247:H58R	ENSP00000343577:H51R	H	+	2	0	TPSAB1	1231245	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.868000	0.04236	-0.567000	0.06046	-1.818000	0.00600	CAC		0.711	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294		3	52	0	0	0	0.009096	0	3	52				
TMEM204	79652	broad.mit.edu	37	16	1584550	1584550	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:1584550G>A	ENST00000566264.1	+	1	977	c.274G>A	c.(274-276)Gtc>Atc	p.V92I	IFT140_ENST00000361339.5_5'Flank|TMEM204_ENST00000253934.5_Missense_Mutation_p.V92I|IFT140_ENST00000426508.2_Intron	NM_024600.5	NP_078876.2	Q9BSN7	TM204_HUMAN	transmembrane protein 204	92					lymph vessel development (GO:0001945)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to stress (GO:0006950)|smooth muscle cell differentiation (GO:0051145)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|cervix(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Hepatocellular(780;0.219)				CCGAGGCACCGTCAAACGTAA	0.667																																							uc002cmc.2		NA																	0					0						c.(274-276)GTC>ATC		transmembrane protein 204							55.0	65.0	62.0					16																	1584550		2077	4191	6268	SO:0001583	missense	79652				response to stress	adherens junction|integral to membrane		g.chr16:1584550G>A		CCDS42098.1	16p13.3	2008-02-05	2008-01-08	2008-01-08		ENSG00000131634			14158	protein-coding gene	gene with protein product		611002	"""chromosome 16 open reading frame 30"""	C16orf30			Standard	NM_024600		Approved	FLJ20898	uc002cmc.3	Q9BSN7		ENST00000566264.1:c.274G>A	16.37:g.1584550G>A	ENSP00000454945:p.Val92Ile					IFT140_uc002clz.2_Intron|IFT140_uc002cmb.2_Intron|TMEM204_uc002cmd.2_Missense_Mutation_p.V92I|TMEM204_uc010brr.1_Missense_Mutation_p.V92I	p.V92I	NM_024600	NP_078876	Q9BSN7	TM204_HUMAN			2	672	+		Hepatocellular(780;0.219)	92			Extracellular (Potential).		D3DU76|Q3KRC1|Q9H7G5	Missense_Mutation	SNP	ENST00000566264.1	37	c.274G>A	CCDS42098.1	.	.	.	.	.	.	.	.	.	.	G	35	5.522818	0.96431	.	.	ENSG00000131634	ENST00000253934	T	0.54675	0.56	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.64724	0.2624	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.68469	-0.5400	10	0.87932	D	0	-7.97	18.7306	0.91734	0.0:0.0:1.0:0.0	.	92	Q9BSN7	TM204_HUMAN	I	92	ENSP00000253934:V92I	ENSP00000253934:V92I	V	+	1	0	TMEM204	1524551	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.394000	0.97261	2.422000	0.82143	0.655000	0.94253	GTC		0.667	TMEM204-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432610.1	NM_024600		22	66	0	0	0	0.010504	0	22	66				
GRIN2A	2903	broad.mit.edu	37	16	9934621	9934621	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:9934621G>A	ENST00000396573.2	-	8	1843	c.1534C>T	c.(1534-1536)Ctc>Ttc	p.L512F	GRIN2A_ENST00000404927.2_Missense_Mutation_p.L512F|GRIN2A_ENST00000396575.2_Missense_Mutation_p.L512F|GRIN2A_ENST00000330684.3_Missense_Mutation_p.L512F|GRIN2A_ENST00000562109.1_Missense_Mutation_p.L512F|GRIN2A_ENST00000535259.1_Missense_Mutation_p.L355F	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	512	Glutamate binding. {ECO:0000250}.				directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTGATGGTGAGCGAGCCAACT	0.443																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(1534-1536)CTC>TTC		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						101.0	78.0	86.0					16																	9934621		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9934621G>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1534C>T	16.37:g.9934621G>A	ENSP00000379818:p.Leu512Phe					GRIN2A_uc010uym.1_Missense_Mutation_p.L512F|GRIN2A_uc010uyn.1_Missense_Mutation_p.L355F|GRIN2A_uc002czr.3_Missense_Mutation_p.L512F	p.L512F	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN			7	2082	-			512			Extracellular (Potential).|Glutamate binding (By similarity).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.1534C>T	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559463	0.65538	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	5.3	4.32	0.51571	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.50257	0.1605	L	0.60957	1.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.81914	0.992;0.995;0.934	T	0.47032	-0.9148	9	.	.	.	.	14.2817	0.66216	0.0:0.0:0.8505:0.1495	.	355;512;512	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	F	512;512;355;512;512	ENSP00000379818:L512F;ENSP00000385872:L512F;ENSP00000441572:L355F;ENSP00000332549:L512F;ENSP00000379820:L512F	.	L	-	1	0	GRIN2A	9842122	1.000000	0.71417	0.764000	0.31436	0.363000	0.29612	9.695000	0.98691	1.184000	0.42957	0.655000	0.94253	CTC		0.443	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			10	28	0	0	0	0.008291	0	10	28				
GRIN2A	2903	broad.mit.edu	37	16	10273919	10273919	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:10273919G>A	ENST00000396573.2	-	3	659	c.350C>T	c.(349-351)tCc>tTc	p.S117F	GRIN2A_ENST00000404927.2_Missense_Mutation_p.S117F|GRIN2A_ENST00000396575.2_Missense_Mutation_p.S117F|GRIN2A_ENST00000330684.3_Missense_Mutation_p.S117F|GRIN2A_ENST00000562109.1_Missense_Mutation_p.S117F	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	117					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGTGTGGGAGGAGATAAAATC	0.607																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(349-351)TCC>TTC		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						77.0	72.0	74.0					16																	10273919		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:10273919G>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.350C>T	16.37:g.10273919G>A	ENSP00000379818:p.Ser117Phe					GRIN2A_uc010uym.1_Missense_Mutation_p.S117F|GRIN2A_uc002czr.3_Missense_Mutation_p.S117F|GRIN2A_uc010buk.2_Missense_Mutation_p.S117F	p.S117F	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN			2	898	-			117			Extracellular (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.350C>T	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557291	0.86231	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	4.54	4.54	0.55810	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91912	0.7439	M	0.86953	2.85	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.93120	0.6524	9	.	.	.	.	16.2901	0.82747	0.0:0.0:1.0:0.0	.	117;117;117	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	F	117	ENSP00000379818:S117F;ENSP00000385872:S117F;ENSP00000332549:S117F;ENSP00000379820:S117F	.	S	-	2	0	GRIN2A	10181420	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.738000	0.98835	2.088000	0.63022	0.561000	0.74099	TCC		0.607	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			4	60	0	0	0	0.009096	0	4	60				
MYH11	4629	broad.mit.edu	37	16	15865511	15865511	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:15865511G>A	ENST00000300036.5	-	9	1057	c.948C>T	c.(946-948)ccC>ccT	p.P316P	MYH11_ENST00000576790.2_Silent_p.P316P|MYH11_ENST00000452625.2_Silent_p.P323P|MYH11_ENST00000396324.3_Silent_p.P323P	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	316	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTGCTGGGATGGGCACAAAGC	0.517			T	CBFB	AML																																		uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		0				ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(946-948)CCC>CCT		smooth muscle myosin heavy chain 11 isoform							118.0	97.0	104.0					16																	15865511		2197	4300	6497	SO:0001819	synonymous_variant	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15865511G>A	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.948C>T	16.37:g.15865511G>A						MYH11_uc002ddv.2_Silent_p.P323P|MYH11_uc002ddw.2_Silent_p.P316P|MYH11_uc002ddx.2_Silent_p.P323P|MYH11_uc010bvg.2_Silent_p.P148P|MYH11_uc002dea.1_Silent_p.P22P	p.P316P	NM_002474	NP_002465	P35749	MYH11_HUMAN			9	1055	-			316			Myosin head-like.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	c.948C>T	CCDS10565.1																																																																																				0.517	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		15	41	0	0	0	0.004007	0	15	41				
XYLT1	64131	broad.mit.edu	37	16	17211698	17211698	+	Missense_Mutation	SNP	C	C	T	rs201348549		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:17211698C>T	ENST00000261381.6	-	11	2446	c.2362G>A	c.(2362-2364)Gtc>Atc	p.V788I		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	788					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATGACATTGACGGGATCCACC	0.572																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(2362-2364)GTC>ATC		xylosyltransferase I		C	ILE/VAL	0,4394		0,0,2197	184.0	154.0	164.0		2362	2.0	0.9	16		164	1,8599	1.2+/-3.3	0,1,4299	yes	missense	XYLT1	NM_022166.3	29	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	benign	788/960	17211698	1,12993	2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17211698C>T	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2362G>A	16.37:g.17211698C>T	ENSP00000261381:p.Val788Ile						p.V788I	NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN			11	2447	-			788			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.2362G>A	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	6.490	0.458642	0.12342	0.0	1.16E-4	ENSG00000103489	ENST00000261381	T	0.43688	0.94	4.97	1.97	0.26223	.	0.172100	0.52532	N	0.000065	T	0.20414	0.0491	N	0.12746	0.255	0.33015	D	0.528006	B	0.26975	0.165	B	0.22753	0.041	T	0.25537	-1.0129	10	0.17369	T	0.5	-42.2089	9.2393	0.37486	0.0:0.6555:0.0:0.3445	.	788	Q86Y38	XYLT1_HUMAN	I	788	ENSP00000261381:V788I	ENSP00000261381:V788I	V	-	1	0	XYLT1	17119199	0.007000	0.16637	0.940000	0.37924	0.667000	0.39255	0.138000	0.16016	0.233000	0.21120	-1.490000	0.00973	GTC		0.572	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		14	52	0	0	0	0.001855	0	14	52				
TMC5	79838	broad.mit.edu	37	16	19498557	19498557	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:19498557C>T	ENST00000396229.2	+	17	3231	c.2482C>T	c.(2482-2484)Cgg>Tgg	p.R828W	TMC5_ENST00000219821.5_Missense_Mutation_p.R582W|TMC5_ENST00000564959.1_Missense_Mutation_p.R511W|TMC5_ENST00000561503.1_Missense_Mutation_p.R469W|TMC5_ENST00000381414.4_Missense_Mutation_p.R828W|TMC5_ENST00000541464.1_Missense_Mutation_p.R776W|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000542583.2_Missense_Mutation_p.R828W	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	828					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R828W(1)|p.R582W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CAAAGCCTGGCGGGCCTCACA	0.567																																							uc002dgc.3		NA																	2	Substitution - Missense(2)		endometrium(2)	skin(1)	1						c.(2482-2484)CGG>TGG		transmembrane channel-like 5 isoform a							73.0	67.0	69.0					16																	19498557		2197	4300	6497	SO:0001583	missense	79838					integral to membrane		g.chr16:19498557C>T	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2482C>T	16.37:g.19498557C>T	ENSP00000379531:p.Arg828Trp					TMC5_uc010vaq.1_Missense_Mutation_p.R776W|TMC5_uc002dgb.3_Missense_Mutation_p.R828W|TMC5_uc010var.1_Missense_Mutation_p.R828W|TMC5_uc002dgd.1_Missense_Mutation_p.R582W|TMC5_uc002dge.3_Missense_Mutation_p.R582W|TMC5_uc002dgf.3_Missense_Mutation_p.R511W|TMC5_uc002dgg.3_Missense_Mutation_p.R469W	p.R828W	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN			17	3231	+			828			Extracellular (Potential).		Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	c.2482C>T	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187204	0.78789	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58	5.72	3.68	0.42216	.	0.284410	0.37304	N	0.002141	D	0.85643	0.5744	M	0.92555	3.32	0.53005	D	0.99996	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.999;1.0;0.999;0.999	D	0.85936	0.1455	10	0.87932	D	0	-21.0866	9.0624	0.36442	0.4067:0.4586:0.1346:0.0	.	776;511;582;582;828;828	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	W	776;828;828;828;582;511	ENSP00000441227:R776W;ENSP00000370822:R828W;ENSP00000379531:R828W;ENSP00000446274:R828W;ENSP00000219821:R582W	ENSP00000219821:R582W	R	+	1	2	TMC5	19406058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.706000	0.47135	0.699000	0.31761	0.655000	0.94253	CGG		0.567	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780		25	19	0	0	0	0.00333	0	25	19				
ITGAX	3687	broad.mit.edu	37	16	31372423	31372423	+	Silent	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:31372423T>C	ENST00000268296.4	+	9	1022	c.901T>C	c.(901-903)Tta>Cta	p.L301L	ITGAX_ENST00000562522.1_Silent_p.L301L	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	301	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TTGGAAAGAATTAAATGACAT	0.373																																							uc002ebu.1		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(901-903)TTA>CTA		integrin alpha X precursor							109.0	120.0	116.0					16																	31372423		2197	4300	6497	SO:0001819	synonymous_variant	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31372423T>C	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.901T>C	16.37:g.31372423T>C						ITGAX_uc002ebt.2_Silent_p.L301L|ITGAX_uc010vfk.1_5'Flank	p.L301L	NM_000887	NP_000878	P20702	ITAX_HUMAN			9	968	+			301			VWFA.|Extracellular (Potential).		Q8IVA6	Silent	SNP	ENST00000268296.4	37	c.901T>C	CCDS10711.1																																																																																				0.373	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		3	79	0	0	0	0.004672	0	3	79				
TGFB1I1	7041	broad.mit.edu	37	16	31485158	31485158	+	Missense_Mutation	SNP	C	C	A	rs201803234		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:31485158C>A	ENST00000394863.3	+	4	315	c.185C>A	c.(184-186)aCg>aAg	p.T62K	TGFB1I1_ENST00000567607.1_Missense_Mutation_p.T45K|TGFB1I1_ENST00000361773.3_Missense_Mutation_p.T45K|TGFB1I1_ENST00000394858.2_Missense_Mutation_p.T45K	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	62	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						CTTCCCAGCACGGTATGCAAG	0.647																																							uc002ecd.1		NA																	0					0						c.(184-186)ACG>AAG		transforming growth factor beta 1 induced							59.0	67.0	64.0					16																	31485158		2197	4300	6497	SO:0001583	missense	7041				androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding	g.chr16:31485158C>A	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.185C>A	16.37:g.31485158C>A	ENSP00000378332:p.Thr62Lys					TGFB1I1_uc002ece.1_Missense_Mutation_p.T45K|TGFB1I1_uc010caq.1_5'UTR	p.T62K	NM_001042454	NP_001035919	O43294	TGFI1_HUMAN			4	211	+			62			Transcription activation (By similarity).|Interaction with PTK2B.		B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	37	c.185C>A	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194476	0.78902	.	.	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	T;T;T	0.41758	0.99;0.99;0.99	4.91	4.91	0.64330	.	0.125030	0.53938	D	0.000052	T	0.51143	0.1657	L	0.53249	1.67	0.80722	D	1	D	0.67145	0.996	D	0.64410	0.925	T	0.45041	-0.9288	10	0.06099	T	0.92	.	13.4792	0.61326	0.0:1.0:0.0:0.0	.	62	O43294	TGFI1_HUMAN	K	62;45;45	ENSP00000378332:T62K;ENSP00000355117:T45K;ENSP00000378327:T45K	ENSP00000355117:T45K	T	+	2	0	TGFB1I1	31392659	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	4.018000	0.57174	2.537000	0.85549	0.561000	0.74099	ACG		0.647	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3			16	84	1	0	0.000422831	0.004007	0.000453244	16	84				
TOX3	27324	broad.mit.edu	37	16	52497959	52497959	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:52497959C>T	ENST00000219746.9	-	3	579	c.295G>A	c.(295-297)Gga>Aga	p.G99R	TOX3_ENST00000407228.3_Missense_Mutation_p.G94R	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	99					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						AATTCACTTCCCTGGGAAGGC	0.532																																							uc002egw.2		NA																	0					0						c.(295-297)GGA>AGA		TOX high mobility group box family member 3							91.0	99.0	96.0					16																	52497959		2020	4182	6202	SO:0001583	missense	27324				apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity	g.chr16:52497959C>T	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.295G>A	16.37:g.52497959C>T	ENSP00000219746:p.Gly99Arg					TOX3_uc010vgt.1_Missense_Mutation_p.G94R|TOX3_uc010vgu.1_Missense_Mutation_p.G99R	p.G99R	NM_001080430	NP_001073899	O15405	TOX3_HUMAN			3	466	-			99					B4DRD0|B5MCW4	Missense_Mutation	SNP	ENST00000219746.9	37	c.295G>A	CCDS54009.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.564312	0.45694	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.41758	0.99;0.99	5.9	5.9	0.94986	.	0.284766	0.35124	N	0.003427	T	0.47783	0.1464	M	0.72894	2.215	0.54753	D	0.999988	B;B	0.26445	0.149;0.149	B;B	0.20384	0.029;0.029	T	0.42207	-0.9465	10	0.52906	T	0.07	.	20.2822	0.98520	0.0:1.0:0.0:0.0	.	94;99	B4DRD0;O15405	.;TOX3_HUMAN	R	99;94	ENSP00000219746:G99R;ENSP00000385705:G94R	ENSP00000219746:G99R	G	-	1	0	TOX3	51055460	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.717000	0.54911	2.806000	0.96561	0.655000	0.94253	GGA		0.532	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000422534.1	XM_049037		10	53	0	0	0	0.008291	0	10	53				
TP53	7157	broad.mit.edu	37	17	7577573	7577573	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:7577573G>T	ENST00000269305.4	-	7	897	c.708C>A	c.(706-708)taC>taA	p.Y236*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Y236*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Nonsense_Mutation_p.Y236*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Y236*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Y236*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Y236*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	236	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y236*(12)|p.0?(8)|p.?(5)|p.Y236del(4)|p.Y236Y(2)|p.Y236_M237delYM(1)|p.Y236_M237insXX(1)|p.H233fs*6(1)|p.N235_Y236delNY(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.Y143*(1)|p.I232_Y236delIHYNY(1)|p.Y236_M237>*L(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGTTACACATGTAGTTGTAGT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		41	Substitution - Nonsense(13)|Deletion - In frame(9)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(2)|Substitution - coding silent(2)|Insertion - In frame(1)|Complex - compound substitution(1)	p.Y236C(46)|p.Y236N(12)|p.Y236H(9)|p.Y236*(9)|p.0?(7)|p.Y236D(6)|p.Y236del(4)|p.Y236S(3)|p.Y236Y(2)|p.Y236fs*4(2)|p.Y236_M237delYM(1)|p.Y236_M237insXX(1)|p.Y236fs*5(1)|p.H233fs*6(1)|p.N235_Y236delNY(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.I232_Y236delIHYNY(1)|p.Y236_M237>*L(1)|p.H233_C242del10(1)	upper_aerodigestive_tract(6)|biliary_tract(5)|large_intestine(5)|central_nervous_system(4)|oesophagus(4)|bone(4)|liver(3)|stomach(2)|breast(2)|lung(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|ovary(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CD951866	TP53	D		c.(706-708)TAC>TAA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							127.0	100.0	109.0					17																	7577573		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577573G>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.708C>A	17.37:g.7577573G>T	ENSP00000269305:p.Tyr236*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Nonsense_Mutation_p.Y236*|TP53_uc002gih.2_Nonsense_Mutation_p.Y236*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.Y104*|TP53_uc010cng.1_Nonsense_Mutation_p.Y104*|TP53_uc002gii.1_Nonsense_Mutation_p.Y104*|TP53_uc010cnh.1_Nonsense_Mutation_p.Y236*|TP53_uc010cni.1_Nonsense_Mutation_p.Y236*|TP53_uc002gij.2_Nonsense_Mutation_p.Y236*|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Nonsense_Mutation_p.Y143*|TP53_uc002gio.2_Nonsense_Mutation_p.Y104*	p.Y236*	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	902	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	236		Y -> S (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.708C>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903126	0.52333	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	4.09	4.09	0.47781	.	0.335105	0.32884	N	0.005532	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-12.7522	7.9496	0.30006	0.1082:0.0:0.8918:0.0	.	.	.	.	X	236;236;236;236;236;236;225;143;104;143	.	ENSP00000269305:Y236X	Y	-	3	2	TP53	7518298	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.890000	0.28295	2.564000	0.86499	0.462000	0.41574	TAC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		18	14	1	0	2.94398e-08	0.007413	3.42599e-08	18	14				
UBBP4	23666	broad.mit.edu	37	17	21731221	21731221	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:21731221A>T	ENST00000584755.1	+	2	920	c.523A>T	c.(523-525)Atc>Ttc	p.I175F	UBBP4_ENST00000578713.1_Intron|UBBP4_ENST00000583708.1_3'UTR					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						CAGTGACACCATCGAAAATGT	0.547																																							uc002gyy.3		NA																	0					NA						c.(523-525)ATC>TTC		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21731221A>T	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000584755.1:c.523A>T	17.37:g.21731221A>T	ENSP00000463647:p.Ile175Phe						p.I175F							2	648	+									Missense_Mutation	SNP	ENST00000584755.1	37	c.523A>T																																																																																					0.547	UBBP4-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000444585.1			9	88	0	0	0	0.006214	0	9	88				
CDK5R1	8851	broad.mit.edu	37	17	30815150	30815150	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:30815150C>G	ENST00000313401.3	+	2	1201	c.512C>G	c.(511-513)cCc>cGc	p.P171R		NM_003885.2	NP_003876.1	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	171					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|ephrin receptor signaling pathway (GO:0048013)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|hippocampus development (GO:0021766)|ionotropic glutamate receptor signaling pathway (GO:0035235)|layer formation in cerebral cortex (GO:0021819)|negative regulation of axon extension (GO:0030517)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of neuron differentiation (GO:0045664)|rhythmic process (GO:0048511)|serine phosphorylation of STAT3 protein (GO:0033136)|superior olivary nucleus maturation (GO:0021722)	axon (GO:0030424)|contractile fiber (GO:0043292)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|cyclin-dependent protein kinase 5 activator activity (GO:0016534)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)			cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			CACCTGTCCCCCACGGACCCC	0.672																																							uc002hhn.2		NA																	0				ovary(1)	1						c.(511-513)CCC>CGC		cyclin-dependent kinase 5, regulatory subunit 1							51.0	52.0	52.0					17																	30815150		2203	4299	6502	SO:0001583	missense	8851				axon guidance|axonal fasciculation|brain development|cell proliferation|embryo development|ionotropic glutamate receptor signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of transcription, DNA-dependent|neuron cell-cell adhesion|neuron migration|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of neuron apoptosis|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation	axon|contractile fiber|cyclin-dependent protein kinase 5 holoenzyme complex|cytosol|dendritic spine|growth cone|neuromuscular junction|neuronal cell body|perinuclear region of cytoplasm|plasma membrane	cadherin binding|calcium ion binding|protein kinase binding	g.chr17:30815150C>G	X80343	CCDS11273.1	17q12	2006-03-28			ENSG00000176749	ENSG00000176749			1775	protein-coding gene	gene with protein product		603460				8090221	Standard	NM_003885		Approved	p35nck5a, Nck5a	uc002hhn.3	Q15078	OTTHUMG00000132814	ENST00000313401.3:c.512C>G	17.37:g.30815150C>G	ENSP00000318486:p.Pro171Arg					CDK5R1_uc010wca.1_Missense_Mutation_p.P171R|CDK5R1_uc010ctc.2_Intron	p.P171R	NM_003885	NP_003876	Q15078	CD5R1_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0938)		2	733	+		Breast(31;0.159)|Ovarian(249;0.182)	171					E1P664|Q5U0G3	Missense_Mutation	SNP	ENST00000313401.3	37	c.512C>G	CCDS11273.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724390	0.89298	.	.	ENSG00000176749	ENST00000313401	T	0.80480	-1.38	5.55	5.55	0.83447	Cyclin-like (2);	0.000000	0.85682	D	0.000000	D	0.90130	0.6916	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91144	0.4948	10	0.87932	D	0	-21.4763	16.9953	0.86366	0.0:1.0:0.0:0.0	.	171	Q15078	CD5R1_HUMAN	R	171	ENSP00000318486:P171R	ENSP00000318486:P171R	P	+	2	0	CDK5R1	27839263	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.926000	0.70070	2.609000	0.88269	0.557000	0.71058	CCC		0.672	CDK5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256264.1	NM_003885		7	75	0	0	0	0.001984	0	7	75				
PIGW	284098	broad.mit.edu	37	17	34894229	34894229	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:34894229C>T	ENST00000592983.1	+	2	1859	c.1279C>T	c.(1279-1281)Cta>Tta	p.L427L	MYO19_ENST00000590081.1_Intron|PIGW_ENST00000328396.2_Silent_p.L427L			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	427					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTCAGAATCTCTAGTCCCTGA	0.343																																							uc002hmy.1		NA																	0					0						c.(1279-1281)CTA>TTA		phosphatidylinositol glycan, class W							73.0	75.0	74.0					17																	34894229		2203	4300	6503	SO:0001819	synonymous_variant	284098				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	O-acyltransferase activity	g.chr17:34894229C>T	AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.1279C>T	17.37:g.34894229C>T						MYO19_uc010wcy.1_5'Flank|MYO19_uc002hmx.2_5'Flank|PIGW_uc002hmz.1_Silent_p.L427L	p.L427L	NM_178517	NP_848612	Q7Z7B1	PIGW_HUMAN	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	2	1322	+		Breast(25;0.00957)|Ovarian(249;0.17)	427					Q8N9G3	Silent	SNP	ENST00000592983.1	37	c.1279C>T	CCDS11313.1																																																																																				0.343	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451318.1	NM_178517		21	46	0	0	0	0.008871	0	21	46				
THRA	7067	broad.mit.edu	37	17	38244647	38244647	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:38244647G>T	ENST00000264637.4	+	8	1456	c.876G>T	c.(874-876)ctG>ctT	p.L292L	THRA_ENST00000450525.2_Silent_p.L292L|THRA_ENST00000584985.1_Silent_p.L292L|THRA_ENST00000394121.4_Silent_p.L292L|THRA_ENST00000546243.1_Silent_p.L292L	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	292	Ligand-binding.				cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ATGGCGGCCTGGGCGTAGTCT	0.607																																							uc002htw.2		NA																	0					0						c.(874-876)CTG>CTT		thyroid hormone receptor, alpha isoform 2	Levothyroxine(DB00451)|Liothyronine(DB00279)						100.0	94.0	96.0					17																	38244647		2203	4300	6503	SO:0001819	synonymous_variant	7067				negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr17:38244647G>T	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.876G>T	17.37:g.38244647G>T						THRA_uc010cwp.1_Silent_p.L292L|THRA_uc002htv.2_Silent_p.L292L|THRA_uc002htx.2_Silent_p.L292L	p.L292L	NM_003250	NP_003241	P10827	THA_HUMAN			8	1359	+	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)	292			Ligand-binding.		A8K3B5|P21205|Q8N6A1|Q96H73	Silent	SNP	ENST00000264637.4	37	c.876G>T	CCDS11360.1																																																																																				0.607	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257160.2			28	72	1	0	9.39395e-14	0.00632	1.19231e-13	28	72				
KRTAP1-3	81850	broad.mit.edu	37	17	39190856	39190856	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:39190856G>A	ENST00000344363.5	-	1	251	c.218C>T	c.(217-219)cCa>cTa	p.P73L		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	83			Missing (in allele KAP1.9). {ECO:0000269|PubMed:12228244}.			keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCAGCAGCTTGGCTGGCAGCA	0.607																																							uc002hvv.2		NA																	0					0						c.(217-219)CCA>CTA		keratin associated protein 1-3							31.0	35.0	34.0					17																	39190856		1997	4172	6169	SO:0001583	missense	81850					extracellular region|keratin filament	structural constituent of epidermis	g.chr17:39190856G>A	AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.218C>T	17.37:g.39190856G>A	ENSP00000344420:p.Pro73Leu						p.P73L	NM_030966	NP_112228	Q8IUG1	KRA13_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	252	-		Breast(137;0.000496)	83		Missing (in allele KAP1.9).			Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	ENST00000344363.5	37	c.218C>T	CCDS42323.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805075	0.70682	.	.	ENSG00000221880	ENST00000344363	T	0.52754	0.65	3.88	2.9	0.33743	.	.	.	.	.	T	0.37156	0.0993	.	.	.	0.43603	D	0.995963	B	0.14438	0.01	B	0.19391	0.025	T	0.32134	-0.9918	8	0.66056	D	0.02	.	7.7948	0.29141	0.1143:0.0:0.8857:0.0	.	83	Q8IUG1	KRA13_HUMAN	L	73	ENSP00000344420:P73L	ENSP00000344420:P73L	P	-	2	0	KRTAP1-3	36444382	1.000000	0.71417	0.129000	0.21949	0.922000	0.55478	1.976000	0.40579	1.204000	0.43247	0.655000	0.94253	CCA		0.607	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1			30	47	0	0	0	0.007291	0	30	47				
GPATCH8	23131	broad.mit.edu	37	17	42478104	42478104	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:42478104C>A	ENST00000591680.1	-	8	1371	c.1341G>T	c.(1339-1341)aaG>aaT	p.K447N	GPATCH8_ENST00000434000.1_Missense_Mutation_p.K369N	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	447							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		TTGCTGCCGCCTTGATGCAGC	0.498											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002igw.1		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(1339-1341)AAG>AAT		G patch domain containing 8							154.0	155.0	155.0					17																	42478104		2203	4300	6503	SO:0001583	missense	23131					intracellular	nucleic acid binding|zinc ion binding	g.chr17:42478104C>A	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.1341G>T	17.37:g.42478104C>A	ENSP00000467556:p.Lys447Asn		OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	909	GPATCH8_uc002igv.1_Missense_Mutation_p.K369N|GPATCH8_uc010wiz.1_Missense_Mutation_p.K369N	p.K447N	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.206)	8	1405	-		Prostate(33;0.0181)	447					B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	c.1341G>T	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.634410	0.29068	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.12465	2.68	5.02	5.02	0.67125	.	0.185774	0.46442	D	0.000293	T	0.16514	0.0397	M	0.63428	1.95	0.42224	D	0.991865	B	0.19583	0.037	B	0.15870	0.014	T	0.04373	-1.0956	10	0.19590	T	0.45	-5.7966	15.8849	0.79238	0.0:1.0:0.0:0.0	.	447	Q9UKJ3	GPTC8_HUMAN	N	447;369	ENSP00000395016:K369N	ENSP00000335486:K447N	K	-	3	2	GPATCH8	39833630	1.000000	0.71417	0.412000	0.26496	0.736000	0.42039	3.340000	0.52143	2.596000	0.87737	0.563000	0.77884	AAG		0.498	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909		72	130	1	0	9.98788e-38	0.01441	1.44652e-37	72	130				
PLEKHM1	9842	broad.mit.edu	37	17	43555508	43555508	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:43555508G>C	ENST00000430334.3	-	3	187	c.54C>G	c.(52-54)atC>atG	p.I18M	PLEKHM1_ENST00000421073.2_Intron	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	18					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GCTTCTTCTTGATGACCTAGG	0.522																																							uc002ija.2		NA																	0					0						c.(52-54)ATC>ATG		pleckstrin homology domain containing, family M							77.0	72.0	74.0					17																	43555508		2203	4300	6503	SO:0001583	missense	9842				intracellular signal transduction	cytoplasm	metal ion binding	g.chr17:43555508G>C	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.54C>G	17.37:g.43555508G>C	ENSP00000389913:p.Ile18Met					PLEKHM1_uc010wjm.1_Intron|PLEKHM1_uc002ijb.2_Translation_Start_Site|PLEKHM1_uc010wjn.1_Intron|hsa-mir-4315-1|MI0015844_5'Flank|PLEKHM1_uc002ijd.1_Missense_Mutation_p.I18M	p.I18M	NM_014798	NP_055613	Q9Y4G2	PKHM1_HUMAN			3	224	-	Renal(3;0.0405)		18					Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	c.54C>G	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386764	0.25031	.	.	ENSG00000225190	ENST00000430334	T	0.15487	2.42	4.82	3.78	0.43462	.	0.000000	0.85682	D	0.000000	T	0.25901	0.0631	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01042	-1.1471	10	0.72032	D	0.01	.	6.9172	0.24367	0.1005:0.0:0.7215:0.1779	.	18	Q9Y4G2	PKHM1_HUMAN	M	18	ENSP00000389913:I18M	ENSP00000389913:I18M	I	-	3	3	PLEKHM1	40911291	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.262000	0.51538	2.497000	0.84241	0.655000	0.94253	ATC		0.522	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798		3	74	0	0	0	0.000602	0	3	74				
ITGB3	3690	broad.mit.edu	37	17	45376752	45376752	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:45376752C>G	ENST00000559488.1	+	11	1785	c.1769C>G	c.(1768-1770)aCt>aGt	p.T590S	ITGB3_ENST00000435993.2_Missense_Mutation_p.T543S|ITGB3_ENST00000560629.1_Nonsense_Mutation_p.Y578*	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	590	Cysteine-rich tandem repeats.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	ACCACGCGTACTGACACCTGC	0.607																																							uc002ilj.2		NA																	0				central_nervous_system(5)|large_intestine(1)	6						c.(1768-1770)ACT>AGT		integrin beta chain, beta 3 precursor	Abciximab(DB00054)|Tirofiban(DB00775)						99.0	89.0	93.0					17																	45376752		2203	4300	6503	SO:0001583	missense	3690				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding	g.chr17:45376752C>G		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.1769C>G	17.37:g.45376752C>G	ENSP00000452786:p.Thr590Ser					ITGB3_uc010wkr.1_RNA	p.T590S	NM_000212	NP_000203	P05106	ITB3_HUMAN			11	1789	+			590			Extracellular (Potential).|III.|Cysteine-rich tandem repeats.		A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	ENST00000559488.1	37	c.1769C>G	CCDS11511.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666989	0.47677	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.95307	-3.67	5.84	3.67	0.42095	.	0.045348	0.85682	D	0.000000	D	0.88596	0.6479	N	0.20685	0.6	0.58432	D	0.999999	P	0.42337	0.776	B	0.37304	0.246	D	0.90349	0.4365	10	0.72032	D	0.01	.	14.4049	0.67075	0.225:0.7749:0.0:0.0	.	590	P05106	ITB3_HUMAN	S	590;543	ENSP00000407801:T543S	ENSP00000262017:T590S	T	+	2	0	C17orf57	42731751	0.982000	0.34865	0.988000	0.46212	0.513000	0.34164	2.575000	0.46025	2.770000	0.95276	0.555000	0.69702	ACT		0.607	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212		46	80	0	0	0	0.01441	0	46	80				
IGF2BP1	10642	broad.mit.edu	37	17	47123696	47123696	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:47123696G>C	ENST00000290341.3	+	14	1936	c.1602G>C	c.(1600-1602)caG>caC	p.Q534H	IGF2BP1_ENST00000431824.2_Missense_Mutation_p.Q395H	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	534	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						AGAACGACCAGGTCATCGTGA	0.557																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)	Esophageal Squamous(198;1041 2123 8248 37119 38268)	uc002iom.2		NA																	0				kidney(1)	1						c.(1600-1602)CAG>CAC		insulin-like growth factor 2 mRNA binding							122.0	99.0	107.0					17																	47123696		2203	4300	6503	SO:0001583	missense	10642				CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr17:47123696G>C	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.1602G>C	17.37:g.47123696G>C	ENSP00000290341:p.Gln534His					IGF2BP1_uc010dbj.2_Missense_Mutation_p.Q395H	p.Q534H	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN			14	1936	+			534			Necessary for interaction with ELAVL4 and binding to TAU mRNA (By similarity).|KH 4.		C9JT33	Missense_Mutation	SNP	ENST00000290341.3	37	c.1602G>C	CCDS11543.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105390	0.77096	.	.	ENSG00000159217	ENST00000290341;ENST00000431824	T;T	0.29917	1.55;1.55	5.65	-0.363	0.12556	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.057150	0.64402	D	0.000001	T	0.41811	0.1175	L	0.59436	1.845	0.51233	D	0.999918	D;P	0.71674	0.998;0.951	P;P	0.60012	0.867;0.768	T	0.35748	-0.9776	10	0.87932	D	0	-23.6662	10.0634	0.42288	0.5595:0.0:0.4405:0.0	.	395;534	C9JT33;Q9NZI8	.;IF2B1_HUMAN	H	534;395	ENSP00000290341:Q534H;ENSP00000389135:Q395H	ENSP00000290341:Q534H	Q	+	3	2	IGF2BP1	44478695	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	1.767000	0.38501	0.091000	0.17302	0.655000	0.94253	CAG		0.557	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1	NM_006546		17	55	0	0	0	0.00499	0	17	55				
B4GALNT2	124872	broad.mit.edu	37	17	47241556	47241556	+	Silent	SNP	C	C	A	rs570206637		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:47241556C>A	ENST00000300404.2	+	8	1112	c.1053C>A	c.(1051-1053)acC>acA	p.T351T	B4GALNT2_ENST00000393354.2_Silent_p.T291T|B4GALNT2_ENST00000504681.1_Silent_p.T265T	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	351					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)	p.T351T(1)		endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			CAGACTTGACCGTAATAGTGG	0.483																																					GBM(124;244 1635 8663 18097 33175)	GBM(124;244 1635 8663 18097 33175)	uc002ion.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	large_intestine(1)|ovary(1)	2						c.(1051-1053)ACC>ACA		beta-1,4-N-acetyl-galactosaminyl transferase 2							160.0	160.0	160.0					17																	47241556		2203	4300	6503	SO:0001819	synonymous_variant	124872				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity	g.chr17:47241556C>A	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1053C>A	17.37:g.47241556C>A						B4GALNT2_uc010wlt.1_Silent_p.T265T|B4GALNT2_uc010wlu.1_Silent_p.T291T	p.T351T	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	all cancers(6;0.000316)		8	1112	+			351			Lumenal (Potential).		B4DZE4|Q14CP1|Q86Y40	Silent	SNP	ENST00000300404.2	37	c.1053C>A	CCDS11544.1																																																																																				0.483	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446		55	134	1	0	9.59835e-30	0.01441	1.37715e-29	55	134				
CACNA1G	8913	broad.mit.edu	37	17	48699156	48699156	+	Splice_Site	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:48699156G>C	ENST00000359106.5	+	35	6060		c.e35+1		CACNA1G_ENST00000515765.1_Intron|CACNA1G_ENST00000515165.1_Intron|CACNA1G_ENST00000514079.1_Intron|CACNA1G_ENST00000514717.1_Intron|CACNA1G_ENST00000354983.4_Splice_Site|CACNA1G_ENST00000510366.1_Intron|CACNA1G_ENST00000507609.1_Intron|CACNA1G_ENST00000358244.5_Intron|CACNA1G_ENST00000513689.2_Intron|CACNA1G_ENST00000507336.1_Splice_Site|CACNA1G_ENST00000510115.1_Intron|CACNA1G_ENST00000507896.1_Intron|CACNA1G_ENST00000507510.2_Intron|CACNA1G_ENST00000429973.2_Intron|CACNA1G_ENST00000505165.1_Intron|CACNA1G_ENST00000502264.1_Splice_Site|CACNA1G_ENST00000360761.4_Intron|CACNA1G_ENST00000352832.5_Intron|CACNA1G_ENST00000513964.1_Intron|CACNA1G_ENST00000503485.1_Intron|CACNA1G_ENST00000514181.1_Intron|CACNA1G_ENST00000442258.2_Intron|CACNA1G_ENST00000512389.1_Intron|CACNA1G_ENST00000515411.1_Intron	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GGAGAGCAATGTACATACACA	0.607																																							uc002irk.1		NA																	0				breast(1)	1						c.e35+1		voltage-dependent calcium channel alpha 1G	Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						127.0	119.0	122.0					17																	48699156		2068	4195	6263	SO:0001630	splice_region_variant	8913				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr17:48699156G>C	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.6060+1G>C	17.37:g.48699156G>C						CACNA1G_uc002irj.1_Intron|CACNA1G_uc002irl.1_Intron|CACNA1G_uc002irm.1_Intron|CACNA1G_uc002irn.1_Intron|CACNA1G_uc002iro.1_Intron|CACNA1G_uc002irp.1_Intron|CACNA1G_uc002irq.1_Splice_Site_p.N1997_splice|CACNA1G_uc002irr.1_Intron|CACNA1G_uc002irs.1_Intron|CACNA1G_uc002irt.1_Intron|CACNA1G_uc002irv.1_Intron|CACNA1G_uc002irw.1_Splice_Site_p.N1949_splice|CACNA1G_uc002iru.1_Splice_Site_p.N1986_splice|CACNA1G_uc002irx.1_Intron|CACNA1G_uc002iry.1_Intron|CACNA1G_uc002irz.1_Intron|CACNA1G_uc002isa.1_Intron|CACNA1G_uc002isb.1_Intron|CACNA1G_uc002isc.1_Splice_Site_p.N1922_splice|CACNA1G_uc002isd.1_Intron|CACNA1G_uc002ise.1_Intron|CACNA1G_uc002isf.1_Intron|CACNA1G_uc002isg.1_Intron|CACNA1G_uc002ish.1_Intron|CACNA1G_uc002isi.1_Intron	p.N2020_splice	NM_018896	NP_061496	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		35	6432	+	Breast(11;6.7e-17)							D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Splice_Site	SNP	ENST00000359106.5	37	c.6060_splice	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273017	0.80580	.	.	ENSG00000006283	ENST00000354983;ENST00000502264;ENST00000507336;ENST00000359106	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1471	0.81578	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1G	46054155	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.823000	0.92018	2.018000	0.59344	0.462000	0.41574	.		0.607	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	Intron	5	35	0	0	0	0.000602	0	5	35				
TRIM37	4591	broad.mit.edu	37	17	57109262	57109262	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:57109262G>A	ENST00000262294.7	-	18	2202	c.1943C>T	c.(1942-1944)cCc>cTc	p.P648L	TRIM37_ENST00000393066.3_Missense_Mutation_p.P648L|TRIM37_ENST00000393065.2_Missense_Mutation_p.P614L|TRIM37_ENST00000376149.3_Missense_Mutation_p.P526L	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	648					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTTACCTGTGGGCTGCAGAAG	0.373									Mulibrey Nanism																														uc002iwy.3		NA																	0				lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7						c.(1942-1944)CCC>CTC		tripartite motif-containing 37 protein							79.0	85.0	83.0					17																	57109262		2203	4300	6503	SO:0001583	missense	4591	Mulibrey_Nanism	Familial Cancer Database	Perheentupa syndrome		perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding	g.chr17:57109262G>A	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.1943C>T	17.37:g.57109262G>A	ENSP00000262294:p.Pro648Leu					TRIM37_uc002iwz.3_Missense_Mutation_p.P648L|TRIM37_uc002ixa.3_Missense_Mutation_p.P526L|TRIM37_uc010woc.1_Missense_Mutation_p.P614L	p.P648L	NM_001005207	NP_001005207	O94972	TRI37_HUMAN			18	2387	-	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		648					Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	c.1943C>T	CCDS32694.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834268	0.50951	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.75	5.75	0.90469	.	0.428883	0.27155	N	0.020662	T	0.19725	0.0474	N	0.14661	0.345	0.42985	D	0.994476	B;B;B	0.23249	0.082;0.082;0.049	B;B;B	0.21917	0.037;0.037;0.016	T	0.04961	-1.0915	10	0.46703	T	0.11	-8.5725	11.84	0.52348	0.0:0.1388:0.7331:0.128	.	614;526;648	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	L	648;648;526;614	ENSP00000376785:P648L;ENSP00000262294:P648L;ENSP00000365319:P526L;ENSP00000376784:P614L	ENSP00000262294:P648L	P	-	2	0	TRIM37	54464044	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.965000	0.40471	2.732000	0.93576	0.650000	0.86243	CCC		0.373	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294		18	89	0	0	0	0.00499	0	18	89				
DHX40	79665	broad.mit.edu	37	17	57647936	57647936	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:57647936C>T	ENST00000251241.4	+	3	485	c.338C>T	c.(337-339)tCa>tTa	p.S113L	DHX40_ENST00000425628.3_Intron|DHX40_ENST00000451169.2_Missense_Mutation_p.S14L	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	113	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GCTGCTATATCAGTTGCTCAG	0.373																																							uc002ixn.1		NA																	0					0						c.(337-339)TCA>TTA		DEAH (Asp-Glu-Ala-His) box polypeptide 40							168.0	159.0	162.0					17																	57647936		2203	4300	6503	SO:0001583	missense	79665						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr17:57647936C>T	AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.338C>T	17.37:g.57647936C>T	ENSP00000251241:p.Ser113Leu					DHX40_uc010woe.1_Intron|DHX40_uc002ixo.1_Missense_Mutation_p.S14L	p.S113L	NM_024612	NP_078888	Q8IX18	DHX40_HUMAN			3	485	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		113			Helicase ATP-binding.		B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Missense_Mutation	SNP	ENST00000251241.4	37	c.338C>T	CCDS11617.1	.	.	.	.	.	.	.	.	.	.	C	32	5.146882	0.94603	.	.	ENSG00000108406	ENST00000251241;ENST00000425628;ENST00000451169	T;T	0.15256	2.44;3.84	5.54	5.54	0.83059	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.060889	0.64402	D	0.000003	T	0.46034	0.1372	M	0.85777	2.775	0.58432	D	0.999996	D	0.71674	0.998	P	0.62491	0.903	T	0.51529	-0.8694	10	0.87932	D	0	.	18.2481	0.89993	0.0:1.0:0.0:0.0	.	113	Q8IX18	DHX40_HUMAN	L	113;113;14	ENSP00000251241:S113L;ENSP00000396039:S14L	ENSP00000251241:S113L	S	+	2	0	DHX40	55002718	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.004000	0.76317	2.610000	0.88304	0.563000	0.77884	TCA		0.373	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446095.1	NM_024612		25	84	0	0	0	0.003954	0	25	84				
KCNH6	81033	broad.mit.edu	37	17	61611628	61611628	+	Missense_Mutation	SNP	G	G	A	rs560196120		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:61611628G>A	ENST00000583023.1	+	5	1068	c.1057G>A	c.(1057-1059)Gcc>Acc	p.A353T	KCNH6_ENST00000314672.5_Missense_Mutation_p.A353T|KCNH6_ENST00000580652.1_Missense_Mutation_p.A353T|KCNH6_ENST00000581784.1_Missense_Mutation_p.A353T|KCNH6_ENST00000456941.2_Missense_Mutation_p.A353T	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	353					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.A353T(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CATGGTGGCCGCCATCCCTTT	0.622																																							uc002jay.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	skin(1)	1						c.(1057-1059)GCC>ACC		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						139.0	105.0	117.0					17																	61611628		2203	4300	6503	SO:0001583	missense	81033				regulation of transcription, DNA-dependent|signal transduction			g.chr17:61611628G>A	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1057G>A	17.37:g.61611628G>A	ENSP00000463533:p.Ala353Thr					KCNH6_uc002jax.1_Missense_Mutation_p.A353T|KCNH6_uc010wpl.1_Missense_Mutation_p.A230T|KCNH6_uc010wpm.1_Missense_Mutation_p.A353T|KCNH6_uc002jaz.1_Missense_Mutation_p.A353T	p.A353T	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN			5	1137	+			353			Helical; Name=Segment S3; (Potential).		Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	c.1057G>A	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703581	0.48412	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.99818	-6.92;-6.92	4.14	4.14	0.48551	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99594	0.9853	L	0.39085	1.19	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.998;1.0	D;D;D;D;D	0.97110	1.0;0.983;1.0;0.992;0.996	D	0.97321	0.9944	10	0.87932	D	0	.	16.6049	0.84826	0.0:0.0:1.0:0.0	.	230;353;353;353;353	B4DPJ3;B4DKC0;Q9H252-2;Q9H252;Q9H252-3	.;.;.;KCNH6_HUMAN;.	T	353	ENSP00000318212:A353T;ENSP00000396900:A353T	ENSP00000318212:A353T	A	+	1	0	KCNH6	58965360	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	9.657000	0.98554	2.121000	0.65114	0.305000	0.20034	GCC		0.622	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779		19	88	0	0	0	0.006122	0	19	88				
HELZ	9931	broad.mit.edu	37	17	65104710	65104710	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:65104710T>C	ENST00000358691.5	-	30	4788	c.4622A>G	c.(4621-4623)cAg>cGg	p.Q1541R	HELZ_ENST00000580168.1_Missense_Mutation_p.Q1542R	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1541						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AGGAAGATGCTGGAGGTGAGG	0.582																																							uc010wqk.1		NA																	0				ovary(1)|pancreas(1)	2						c.(4624-4626)CAG>CGG		helicase with zinc finger domain							109.0	127.0	121.0					17																	65104710		2185	4264	6449	SO:0001583	missense	9931							g.chr17:65104710T>C	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.4622A>G	17.37:g.65104710T>C	ENSP00000351524:p.Gln1541Arg					HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.Q1541R|HELZ_uc010der.2_Missense_Mutation_p.Q85R	p.Q1542R	NM_014877	NP_055692					30	4812	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	c.4625A>G	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	T	11.70	1.717818	0.30413	.	.	ENSG00000198265	ENST00000358691	D	0.83250	-1.7	5.27	1.65	0.23941	.	0.313352	0.34460	N	0.003958	T	0.72550	0.3474	L	0.27053	0.805	0.24433	N	0.994568	B;B	0.19583	0.037;0.037	B;B	0.13407	0.009;0.009	T	0.57075	-0.7873	10	0.34782	T	0.22	-0.1861	15.0774	0.72087	0.0:0.0:0.5862:0.4138	.	1542;1541	B7ZLW2;P42694	.;HELZ_HUMAN	R	1541	ENSP00000351524:Q1541R	ENSP00000351524:Q1541R	Q	-	2	0	HELZ	62535172	0.998000	0.40836	0.995000	0.50966	0.969000	0.65631	0.805000	0.27112	-0.005000	0.14395	0.450000	0.29827	CAG		0.582	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		22	62	0	0	0	0.010504	0	22	62				
DNAI2	64446	broad.mit.edu	37	17	72278023	72278023	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr17:72278023C>A	ENST00000311014.6	+	2	134	c.67C>A	c.(67-69)Cgc>Agc	p.R23S	DNAI2_ENST00000579490.1_Missense_Mutation_p.R80S|DNAI2_ENST00000307504.5_5'UTR|DNAI2_ENST00000446837.2_Missense_Mutation_p.R23S|DNAI2_ENST00000582036.1_Missense_Mutation_p.R23S			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	23					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TTTCTCGGACCGCCAGGCCGA	0.617									Kartagener syndrome																														uc002jkf.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(67-69)CGC>AGC		dynein, axonemal, intermediate polypeptide 2							143.0	120.0	128.0					17																	72278023		2203	4300	6503	SO:0001583	missense	64446	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity	g.chr17:72278023C>A	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.67C>A	17.37:g.72278023C>A	ENSP00000308312:p.Arg23Ser					DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	p.R23S	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN			2	166	+			23					C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	c.67C>A	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932200	0.52866	.	.	ENSG00000171595	ENST00000311014;ENST00000446837	T;T	0.65916	-0.18;-0.18	5.22	5.22	0.72569	.	0.253251	0.39615	N	0.001302	T	0.54351	0.1853	L	0.52206	1.635	0.80722	D	1	B	0.31174	0.311	B	0.27887	0.084	T	0.50931	-0.8769	10	0.25751	T	0.34	-37.5674	14.327	0.66528	0.0:0.9271:0.0:0.0728	.	23	Q9GZS0	DNAI2_HUMAN	S	23	ENSP00000308312:R23S;ENSP00000400252:R23S	ENSP00000308312:R23S	R	+	1	0	DNAI2	69789618	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.456000	0.44997	2.731000	0.93534	0.644000	0.83932	CGC		0.617	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		49	62	1	0	4.18559e-23	0.01441	5.93172e-23	49	62				
MYOM1	8736	broad.mit.edu	37	18	3067287	3067287	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr18:3067287G>T	ENST00000356443.4	-	38	5364	c.5031C>A	c.(5029-5031)tcC>tcA	p.S1677S	MYOM1_ENST00000261606.7_Silent_p.S1581S|MYOM1_ENST00000400569.3_Silent_p.S1677S	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1677					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CACCTTTCAGGGACTCCAAGG	0.587																																							uc002klp.2		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(5029-5031)TCC>TCA		myomesin 1 isoform a							21.0	27.0	25.0					18																	3067287		2183	4287	6470	SO:0001819	synonymous_variant	8736					striated muscle myosin thick filament	structural constituent of muscle	g.chr18:3067287G>T	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.5031C>A	18.37:g.3067287G>T						MYOM1_uc002klq.2_Silent_p.S1581S	p.S1677S	NM_003803	NP_003794	P52179	MYOM1_HUMAN			38	5365	-			1677					Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	ENST00000356443.4	37	c.5031C>A	CCDS45824.1																																																																																				0.587	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803		14	12	1	0	9.31168e-06	0.001855	1.03913e-05	14	12				
MPPE1	65258	broad.mit.edu	37	18	11889438	11889438	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr18:11889438G>A	ENST00000588072.1	-	5	1663	c.442C>T	c.(442-444)Cat>Tat	p.H148Y	MPPE1_ENST00000317235.7_Missense_Mutation_p.H148Y|MPPE1_ENST00000399978.2_Missense_Mutation_p.H148Y|MPPE1_ENST00000344987.7_Missense_Mutation_p.H148Y|MPPE1_ENST00000309976.9_Missense_Mutation_p.H148Y	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	148					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						AGCTGTACATGACTTGGGTGT	0.483																																							uc002kqf.2		NA																	0					0						c.(442-444)CAT>TAT		metallophosphoesterase 1 precursor							129.0	109.0	116.0					18																	11889438		2203	4300	6503	SO:0001583	missense	65258				ER to Golgi vesicle-mediated transport|GPI anchor biosynthetic process	cis-Golgi network|endoplasmic reticulum exit site|ER-Golgi intermediate compartment membrane|integral to membrane	GPI anchor binding|manganese ion binding|phosphoric diester hydrolase activity	g.chr18:11889438G>A	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.442C>T	18.37:g.11889438G>A	ENSP00000465894:p.His148Tyr					MPPE1_uc002kqn.2_Missense_Mutation_p.H148Y|MPPE1_uc002kqg.2_RNA|MPPE1_uc002kqh.2_RNA|MPPE1_uc002kqi.2_RNA|MPPE1_uc002kqj.2_Missense_Mutation_p.H148Y|MPPE1_uc002kqk.2_Missense_Mutation_p.H148Y|MPPE1_uc002kql.2_Missense_Mutation_p.H148Y|MPPE1_uc002kqm.2_Missense_Mutation_p.H148Y|MPPE1_uc010dla.1_Missense_Mutation_p.H148Y	p.H148Y	NM_023075	NP_075563	Q53F39	MPPE1_HUMAN			5	1083	-			148					B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Missense_Mutation	SNP	ENST00000588072.1	37	c.442C>T	CCDS11853.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631747	0.29068	.	.	ENSG00000154889	ENST00000317235;ENST00000309976;ENST00000317251;ENST00000344987;ENST00000399978	T;T;T;T;T	0.69806	2.3;2.3;2.3;-0.43;2.3	5.77	2.75	0.32379	Calcineurin-like phosphoesterase superfamily domain (1);	0.334523	0.38492	N	0.001678	T	0.61627	0.2362	L	0.54323	1.7	0.09310	N	1	P;P;P;B;P;B	0.37276	0.529;0.589;0.584;0.156;0.529;0.302	B;B;B;B;B;B	0.43386	0.294;0.226;0.418;0.08;0.294;0.229	T	0.53107	-0.8485	10	0.41790	T	0.15	0.0614	6.0931	0.20005	0.0629:0.2133:0.5045:0.2193	.	148;148;51;148;148;148	Q53F39-3;Q53F39-4;B3KNP1;Q53F39-5;Q53F39-2;Q53F39	.;.;.;.;.;MPPE1_HUMAN	Y	148;148;51;148;148	ENSP00000327257:H148Y;ENSP00000311200:H148Y;ENSP00000312935:H51Y;ENSP00000339423:H148Y;ENSP00000382860:H148Y	ENSP00000311200:H148Y	H	-	1	0	MPPE1	11879438	0.061000	0.20836	0.018000	0.16275	0.581000	0.36288	0.736000	0.26130	0.838000	0.34948	0.655000	0.94253	CAT		0.483	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075		13	32	0	0	0	0.013537	0	13	32				
ADNP2	22850	broad.mit.edu	37	18	77894189	77894189	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr18:77894189A>G	ENST00000262198.4	+	4	1348	c.893A>G	c.(892-894)cAg>cGg	p.Q298R		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	298	Pro-rich.				cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GCTTTGCCACAGAACAGTCCA	0.602																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(892-894)CAG>CGG		ADNP homeobox 2							65.0	70.0	68.0					18																	77894189		2203	4299	6502	SO:0001583	missense	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77894189A>G	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.893A>G	18.37:g.77894189A>G	ENSP00000262198:p.Gln298Arg						p.Q298R	NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	1348	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	298			Pro-rich.		A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	c.893A>G	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	A	7.248	0.602622	0.13939	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.42	0.158	0.14942	.	0.204114	0.34314	N	0.004064	T	0.25269	0.0614	L	0.27053	0.805	0.09310	N	1	B	0.15930	0.015	B	0.16289	0.015	T	0.18808	-1.0325	8	.	.	.	-4.1311	10.0127	0.41997	0.4346:0.5001:0.0653:0.0	.	298	Q6IQ32	ADNP2_HUMAN	R	298	.	.	Q	+	2	0	ADNP2	75995180	0.990000	0.36364	0.002000	0.10522	0.141000	0.21300	0.883000	0.28200	-0.101000	0.12219	0.528000	0.53228	CAG		0.602	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		19	44	0	0	0	0.010504	0	19	44				
ODF3L2	284451	broad.mit.edu	37	19	463978	463978	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:463978C>A	ENST00000315489.4	-	4	971	c.736G>T	c.(736-738)Gag>Tag	p.E246*	SHC2_ENST00000264554.6_5'Flank|ODF3L2_ENST00000382696.3_Nonsense_Mutation_p.E210*	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	246						cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						GTGACCTGCTCTGGGCAGTGG	0.716																																							uc002lor.2		NA																	0					0						c.(736-738)GAG>TAG		outer dense fiber of sperm tails 3-like 2							20.0	24.0	23.0					19																	463978		2197	4289	6486	SO:0001587	stop_gained	284451							g.chr19:463978C>A	AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.736G>T	19.37:g.463978C>A	ENSP00000318029:p.Glu246*					SHC2_uc002loq.3_5'Flank|ODF3L2_uc010drp.2_Nonsense_Mutation_p.E210*	p.E246*	NM_182577	NP_872383	Q3SX64	OD3L2_HUMAN			4	972	-			246			DUF1309 3.		Q3SX65|Q8N1L2	Nonsense_Mutation	SNP	ENST00000315489.4	37	c.736G>T	CCDS12027.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824900	0.90955	.	.	ENSG00000181781	ENST00000315489;ENST00000382696	.	.	.	3.81	3.81	0.43845	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.975	13.6061	0.62048	0.0:1.0:0.0:0.0	.	.	.	.	X	246;210	.	ENSP00000318029:E246X	E	-	1	0	ODF3L2	414978	1.000000	0.71417	0.867000	0.34043	0.218000	0.24690	5.099000	0.64554	1.850000	0.53721	0.555000	0.69702	GAG		0.716	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451849.2	NM_182577		10	13	1	0	2.17888e-05	0.006214	2.42564e-05	10	13				
MUC16	94025	broad.mit.edu	37	19	9009600	9009600	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:9009600G>T	ENST00000397910.4	-	39	39329	c.39126C>A	c.(39124-39126)gtC>gtA	p.V13042V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13044	SEA 7. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACCCTGCAGGACCCTCTCTG	0.552																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(39124-39126)GTC>GTA		mucin 16							190.0	158.0	168.0					19																	9009600		2009	4170	6179	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9009600G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39126C>A	19.37:g.9009600G>T						MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	p.V13042V	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			39	39330	-			13044			Extracellular (Potential).|SEA 7.		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.39126C>A	CCDS54212.1																																																																																				0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		17	59	1	0	3.41278e-10	0.00499	4.13833e-10	17	59				
MUC16	94025	broad.mit.edu	37	19	9065356	9065356	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:9065356G>C	ENST00000397910.4	-	3	22293	c.22090C>G	c.(22090-22092)Cac>Gac	p.H7364D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7366	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATCTCTGAGTGTGGCAATCTC	0.507																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(22090-22092)CAC>GAC		mucin 16							97.0	101.0	99.0					19																	9065356		2011	4181	6192	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9065356G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.22090C>G	19.37:g.9065356G>C	ENSP00000381008:p.His7364Asp						p.H7364D	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	22294	-			7366			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.22090C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	N	3.359	-0.130963	0.06753	.	.	ENSG00000181143	ENST00000397910	T	0.24908	1.83	2.28	1.24	0.21308	.	.	.	.	.	T	0.23014	0.0556	L	0.27053	0.805	.	.	.	P	0.44344	0.833	P	0.50270	0.636	T	0.25398	-1.0133	8	0.87932	D	0	.	4.5467	0.12085	0.189:0.0:0.811:0.0	.	7364	B5ME49	.	D	7364	ENSP00000381008:H7364D	ENSP00000381008:H7364D	H	-	1	0	MUC16	8926356	0.000000	0.05858	0.006000	0.13384	0.019000	0.09904	-0.019000	0.12546	0.520000	0.28426	0.455000	0.32223	CAC		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		10	25	0	0	0	0.006214	0	10	25				
RAVER1	125950	broad.mit.edu	37	19	10439672	10439672	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:10439672C>T	ENST00000293677.6	-	3	534	c.453G>A	c.(451-453)ctG>ctA	p.L151L		NM_133452.2	NP_597709.2	Q8IY67	RAVR1_HUMAN	ribonucleoprotein, PTB-binding 1	134	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	18			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			TGGCCACACACAGCAGGGCAT	0.657																																							uc002moa.2		NA																	0				ovary(1)	1						c.(451-453)CTG>CTA		RAVER1							11.0	13.0	13.0					19																	10439672		2152	4245	6397	SO:0001819	synonymous_variant	125950					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding	g.chr19:10439672C>T		CCDS45960.1	19p13.2	2013-02-12				ENSG00000161847		"""RNA binding motif (RRM) containing"""	30296	protein-coding gene	gene with protein product		609950				11853319, 11724819	Standard	NM_133452		Approved	KIAA1978	uc002moa.3	Q8IY67		ENST00000293677.6:c.453G>A	19.37:g.10439672C>T							p.L151L	NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)		3	533	-			134			RRM 2.		A6NMU4|Q8IY60|Q8TF24	Silent	SNP	ENST00000293677.6	37	c.453G>A	CCDS45960.1																																																																																				0.657	RAVER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451227.1	NM_133452		3	6	0	0	0	0.004672	0	3	6				
ZNF98	148198	broad.mit.edu	37	19	22575653	22575653	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:22575653G>T	ENST00000357774.5	-	4	505	c.384C>A	c.(382-384)agC>agA	p.S128R		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				ACTCATCCATGCTTTTACAGT	0.323																																							uc002nqt.2		NA																	0				ovary(1)|skin(1)	2						c.(382-384)AGC>AGA		zinc finger protein 98							61.0	56.0	57.0					19																	22575653		2011	4205	6216	SO:0001583	missense	148198				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22575653G>T		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.384C>A	19.37:g.22575653G>T	ENSP00000350418:p.Ser128Arg						p.S128R	NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN			4	506	-		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)	128						Missense_Mutation	SNP	ENST00000357774.5	37	c.384C>A	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	1.596	-0.527680	0.04141	.	.	ENSG00000197360	ENST00000357774	T	0.06849	3.25	0.225	-0.451	0.12214	.	.	.	.	.	T	0.09642	0.0237	M	0.79475	2.455	0.09310	N	1	B	0.24043	0.096	B	0.25614	0.062	T	0.45011	-0.9290	8	0.41790	T	0.15	.	.	.	.	.	128	A6NK75	ZNF98_HUMAN	R	128	ENSP00000350418:S128R	ENSP00000350418:S128R	S	-	3	2	ZNF98	22367493	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.553000	0.23391	-2.752000	0.00374	-2.767000	0.00120	AGC		0.323	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626		5	18	1	0	3.59834e-05	0.001168	3.96762e-05	5	18				
ZNF99	7652	broad.mit.edu	37	19	22941422	22941422	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:22941422C>T	ENST00000596209.1	-	4	1379	c.1289G>A	c.(1288-1290)tGt>tAt	p.C430Y	ZNF99_ENST00000397104.3_Missense_Mutation_p.C339Y	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	430					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AGCTTTGCCACATTCTTCACA	0.368																																							uc010xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(1015-1017)TGT>TAT		zinc finger protein 99							53.0	54.0	54.0					19																	22941422		2032	4210	6242	SO:0001583	missense	7652							g.chr19:22941422C>T	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1289G>A	19.37:g.22941422C>T	ENSP00000472969:p.Cys430Tyr						p.C339Y	NM_001080409	NP_001073878					5	1016	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.1016G>A	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	7.900	0.734293	0.15574	.	.	ENSG00000213973	ENST00000397104	T	0.38240	1.15	1.28	-0.0711	0.13745	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.66356	0.2781	H	0.97465	4.01	0.34589	D	0.715302	D	0.69078	0.997	D	0.81914	0.995	T	0.68557	-0.5377	9	0.87932	D	0	.	5.0442	0.14475	0.0:0.778:0.0:0.222	.	339	A8MXY4	ZNF99_HUMAN	Y	339	ENSP00000380293:C339Y	ENSP00000380293:C339Y	C	-	2	0	ZNF99	22733262	0.047000	0.20315	0.003000	0.11579	0.021000	0.10359	1.219000	0.32479	-0.130000	0.11599	0.395000	0.25975	TGT		0.368	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		12	25	0	0	0	0.010729	0	12	25				
ZFP14	57677	broad.mit.edu	37	19	36831589	36831589	+	Missense_Mutation	SNP	C	C	T	rs370356503		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:36831589C>T	ENST00000270001.7	-	5	1254	c.1139G>A	c.(1138-1140)aGa>aAa	p.R380K		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TAGTTGTTGTCTTAATCTAAA	0.373																																							uc002odx.1		NA																	0				ovary(1)	1						c.(1138-1140)AGA>AAA		zinc finger protein 14-like		C	LYS/ARG	0,4406		0,0,2203	107.0	99.0	102.0		1139	4.1	1.0	19		102	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZFP14	NM_020917.2	26	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	380/534	36831589	1,13005	2203	4300	6503	SO:0001583	missense	57677				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:36831589C>T	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1139G>A	19.37:g.36831589C>T	ENSP00000270001:p.Arg380Lys					ZFP14_uc010xtd.1_Missense_Mutation_p.R381K|ZFP14_uc010eex.1_Missense_Mutation_p.R380K	p.R380K	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN			4	1232	-	Esophageal squamous(110;0.162)		380			C2H2-type 8.		A7MD23	Missense_Mutation	SNP	ENST00000270001.7	37	c.1139G>A	CCDS33002.1	.	.	.	.	.	.	.	.	.	.	c	9.459	1.092712	0.20471	0.0	1.16E-4	ENSG00000142065	ENST00000270001;ENST00000392172	T	0.13901	2.55	4.1	4.1	0.47936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000214	T	0.09862	0.0242	N	0.26130	0.795	0.09310	N	0.999992	B;B	0.26483	0.15;0.047	B;B	0.29524	0.103;0.066	T	0.21861	-1.0233	10	0.30854	T	0.27	.	9.435	0.38632	0.0:0.8985:0.0:0.1015	.	380;380	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	K	380	ENSP00000270001:R380K	ENSP00000270001:R380K	R	-	2	0	ZFP14	41523429	0.000000	0.05858	0.978000	0.43139	0.963000	0.63663	0.053000	0.14184	2.270000	0.75569	0.643000	0.83706	AGA		0.373	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917		21	35	0	0	0	0.012319	0	21	35				
LGALS14	56891	broad.mit.edu	37	19	40199884	40199884	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:40199884G>T	ENST00000392052.3	+	4	574	c.351G>T	c.(349-351)ccG>ccT	p.P117P	LGALS14_ENST00000360675.3_Silent_p.P146P	NM_020129.2	NP_064514.1	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14	117	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)	nucleus (GO:0005634)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|stomach(2)	14	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			ATCGATTCCCGCCAGCATCTG	0.458																																							uc002omg.2		NA																	0				ovary(1)|skin(1)	2						c.(349-351)CCG>CCT		lectin, galactoside-binding, soluble, 14 isoform							104.0	99.0	101.0					19																	40199884		2203	4300	6503	SO:0001819	synonymous_variant	56891					nucleus	sugar binding	g.chr19:40199884G>T	AF267852	CCDS12542.1, CCDS46073.1	19q13.2	2014-03-19			ENSG00000006659	ENSG00000006659		"""Lectins, galactoside-binding"""	30054	protein-coding gene	gene with protein product		607260				11997112	Standard	NM_020129		Approved	PPL13, CLC2	uc002omg.3	Q8TCE9	OTTHUMG00000183143	ENST00000392052.3:c.351G>T	19.37:g.40199884G>T						LGALS14_uc002omf.2_Silent_p.P146P	p.P117P	NM_020129	NP_064514	Q8TCE9	PPL13_HUMAN	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)		4	574	+	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	117			Galectin.		A8MPV8|B2R530|C5HZ19|Q7Z4X8|Q96KD4|Q96KD5|Q96KD6|Q9NR03	Silent	SNP	ENST00000392052.3	37	c.351G>T	CCDS46073.1																																																																																				0.458	LGALS14-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465222.1	NM_020129		11	37	1	0	3.07112e-06	0.010729	3.47759e-06	11	37				
MEGF8	1954	broad.mit.edu	37	19	42853681	42853681	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:42853681G>A	ENST00000251268.6	+	14	2329	c.2329G>A	c.(2329-2331)Gag>Aag	p.E777K	MEGF8_ENST00000334370.4_Missense_Mutation_p.E710K	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	777					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GGCTCATCAGGAGAAGGAGAC	0.637																																							uc002otl.3		NA																	0				ovary(1)	1						c.(2128-2130)GAG>AAG		multiple EGF-like-domains 8							25.0	31.0	29.0					19																	42853681		2203	4300	6503	SO:0001583	missense	1954					integral to membrane	calcium ion binding|structural molecule activity	g.chr19:42853681G>A	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2329G>A	19.37:g.42853681G>A	ENSP00000251268:p.Glu777Lys					MEGF8_uc002otm.3_Missense_Mutation_p.E318K	p.E710K	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN			13	2763	+		Prostate(69;0.00682)	777			Extracellular (Potential).		A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37	c.2128G>A		.	.	.	.	.	.	.	.	.	.	G	31	5.064282	0.93898	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.24538	1.85;1.98	4.88	4.88	0.63580	.	0.083276	0.45867	D	0.000327	T	0.13072	0.0317	N	0.08118	0	0.42617	D	0.993336	B;P	0.44139	0.085;0.827	B;B	0.40982	0.016;0.345	T	0.07635	-1.0762	10	0.06494	T	0.89	-21.9396	15.5077	0.75753	0.0:0.0:1.0:0.0	.	777;710	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	K	710;777	ENSP00000334219:E710K;ENSP00000251268:E777K	ENSP00000251268:E777K	E	+	1	0	MEGF8	47545521	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	7.543000	0.82106	2.260000	0.74910	0.491000	0.48974	GAG		0.637	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410		8	25	0	0	0	0.00308	0	8	25				
IRGC	56269	broad.mit.edu	37	19	44224056	44224056	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:44224056A>T	ENST00000244314.5	+	2	1545	c.1346A>T	c.(1345-1347)aAg>aTg	p.K449M		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	449						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				CTCCTTCTTAAGTACATTCTG	0.557																																					Colon(189;350 2037 11447 13433 38914)	Colon(189;350 2037 11447 13433 38914)	uc002oxh.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1345-1347)AAG>ATG		immunity-related GTPase family, cinema							31.0	38.0	36.0					19																	44224056		2196	4294	6490	SO:0001583	missense	56269					membrane	GTP binding|hydrolase activity, acting on acid anhydrides	g.chr19:44224056A>T	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.1346A>T	19.37:g.44224056A>T	ENSP00000244314:p.Lys449Met						p.K449M	NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN			2	1493	+		Prostate(69;0.0435)	449					Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	37	c.1346A>T	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	A	17.72	3.458131	0.63401	.	.	ENSG00000124449	ENST00000244314	T	0.33216	1.42	4.77	4.77	0.60923	.	0.466802	0.19967	N	0.102071	T	0.36663	0.0975	N	0.14661	0.345	0.36589	D	0.873995	D	0.89917	1.0	D	0.83275	0.996	T	0.49370	-0.8947	10	0.87932	D	0	.	10.696	0.45899	1.0:0.0:0.0:0.0	.	449	Q6NXR0	IIGP5_HUMAN	M	449	ENSP00000244314:K449M	ENSP00000244314:K449M	K	+	2	0	IRGC	48915896	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	4.937000	0.63513	1.800000	0.52685	0.528000	0.53228	AAG		0.557	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612		18	30	0	0	0	0.007413	0	18	30				
ZNF222	7673	broad.mit.edu	37	19	44536246	44536246	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:44536246C>G	ENST00000187879.8	+	4	581	c.419C>G	c.(418-420)tCa>tGa	p.S140*	ZNF222_ENST00000391960.3_Nonsense_Mutation_p.S180*|ZNF223_ENST00000591793.1_Intron	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				CAGTTATATTCAGGAGAGAAG	0.403																																							uc002oyc.2		NA																	0				ovary(3)	3						c.(418-420)TCA>TGA		zinc finger protein 222 isoform 2							137.0	142.0	140.0					19																	44536246		2203	4300	6503	SO:0001587	stop_gained	7673				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44536246C>G	AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.419C>G	19.37:g.44536246C>G	ENSP00000187879:p.Ser140*					ZNF284_uc010ejd.2_Intron|ZNF222_uc002oye.2_Nonsense_Mutation_p.S180*|ZNF222_uc002oyd.2_Nonsense_Mutation_p.S86*	p.S140*	NM_013360	NP_037492	Q9UK12	ZN222_HUMAN			4	602	+		Prostate(69;0.0435)	140					G5E9B9|Q8N6G7|Q9P1U5	Nonsense_Mutation	SNP	ENST00000187879.8	37	c.419C>G	CCDS33045.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178466	0.78564	.	.	ENSG00000159885	ENST00000391960;ENST00000187879;ENST00000251272	.	.	.	2.57	2.57	0.30868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.8507	0.46769	0.0:1.0:0.0:0.0	.	.	.	.	X	180;140;86	.	ENSP00000187879:S140X	S	+	2	0	ZNF222	49228086	0.005000	0.15991	0.008000	0.14137	0.356000	0.29392	1.497000	0.35649	1.413000	0.46997	0.205000	0.17691	TCA		0.403	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460465.2			23	72	0	0	0	0.012319	0	23	72				
BCAM	4059	broad.mit.edu	37	19	45322414	45322414	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:45322414G>T	ENST00000270233.6	+	11	1460	c.1438G>T	c.(1438-1440)Gac>Tac	p.D480Y	BCAM_ENST00000589651.1_Missense_Mutation_p.D480Y	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	480	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CGGCCATCCAGACCCCAAACT	0.592																																							uc002ozu.2		NA																	0				skin(1)	1						c.(1438-1440)GAC>TAC		basal cell adhesion molecule isoform 1							92.0	98.0	96.0					19																	45322414		2203	4300	6503	SO:0001583	missense	4059				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity	g.chr19:45322414G>T	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1438G>T	19.37:g.45322414G>T	ENSP00000270233:p.Asp480Tyr					BCAM_uc002ozt.1_Missense_Mutation_p.D480Y	p.D480Y	NM_005581	NP_005572	P50895	BCAM_HUMAN			11	1482	+	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)	480			Extracellular (Potential).|Ig-like C2-type 3.		A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	c.1438G>T	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	5.945	0.358381	0.11239	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.03124	4.04;4.04	4.37	2.16	0.27623	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03871	0.0109	L	0.39898	1.24	0.09310	N	0.999998	B	0.24426	0.103	B	0.15052	0.012	T	0.35126	-0.9801	9	0.62326	D	0.03	-7.0935	7.5081	0.27558	0.221:0.0:0.779:0.0	.	480	P50895	BCAM_HUMAN	Y	480	ENSP00000270233:D480Y;ENSP00000375817:D480Y	ENSP00000270233:D480Y	D	+	1	0	BCAM	50014254	0.895000	0.30542	0.641000	0.29422	0.063000	0.16089	2.525000	0.45598	0.972000	0.38314	0.478000	0.44815	GAC		0.592	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581		23	77	1	0	2.52088e-20	0.00278	3.51857e-20	23	77				
PTGIR	5739	broad.mit.edu	37	19	47124810	47124810	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:47124810G>T	ENST00000291294.2	-	3	1021	c.888C>A	c.(886-888)cgC>cgA	p.R296R	PTGIR_ENST00000598865.1_Silent_p.R84R|PTGIR_ENST00000597185.1_Silent_p.R25R|PTGIR_ENST00000594275.1_Silent_p.R53R	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	296					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	AGACAGCCTTGCGGAAAAGGA	0.632																																							uc002pex.2		NA																	0					0						c.(886-888)CGC>CGA		prostaglandin I2 (prostacyclin) receptor (IP)	Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Epoprostenol(DB01240)|Iloprost(DB01088)|Misoprostol(DB00929)						47.0	52.0	50.0					19																	47124810		2203	4299	6502	SO:0001819	synonymous_variant	5739				cell-cell signaling|G-protein signaling, coupled to cyclic nucleotide second messenger|platelet activation	integral to plasma membrane	G-protein coupled receptor activity|guanyl-nucleotide exchange factor activity	g.chr19:47124810G>T		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.888C>A	19.37:g.47124810G>T							p.R296R	NM_000960	NP_000951	P43119	PI2R_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	3	1001	-		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)	296			Cytoplasmic (Potential).			Silent	SNP	ENST00000291294.2	37	c.888C>A	CCDS12686.1																																																																																				0.632	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1			19	29	1	0	3.99206e-14	0.007413	5.13741e-14	19	29				
ZNF534	147658	broad.mit.edu	37	19	52938390	52938390	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:52938390T>C	ENST00000332323.6	+	3	299	c.238T>C	c.(238-240)Tgg>Cgg	p.W80R	ZNF534_ENST00000433050.1_Missense_Mutation_p.W67R|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Missense_Mutation_p.W67R	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	80	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						GAGAGATCCCTGGACTCTGCA	0.463																																							uc002pzk.2		NA																	0					0						c.(238-240)TGG>CGG		zinc finger protein 534 isoform 2							115.0	97.0	102.0					19																	52938390		1568	3582	5150	SO:0001583	missense	147658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52938390T>C	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.238T>C	19.37:g.52938390T>C	ENSP00000327538:p.Trp80Arg					ZNF534_uc002pzj.1_Missense_Mutation_p.W67R|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.W67R	p.W80R	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN			3	299	+			80			KRAB.		Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	c.238T>C	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	T	9.658	1.143298	0.21205	.	.	ENSG00000198633	ENST00000301085;ENST00000332323;ENST00000433050;ENST00000391790	T;T;T	0.12465	5.36;2.68;2.9	1.67	1.67	0.24075	Krueppel-associated box (2);	.	.	.	.	T	0.11537	0.0281	L	0.49350	1.555	0.09310	N	1	P;B;P	0.45768	0.866;0.006;0.609	B;B;B	0.38106	0.265;0.005;0.168	T	0.20042	-1.0287	9	0.66056	D	0.02	.	5.6702	0.17717	0.0:0.0:0.0:1.0	.	67;80;67	Q76KX8-2;Q76KX8;Q1T7F5	.;ZN534_HUMAN;.	R	67;80;67;79	ENSP00000301085:W67R;ENSP00000327538:W80R;ENSP00000391358:W67R	ENSP00000301085:W67R	W	+	1	0	ZNF534	57630202	0.099000	0.21834	0.024000	0.17045	0.017000	0.09413	0.287000	0.18920	0.695000	0.31675	0.338000	0.21704	TGG		0.463	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512		7	20	0	0	0	0.00308	0	7	20				
ZNF160	90338	broad.mit.edu	37	19	53572747	53572747	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:53572747C>T	ENST00000429604.1	-	7	1455	c.1040G>A	c.(1039-1041)gGa>gAa	p.G347E	ZNF160_ENST00000599056.1_Missense_Mutation_p.G347E|ZNF160_ENST00000601421.1_Missense_Mutation_p.G311E|ZNF160_ENST00000418871.1_Missense_Mutation_p.G347E	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	347					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		AAAGGCTTTTCCACACTCATT	0.403																																							uc010eqk.2		NA																	0				central_nervous_system(1)	1						c.(1039-1041)GGA>GAA		zinc finger protein 160							85.0	86.0	86.0					19																	53572747		2203	4300	6503	SO:0001583	missense	90338				hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53572747C>T	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.1040G>A	19.37:g.53572747C>T	ENSP00000406201:p.Gly347Glu					ZNF160_uc002qaq.3_Missense_Mutation_p.G347E|ZNF160_uc002qar.3_Missense_Mutation_p.G347E	p.G347E	NM_001102603	NP_001096073	Q9HCG1	ZN160_HUMAN		GBM - Glioblastoma multiforme(134;0.02)	7	1456	-			347			C2H2-type 4.		Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	ENST00000429604.1	37	c.1040G>A	CCDS12859.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081260	0.36758	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.07114	3.22;3.22	2.47	1.37	0.22104	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23926	0.0579	M	0.75150	2.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00688	-1.1609	9	0.62326	D	0.03	.	8.565	0.33534	0.0:0.8715:0.0:0.1285	.	347	Q9HCG1	ZN160_HUMAN	E	347	ENSP00000406201:G347E;ENSP00000409597:G347E	ENSP00000409597:G347E	G	-	2	0	ZNF160	58264559	0.069000	0.21087	0.015000	0.15790	0.068000	0.16541	0.350000	0.20079	0.339000	0.23719	0.561000	0.74099	GGA		0.403	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288		15	51	0	0	0	0.003163	0	15	51				
CACNG6	59285	broad.mit.edu	37	19	54502940	54502940	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:54502940C>A	ENST00000252729.2	+	3	1049	c.459C>A	c.(457-459)gcC>gcA	p.A153A	CACNG6_ENST00000352529.1_Intron|CACNG6_ENST00000346968.2_Intron	NM_145814.1	NP_665813.1	Q9BXT2	CCG6_HUMAN	calcium channel, voltage-dependent, gamma subunit 6	153					calcium ion transport (GO:0006816)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		CAGTCATGGCCTTGGGGTGCC	0.567																																							uc002qct.2		NA																	0				ovary(2)	2						c.(457-459)GCC>GCA		voltage-dependent calcium channel gamma-6							257.0	234.0	242.0					19																	54502940		2203	4300	6503	SO:0001819	synonymous_variant	59285					voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr19:54502940C>A	AF288386	CCDS12870.1, CCDS12871.1	19q13.4	2008-05-02			ENSG00000130433	ENSG00000130433		"""Calcium channel subunits"""	13625	protein-coding gene	gene with protein product		606898				11170751	Standard	NM_145814		Approved		uc002qct.3	Q9BXT2	OTTHUMG00000064907	ENST00000252729.2:c.459C>A	19.37:g.54502940C>A						CACNG6_uc002qcu.2_Intron|CACNG6_uc002qcv.2_Intron	p.A153A	NM_145814	NP_665813	Q9BXT2	CCG6_HUMAN		GBM - Glioblastoma multiforme(134;0.168)	3	1049	+	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)		153			Helical; (Potential).			Silent	SNP	ENST00000252729.2	37	c.459C>A	CCDS12870.1																																																																																				0.567	CACNG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139359.1			110	127	1	0	3.60008e-62	0.01441	5.2468e-62	110	127				
LILRB2	10288	broad.mit.edu	37	19	54783278	54783278	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:54783278G>A	ENST00000391749.4	-	5	851	c.580C>T	c.(580-582)Cac>Tac	p.H194Y	LILRB2_ENST00000314446.5_Missense_Mutation_p.H194Y|LILRB2_ENST00000434421.1_Missense_Mutation_p.H78Y|MIR4752_ENST00000579672.1_RNA|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000391746.1_Missense_Mutation_p.H194Y|LILRB2_ENST00000391748.1_Missense_Mutation_p.H194Y	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	194	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TAGCACCTGTGCGACCACCTG	0.582																																							uc002qfb.2		NA																	0				skin(1)	1						c.(580-582)CAC>TAC		leukocyte immunoglobulin-like receptor,							123.0	118.0	120.0					19																	54783278		2203	4300	6503	SO:0001583	missense	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54783278G>A	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.580C>T	19.37:g.54783278G>A	ENSP00000375629:p.His194Tyr					LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.H194Y|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.H194Y|LILRB2_uc010yet.1_Missense_Mutation_p.H78Y|LILRB2_uc010yeu.1_RNA	p.H194Y	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	5	846	-	Ovarian(34;0.19)		194			Extracellular (Potential).|Ig-like C2-type 2.		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	ENST00000391749.4	37	c.580C>T	CCDS12886.1	.	.	.	.	.	.	.	.	.	.	A	0.664	-0.804625	0.02819	.	.	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746;ENST00000434421	T;T;T;T;T	0.00296	8.24;8.24;8.24;8.24;8.24	2.58	0.277	0.15668	Immunoglobulin-like fold (1);	0.250157	0.28062	N	0.016758	T	0.00039	0.0001	N	0.00000	-4.19	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.51505	-0.8697	10	0.11794	T	0.64	.	6.2544	0.20865	0.5741:0.0:0.4259:0.0	.	194;211;194	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	Y	194;194;194;194;78	ENSP00000375628:H194Y;ENSP00000319960:H194Y;ENSP00000375629:H194Y;ENSP00000375626:H194Y;ENSP00000410117:H78Y	ENSP00000319960:H194Y	H	-	1	0	LILRB2	59475090	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	1.182000	0.32029	-0.547000	0.06207	-0.851000	0.03033	CAC		0.582	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			30	78	0	0	0	0.009535	0	30	78				
ZNF581	51545	broad.mit.edu	37	19	56156247	56156247	+	Nonsense_Mutation	SNP	C	C	T	rs375452466		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:56156247C>T	ENST00000587252.1	+	2	583	c.310C>T	c.(310-312)Cga>Tga	p.R104*	ZNF581_ENST00000270451.5_Nonsense_Mutation_p.R104*|ZNF581_ENST00000588537.1_Nonsense_Mutation_p.R104*			Q9P0T4	ZN581_HUMAN	zinc finger protein 581	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)	3		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CTACCTTCAGCGACACAGCAT	0.587																																							uc002qln.2		NA																	0					0						c.(310-312)CGA>TGA		zinc finger protein 581		C	stop/ARG	0,4406		0,0,2203	76.0	69.0	71.0		310	1.5	0.1	19		71	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	ZNF581	NM_016535.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		104/198	56156247	1,13005	2203	4300	6503	SO:0001587	stop_gained	51545				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:56156247C>T	AK026203	CCDS12932.1	19q13.42	2013-09-20			ENSG00000171425	ENSG00000171425		"""Zinc fingers, C2H2-type"""	25017	protein-coding gene	gene with protein product						11042152	Standard	NM_016535		Approved	HSPC189, FLJ22550	uc002qlq.3	Q9P0T4	OTTHUMG00000180869	ENST00000587252.1:c.310C>T	19.37:g.56156247C>T	ENSP00000466047:p.Arg104*					ZNF581_uc002qlq.2_Nonsense_Mutation_p.R104*|CCDC106_uc002qlr.2_5'Flank	p.R104*	NM_016535	NP_057619	Q9P0T4	ZN581_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)	2	1026	+		Ovarian(87;0.133)	104			C2H2-type 1.		B2RDM6	Nonsense_Mutation	SNP	ENST00000587252.1	37	c.310C>T	CCDS12932.1	.	.	.	.	.	.	.	.	.	.	C	36	5.773497	0.96922	0.0	1.16E-4	ENSG00000171425	ENST00000270451	.	.	.	3.9	1.45	0.22620	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999988	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6381	0.28277	0.2776:0.5726:0.1498:0.0	.	.	.	.	X	104	.	ENSP00000270451:R104X	R	+	1	2	ZNF581	60848059	0.889000	0.30405	0.083000	0.20561	0.985000	0.73830	0.240000	0.18042	0.954000	0.37851	0.407000	0.27541	CGA		0.587	ZNF581-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453430.1	NM_016535		23	71	0	0	0	0.00333	0	23	71				
ZNF835	90485	broad.mit.edu	37	19	57176525	57176525	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:57176525C>T	ENST00000537055.2	-	2	273	c.42G>A	c.(40-42)ttG>ttA	p.L14L		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	14					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						AGTTTCCTTCCAACTCTGCGC	0.572																																							uc010ygo.1		NA																	0				pancreas(3)|skin(1)	4						c.(106-108)TTG>TTA		zinc finger protein 835							71.0	73.0	72.0					19																	57176525		1991	4158	6149	SO:0001819	synonymous_variant	90485							g.chr19:57176525C>T	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.42G>A	19.37:g.57176525C>T						ZNF835_uc010ygn.1_Silent_p.L14L	p.L36L	NM_001005850	NP_001005850					2	108	-								B7Z5Y0|G3V1S0	Silent	SNP	ENST00000537055.2	37	c.108G>A	CCDS56105.1																																																																																				0.572	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850		12	30	0	0	0	0.010729	0	12	30				
ZNF256	10172	broad.mit.edu	37	19	58453016	58453016	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:58453016G>T	ENST00000282308.3	-	3	1356	c.1160C>A	c.(1159-1161)tCc>tAc	p.S387Y	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	387					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		CTGGCTAAAGGATTTCCCACA	0.413																																					NSCLC(55;1313 1552 8040 11996)	NSCLC(55;1313 1552 8040 11996)	uc002qqu.2		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(1159-1161)TCC>TAC		zinc finger protein 256							72.0	67.0	69.0					19																	58453016		2203	4300	6503	SO:0001583	missense	10172				multicellular organismal development|negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58453016G>T	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.1160C>A	19.37:g.58453016G>T	ENSP00000282308:p.Ser387Tyr					ZNF256_uc010euj.2_Missense_Mutation_p.S234Y	p.S387Y	NM_005773	NP_005764	Q9Y2P7	ZN256_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)	3	1395	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	387			C2H2-type 7.		B2RA92|Q53Y85|Q9BV71	Missense_Mutation	SNP	ENST00000282308.3	37	c.1160C>A	CCDS12966.1	.	.	.	.	.	.	.	.	.	.	.	10.45	1.353157	0.24512	.	.	ENSG00000152454	ENST00000282308	T	0.18810	2.19	2.97	1.91	0.25777	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40546	0.1121	M	0.67569	2.06	0.24066	N	0.995997	D	0.89917	1.0	D	0.87578	0.998	T	0.09596	-1.0667	9	0.52906	T	0.07	.	8.755	0.34639	0.1217:0.0:0.8783:0.0	.	387	Q9Y2P7	ZN256_HUMAN	Y	387	ENSP00000282308:S387Y	ENSP00000282308:S387Y	S	-	2	0	ZNF256	63144828	0.000000	0.05858	0.972000	0.41901	0.190000	0.23558	-0.653000	0.05360	0.557000	0.29117	0.563000	0.77884	TCC		0.413	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1			8	38	1	0	0.00307968	0.00308	0.00325586	8	38				
ZNF606	80095	broad.mit.edu	37	19	58490876	58490876	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:58490876G>C	ENST00000341164.4	-	7	1792	c.1172C>G	c.(1171-1173)aCa>aGa	p.T391R	ZNF606_ENST00000536132.1_Missense_Mutation_p.T301R	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GTAAGTGCTTGTATGTTGAGT	0.373																																							uc002qqw.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1171-1173)ACA>AGA		zinc finger protein 606							108.0	96.0	100.0					19																	58490876		2203	4300	6503	SO:0001583	missense	80095				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58490876G>C	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.1172C>G	19.37:g.58490876G>C	ENSP00000343617:p.Thr391Arg					ZNF606_uc010yhp.1_Missense_Mutation_p.T301R	p.T391R	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)	7	1790	-		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	391					A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	ENST00000341164.4	37	c.1172C>G	CCDS12968.1	.	.	.	.	.	.	.	.	.	.	G	6.749	0.507099	0.12883	.	.	ENSG00000166704	ENST00000341164;ENST00000536132;ENST00000551380	T;T;T	0.14516	2.5;2.5;2.5	4.55	3.43	0.39272	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.142777	0.32836	N	0.005600	T	0.03651	0.0104	N	0.00517	-1.405	0.21897	N	0.999487	B	0.14438	0.01	B	0.14023	0.01	T	0.38222	-0.9671	10	0.32370	T	0.25	.	9.9191	0.41453	0.0:0.0:0.6511:0.3489	.	391	Q8WXB4	ZN606_HUMAN	R	391;301;391	ENSP00000343617:T391R;ENSP00000445624:T301R;ENSP00000446972:T391R	ENSP00000343617:T391R	T	-	2	0	ZNF606	63182688	0.000000	0.05858	0.999000	0.59377	0.849000	0.48306	0.030000	0.13688	2.515000	0.84797	0.655000	0.94253	ACA		0.373	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	NM_025027		11	53	0	0	0	0.008291	0	11	53				
SLC27A5	10998	broad.mit.edu	37	19	59022759	59022759	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr19:59022759C>G	ENST00000263093.2	-	1	673	c.564G>C	c.(562-564)ctG>ctC	p.L188L	SLC27A5_ENST00000601355.1_Intron	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	188					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		GCCACATACACAGGGCTGGAA	0.687																																							uc002qtc.2		NA																	0					0						c.(562-564)CTG>CTC		solute carrier family 27 (fatty acid							12.0	12.0	12.0					19																	59022759		2159	4218	6377	SO:0001819	synonymous_variant	10998				bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity	g.chr19:59022759C>G	AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.564G>C	19.37:g.59022759C>G							p.L188L	NM_012254	NP_036386	Q9Y2P5	S27A5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)	1	674	-		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	188			Cytoplasmic (Probable).		B3KVP6|B4DPQ1	Silent	SNP	ENST00000263093.2	37	c.564G>C	CCDS12983.1																																																																																				0.687	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467060.1	NM_012254		8	7	0	0	0	0.00308	0	8	7				
RRM2	6241	broad.mit.edu	37	2	10263558	10263558	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:10263558G>A	ENST00000304567.5	+	3	288	c.219G>A	c.(217-219)ctG>ctA	p.L73L	RP11-254F7.4_ENST00000607140.1_lincRNA|RRM2_ENST00000360566.2_Silent_p.L133L	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2	73					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	AGCCGCTGCTGAGAGAAAACC	0.517																																							uc002rah.2		NA																	0					0						c.(217-219)CTG>CTA		ribonucleotide reductase M2 polypeptide isoform							39.0	47.0	44.0					2																	10263558		2203	4299	6502	SO:0001819	synonymous_variant	6241				deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding	g.chr2:10263558G>A		CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449	ENST00000304567.5:c.219G>A	2.37:g.10263558G>A							p.L73L	NM_001034	NP_001025	P31350	RIR2_HUMAN		Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	3	410	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		73					B2R9B5|J3KP43|Q5WRU7	Silent	SNP	ENST00000304567.5	37	c.219G>A	CCDS1669.1																																																																																				0.517	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364902.2			14	49	0	0	0	0.00245	0	14	49				
GREB1	9687	broad.mit.edu	37	2	11758583	11758583	+	Silent	SNP	C	C	G	rs200161857		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:11758583C>G	ENST00000381486.2	+	22	3882	c.3582C>G	c.(3580-3582)ccC>ccG	p.P1194P	GREB1_ENST00000396123.1_Silent_p.P192P|GREB1_ENST00000234142.5_Silent_p.P1194P	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1194	Ser-rich.					integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGCACAGTCCCGGGCCGACGC	0.716																																					Ovarian(39;850 945 2785 23371 33093)	Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	0				ovary(1)	1						c.(3580-3582)CCC>CCG		growth regulation by estrogen in breast cancer 1							7.0	10.0	10.0					2																	11758583		2036	4132	6168	SO:0001819	synonymous_variant	9687					integral to membrane		g.chr2:11758583C>G		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3582C>G	2.37:g.11758583C>G						GREB1_uc002rbp.1_Silent_p.P192P	p.P1194P	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	22	3882	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		1194			Ser-rich.		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	ENST00000381486.2	37	c.3582C>G	CCDS42655.1																																																																																				0.716	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		4	9	0	0	0	0.009096	0	4	9				
EHD3	30845	broad.mit.edu	37	2	31489255	31489255	+	Silent	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:31489255A>T	ENST00000322054.5	+	6	1578	c.1293A>T	c.(1291-1293)ggA>ggT	p.G431G	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	431					blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					AGGGGGCTGGAGAAGGTATCG	0.627																																							uc002rnu.2		NA																	0				skin(2)	2						c.(1291-1293)GGA>GGT		EH-domain containing 3							78.0	71.0	73.0					2																	31489255		2203	4300	6503	SO:0001819	synonymous_variant	30845				blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding	g.chr2:31489255A>T	AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1293A>T	2.37:g.31489255A>T						EHD3_uc010ymt.1_3'UTR	p.G431G	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN			6	1901	+	Acute lymphoblastic leukemia(172;0.155)		431					B4DFR5|D6W574|Q8N514|Q9NZB3	Silent	SNP	ENST00000322054.5	37	c.1293A>T	CCDS1774.1																																																																																				0.627	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600		15	24	0	0	0	0.003163	0	15	24				
EHBP1	23301	broad.mit.edu	37	2	63176238	63176238	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:63176238G>A	ENST00000263991.5	+	14	2844	c.2362G>A	c.(2362-2364)Gat>Aat	p.D788N	EHBP1_ENST00000431489.1_Missense_Mutation_p.D753N|EHBP1_ENST00000405015.3_Missense_Mutation_p.D753N|EHBP1_ENST00000354487.3_Missense_Mutation_p.D753N|EHBP1_ENST00000405289.1_Missense_Mutation_p.D753N	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	788						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GACGGAGTCTGATCCAGATGC	0.353																																							uc002sby.2		NA																	0				ovary(1)|breast(1)	2						c.(2362-2364)GAT>AAT		EH domain binding protein 1 isoform 1							40.0	43.0	42.0					2																	63176238		2202	4296	6498	SO:0001583	missense	23301	Hereditary_Prostate_Cancer				cytoplasm|membrane		g.chr2:63176238G>A	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.2362G>A	2.37:g.63176238G>A	ENSP00000263991:p.Asp788Asn					EHBP1_uc010fcp.2_Missense_Mutation_p.D753N|EHBP1_uc002sbz.2_Missense_Mutation_p.D753N|EHBP1_uc002scb.2_Missense_Mutation_p.D753N	p.D788N	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)		14	2844	+	Lung NSC(7;0.0951)|all_lung(7;0.169)		788					O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	37	c.2362G>A	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771829	0.49680	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T	0.75589	-0.92;-0.92;-0.95;-0.94;-0.94	6.03	4.23	0.50019	.	0.274629	0.40818	N	0.001008	T	0.60457	0.2270	L	0.31926	0.97	0.36284	D	0.855961	B;B;B	0.16603	0.018;0.001;0.006	B;B;B	0.14578	0.011;0.004;0.005	T	0.59963	-0.7355	10	0.22109	T	0.4	.	9.7192	0.40293	0.2067:0.0:0.7933:0.0	.	753;753;788	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	N	753;753;788;753;753	ENSP00000384143:D753N;ENSP00000403783:D753N;ENSP00000263991:D788N;ENSP00000346482:D753N;ENSP00000385524:D753N	ENSP00000263991:D788N	D	+	1	0	EHBP1	63029742	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.486000	0.66856	1.560000	0.49568	-0.150000	0.13652	GAT		0.353	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252		15	32	0	0	0	0.00245	0	15	32				
GFPT1	2673	broad.mit.edu	37	2	69565628	69565628	+	Nonsense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:69565628T>A	ENST00000357308.4	-	14	1451	c.1273A>T	c.(1273-1275)Aga>Tga	p.R425*	GFPT1_ENST00000361060.5_Nonsense_Mutation_p.R407*	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	425	Isomerase.|SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						GGTGTGTTTCTGTCCAGGAAG	0.398																																							uc002sfh.2		NA																	0				skin(1)	1						c.(1219-1221)AGA>TGA		glucosamine-fructose-6-phosphate							118.0	111.0	113.0					2																	69565628		2203	4300	6503	SO:0001587	stop_gained	2673				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding	g.chr2:69565628T>A		CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.1273A>T	2.37:g.69565628T>A	ENSP00000349860:p.Arg425*						p.R407*	NM_002056	NP_002047	Q06210	GFPT1_HUMAN			13	1398	-			425			SIS 1.		Q53QE6|Q9BXF8	Nonsense_Mutation	SNP	ENST00000357308.4	37	c.1219A>T	CCDS58713.1	.	.	.	.	.	.	.	.	.	.	T	38	7.122001	0.98077	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	.	.	.	5.05	3.9	0.45041	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.9321	11.2358	0.48940	0.0:0.0:0.1641:0.8358	.	.	.	.	X	425;407	.	ENSP00000349860:R425X	R	-	1	2	GFPT1	69419132	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.490000	0.35573	0.954000	0.37851	0.528000	0.53228	AGA		0.398	GFPT1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				6	25	0	0	0	0.001168	0	6	25				
FBXO41	150726	broad.mit.edu	37	2	73491152	73491152	+	Silent	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:73491152G>C	ENST00000521871.1	-	7	2251	c.1836C>G	c.(1834-1836)acC>acG	p.T612T	FBXO41_ENST00000295133.5_Silent_p.T673T|FBXO41_ENST00000520530.2_Silent_p.T612T			Q8TF61	FBX41_HUMAN	F-box protein 41	612										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						AGTGGGCCTGGGTGCACCACT	0.627																																							uc002sjb.1		NA																	0				breast(2)|pancreas(1)	3						c.(2017-2019)ACC>ACG		F-box protein 41							19.0	22.0	21.0					2																	73491152		1983	4167	6150	SO:0001819	synonymous_variant	150726					intracellular	protein binding|zinc ion binding	g.chr2:73491152G>C	AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.1836C>G	2.37:g.73491152G>C							p.T673T	NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN			7	2019	-			612					G3V0Z7|Q2M1V8	Silent	SNP	ENST00000521871.1	37	c.2019C>G	CCDS46337.2																																																																																				0.627	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377381.1			5	4	0	0	0	0.000602	0	5	4				
SEMA4C	54910	broad.mit.edu	37	2	97526514	97526514	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:97526514G>C	ENST00000305476.5	-	15	2483	c.2351C>G	c.(2350-2352)tCa>tGa	p.S784*	ANKRD39_ENST00000393537.4_5'Flank	NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	784					cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						ATTGGCATTTGAGTTCCGCCC	0.667																																							uc002sxh.3		NA																	0				skin(2)	2						c.(2350-2352)TCA>TGA		semaphorin 4C precursor							82.0	90.0	87.0					2																	97526514		2203	4300	6503	SO:0001587	stop_gained	54910				muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity	g.chr2:97526514G>C	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.2351C>G	2.37:g.97526514G>C	ENSP00000306844:p.Ser784*					ANKRD39_uc002sxd.3_5'Flank|SEMA4C_uc002sxf.3_Nonsense_Mutation_p.S284*|SEMA4C_uc002sxe.2_Nonsense_Mutation_p.S325*|SEMA4C_uc002sxg.3_Nonsense_Mutation_p.S837*	p.S784*	NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN			15	2511	-			784			Cytoplasmic (Potential).		Q32MJ3|Q7Z5X0	Nonsense_Mutation	SNP	ENST00000305476.5	37	c.2351C>G	CCDS2029.1	.	.	.	.	.	.	.	.	.	.	G	38	7.246416	0.98161	.	.	ENSG00000168758	ENST00000305476	.	.	.	4.91	4.91	0.64330	.	0.791937	0.11622	N	0.545707	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	15.6323	0.76920	0.0:0.0:1.0:0.0	.	.	.	.	X	784	.	ENSP00000306844:S784X	S	-	2	0	SEMA4C	96890241	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.514000	0.67043	2.552000	0.86080	0.555000	0.69702	TCA		0.667	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	NM_017789		36	73	0	0	0	0.005524	0	36	73				
ST6GAL2	84620	broad.mit.edu	37	2	107423166	107423166	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:107423166G>T	ENST00000409382.3	-	6	2168	c.1558C>A	c.(1558-1560)Cct>Act	p.P520T	ST6GAL2_ENST00000361686.4_Missense_Mutation_p.P520T	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	520					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CTTGGTGCAGGGCAGTGCACC	0.507																																							uc002tdq.2		NA																	0				pancreas(6)|ovary(4)|skin(1)	11						c.(1558-1560)CCT>ACT		ST6 beta-galactosamide							107.0	101.0	103.0					2																	107423166		2203	4300	6503	SO:0001583	missense	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107423166G>T	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1558C>A	2.37:g.107423166G>T	ENSP00000386942:p.Pro520Thr					ST6GAL2_uc002tdr.2_Missense_Mutation_p.P520T	p.P520T	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN			6	1677	-			520			Lumenal (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	c.1558C>A	CCDS2073.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.77|12.77	2.038709|2.038709	0.35989|0.35989	.|.	.|.	ENSG00000144057|ENSG00000144057	ENST00000361803|ENST00000361686;ENST00000409382	.|T;T	.|0.14144	.|2.53;2.53	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.212707|0.212707	0.49305|0.49305	D|D	0.000149|0.000149	T|T	0.16981|0.16981	0.0408|0.0408	L|L	0.49699|0.49699	1.58|1.58	0.80722|0.80722	D|D	1|1	.|B	.|0.21606	.|0.058	.|B	.|0.18263	.|0.021	T|T	0.02533|0.02533	-1.1145|-1.1145	6|10	.|0.30854	.|T	.|0.27	-27.8131|-27.8131	19.0512|19.0512	0.93046|0.93046	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|520	.|Q96JF0	.|SIAT2_HUMAN	H|T	85|520	.|ENSP00000355273:P520T;ENSP00000386942:P520T	.|ENSP00000355273:P520T	P|P	-|-	2|1	0|0	ST6GAL2|ST6GAL2	106789598|106789598	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.373000|0.373000	0.29922|0.29922	3.761000|3.761000	0.55242|0.55242	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	CCC|CCT		0.507	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		30	59	1	0	8.4185e-14	0.012213	1.07738e-13	30	59				
GYPC	2995	broad.mit.edu	37	2	127453545	127453545	+	Missense_Mutation	SNP	G	G	T	rs200879714		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:127453545G>T	ENST00000259254.4	+	4	545	c.214G>T	c.(214-216)Gtc>Ttc	p.V72F	GYPC_ENST00000409836.3_Missense_Mutation_p.V53F|GYPC_ENST00000464053.1_3'UTR|GYPC_ENST00000356887.7_Missense_Mutation_p.V51F	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	72						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		TGTGGCCATCGTCCTAGTCTC	0.607																																					Melanoma(110;806 1600 6704 9981 33404)	Melanoma(110;806 1600 6704 9981 33404)	uc002tnq.2		NA																	0				central_nervous_system(1)	1						c.(214-216)GTC>TTC		glycophorin C isoform 1							196.0	153.0	167.0					2																	127453545		2203	4300	6503	SO:0001583	missense	2995					cortical cytoskeleton|integral to plasma membrane	protein binding	g.chr2:127453545G>T		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.214G>T	2.37:g.127453545G>T	ENSP00000259254:p.Val72Phe					GYPC_uc002tnr.2_Missense_Mutation_p.V53F|GYPC_uc010flv.2_RNA	p.V72F	NM_002101	NP_002092	P04921	GLPC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.075)	4	370	+	Colorectal(110;0.0533)		72			Helical; Signal-anchor for type III membrane protein.		B2R522|Q53SV9|Q92642	Missense_Mutation	SNP	ENST00000259254.4	37	c.214G>T	CCDS2136.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120044	0.37436	.	.	ENSG00000136732	ENST00000259254;ENST00000356887;ENST00000409836	T;T;T	0.21734	2.47;1.99;2.47	5.22	2.41	0.29592	.	.	.	.	.	T	0.18215	0.0437	L	0.47190	1.495	0.38665	D	0.952173	P;P	0.46457	0.453;0.878	B;B	0.41619	0.149;0.361	T	0.04347	-1.0958	9	0.87932	D	0	-5.7083	6.9613	0.24599	0.1526:0.0:0.7071:0.1403	.	51;72	P04921-2;P04921	.;GLPC_HUMAN	F	72;51;53	ENSP00000259254:V72F;ENSP00000349354:V51F;ENSP00000386904:V53F	ENSP00000259254:V72F	V	+	1	0	GYPC	127170015	0.995000	0.38212	0.285000	0.24819	0.020000	0.10135	2.361000	0.44160	0.201000	0.20466	0.561000	0.74099	GTC		0.607	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254297.1	NM_002101		27	90	1	0	1.77063e-15	0.005443	2.32395e-15	27	90				
ARHGAP15	55843	broad.mit.edu	37	2	144381787	144381787	+	Silent	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:144381787T>A	ENST00000295095.6	+	12	1256	c.1089T>A	c.(1087-1089)ccT>ccA	p.P363P		NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	363	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		GGGAGCTGCCTGAGCCGCTCT	0.507																																							uc002tvm.3		NA																	0				ovary(1)|skin(1)	2						c.(1087-1089)CCT>CCA		ARHGAP15							95.0	88.0	90.0					2																	144381787		2203	4300	6503	SO:0001819	synonymous_variant	55843				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity	g.chr2:144381787T>A	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.1089T>A	2.37:g.144381787T>A						ARHGAP15_uc002tvn.2_Silent_p.P129P	p.P363P	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.151)	12	1240	+			363			Rho-GAP.		Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	37	c.1089T>A	CCDS2184.1																																																																																				0.507	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460		20	16	0	0	0	0.010504	0	20	16				
GALNT5	11227	broad.mit.edu	37	2	158115703	158115703	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:158115703C>T	ENST00000259056.4	+	1	1594	c.1109C>T	c.(1108-1110)tCa>tTa	p.S370L		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	370					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TCTTCCTCTTCACTTGCTCCA	0.413																																							uc002tzg.2		NA																	0				breast(3)|skin(1)	4						c.(1108-1110)TCA>TTA		N-acetylgalactosaminyltransferase 5							101.0	101.0	101.0					2																	158115703		2203	4300	6503	SO:0001583	missense	11227				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:158115703C>T	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1109C>T	2.37:g.158115703C>T	ENSP00000259056:p.Ser370Leu					GALNT5_uc010zci.1_RNA	p.S370L	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN			1	1364	+			370			Lumenal (Potential).		A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	c.1109C>T	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	C	9.168	1.020364	0.19433	.	.	ENSG00000136542	ENST00000259056	T	0.57436	0.4	5.71	2.5	0.30297	.	1.286710	0.05159	N	0.497490	T	0.33294	0.0858	N	0.11560	0.145	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19976	-1.0289	10	0.21014	T	0.42	.	7.7179	0.28715	0.0:0.6088:0.0:0.3912	.	370	Q7Z7M9	GALT5_HUMAN	L	370	ENSP00000259056:S370L	ENSP00000259056:S370L	S	+	2	0	GALNT5	157823949	0.000000	0.05858	0.007000	0.13788	0.283000	0.27025	-0.345000	0.07770	0.747000	0.32809	0.650000	0.86243	TCA		0.413	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568		18	30	0	0	0	0.00499	0	18	30				
UPP2	151531	broad.mit.edu	37	2	158974356	158974356	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:158974356C>A	ENST00000005756.4	+	4	554	c.360C>A	c.(358-360)tcC>tcA	p.S120S	UPP2_ENST00000460456.1_Intron|UPP2_ENST00000605860.1_Silent_p.S177S|UPP2_ENST00000409859.4_Silent_p.S177S	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	120					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	GCATCCCCTCCATTTCTATTA	0.418																																							uc002tzp.2		NA																	0					0						c.(358-360)TCC>TCA		uridine phosphorylase 2 isoform a							178.0	160.0	166.0					2																	158974356		2203	4299	6502	SO:0001819	synonymous_variant	151531				nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity	g.chr2:158974356C>A	AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.360C>A	2.37:g.158974356C>A						UPP2_uc002tzo.2_Silent_p.S177S	p.S120S	NM_173355	NP_775491	O95045	UPP2_HUMAN			4	554	+			120					B3KV87	Silent	SNP	ENST00000005756.4	37	c.360C>A	CCDS2207.1																																																																																				0.418	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254929.2	NM_173355		24	75	1	0	1.64293e-13	0.00333	2.06822e-13	24	75				
KCNH7	90134	broad.mit.edu	37	2	163241415	163241415	+	Silent	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:163241415A>G	ENST00000332142.5	-	13	2844	c.2745T>C	c.(2743-2745)gaT>gaC	p.D915D		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	915					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GTCTTATGGTATCTGCAGAGT	0.353																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	0				ovary(3)|skin(2)	5						c.(2743-2745)GAT>GAC		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						146.0	140.0	142.0					2																	163241415		2203	4300	6503	SO:0001819	synonymous_variant	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163241415A>G	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2745T>C	2.37:g.163241415A>G							p.D915D	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN			13	2957	-			915			Cytoplasmic (Potential).		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Silent	SNP	ENST00000332142.5	37	c.2745T>C	CCDS2219.1																																																																																				0.353	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		7	48	0	0	0	0.001984	0	7	48				
HOXD12	3238	broad.mit.edu	37	2	176965464	176965465	+	Nonsense_Mutation	DNP	GG	GG	AT	rs200302685		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:176965464_176965465GG>AT	ENST00000406506.2	+	2	861_862	c.789_790GG>AT	c.(787-792)cgGGag>cgATag	p.E264*	HOXD12_ENST00000404162.2_3'UTR			P35452	HXD12_HUMAN	homeobox D12	264					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		TGGTGCTTCGGGAGCAGGCGCT	0.589																																							uc010zev.1		NA																	0					0						c.(787-792)CGGGAG>CGATAG		homeobox D12																																				SO:0001587	stop_gained	3238					nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176965464_176965465GG>AT		CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	Exception_encountered	2.37:g.176965464_176965465delinsAT	ENSP00000385586:p.Glu264*					HOXD12_uc010zew.1_3'UTR	p.E264*	NM_021193	NP_067016	P35452	HXD12_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)	2	789_790	+			264					B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Nonsense_Mutation	DNP	ENST00000406506.2	37	c.789_790GG>AT	CCDS46456.1																																																																																				0.589	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193		4	8	0	0	0	0.004672	0	4	8				
TTN	7273	broad.mit.edu	37	2	179467165	179467165	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:179467165C>G	ENST00000591111.1	-	233	50265	c.50041G>C	c.(50041-50043)Gta>Cta	p.V16681L	TTN_ENST00000359218.5_Missense_Mutation_p.V9382L|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V15754L|TTN_ENST00000342175.6_Missense_Mutation_p.V9449L|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V18322L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V9257L			Q8WZ42	TITIN_HUMAN	titin	16681	Fibronectin type-III 21. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTCATTTACTCTTTTCCAG	0.423																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(47260-47262)GTA>CTA		titin isoform N2-A							157.0	153.0	154.0					2																	179467165		1893	4108	6001	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179467165C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50041G>C	2.37:g.179467165C>G	ENSP00000465570:p.Val16681Leu					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V9449L|TTN_uc010zfi.1_Missense_Mutation_p.V9382L|TTN_uc010zfj.1_Missense_Mutation_p.V9257L	p.V15754L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		232	47484	-			16681					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.47260G>C		.	.	.	.	.	.	.	.	.	.	C	15.26	2.781356	0.49891	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.62	5.62	0.85841	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54743	0.1877	L	0.45285	1.41	0.58432	D	0.999996	P;P;P;D	0.55800	0.948;0.948;0.948;0.973	P;P;P;P	0.57101	0.7;0.7;0.7;0.813	T	0.55698	-0.8100	9	0.87932	D	0	.	19.655	0.95832	0.0:1.0:0.0:0.0	.	9257;9382;9449;16681	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	15754;9257;9449;9382;9257	ENSP00000343764:V15754L;ENSP00000434586:V9257L;ENSP00000340554:V9449L;ENSP00000352154:V9382L	ENSP00000340554:V9449L	V	-	1	0	TTN	179175410	1.000000	0.71417	0.949000	0.38748	0.975000	0.68041	4.901000	0.63259	2.650000	0.89964	0.650000	0.86243	GTA		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		10	29	0	0	0	0.008291	0	10	29				
ITGA4	3676	broad.mit.edu	37	2	182387061	182387061	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:182387061T>C	ENST00000397033.2	+	18	2496	c.2066T>C	c.(2065-2067)tTa>tCa	p.L689S		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	689					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	ATTAAGATTTTAGAGCTGGTA	0.338																																							uc002unu.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(2065-2067)TTA>TCA		integrin alpha 4 precursor	Natalizumab(DB00108)						165.0	152.0	156.0					2																	182387061		1838	4086	5924	SO:0001583	missense	3676				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity	g.chr2:182387061T>C		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2066T>C	2.37:g.182387061T>C	ENSP00000380227:p.Leu689Ser					ITGA4_uc010frj.1_Missense_Mutation_p.L171S|ITGA4_uc002unv.2_5'UTR	p.L689S	NM_000885	NP_000876	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)		18	2829	+			689			Extracellular (Potential).		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	c.2066T>C	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.375866	0.61735	.	.	ENSG00000115232	ENST00000397033	T	0.46063	0.88	5.67	4.47	0.54385	Integrin alpha-2 (1);	0.145725	0.47455	D	0.000222	T	0.54919	0.1888	L	0.56769	1.78	0.38863	D	0.956526	D;D	0.76494	0.998;0.999	D;D	0.71656	0.974;0.974	T	0.56547	-0.7961	10	0.41790	T	0.15	.	8.8421	0.35148	0.0:0.0681:0.1273:0.8046	.	511;689	Q59H74;P13612	.;ITA4_HUMAN	S	689	ENSP00000380227:L689S	ENSP00000380227:L689S	L	+	2	0	ITGA4	182095306	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.230000	0.51286	2.156000	0.67533	0.477000	0.44152	TTA		0.338	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1			25	15	0	0	0	0.004656	0	25	15				
ZDBF2	57683	broad.mit.edu	37	2	207174788	207174788	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:207174788C>T	ENST00000374423.3	+	5	5922	c.5536C>T	c.(5536-5538)Ctg>Ttg	p.L1846L		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1846							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AATTAATGCTCTGGTGAAGGA	0.413																																							uc002vbp.2		NA																	0				ovary(3)	3						c.(5536-5538)CTG>TTG		zinc finger, DBF-type containing 2							74.0	71.0	72.0					2																	207174788		1864	4109	5973	SO:0001819	synonymous_variant	57683						nucleic acid binding|zinc ion binding	g.chr2:207174788C>T	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5536C>T	2.37:g.207174788C>T							p.L1846L	NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN			5	5786	+			1846					Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	37	c.5536C>T	CCDS46501.1																																																																																				0.413	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		13	23	0	0	0	0.013537	0	13	23				
DYTN	391475	broad.mit.edu	37	2	207564891	207564892	+	Missense_Mutation	DNP	GC	GC	AA	rs199745795		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:207564891_207564892GC>AA	ENST00000452335.2	-	6	648_649	c.532_533GC>TT	c.(532-534)GCc>TTc	p.A178F	Y_RNA_ENST00000384589.1_RNA|DYTN_ENST00000477734.1_5'UTR	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	178						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		GCTGCGGGTGGCACTTTCCACA	0.5																																							uc002vbr.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(532-534)GCC>TTC		dystrotelin																																				SO:0001583	missense	391475					plasma membrane	zinc ion binding	g.chr2:207564891_207564892GC>AA	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.532_533delinsAA	2.37:g.207564891_207564892delinsAA	ENSP00000396593:p.Ala178Phe						p.A178F	NM_001093730	NP_001087199	A2CJ06	DYTN_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)	6	649_650	-			178						Missense_Mutation	DNP	ENST00000452335.2	37	c.532_533GC>TT	CCDS46502.1																																																																																				0.500	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1			6	50	0	0	0	0.004672	0	6	50				
STK11IP	114790	broad.mit.edu	37	2	220478566	220478566	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:220478566G>C	ENST00000456909.1	+	21	2720	c.2630G>C	c.(2629-2631)cGg>cCg	p.R877P	STK11IP_ENST00000295641.10_Missense_Mutation_p.R888P			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	888					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGAGCCTGCGGCTAGAGTGG	0.667																																							uc002vml.2		NA																	0				ovary(1)	1						c.(2662-2664)CGG>CCG		LKB1 interacting protein							30.0	34.0	33.0					2																	220478566		1969	4167	6136	SO:0001583	missense	114790				protein localization	cytoplasm	protein kinase binding	g.chr2:220478566G>C	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2630G>C	2.37:g.220478566G>C	ENSP00000389383:p.Arg877Pro						p.R888P	NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	21	2706	+		Renal(207;0.0183)	888					Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37	c.2663G>C		.	.	.	.	.	.	.	.	.	.	g	12.73	2.025484	0.35701	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	T;T	0.06768	3.27;3.26	4.72	2.91	0.33838	.	0.334756	0.30235	N	0.010081	T	0.17704	0.0425	M	0.62723	1.935	0.26327	N	0.977571	D	0.53151	0.958	P	0.55965	0.788	T	0.03202	-1.1061	10	0.62326	D	0.03	-5.38	9.068	0.36475	0.2606:0.0:0.7394:0.0	.	888	Q8N1F8	S11IP_HUMAN	P	877;888	ENSP00000389383:R877P;ENSP00000295641:R888P	ENSP00000295641:R888P	R	+	2	0	STK11IP	220186810	1.000000	0.71417	0.987000	0.45799	0.435000	0.31806	1.717000	0.37991	0.230000	0.21059	-1.144000	0.01866	CGG		0.667	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902		11	44	0	0	0	0.008291	0	11	44				
C2orf57	165100	broad.mit.edu	37	2	232458229	232458229	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:232458229C>T	ENST00000313965.2	+	1	655	c.567C>T	c.(565-567)acC>acT	p.T189T		NM_152614.2	NP_689827.2	Q53QW1	CB057_HUMAN	chromosome 2 open reading frame 57	189										endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	19		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		CTGCCAGCACCACCAAGTCTG	0.582																																							uc002vrz.2		NA																	0				ovary(1)	1						c.(565-567)ACC>ACT		hypothetical protein LOC165100							93.0	92.0	92.0					2																	232458229		2203	4300	6503	SO:0001819	synonymous_variant	165100							g.chr2:232458229C>T	BC034405	CCDS2487.1	2q37.1	2008-02-05			ENSG00000177673	ENSG00000177673			28563	protein-coding gene	gene with protein product						12477932	Standard	NM_152614		Approved	MGC35154	uc002vrz.3	Q53QW1	OTTHUMG00000133226	ENST00000313965.2:c.567C>T	2.37:g.232458229C>T							p.T189T	NM_152614	NP_689827	Q53QW1	CB057_HUMAN		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)	1	618	+		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)	189					Q8N4F2	Silent	SNP	ENST00000313965.2	37	c.567C>T	CCDS2487.1																																																																																				0.582	C2orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256962.1	NM_152614		34	27	0	0	0	0.013726	0	34	27				
ALPI	248	broad.mit.edu	37	2	233323045	233323045	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:233323045G>A	ENST00000295463.3	+	9	1187	c.1110G>A	c.(1108-1110)ctG>ctA	p.L370L		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	370					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		AGGACACGCTGACCCTCGTCA	0.617																																							uc002vst.3		NA																	0				central_nervous_system(1)	1						c.(1108-1110)CTG>CTA		intestinal alkaline phosphatase precursor							90.0	72.0	78.0					2																	233323045		2203	4300	6503	SO:0001819	synonymous_variant	248				phosphorylation	anchored to membrane|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding|protein binding	g.chr2:233323045G>A	M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.1110G>A	2.37:g.233323045G>A						ALPI_uc002vsu.3_Silent_p.L281L	p.L370L	NM_001631	NP_001622	P09923	PPBI_HUMAN		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)	9	1187	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	370					B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Silent	SNP	ENST00000295463.3	37	c.1110G>A	CCDS2492.1																																																																																				0.617	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257035.2	NM_001631		9	29	0	0	0	0.004482	0	9	29				
DGKD	8527	broad.mit.edu	37	2	234359623	234359623	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:234359623T>G	ENST00000264057.2	+	17	2106	c.2094T>G	c.(2092-2094)agT>agG	p.S698R	DGKD_ENST00000409813.3_Missense_Mutation_p.S654R	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	698					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S698S(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CCCTAGGCAGTTCTGCTTCCC	0.567																																							uc002vui.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5						c.(2092-2094)AGT>AGG		diacylglycerol kinase, delta 130kDa isoform 2	Phosphatidylserine(DB00144)						133.0	122.0	126.0					2																	234359623		2203	4300	6503	SO:0001583	missense	8527				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity	g.chr2:234359623T>G	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2094T>G	2.37:g.234359623T>G	ENSP00000264057:p.Ser698Arg					DGKD_uc002vuj.1_Missense_Mutation_p.S654R|DGKD_uc010fyh.1_Missense_Mutation_p.S565R|DGKD_uc010fyi.1_RNA	p.S698R	NM_152879	NP_690618	Q16760	DGKD_HUMAN		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	17	2106	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)	698					Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	c.2094T>G	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	T	10.73	1.433846	0.25813	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.80033	-1.17;-1.33	4.16	-0.737	0.11129	.	0.245701	0.35870	N	0.002935	T	0.70666	0.3250	L	0.43152	1.355	0.36132	D	0.846213	B;B;B	0.21147	0.052;0.039;0.044	B;B;B	0.25884	0.039;0.064;0.042	T	0.63097	-0.6713	10	0.33141	T	0.24	.	11.1606	0.48514	0.0:0.7025:0.0:0.2975	.	582;654;698	Q53SE4;Q16760-2;Q16760	.;.;DGKD_HUMAN	R	698;654	ENSP00000264057:S698R;ENSP00000386455:S654R	ENSP00000264057:S698R	S	+	3	2	DGKD	234024362	0.996000	0.38824	0.990000	0.47175	0.032000	0.12392	0.328000	0.19681	-0.073000	0.12842	-0.408000	0.06270	AGT		0.567	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648		44	60	0	0	0	0.009718	0	44	60				
INSM1	3642	broad.mit.edu	37	20	20350422	20350422	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr20:20350422T>C	ENST00000310227.1	+	1	1658	c.1511T>C	c.(1510-1512)gTg>gCg	p.V504A		NM_002196.2	NP_002187.1	Q01101	INSM1_HUMAN	insulinoma-associated 1	504					adrenal chromaffin cell differentiation (GO:0061104)|cell cycle (GO:0007049)|endocrine pancreas development (GO:0031018)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|noradrenergic neuron development (GO:0003358)|norepinephrine biosynthetic process (GO:0042421)|pancreatic A cell differentiation (GO:0003310)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of gene expression (GO:0010468)|regulation of protein complex assembly (GO:0043254)|sympathetic ganglion development (GO:0061549)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell differentiation (GO:0003309)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|cyclin binding (GO:0030332)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			liver(1)|lung(3)|ovary(1)|prostate(1)	6				READ - Rectum adenocarcinoma(2;0.0649)		CTCCTGCAGGTGCCCGTGCGC	0.657																																							uc002wrx.2		NA																	0				ovary(1)	1						c.(1510-1512)GTG>GCG		insulinoma-associated 1							14.0	17.0	16.0					20																	20350422		2152	4200	6352	SO:0001583	missense	3642				endocrine pancreas development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:20350422T>C		CCDS13143.1	20p11.2	2012-07-10			ENSG00000173404	ENSG00000173404			6090	protein-coding gene	gene with protein product		600010				8188699, 16569215	Standard	NM_002196		Approved	IA-1, IA1	uc002wrx.3	Q01101	OTTHUMG00000032004	ENST00000310227.1:c.1511T>C	20.37:g.20350422T>C	ENSP00000312631:p.Val504Ala						p.V504A	NM_002196	NP_002187	Q01101	INSM1_HUMAN		READ - Rectum adenocarcinoma(2;0.0649)	1	1658	+			504						Missense_Mutation	SNP	ENST00000310227.1	37	c.1511T>C	CCDS13143.1	.	.	.	.	.	.	.	.	.	.	T	16.78	3.219083	0.58560	.	.	ENSG00000173404	ENST00000310227	T	0.00792	5.69	5.41	5.41	0.78517	.	0.071764	0.56097	U	0.000033	T	0.01421	0.0046	L	0.34521	1.04	0.41667	D	0.989218	D	0.56521	0.976	P	0.49085	0.6	T	0.74034	-0.3794	10	0.62326	D	0.03	-18.6173	15.4449	0.75223	0.0:0.0:0.0:1.0	.	504	Q01101	INSM1_HUMAN	A	504	ENSP00000312631:V504A	ENSP00000312631:V504A	V	+	2	0	INSM1	20298422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.993000	0.88291	2.040000	0.60383	0.528000	0.53228	GTG		0.657	INSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078223.1	NM_002196		5	24	0	0	0	0.000602	0	5	24				
TGIF2	60436	broad.mit.edu	37	20	35219609	35219609	+	Silent	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr20:35219609A>G	ENST00000373874.2	+	3	688	c.489A>G	c.(487-489)acA>acG	p.T163T	TGIF2_ENST00000373872.4_Silent_p.T163T|TGIF2-C20orf24_ENST00000558530.1_Intron|RP5-977B1.11_ENST00000561134.1_RNA	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	163	Repressive function.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CTGGTAGCACACTTACTCTGC	0.627																																							uc002xfn.2		NA																	0				pancreas(1)|skin(1)	2						c.(487-489)ACA>ACG		TGFB-induced factor homeobox 2							40.0	45.0	43.0					20																	35219609		2203	4300	6503	SO:0001819	synonymous_variant	60436					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:35219609A>G	AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.489A>G	20.37:g.35219609A>G						C20orf24_uc002xfo.2_Intron	p.T163T	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN			3	662	+	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)	163			Repressive function.		B2R9U3|E1P5T9|H0YNI0	Silent	SNP	ENST00000373874.2	37	c.489A>G	CCDS13278.1																																																																																				0.627	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809		18	63	0	0	0	0.00499	0	18	63				
PREX1	57580	broad.mit.edu	37	20	47317347	47317347	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr20:47317347C>A	ENST00000371941.3	-	7	883	c.861G>T	c.(859-861)caG>caT	p.Q287H	PREX1_ENST00000396220.1_Missense_Mutation_p.Q287H	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	287	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGGCCCTTTCCTGGATGTTGC	0.562																																							uc002xtw.1		NA																	0				lung(3)|ovary(2)|pancreas(1)	6						c.(859-861)CAG>CAT		phosphatidylinositol-3,4,							208.0	199.0	202.0					20																	47317347		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47317347C>A	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.861G>T	20.37:g.47317347C>A	ENSP00000361009:p.Gln287His						p.Q287H	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		7	884	-			287			PH.		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.861G>T	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.441197	0.63067	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.74737	-0.87;-0.87	5.11	3.14	0.36123	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.52532	U	0.000080	D	0.85496	0.5710	M	0.86740	2.835	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.84937	0.0863	10	0.87932	D	0	.	8.4128	0.32653	0.0:0.7557:0.0:0.2443	.	287	Q8TCU6	PREX1_HUMAN	H	287	ENSP00000361009:Q287H;ENSP00000379522:Q287H	ENSP00000361009:Q287H	Q	-	3	2	PREX1	46750754	0.818000	0.29161	1.000000	0.80357	0.918000	0.54935	0.007000	0.13174	0.621000	0.30232	0.455000	0.32223	CAG		0.562	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		41	109	1	0	2.95478e-19	0.00874	4.08715e-19	41	109				
ZFP64	55734	broad.mit.edu	37	20	50768964	50768964	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr20:50768964C>G	ENST00000216923.4	-	6	2116	c.1767G>C	c.(1765-1767)acG>acC	p.T589T	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000346617.4_Silent_p.T535T|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371515.4_Silent_p.T587T|ZFP64_ENST00000477786.1_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CACCTGAGGCCGTGGGGATGA	0.597																																							uc002xwl.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1765-1767)ACG>ACC		zinc finger protein 64 isoform a							56.0	55.0	56.0					20																	50768964		2203	4300	6503	SO:0001819	synonymous_variant	55734				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50768964C>G	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1767G>C	20.37:g.50768964C>G						ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_Silent_p.T587T|ZFP64_uc002xwn.2_Silent_p.T535T	p.T589T	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN			6	2116	-			589					Q9NTS7|Q9NVH4	Silent	SNP	ENST00000216923.4	37	c.1767G>C	CCDS13440.1																																																																																				0.597	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197		24	34	0	0	0	0.00333	0	24	34				
TSHZ2	128553	broad.mit.edu	37	20	51870753	51870753	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr20:51870753C>A	ENST00000371497.5	+	2	1643	c.756C>A	c.(754-756)ccC>ccA	p.P252P	TSHZ2_ENST00000329613.6_Silent_p.P249P|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Silent_p.P249P	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	252					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AGCTCAGACCCACGAGCTATT	0.483																																							uc002xwo.2		NA																	0				ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(754-756)CCC>CCA		teashirt zinc finger homeobox 2							65.0	51.0	56.0					20																	51870753		2203	4300	6503	SO:0001819	synonymous_variant	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51870753C>A	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.756C>A	20.37:g.51870753C>A							p.P252P	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	1712	+			252					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	ENST00000371497.5	37	c.756C>A	CCDS33490.1																																																																																				0.483	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		9	29	1	0	0.00448238	0.004482	0.00471722	9	29				
CHRNA4	1137	broad.mit.edu	37	20	61982135	61982135	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr20:61982135C>A	ENST00000370263.4	-	5	849	c.628G>T	c.(628-630)Gtc>Ttc	p.V210F	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	210					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TCCACGATGACCCACTCGCCA	0.597																																							uc002yes.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(628-630)GTC>TTC		cholinergic receptor, nicotinic, alpha 4 subunit	Nicotine(DB00184)|Varenicline(DB01273)						144.0	114.0	124.0					20																	61982135		2203	4299	6502	SO:0001583	missense	1137				B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr20:61982135C>A		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.628G>T	20.37:g.61982135C>A	ENSP00000359285:p.Val210Phe					CHRNA4_uc002yet.1_Missense_Mutation_p.V34F|CHRNA4_uc011aaw.1_RNA|CHRNA4_uc010gke.1_Missense_Mutation_p.V139F|CHRNA4_uc002yev.1_Missense_Mutation_p.V34F|CHRNA4_uc010gkf.1_Missense_Mutation_p.V34F	p.V210F	NM_000744	NP_000735	P43681	ACHA4_HUMAN			5	806	-	all_cancers(38;1.71e-10)		210			Extracellular (Potential).		Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	c.628G>T	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037481	0.75617	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.79554	-1.28	4.87	4.87	0.63330	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.88074	0.6339	M	0.67517	2.055	0.80722	D	1	D;P	0.56287	0.975;0.86	D;P	0.63488	0.915;0.514	D	0.88956	0.3390	10	0.56958	D	0.05	.	18.0032	0.89203	0.0:1.0:0.0:0.0	.	139;210	Q4VAQ5;P43681	.;ACHA4_HUMAN	F	116;210;139	ENSP00000359285:V210F	ENSP00000359280:V116F	V	-	1	0	CHRNA4	61452579	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.631000	0.61304	2.227000	0.72691	0.561000	0.74099	GTC		0.597	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3			19	43	1	0	1.28384e-07	0.012319	1.49029e-07	19	43				
CYYR1	116159	broad.mit.edu	37	21	27852738	27852738	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr21:27852738T>A	ENST00000299340.4	-	3	530	c.187A>T	c.(187-189)Att>Ttt	p.I63F	AP001597.1_ENST00000357401.3_RNA|CYYR1_ENST00000435845.2_3'UTR|AP001597.1_ENST00000414486.1_RNA|CYYR1_ENST00000400043.3_Missense_Mutation_p.I63F	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	63						integral component of membrane (GO:0016021)				large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						ATGCCCGCAATTGCAGTGCCC	0.423																																							uc002ymd.2		NA																	0					0						c.(187-189)ATT>TTT		cysteine and tyrosine-rich 1 protein precursor							105.0	96.0	99.0					21																	27852738		2203	4300	6503	SO:0001583	missense	116159					integral to membrane		g.chr21:27852738T>A	AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.187A>T	21.37:g.27852738T>A	ENSP00000299340:p.Ile63Phe					CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_Missense_Mutation_p.I63F	p.I63F	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN			3	509	-			63			Helical; (Potential).		A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Missense_Mutation	SNP	ENST00000299340.4	37	c.187A>T	CCDS13578.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.689857	0.48097	.	.	ENSG00000166265	ENST00000299340;ENST00000400043	T;T	0.39787	1.06;1.06	4.9	4.9	0.64082	.	0.043830	0.85682	D	0.000000	T	0.54935	0.1889	M	0.66939	2.045	0.80722	D	1	P;P	0.49783	0.911;0.928	P;P	0.53593	0.61;0.73	T	0.60606	-0.7230	10	0.87932	D	0	-13.8458	14.0397	0.64667	0.0:0.0:0.0:1.0	.	63;63	Q96J86-2;Q96J86	.;CYYR1_HUMAN	F	63	ENSP00000299340:I63F;ENSP00000382918:I63F	ENSP00000299340:I63F	I	-	1	0	CYYR1	26774609	1.000000	0.71417	0.854000	0.33618	0.010000	0.07245	6.071000	0.71229	2.138000	0.66242	0.477000	0.44152	ATT		0.423	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954		7	48	0	0	0	0.001984	0	7	48				
MORC3	23515	broad.mit.edu	37	21	37741749	37741749	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr21:37741749C>T	ENST00000400485.1	+	15	2159	c.2083C>T	c.(2083-2085)Caa>Taa	p.Q695*	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	695					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						TGCAGGCTGCCAATTACAAGA	0.398																																							uc002yvi.2		NA																	0				ovary(2)	2						c.(2083-2085)CAA>TAA		MORC family CW-type zinc finger 3							79.0	72.0	74.0					21																	37741749		1911	4141	6052	SO:0001587	stop_gained	23515				cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding	g.chr21:37741749C>T	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.2083C>T	21.37:g.37741749C>T	ENSP00000383333:p.Gln695*						p.Q695*	NM_015358	NP_056173	Q14149	MORC3_HUMAN			15	2159	+			695			Potential.		A8KA92|Q9UEZ2	Nonsense_Mutation	SNP	ENST00000400485.1	37	c.2083C>T	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	C	36	5.808512	0.96967	.	.	ENSG00000159256	ENST00000400485	.	.	.	5.8	2.95	0.34219	.	0.836318	0.10893	N	0.622444	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-3.4737	14.2356	0.65925	0.3902:0.6098:0.0:0.0	.	.	.	.	X	695	.	ENSP00000383333:Q695X	Q	+	1	0	MORC3	36663619	0.014000	0.17966	0.027000	0.17364	0.609000	0.37215	1.015000	0.29963	0.339000	0.23719	0.655000	0.94253	CAA		0.398	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358		20	20	0	0	0	0.007413	0	20	20				
ETS2	2114	broad.mit.edu	37	21	40191522	40191522	+	Silent	SNP	C	C	T	rs568367551		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr21:40191522C>T	ENST00000360214.3	+	9	1367	c.907C>T	c.(907-909)Ctg>Ttg	p.L303L	ETS2_ENST00000360938.3_Silent_p.L303L	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	303					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				GTCGTCCTTGCTGGATGTGCA	0.557																																							uc002yxg.2		NA																	0				ovary(1)|lung(1)|breast(1)|pancreas(1)	4						c.(907-909)CTG>TTG		v-ets erythroblastosis virus E26 oncogene							88.0	77.0	81.0					21																	40191522		2203	4300	6503	SO:0001819	synonymous_variant	2114				positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr21:40191522C>T		CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.907C>T	21.37:g.40191522C>T						ETS2_uc002yxf.2_Silent_p.L443L	p.L303L	NM_005239	NP_005230	P15036	ETS2_HUMAN			8	1103	+		Prostate(19;6.33e-08)|all_epithelial(19;0.123)	303					A6NM68|D3DSH6|Q53Y89	Silent	SNP	ENST00000360214.3	37	c.907C>T	CCDS13659.1																																																																																				0.557	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207544.1			16	17	0	0	0	0.003163	0	16	17				
PKNOX1	5316	broad.mit.edu	37	21	44438242	44438242	+	Splice_Site	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr21:44438242G>T	ENST00000291547.5	+	7	833		c.e7-1		PKNOX1_ENST00000432907.2_Splice_Site	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1						angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						TCCCTTTCGAGGTGGCACAGT	0.423																																							uc002zcq.1		NA																	0				large_intestine(2)	2						c.e7-1		PBX/knotted 1 homeobox 1							88.0	77.0	81.0					21																	44438242		2203	4300	6503	SO:0001630	splice_region_variant	5316						sequence-specific DNA binding	g.chr21:44438242G>T		CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.623-1G>T	21.37:g.44438242G>T						PKNOX1_uc002zcp.1_Splice_Site_p.G208_splice|PKNOX1_uc011aex.1_Splice_Site_p.G91_splice	p.G208_splice	NM_004571	NP_004562	P55347	PKNX1_HUMAN			7	811	+								O00528|Q8IWT7	Splice_Site	SNP	ENST00000291547.5	37	c.623_splice	CCDS13692.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600865	0.66332	.	.	ENSG00000160199	ENST00000291547;ENST00000432907	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0853	0.89455	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKNOX1	43311311	1.000000	0.71417	0.986000	0.45419	0.638000	0.38207	8.918000	0.92759	2.329000	0.79093	0.561000	0.74099	.		0.423	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195520.3		Intron	25	16	1	0	5.35047e-06	0.00333	6.0144e-06	25	16				
GGT1	2678	broad.mit.edu	37	22	24981999	24981999	+	Intron	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:24981999C>T	ENST00000248923.4	+	1	59				FAM211B_ENST00000495297.1_5'Flank|FAM211B_ENST00000318753.8_Missense_Mutation_p.S268N	NM_013430.2	NP_038347.2	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1						arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	GGTGCGCTGGCTCAGCCGCCG	0.687																																							uc003aaq.2		NA																	0					0						c.(802-804)AGC>AAC		hypothetical protein LOC388886							49.0	60.0	56.0					22																	24981999		2067	4176	6243	SO:0001627	intron_variant	388886							g.chr22:24981999C>T	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000248923.4:c.-429+2223C>T	22.37:g.24981999C>T						GGT1_uc003aan.1_Intron|C22orf36_uc003aao.2_RNA|C22orf36_uc003aap.2_RNA	p.S268N	NM_207644	NP_997527	Q2VPJ9	LRC6X_HUMAN			4	832	-			268					Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000248923.4	37	c.803G>A	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762373	0.69763	.	.	ENSG00000178026	ENST00000318753	T	0.51574	0.7	3.95	1.8	0.24995	.	0.180167	0.48767	N	0.000177	T	0.39064	0.1064	M	0.62723	1.935	0.37238	D	0.905996	P	0.42518	0.782	B	0.34652	0.187	T	0.47459	-0.9116	10	0.72032	D	0.01	-13.9437	9.354	0.38155	0.0:0.8179:0.0:0.1821	.	268	Q2VPJ9	LRC6X_HUMAN	N	268	ENSP00000320520:S268N	ENSP00000320520:S268N	S	-	2	0	C22orf36	23311999	1.000000	0.71417	0.403000	0.26384	0.888000	0.51559	3.279000	0.51670	0.402000	0.25451	0.561000	0.74099	AGC		0.687	GGT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319110.1	NM_013430		16	66	0	0	0	0.003163	0	16	66				
SLC35E4	339665	broad.mit.edu	37	22	31032948	31032948	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:31032948T>C	ENST00000343605.4	+	1	1310	c.511T>C	c.(511-513)Tgc>Cgc	p.C171R	SLC35E4_ENST00000300385.8_Missense_Mutation_p.C171R|SLC35E4_ENST00000406566.1_Missense_Mutation_p.C171R	NM_001001479.2	NP_001001479.1	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4	171	EamA.|Leu-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	10						GGGTCCGCTCTGCCTGGGGGC	0.687																																							uc003ais.1		NA																	0					0						c.(511-513)TGC>CGC		solute carrier family 35, member E4							22.0	21.0	21.0					22																	31032948		2202	4298	6500	SO:0001583	missense	339665					integral to membrane		g.chr22:31032948T>C		CCDS13882.1	22q12.2	2013-05-22			ENSG00000100036	ENSG00000100036		"""Solute carriers"""	17058	protein-coding gene	gene with protein product							Standard	NM_001001479		Approved		uc003ais.1	Q6ICL7	OTTHUMG00000151110	ENST00000343605.4:c.511T>C	22.37:g.31032948T>C	ENSP00000339626:p.Cys171Arg					SLC35E4_uc003ait.2_Missense_Mutation_p.C159R	p.C171R	NM_001001479	NP_001001479	Q6ICL7	S35E4_HUMAN			1	1156	+			171			DUF6.|Leu-rich.		Q567P0	Missense_Mutation	SNP	ENST00000343605.4	37	c.511T>C	CCDS13882.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416481	0.83449	.	.	ENSG00000100036	ENST00000343605;ENST00000300385;ENST00000406566;ENST00000451479	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.16	5.16	0.70880	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.61751	0.2372	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.63892	-0.6534	10	0.59425	D	0.04	-18.8313	14.0058	0.64463	0.0:0.0:0.0:1.0	.	171;171	Q6ICL7-2;Q6ICL7	.;S35E4_HUMAN	R	171;171;171;147	ENSP00000339626:C171R;ENSP00000300385:C171R;ENSP00000384377:C171R;ENSP00000413552:C147R	ENSP00000300385:C171R	C	+	1	0	SLC35E4	29362948	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.212000	0.77941	1.950000	0.56595	0.448000	0.29417	TGC		0.687	SLC35E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321382.1	XM_290973		3	31	0	0	0	0.004672	0	3	31				
DEPDC5	9681	broad.mit.edu	37	22	32188070	32188070	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:32188070T>A	ENST00000382112.3	+	10	746	c.676T>A	c.(676-678)Tat>Aat	p.Y226N	DEPDC5_ENST00000536766.1_Missense_Mutation_p.Y198N|DEPDC5_ENST00000535622.1_Missense_Mutation_p.Y226N|DEPDC5_ENST00000382111.2_Missense_Mutation_p.Y226N|DEPDC5_ENST00000400246.1_Missense_Mutation_p.Y226N|DEPDC5_ENST00000382105.2_Missense_Mutation_p.Y226N|DEPDC5_ENST00000400248.2_Missense_Mutation_p.Y226N|DEPDC5_ENST00000400242.3_Missense_Mutation_p.Y226N|DEPDC5_ENST00000266091.3_Missense_Mutation_p.Y226N|DEPDC5_ENST00000400249.2_Missense_Mutation_p.Y226N	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	226					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TAGAACTTTCTATGATGCAAA	0.388																																							uc003als.2		NA																	0				ovary(4)|central_nervous_system(3)|pancreas(1)	8						c.(676-678)TAT>AAT		DEP domain containing 5 isoform 1							152.0	143.0	146.0					22																	32188070		1862	4105	5967	SO:0001583	missense	9681				intracellular signal transduction			g.chr22:32188070T>A	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.676T>A	22.37:g.32188070T>A	ENSP00000371546:p.Tyr226Asn					DEPDC5_uc011als.1_Missense_Mutation_p.Y226N|DEPDC5_uc011alu.1_Missense_Mutation_p.Y226N|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.Y226N|DEPDC5_uc003alr.1_Missense_Mutation_p.Y226N|DEPDC5_uc011alt.1_Missense_Mutation_p.Y198N	p.Y226N	NM_014662	NP_055477	O75140	DEPD5_HUMAN			11	818	+			226					A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	c.676T>A	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	-	23.7	4.443135	0.83993	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T;T	0.58210	0.83;0.87;0.35;1.2;1.23;1.16;0.81;1.22;1.16;1.23	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.78168	0.4241	M	0.90870	3.155	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;0.998	D;D;D;D;D;D	0.91635	0.997;0.974;0.999;0.986;0.995;0.974	T	0.83328	-0.0014	10	0.72032	D	0.01	.	14.7907	0.69841	0.0:0.0:0.0:1.0	.	226;198;226;226;226;226	B9EGN9;F5GYZ8;B4DH93;A8MPX9;O75140;O75140-2	.;.;.;.;DEPD5_HUMAN;.	N	226;198;226;226;226;226;226;226;226;226;226	ENSP00000440210:Y226N;ENSP00000441358:Y198N;ENSP00000383101:Y226N;ENSP00000266091:Y226N;ENSP00000383108:Y226N;ENSP00000383105:Y226N;ENSP00000371539:Y226N;ENSP00000371546:Y226N;ENSP00000371545:Y226N;ENSP00000383107:Y226N	ENSP00000266091:Y226N	Y	+	1	0	DEPDC5	30518070	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.996000	0.76263	2.173000	0.68751	0.515000	0.50301	TAT		0.388	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		16	17	0	0	0	0.004007	0	16	17				
DEPDC5	9681	broad.mit.edu	37	22	32239157	32239157	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:32239157G>T	ENST00000382112.3	+	27	2635	c.2565G>T	c.(2563-2565)acG>acT	p.T855T	DEPDC5_ENST00000535622.1_Silent_p.T786T|DEPDC5_ENST00000382111.2_Silent_p.T864T|DEPDC5_ENST00000400246.1_Silent_p.T864T|DEPDC5_ENST00000382105.2_Silent_p.T786T|DEPDC5_ENST00000400248.2_Silent_p.T855T|DEPDC5_ENST00000266091.3_Silent_p.T864T|DEPDC5_ENST00000400249.2_Silent_p.T855T	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	864					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ACAAAGTGACGCTGAAGGATA	0.433																																							uc003als.2		NA																	0				ovary(4)|central_nervous_system(3)|pancreas(1)	8						c.(2563-2565)ACG>ACT		DEP domain containing 5 isoform 1							112.0	104.0	107.0					22																	32239157		2013	4193	6206	SO:0001819	synonymous_variant	9681				intracellular signal transduction			g.chr22:32239157G>T	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2565G>T	22.37:g.32239157G>T						DEPDC5_uc011als.1_Silent_p.T786T|DEPDC5_uc011alu.1_Silent_p.T864T|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Silent_p.T855T|DEPDC5_uc003alu.2_Silent_p.T304T|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Silent_p.T185T|DEPDC5_uc003alw.2_Silent_p.T153T|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_5'Flank	p.T855T	NM_014662	NP_055477	O75140	DEPD5_HUMAN			28	2707	+			855					A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Silent	SNP	ENST00000382112.3	37	c.2565G>T	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	G	8.875	0.950279	0.18431	.	.	ENSG00000100150	ENST00000433147	.	.	.	5.68	-11.4	0.00090	.	.	.	.	.	T	0.34106	0.0886	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.43556	-0.9384	4	.	.	.	.	3.9846	0.09509	0.2076:0.2845:0.367:0.1409	.	.	.	.	S	262	.	.	A	+	1	0	DEPDC5	30569157	0.000000	0.05858	0.294000	0.24946	0.996000	0.88848	-2.645000	0.00861	-2.406000	0.00574	-0.290000	0.09829	GCT		0.433	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		17	26	1	0	3.41278e-10	0.00499	4.13833e-10	17	26				
TOB2	10766	broad.mit.edu	37	22	41833088	41833088	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:41833088C>T	ENST00000327492.3	-	2	968	c.262G>A	c.(262-264)Gag>Aag	p.E88K		NM_016272.3	NP_057356.1	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	88					female gamete generation (GO:0007292)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ossification (GO:0045778)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						CTCAGCTCCTCAGGCACATTG	0.592																																							uc003azz.1		NA																	0				ovary(1)	1						c.(262-264)GAG>AAG		transducer of ERBB2, 2							81.0	71.0	75.0					22																	41833088		2203	4300	6503	SO:0001583	missense	10766				female gamete generation|negative regulation of cell proliferation	cytoplasm|nucleus		g.chr22:41833088C>T	D64109	CCDS14015.1	22q13.2	2010-02-26			ENSG00000183864	ENSG00000183864			11980	protein-coding gene	gene with protein product		607396		TROB2		10602502, 10591208	Standard	XM_005261315		Approved	TOBL, TOB4, bK223H9	uc003azz.1	Q14106	OTTHUMG00000150970	ENST00000327492.3:c.262G>A	22.37:g.41833088C>T	ENSP00000331305:p.Glu88Lys						p.E88K	NM_016272	NP_057356	Q14106	TOB2_HUMAN			2	969	-			88					Q6FHR7|Q6PIT9|Q9BY97|Q9UBI0	Missense_Mutation	SNP	ENST00000327492.3	37	c.262G>A	CCDS14015.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474168	0.26423	.	.	ENSG00000183864	ENST00000327492;ENST00000434408	T	0.41758	0.99	5.82	5.82	0.92795	Anti-proliferative protein (4);	0.060289	0.64402	D	0.000003	T	0.27559	0.0677	N	0.11255	0.115	0.33441	D	0.582388	B	0.14012	0.009	B	0.18263	0.021	T	0.26916	-1.0089	10	0.38643	T	0.18	.	15.5582	0.76216	0.0:0.8627:0.1373:0.0	.	88	Q14106	TOB2_HUMAN	K	88	ENSP00000331305:E88K	ENSP00000331305:E88K	E	-	1	0	TOB2	40163034	0.993000	0.37304	0.995000	0.50966	0.997000	0.91878	2.814000	0.48010	2.761000	0.94854	0.655000	0.94253	GAG		0.592	TOB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320699.1	NM_016272		16	112	0	0	0	0.004007	0	16	112				
ACO2	50	broad.mit.edu	37	22	41913580	41913580	+	Silent	SNP	C	C	T	rs560040600		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:41913580C>T	ENST00000216254.4	+	7	907	c.885C>T	c.(883-885)tcC>tcT	p.S295S	ACO2_ENST00000466237.1_3'UTR|ACO2_ENST00000396512.3_Silent_p.S320S	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	295					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						CCACCACTTCCGTGTTCCCTT	0.622											OREG0026588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0014	5008	,	,		19069	0.0		0.0	False		,,,				2504	0.0						uc003bac.2		NA																	0				breast(2)|ovary(1)|lung(1)	4						c.(883-885)TCC>TCT		aconitase 2, mitochondrial precursor							88.0	66.0	73.0					22																	41913580		2203	4300	6503	SO:0001819	synonymous_variant	50				citrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron ion binding|isocitrate hydro-lyase (cis-aconitate-forming) activity	g.chr22:41913580C>T	AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.885C>T	22.37:g.41913580C>T			OREG0026588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	904	ACO2_uc003bad.2_Silent_p.S320S	p.S295S	NM_001098	NP_001089	Q99798	ACON_HUMAN			7	907	+			295					O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Silent	SNP	ENST00000216254.4	37	c.885C>T	CCDS14017.1																																																																																				0.622	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098		4	47	0	0	0	0.009096	0	4	47				
MPPED1	758	broad.mit.edu	37	22	43831029	43831029	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:43831029G>T	ENST00000417669.2	+	3	744	c.300G>T	c.(298-300)tcG>tcT	p.S100S	MPPED1_ENST00000538182.1_Silent_p.S133S|MPPED1_ENST00000542779.1_Silent_p.S100S|MPPED1_ENST00000443721.1_Silent_p.S100S|MPPED1_ENST00000439548.1_Intron|MPPED1_ENST00000414469.2_5'UTR			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	100							hydrolase activity (GO:0016787)	p.S100S(1)		endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				ATACCCACTCGAGGACGGACC	0.627																																							uc011apv.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)		0						c.(298-300)TCG>TCT		metallophosphoesterase domain containing 1							108.0	124.0	118.0					22																	43831029		2133	4224	6357	SO:0001819	synonymous_variant	758						hydrolase activity	g.chr22:43831029G>T	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.300G>T	22.37:g.43831029G>T						MPPED1_uc011apw.1_5'UTR|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Silent_p.S100S|MPPED1_uc011apz.1_Silent_p.S133S	p.S100S	NM_001044370	NP_001037835	O15442	MPPD1_HUMAN			3	523	+		all_neural(38;0.0244)|Ovarian(80;0.0694)	100					A8K159|B7Z2S9|Q8N361	Silent	SNP	ENST00000417669.2	37	c.300G>T	CCDS46723.1																																																																																				0.627	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370		44	82	1	0	9.84934e-19	0.010771	1.35027e-18	44	82				
CELSR1	9620	broad.mit.edu	37	22	46860009	46860009	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr22:46860009C>T	ENST00000262738.3	-	2	3777	c.3778G>A	c.(3778-3780)Gtg>Atg	p.V1260M	CELSR1_ENST00000395964.1_Missense_Mutation_p.V1260M	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1260					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GAGAAGGTCACGTTCAGGATG	0.637																																							uc003bhw.1		NA																	0				lung(4)|breast(4)|pancreas(2)|skin(1)	11						c.(3778-3780)GTG>ATG		cadherin EGF LAG seven-pass G-type receptor 1							81.0	82.0	81.0					22																	46860009		2203	4300	6503	SO:0001583	missense	9620				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity	g.chr22:46860009C>T	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.3778G>A	22.37:g.46860009C>T	ENSP00000262738:p.Val1260Met						p.V1260M	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)	2	3778	-		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)	1260			Extracellular (Potential).		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	c.3778G>A	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689462	0.88735	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.72505	-0.66;-0.39	4.85	4.85	0.62838	.	0.000000	0.64402	U	0.000012	D	0.85336	0.5673	M	0.84326	2.69	0.49687	D	0.999816	D	0.89917	1.0	D	0.79784	0.993	D	0.88044	0.2783	10	0.87932	D	0	.	17.5878	0.87987	0.0:1.0:0.0:0.0	.	1260	Q9NYQ6	CELR1_HUMAN	M	1260	ENSP00000262738:V1260M;ENSP00000379293:V1260M	ENSP00000262738:V1260M	V	-	1	0	CELSR1	45238673	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.170000	0.77587	2.239000	0.73571	0.655000	0.94253	GTG		0.637	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246		13	56	0	0	0	0.001855	0	13	56				
FBLN2	2199	broad.mit.edu	37	3	13670462	13670462	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:13670462A>G	ENST00000295760.7	+	11	2555	c.2486A>G	c.(2485-2487)aAc>aGc	p.N829S	FBLN2_ENST00000492059.1_Missense_Mutation_p.N876S|FBLN2_ENST00000535798.1_Missense_Mutation_p.N855S|FBLN2_ENST00000404922.3_Missense_Mutation_p.N876S	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	829	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			AGCTGCATCAACACGGTGGGC	0.632																																							uc011avb.1		NA																	0				ovary(1)	1						c.(2485-2487)AAC>AGC		fibulin 2 isoform b precursor							44.0	50.0	48.0					3																	13670462		2183	4288	6471	SO:0001583	missense	2199					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr3:13670462A>G	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2486A>G	3.37:g.13670462A>G	ENSP00000295760:p.Asn829Ser					FBLN2_uc011auz.1_Missense_Mutation_p.N855S|FBLN2_uc011ava.1_Missense_Mutation_p.N876S|FBLN2_uc011avc.1_Missense_Mutation_p.N876S	p.N829S	NM_001998	NP_001989	P98095	FBLN2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)		11	2611	+			829			EGF-like 5; calcium-binding.		B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	c.2486A>G	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.255365	0.80135	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	D;D;D;D	0.98777	-5.13;-5.13;-5.13;-5.13	5.11	5.11	0.69529	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.000000	0.85682	D	0.000000	D	0.99155	0.9708	M	0.86953	2.85	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.997;0.997	D	0.99474	1.0946	10	0.87932	D	0	.	14.5761	0.68249	1.0:0.0:0.0:0.0	.	829;876;855	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	S	855;876;829;876	ENSP00000445705:N855S;ENSP00000384169:N876S;ENSP00000295760:N829S;ENSP00000420042:N876S	ENSP00000295760:N829S	N	+	2	0	FBLN2	13645463	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	7.407000	0.80029	1.917000	0.55516	0.533000	0.62120	AAC		0.632	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019		4	9	0	0	0	0.009096	0	4	9				
CX3CR1	1524	broad.mit.edu	37	3	39307243	39307243	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:39307243A>T	ENST00000541347.1	-	2	997	c.758T>A	c.(757-759)cTg>cAg	p.L253Q	CX3CR1_ENST00000399220.2_Missense_Mutation_p.L253Q|CX3CR1_ENST00000542107.1_Missense_Mutation_p.L253Q|CX3CR1_ENST00000358309.3_Missense_Mutation_p.L285Q	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	253					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		AAGCGTCTCCAGGAAAATCAT	0.468																																							uc003cjl.2		NA																	0				lung(3)	3						c.(757-759)CTG>CAG		chemokine (C-X3-C motif) receptor 1							116.0	118.0	117.0					3																	39307243		1924	4124	6048	SO:0001583	missense	1524				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity	g.chr3:39307243A>T	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.758T>A	3.37:g.39307243A>T	ENSP00000439140:p.Leu253Gln						p.L253Q	NM_001337	NP_001328	P49238	CX3C1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)	2	850	-			253			Helical; Name=6; (Potential).		A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	ENST00000541347.1	37	c.758T>A	CCDS43069.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.368932	0.82463	.	.	ENSG00000168329	ENST00000399220;ENST00000538756;ENST00000358309;ENST00000541347;ENST00000542107	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.77	5.77	0.91146	GPCR, rhodopsin-like superfamily (1);	0.070427	0.64402	D	0.000016	T	0.69079	0.3071	M	0.86864	2.845	0.51233	D	0.99991	D	0.89917	1.0	D	0.77557	0.99	T	0.75337	-0.3353	10	0.87932	D	0	.	14.9109	0.70755	1.0:0.0:0.0:0.0	.	253	P49238	CX3C1_HUMAN	Q	253;261;285;253;253	ENSP00000382166:L253Q;ENSP00000351059:L285Q;ENSP00000439140:L253Q;ENSP00000444928:L253Q	ENSP00000351059:L285Q	L	-	2	0	CX3CR1	39282247	0.980000	0.34600	1.000000	0.80357	0.864000	0.49448	9.265000	0.95647	2.200000	0.70718	0.533000	0.62120	CTG		0.468	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343613.1	NM_001337		37	23	0	0	0	0.005524	0	37	23				
CACNA1D	776	broad.mit.edu	37	3	53757478	53757478	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:53757478C>T	ENST00000350061.5	+	13	2195	c.1684C>T	c.(1684-1686)Ctc>Ttc	p.L562F	CACNA1D_ENST00000288139.4_Missense_Mutation_p.L582F|CACNA1D_ENST00000422281.2_Missense_Mutation_p.L562F	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	562					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAACAAAGTCCTCTTGGCTCT	0.512																																							uc003dgv.3		NA																	0				ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11						c.(1684-1686)CTC>TTC		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						176.0	155.0	162.0					3																	53757478		2203	4300	6503	SO:0001583	missense	776				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr3:53757478C>T	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1684C>T	3.37:g.53757478C>T	ENSP00000288133:p.Leu562Phe					CACNA1D_uc003dgu.3_Missense_Mutation_p.L582F|CACNA1D_uc003dgy.3_Missense_Mutation_p.L562F|CACNA1D_uc003dgw.3_Missense_Mutation_p.L229F	p.L562F	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	13	1847	+			562			II.|Helical; Name=S2 of repeat II; (Potential).		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	c.1684C>T	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189988	0.58017	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54	6.07	6.07	0.98685	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.95692	0.8599	N	0.01522	-0.82	0.80722	D	1	D;P;B;D	0.89917	1.0;0.837;0.289;1.0	D;P;B;D	0.97110	1.0;0.601;0.288;1.0	D	0.94146	0.7401	10	0.15499	T	0.54	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	562;255;562;582	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	F	562;582;562;255	ENSP00000288133:L562F;ENSP00000288139:L582F;ENSP00000409174:L562F;ENSP00000418014:L255F	ENSP00000288139:L582F	L	+	1	0	CACNA1D	53732518	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	CTC		0.512	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		17	31	0	0	0	0.006122	0	17	31				
CADM2	253559	broad.mit.edu	37	3	86010666	86010666	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:86010666C>A	ENST00000407528.2	+	7	874	c.812C>A	c.(811-813)cCt>cAt	p.P271H	CADM2_ENST00000405615.2_Missense_Mutation_p.P273H|CADM2_ENST00000383699.3_Missense_Mutation_p.P280H	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	271	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TTACCAGATCCTGACCGAATG	0.403																																							uc003dqj.2		NA																	0				ovary(1)|lung(1)|kidney(1)|skin(1)	4						c.(811-813)CCT>CAT		immunoglobulin superfamily, member 4D							152.0	148.0	149.0					3																	86010666		2203	4300	6503	SO:0001583	missense	253559				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane		g.chr3:86010666C>A	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.812C>A	3.37:g.86010666C>A	ENSP00000384575:p.Pro271His					CADM2_uc003dqk.2_Missense_Mutation_p.P280H|CADM2_uc003dql.2_Missense_Mutation_p.P273H	p.P271H	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)	7	1438	+		Lung NSC(201;0.0148)	271			Ig-like C2-type 2.|Extracellular (Potential).		G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	c.812C>A	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956916	0.73902	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	D;T;T	0.81821	-1.54;-0.62;-0.62	5.31	5.31	0.75309	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.174404	0.52532	D	0.000062	T	0.81413	0.4817	N	0.12920	0.275	0.48087	D	0.999583	D;D;D	0.71674	0.988;0.992;0.998	P;P;D	0.64042	0.77;0.794;0.921	T	0.83066	-0.0145	10	0.45353	T	0.12	.	19.3281	0.94270	0.0:1.0:0.0:0.0	.	273;280;271	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	H	280;271;273	ENSP00000373200:P280H;ENSP00000384575:P271H;ENSP00000384193:P273H	ENSP00000373200:P280H	P	+	2	0	CADM2	86093356	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.682000	0.68182	2.629000	0.89072	0.650000	0.86243	CCT		0.403	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184		17	33	1	0	6.44725e-10	0.014323	7.7771e-10	17	33				
CD200R1L	344807	broad.mit.edu	37	3	112538705	112538705	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:112538705C>A	ENST00000398214.1	-	5	942	c.717G>T	c.(715-717)ctG>ctT	p.L239L	CD200R1L_ENST00000448932.1_Silent_p.L218L|CD200R1L_ENST00000488794.1_Silent_p.L218L	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	239						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						AAAGAATGATCAGTAAGGACA	0.388																																							uc003dzi.1		NA																	0				ovary(1)	1						c.(715-717)CTG>CTT		CD200 cell surface glycoprotein receptor 2							92.0	87.0	89.0					3																	112538705		1856	4107	5963	SO:0001819	synonymous_variant	344807					integral to membrane	receptor activity	g.chr3:112538705C>A	AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.717G>T	3.37:g.112538705C>A						CD200R1L_uc011bhw.1_Silent_p.L218L|CD200R1L_uc010hqf.1_Silent_p.L218L	p.L239L	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN			5	943	-			239			Extracellular (Potential).		Q6WHB7	Silent	SNP	ENST00000398214.1	37	c.717G>T	CCDS43131.1																																																																																				0.388	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354365.1	NM_001008784		11	32	1	0	1.58986e-06	0.008291	1.81362e-06	11	32				
SEMA5B	54437	broad.mit.edu	37	3	122631807	122631807	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:122631807C>G	ENST00000357599.3	-	18	2994	c.2608G>C	c.(2608-2610)Gag>Cag	p.E870Q	SEMA5B_ENST00000195173.4_Missense_Mutation_p.E869Q|SEMA5B_ENST00000451055.2_Missense_Mutation_p.E924Q	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	870	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		AAGCCCAGCTCGCAGTCCCGG	0.726																																							uc003efz.1		NA																	0				ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7						c.(2608-2610)GAG>CAG		semaphorin 5B isoform 1							18.0	23.0	21.0					3																	122631807		2198	4298	6496	SO:0001583	missense	54437				cell differentiation|nervous system development	integral to membrane	receptor activity	g.chr3:122631807C>G	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2608G>C	3.37:g.122631807C>G	ENSP00000350215:p.Glu870Gln					SEMA5B_uc011bju.1_Missense_Mutation_p.E812Q|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.E870Q|SEMA5B_uc003efy.1_5'Flank	p.E870Q	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN		GBM - Glioblastoma multiforme(114;0.0367)	18	2912	-			870			Extracellular (Potential).|TSP type-1 3.		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	c.2608G>C	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.387217	0.82902	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.01	5.01	0.66863	.	0.289644	0.33772	N	0.004564	T	0.58666	0.2138	N	0.10782	0.045	0.43608	D	0.995974	D;D	0.61697	0.987;0.99	P;D	0.64506	0.805;0.926	T	0.67162	-0.5740	10	0.66056	D	0.02	.	17.4735	0.87653	0.0:1.0:0.0:0.0	.	812;870	D3YTI7;Q9P283	.;SEM5B_HUMAN	Q	870;869;812;924;870	ENSP00000350215:E870Q;ENSP00000195173:E869Q;ENSP00000389588:E924Q;ENSP00000377208:E870Q	ENSP00000195173:E869Q	E	-	1	0	SEMA5B	124114497	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.426000	0.44731	2.616000	0.88540	0.655000	0.94253	GAG		0.726	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702		9	37	0	0	0	0.004482	0	9	37				
PDIA5	10954	broad.mit.edu	37	3	122849399	122849399	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:122849399C>T	ENST00000316218.7	+	11	941	c.846C>T	c.(844-846)acC>acT	p.T282T		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	282	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		ATCACCTGACCGATGAAGACT	0.582																																							uc003egc.1		NA																	0				ovary(1)	1						c.(844-846)ACC>ACT		protein disulfide isomerase A5 precursor							141.0	118.0	126.0					3																	122849399		2203	4300	6503	SO:0001819	synonymous_variant	10954				cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr3:122849399C>T	AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.846C>T	3.37:g.122849399C>T						PDIA5_uc003egd.1_Intron	p.T282T	NM_006810	NP_006801	Q14554	PDIA5_HUMAN		GBM - Glioblastoma multiforme(114;0.0427)	11	902	+			282			Thioredoxin 2.		D3DN95|Q9BV43	Silent	SNP	ENST00000316218.7	37	c.846C>T	CCDS3020.1																																																																																				0.582	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810		12	62	0	0	0	0.010729	0	12	62				
PPP2R3A	5523	broad.mit.edu	37	3	135721990	135721990	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:135721990C>G	ENST00000264977.3	+	2	2267	c.1650C>G	c.(1648-1650)acC>acG	p.T550T	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	550					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCGGTCAGACCCTTGTAGATC	0.388																																							uc003eqv.1		NA																	0				ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						c.(1648-1650)ACC>ACG		protein phosphatase 2, regulatory subunit B'',							56.0	57.0	57.0					3																	135721990		2203	4300	6503	SO:0001819	synonymous_variant	5523				protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity	g.chr3:135721990C>G	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1650C>G	3.37:g.135721990C>G						PPP2R3A_uc011blz.1_Intron	p.T550T	NM_002718	NP_002709	Q06190	P2R3A_HUMAN			2	2215	+			550					A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	ENST00000264977.3	37	c.1650C>G	CCDS3087.1																																																																																				0.388	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718		7	23	0	0	0	0.001984	0	7	23				
PRR23C	389152	broad.mit.edu	37	3	138762829	138762829	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:138762829G>A	ENST00000413199.1	-	1	905	c.634C>T	c.(634-636)Cgc>Tgc	p.R212C	MRPS22_ENST00000495075.1_Intron|PRR23C_ENST00000502927.2_Missense_Mutation_p.R212C	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	212	Pro-rich.									breast(2)|lung(7)|skin(2)	11						AAGATGGGGCGTGGAGAGCGT	0.647																																							uc011bmt.1		NA																	0				skin(1)	1						c.(634-636)CGC>TGC		proline rich 23C							50.0	56.0	54.0					3																	138762829		692	1591	2283	SO:0001583	missense	389152							g.chr3:138762829G>A		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.634C>T	3.37:g.138762829G>A	ENSP00000396648:p.Arg212Cys						p.R212C	NM_001134657	NP_001128129	Q6ZRP0	PR23C_HUMAN			1	906	-			212			Pro-rich.			Missense_Mutation	SNP	ENST00000413199.1	37	c.634C>T	CCDS46924.1	.	.	.	.	.	.	.	.	.	.	G	0.461	-0.889066	0.02511	.	.	ENSG00000233701	ENST00000413199;ENST00000502927	.	.	.	3.3	-6.61	0.01818	.	4.998830	0.00166	N	0.000006	T	0.34803	0.0910	L	0.59436	1.845	0.09310	N	1	P	0.39116	0.66	B	0.34242	0.178	T	0.44190	-0.9344	9	0.37606	T	0.19	.	6.1979	0.20559	0.0797:0.1005:0.4735:0.3463	.	212	Q6ZRP0	PR23C_HUMAN	C	212	.	ENSP00000396648:R212C	R	-	1	0	PRR23C	140245519	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-3.083000	0.00612	-5.168000	0.00020	-2.157000	0.00329	CGC		0.647	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657		10	11	0	0	0	0.006214	0	10	11				
XRN1	54464	broad.mit.edu	37	3	142141705	142141705	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:142141705T>C	ENST00000264951.4	-	7	887	c.770A>G	c.(769-771)tAt>tGt	p.Y257C	RNU1-100P_ENST00000365255.1_RNA|XRN1_ENST00000544157.1_Missense_Mutation_p.Y47C|XRN1_ENST00000392981.2_Missense_Mutation_p.Y257C|XRN1_ENST00000463916.1_Missense_Mutation_p.Y257C	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	257					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATAGTCAATATACTCTCTCAT	0.328																																							uc003eus.2		NA																	0				ovary(3)	3						c.(769-771)TAT>TGT		5'-3' exoribonuclease 1 isoform a							64.0	70.0	68.0					3																	142141705		2203	4295	6498	SO:0001583	missense	54464				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding	g.chr3:142141705T>C	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.770A>G	3.37:g.142141705T>C	ENSP00000264951:p.Tyr257Cys					XRN1_uc003eut.2_Missense_Mutation_p.Y257C|XRN1_uc003euu.2_Missense_Mutation_p.Y257C|XRN1_uc003euv.1_Missense_Mutation_p.Y118C|XRN1_uc003euw.2_Missense_Mutation_p.Y257C|XRN1_uc011bnh.1_Missense_Mutation_p.Y47C	p.Y257C	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN			7	837	-			257					Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	c.770A>G	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.191459	0.78902	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157;ENST00000477237	T;T	0.46451	0.87;0.87	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.72795	0.3505	M	0.92317	3.295	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.949;1.0;1.0	T	0.80630	-0.1297	10	0.87932	D	0	-19.0539	15.7095	0.77615	0.0:0.0:0.0:1.0	.	47;257;118;257;257	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	C	257;257;257;47;118	ENSP00000264951:Y257C;ENSP00000376707:Y257C	ENSP00000264951:Y257C	Y	-	2	0	XRN1	143624395	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.529000	0.81952	2.102000	0.63906	0.528000	0.53228	TAT		0.328	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		13	30	0	0	0	0.001855	0	13	30				
SI	6476	broad.mit.edu	37	3	164700152	164700152	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:164700152C>A	ENST00000264382.3	-	47	5356	c.5294G>T	c.(5293-5295)aGt>aTt	p.S1765I		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1765	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CCTCGTTTCACTTTTATTTAT	0.333										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(5293-5295)AGT>ATT		sucrase-isomaltase	Acarbose(DB00284)						127.0	122.0	123.0					3																	164700152		2202	4300	6502	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164700152C>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5294G>T	3.37:g.164700152C>A	ENSP00000264382:p.Ser1765Ile	HNSCC(35;0.089)					p.S1765I	NM_001041	NP_001032	P14410	SUIS_HUMAN			47	5356	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1765			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.5294G>T	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	2.408	-0.336106	0.05278	.	.	ENSG00000090402	ENST00000264382	D	0.89196	-2.48	4.56	-9.12	0.00707	.	0.779066	0.12241	N	0.486549	T	0.74801	0.3764	N	0.16743	0.435	0.09310	N	1	B	0.32101	0.356	B	0.32090	0.14	T	0.66188	-0.5986	10	0.54805	T	0.06	.	9.7696	0.40580	0.0:0.5591:0.2141:0.2268	.	1765	P14410	SUIS_HUMAN	I	1765	ENSP00000264382:S1765I	ENSP00000264382:S1765I	S	-	2	0	SI	166182846	0.000000	0.05858	0.000000	0.03702	0.286000	0.27126	-3.277000	0.00529	-3.007000	0.00274	-0.216000	0.12614	AGT		0.333	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		36	9	1	0	1.36239e-07	0.003271	1.5775e-07	36	9				
GOLIM4	27333	broad.mit.edu	37	3	167750322	167750322	+	Missense_Mutation	SNP	G	G	A	rs562832050		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:167750322G>A	ENST00000470487.1	-	9	1851	c.1162C>T	c.(1162-1164)Cac>Tac	p.H388Y	GOLIM4_ENST00000309027.4_Missense_Mutation_p.H360Y	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	388	Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GCACGCGCGTGCCCTTCCAGG	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20656	0.0		0.0	False		,,,				2504	0.0						uc003ffe.2		NA																	0				breast(4)|skin(1)	5						c.(1162-1164)CAC>TAC		golgi integral membrane protein 4							249.0	205.0	220.0					3																	167750322		2203	4300	6503	SO:0001583	missense	27333				transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus		g.chr3:167750322G>A	U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.1162C>T	3.37:g.167750322G>A	ENSP00000417354:p.His388Tyr					GOLIM4_uc011bpe.1_Missense_Mutation_p.H388Y|GOLIM4_uc011bpf.1_Missense_Mutation_p.H360Y|GOLIM4_uc011bpg.1_Missense_Mutation_p.H360Y	p.H388Y	NM_014498	NP_055313	O00461	GOLI4_HUMAN			9	1506	-			388			Glu-rich.|Lumenal (Potential).			Missense_Mutation	SNP	ENST00000470487.1	37	c.1162C>T	CCDS3204.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103355	0.37145	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	5.54	2.68	0.31781	.	0.894418	0.09921	N	0.738499	T	0.45975	0.1369	L	0.60455	1.87	0.09310	N	1	P;P	0.40250	0.709;0.49	B;B	0.43123	0.409;0.409	T	0.32877	-0.9890	9	0.62326	D	0.03	-0.5934	11.5883	0.50931	0.0:0.3793:0.49:0.1307	.	360;388	F8W785;O00461	.;GOLI4_HUMAN	Y	388;360	.	ENSP00000309893:H360Y	H	-	1	0	GOLIM4	169233016	0.463000	0.25799	0.001000	0.08648	0.021000	0.10359	2.796000	0.47869	0.275000	0.22094	0.555000	0.69702	CAC		0.488	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2			6	170	0	0	0	0.001168	0	6	170				
MCF2L2	23101	broad.mit.edu	37	3	183006944	183006944	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr3:183006944C>A	ENST00000328913.3	-	14	2037	c.1740G>T	c.(1738-1740)cgG>cgT	p.R580R	MCF2L2_ENST00000473233.1_Silent_p.R580R|B3GNT5_ENST00000462559.1_Intron|MCF2L2_ENST00000447025.2_Silent_p.R580R|MCF2L2_ENST00000414362.2_Silent_p.R580R	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	580							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CTTCCTTTCCCCGGGAGTTCA	0.403																																							uc003fli.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)	5						c.(1738-1740)CGG>CGT		Rho family guanine-nucleotide exchange factor							72.0	69.0	70.0					3																	183006944		2203	4300	6503	SO:0001819	synonymous_variant	23101				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr3:183006944C>A	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1740G>T	3.37:g.183006944C>A						MCF2L2_uc003flj.1_Silent_p.R580R|MCF2L2_uc011bqr.1_RNA|uc003fln.1_Intron	p.R580R	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)		14	1830	-	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		580					O94942|Q6P2B8|Q6ZVJ5|Q8N318	Silent	SNP	ENST00000328913.3	37	c.1740G>T	CCDS3243.1																																																																																				0.403	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078		4	34	1	0	0.00024832	0.009096	0.0002668	4	34				
HGFAC	3083	broad.mit.edu	37	4	3447936	3447936	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:3447936G>C	ENST00000382774.3	+	10	1385	c.1270G>C	c.(1270-1272)Gcc>Ccc	p.A424P	HGFAC_ENST00000511533.1_Missense_Mutation_p.A431P	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	424	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CTGGCTGGCCGCCATCTACAT	0.697																																							uc003ghc.2		NA																	0				central_nervous_system(2)	2						c.(1270-1272)GCC>CCC		HGF activator preproprotein																																				SO:0001583	missense	3083				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity	g.chr4:3447936G>C	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.1270G>C	4.37:g.3447936G>C	ENSP00000372224:p.Ala424Pro					HGFAC_uc010icw.2_Missense_Mutation_p.A431P	p.A424P	NM_001528	NP_001519	Q04756	HGFA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	10	1273	+			424			Peptidase S1.		Q14726|Q2M1W7|Q53X47	Missense_Mutation	SNP	ENST00000382774.3	37	c.1270G>C	CCDS3369.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957012	0.53293	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	D;D	0.93859	-3.3;-3.3	3.64	2.8	0.32819	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.068985	0.56097	D	0.000024	D	0.96534	0.8869	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.95668	0.8721	10	0.87932	D	0	.	8.7216	0.34445	0.1158:0.0:0.8842:0.0	.	431;424	D6RAR4;Q04756	.;HGFA_HUMAN	P	424;431	ENSP00000372224:A424P;ENSP00000421801:A431P	ENSP00000372224:A424P	A	+	1	0	HGFAC	3417734	1.000000	0.71417	0.757000	0.31301	0.112000	0.19704	3.012000	0.49575	0.748000	0.32831	-0.229000	0.12294	GCC		0.697	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3			6	9	0	0	0	0.001168	0	6	9				
CRMP1	1400	broad.mit.edu	37	4	5857888	5857888	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:5857888C>T	ENST00000397890.2	-	4	674	c.460G>A	c.(460-462)Gtg>Atg	p.V154M	CRMP1_ENST00000324989.7_Missense_Mutation_p.V268M|CRMP1_ENST00000512574.1_Missense_Mutation_p.V152M|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	154					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TGCACCAGCACCTCCAGCTCC	0.522																																							uc003gip.2		NA																	0				ovary(2)	2						c.(460-462)GTG>ATG		collapsin response mediator protein 1 isoform 2							109.0	93.0	99.0					4																	5857888		2203	4300	6503	SO:0001583	missense	1400				axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding	g.chr4:5857888C>T	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.460G>A	4.37:g.5857888C>T	ENSP00000380987:p.Val154Met					CRMP1_uc003gin.1_Missense_Mutation_p.V66M|CRMP1_uc003giq.2_Missense_Mutation_p.V154M|CRMP1_uc003gir.2_Missense_Mutation_p.V149M|CRMP1_uc003gis.2_Missense_Mutation_p.V268M	p.V154M	NM_001313	NP_001304	Q14194	DPYL1_HUMAN		Colorectal(103;0.0721)	5	561	-			154					A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	ENST00000397890.2	37	c.460G>A	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	c	4.949	0.176263	0.09443	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.90385	-2.66;-2.66;-2.66	3.09	1.05	0.20165	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.531829	0.18188	N	0.148909	T	0.81564	0.4849	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.18013	0.002;0.025;0.001;0.003	B;B;B;B	0.12156	0.007;0.007;0.007;0.004	T	0.71441	-0.4592	10	0.49607	T	0.09	-10.9923	8.4844	0.33063	0.0:0.7547:0.0:0.2453	.	268;152;154;91	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	M	268;154;154;152	ENSP00000321606:V268M;ENSP00000380987:V154M;ENSP00000425742:V152M	ENSP00000321606:V268M	V	-	1	0	CRMP1	5908789	0.000000	0.05858	0.998000	0.56505	0.655000	0.38815	-0.100000	0.10990	0.514000	0.28300	-0.293000	0.09583	GTG		0.522	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313		10	49	0	0	0	0.010729	0	10	49				
DRD5	1816	broad.mit.edu	37	4	9784944	9784944	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:9784944G>T	ENST00000304374.2	+	1	1687	c.1291G>T	c.(1291-1293)Gag>Tag	p.E431*		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	431					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CGACGAGGAGGAGGGTCCTTT	0.577																																							uc003gmb.3		NA																	0				skin(1)	1						c.(1291-1293)GAG>TAG		dopamine receptor D5	Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)						83.0	73.0	77.0					4																	9784944		2203	4300	6503	SO:0001587	stop_gained	1816				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane		g.chr4:9784944G>T	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1291G>T	4.37:g.9784944G>T	ENSP00000306129:p.Glu431*						p.E431*	NM_000798	NP_000789	P21918	DRD5_HUMAN			1	1687	+			431			Cytoplasmic (Potential).		B2R9S3|Q8NEQ8	Nonsense_Mutation	SNP	ENST00000304374.2	37	c.1291G>T	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	g	36	5.884714	0.97062	.	.	ENSG00000169676	ENST00000304374	.	.	.	4.52	4.52	0.55395	.	0.539428	0.17342	N	0.177733	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	16.4387	0.83894	0.0:0.0:1.0:0.0	.	.	.	.	X	431	.	ENSP00000306129:E431X	E	+	1	0	DRD5	9394042	0.999000	0.42202	0.580000	0.28601	0.022000	0.10575	5.831000	0.69330	2.353000	0.79882	0.460000	0.39030	GAG		0.577	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1			13	42	1	0	4.3838e-07	0.001855	5.0381e-07	13	42				
GBA3	57733	broad.mit.edu	37	4	22749486	22749486	+	RNA	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:22749486G>C	ENST00000503442.1	+	0	377				GBA3_ENST00000511446.2_RNA|GBA3_ENST00000508166.1_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCATCATCGAGGCTTCCAGAA	0.393																																							uc003gqp.3		NA																	0					0						c.(853-855)AGG>ACG		cytosolic beta-glucosidase isoform a							53.0	52.0	52.0					4																	22749486		1847	4107	5954			57733				glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity	g.chr4:22749486G>C	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22749486G>C						GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Missense_Mutation_p.R286T	p.R285T	NM_020973	NP_066024	Q9H227	GBA3_HUMAN			3	945	+			285					Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Missense_Mutation	SNP	ENST00000503442.1	37	c.854G>C																																																																																					0.393	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2			10	23	0	0	0	0.006214	0	10	23				
STIM2	57620	broad.mit.edu	37	4	27000912	27000912	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:27000912C>G	ENST00000467011.1	+	5	993	c.568C>G	c.(568-570)Cac>Gac	p.H190D	STIM2_ENST00000382009.3_Missense_Mutation_p.H277D|STIM2_ENST00000467087.1_Missense_Mutation_p.H190D|STIM2_ENST00000465503.1_Missense_Mutation_p.H190D|STIM2_ENST00000237364.5_Missense_Mutation_p.H277D|STIM2_ENST00000412829.2_Missense_Mutation_p.H277D	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	190	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				TGACCGGAGTCACAGACAAAA	0.368																																							uc003gsh.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(829-831)CAC>GAC		stromal interaction molecule 2							120.0	106.0	111.0					4																	27000912		2203	4300	6503	SO:0001583	missense	57620				activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding	g.chr4:27000912C>G	AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.568C>G	4.37:g.27000912C>G	ENSP00000419383:p.His190Asp					STIM2_uc003gsg.3_Missense_Mutation_p.H277D|STIM2_uc010iex.2_Missense_Mutation_p.H277D	p.H277D	NM_020860	NP_065911	Q9P246	STIM2_HUMAN			5	1045	+		Breast(46;0.0503)	190			SAM.|Extracellular (Potential).		A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	ENST00000467011.1	37	c.829C>G	CCDS54752.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.674077	0.88445	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000467011;ENST00000412829;ENST00000465503	D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.95069	0.8403	M	0.72894	2.215	0.80722	D	1	B;B;B	0.22800	0.075;0.075;0.061	P;P;P	0.61940	0.824;0.896;0.833	D	0.92562	0.6059	10	0.87932	D	0	.	20.3473	0.98799	0.0:1.0:0.0:0.0	.	277;277;277	A6H8L7;E9PGD0;F5GXJ4	.;.;.	D	190;277;277;190;277;190	ENSP00000419073:H190D;ENSP00000371439:H277D;ENSP00000237364:H277D;ENSP00000419383:H190D;ENSP00000404812:H277D;ENSP00000417569:H190D	ENSP00000237364:H277D	H	+	1	0	STIM2	26610010	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.595000	0.54016	2.884000	0.98904	0.655000	0.94253	CAC		0.368	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000356861.1	NM_020860		3	19	0	0	0	0.009096	0	3	19				
PCDH7	5099	broad.mit.edu	37	4	30724395	30724395	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:30724395G>A	ENST00000361762.2	+	1	2359	c.1351G>A	c.(1351-1353)Gac>Aac	p.D451N	PCDH7_ENST00000543491.1_Missense_Mutation_p.D451N	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	451	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GTCCGACCGAGACCAAGGCGA	0.652																																							uc003gsk.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						c.(1351-1353)GAC>AAC		protocadherin 7 isoform a precursor							60.0	48.0	52.0					4																	30724395		2203	4300	6503	SO:0001583	missense	5099				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chr4:30724395G>A	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1351G>A	4.37:g.30724395G>A	ENSP00000355243:p.Asp451Asn					PCDH7_uc011bxw.1_Missense_Mutation_p.D404N|PCDH7_uc011bxx.1_Missense_Mutation_p.D451N	p.D451N	NM_002589	NP_002580	O60245	PCDH7_HUMAN			1	2359	+			451			Extracellular (Potential).|Cadherin 4.		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	c.1351G>A	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.3|26.3	4.725111|4.725111	0.89298|0.89298	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|T	0.74002|0.49432	-0.8;-0.8|0.78	5.48|5.48	5.48|5.48	0.80851|0.80851	Cadherin (4);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.76695|0.76695	0.4023|0.4023	H|H	0.98487|0.98487	4.245|4.245	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	T|T	0.81482|0.81482	-0.0913|-0.0913	9|7	0.87932|0.02654	D|T	0|1	.|.	19.3488|19.3488	0.94376|0.94376	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	451;404;451|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	N|K	451;451;404|140	ENSP00000355243:D451N;ENSP00000441802:D451N|ENSP00000427066:R140K	ENSP00000330302:D404N|ENSP00000427066:R140K	D|R	+|+	1|2	0|0	PCDH7|PCDH7	30333493|30333493	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	9.869000|9.869000	0.99810|0.99810	2.569000|2.569000	0.86673|0.86673	0.655000|0.655000	0.94253|0.94253	GAC|AGA		0.652	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		3	32	0	0	0	0.004672	0	3	32				
UGDH	7358	broad.mit.edu	37	4	39515741	39515741	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:39515741C>T	ENST00000316423.6	-	3	568	c.226G>A	c.(226-228)Gat>Aat	p.D76N	UGDH_ENST00000506179.1_Missense_Mutation_p.D76N|UGDH_ENST00000515398.1_5'UTR|UGDH_ENST00000507089.1_5'UTR|UGDH_ENST00000501493.2_Missense_Mutation_p.D76N	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	76					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)			breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						ATGGCATCATCAATATTGGTA	0.289																																							uc003guk.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(226-228)GAT>AAT		UDP-glucose dehydrogenase	NADH(DB00157)						69.0	79.0	75.0					4																	39515741		2200	4293	6493	SO:0001583	missense	7358				glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity	g.chr4:39515741C>T	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.226G>A	4.37:g.39515741C>T	ENSP00000319501:p.Asp76Asn					UGDH_uc011byp.1_5'UTR|UGDH_uc003gul.1_Missense_Mutation_p.D76N	p.D76N	NM_003359	NP_003350	O60701	UGDH_HUMAN			3	542	-			76					B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	37	c.226G>A	CCDS3455.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.907369	0.52333	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000515021;ENST00000514106;ENST00000509391;ENST00000505698	T;T;T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01	5.66	4.81	0.61882	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.72036	0.3411	L	0.42245	1.32	0.80722	D	1	B;B	0.21753	0.06;0.003	B;B	0.22152	0.038;0.005	T	0.68326	-0.5438	10	0.46703	T	0.11	-24.2101	14.9484	0.71050	0.144:0.8559:0.0:0.0	.	76;76	B3KUU2;O60701	.;UGDH_HUMAN	N	76;76;76;89;76;76;76	ENSP00000319501:D76N;ENSP00000422909:D76N;ENSP00000421757:D76N;ENSP00000421954:D89N;ENSP00000425834:D76N;ENSP00000422603:D76N;ENSP00000422565:D76N	ENSP00000319501:D76N	D	-	1	0	UGDH	39192136	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.154000	0.64894	1.349000	0.45751	0.555000	0.69702	GAT		0.289	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359		13	53	0	0	0	0.00245	0	13	53				
N4BP2	55728	broad.mit.edu	37	4	40104480	40104480	+	Nonsense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:40104480A>T	ENST00000261435.6	+	4	1431	c.1015A>T	c.(1015-1017)Aag>Tag	p.K339*		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	339	Pro-rich.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AACTAAGGGGAAGGATGTGAG	0.512																																							uc003guy.3		NA																	0				lung(3)|breast(2)|kidney(2)|ovary(1)	8						c.(1015-1017)AAG>TAG		Nedd4 binding protein 2							103.0	105.0	104.0					4																	40104480		2203	4300	6503	SO:0001587	stop_gained	55728					cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding	g.chr4:40104480A>T	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.1015A>T	4.37:g.40104480A>T	ENSP00000261435:p.Lys339*					N4BP2_uc010ifq.2_Nonsense_Mutation_p.K259*|N4BP2_uc010ifr.2_Nonsense_Mutation_p.K259*	p.K339*	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN			4	1353	+			339			Pro-rich.		A0AVR3|Q9NVK2|Q9P2D4	Nonsense_Mutation	SNP	ENST00000261435.6	37	c.1015A>T	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	A	37	6.485612	0.97607	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	.	.	.	5.55	5.55	0.83447	.	0.413975	0.24098	N	0.041572	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.371	10.3763	0.44083	0.7853:0.2147:0.0:0.0	.	.	.	.	X	339;259	.	ENSP00000261435:K339X	K	+	1	0	N4BP2	39780875	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	3.796000	0.55507	2.326000	0.78906	0.533000	0.62120	AAG		0.512	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177		34	36	0	0	0	0.003271	0	34	36				
REST	5978	broad.mit.edu	37	4	57796484	57796484	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:57796484A>T	ENST00000309042.7	+	4	1774	c.1460A>T	c.(1459-1461)cAg>cTg	p.Q487L		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	487	Lys-rich.				cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					TCAGTGATCCAGGTGACTACC	0.378																																							uc003hch.2		NA																	0				skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9						c.(1459-1461)CAG>CTG		RE1-silencing transcription factor							64.0	66.0	66.0					4																	57796484		2203	4300	6503	SO:0001583	missense	5978				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding	g.chr4:57796484A>T	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.1460A>T	4.37:g.57796484A>T	ENSP00000311816:p.Gln487Leu					REST_uc003hci.2_Missense_Mutation_p.Q487L|REST_uc010ihf.2_Missense_Mutation_p.Q161L	p.Q487L	NM_005612	NP_005603	Q13127	REST_HUMAN			4	1807	+	Glioma(25;0.08)|all_neural(26;0.181)		487			Lys-rich.		A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	37	c.1460A>T	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.479331	0.44044	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.41400	1.0	5.88	4.68	0.58851	.	0.126360	0.36519	N	0.002545	T	0.59851	0.2224	M	0.71581	2.175	0.48696	D	0.999692	D;D	0.67145	0.996;0.966	P;P	0.62298	0.9;0.462	T	0.63721	-0.6573	10	0.87932	D	0	-15.7122	12.8592	0.57903	0.8636:0.1364:0.0:0.0	.	464;487	F8WAN5;Q13127	.;REST_HUMAN	L	487;464	ENSP00000311816:Q487L	ENSP00000311816:Q487L	Q	+	2	0	REST	57491241	0.873000	0.30073	0.419000	0.26584	0.078000	0.17371	3.269000	0.51592	1.029000	0.39812	0.459000	0.35465	CAG		0.378	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612		7	28	0	0	0	0.001984	0	7	28				
PRDM8	56978	broad.mit.edu	37	4	81123069	81123069	+	Splice_Site	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:81123069G>T	ENST00000504452.1	+	8	1292	c.453G>T	c.(451-453)ggG>ggT	p.G151G	PRDM8_ENST00000339711.4_Splice_Site_p.G151G|PRDM8_ENST00000415738.2_Splice_Site_p.G151G			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	151					corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						ACTAAGCAGGGTCGTCCCCTT	0.562											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010ijo.2		NA																	0				skin(1)	1						c.(451-453)GGG>GGT		PR domain containing 8							102.0	111.0	108.0					4																	81123069		2180	4272	6452	SO:0001630	splice_region_variant	56978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:81123069G>T	AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.452-1G>T	4.37:g.81123069G>T			OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1203	PRDM8_uc003hmb.3_Silent_p.G151G|PRDM8_uc003hmc.3_Silent_p.G151G	p.G151G	NM_020226	NP_064611	Q9NQV8	PRDM8_HUMAN			8	1292	+			151					A8K7X2|Q6IQ36	Silent	SNP	ENST00000504452.1	37	c.453G>T	CCDS43243.1																																																																																				0.562	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362793.1		Silent	24	54	1	0	1.64293e-13	0.00333	2.06822e-13	24	54				
NPNT	255743	broad.mit.edu	37	4	106858224	106858224	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:106858224C>A	ENST00000379987.2	+	4	540	c.324C>A	c.(322-324)taC>taA	p.Y108*	NPNT_ENST00000506666.1_Nonsense_Mutation_p.Y138*|NPNT_ENST00000513430.1_3'UTR|NPNT_ENST00000514622.1_Nonsense_Mutation_p.Y108*|NPNT_ENST00000305572.8_Nonsense_Mutation_p.Y108*|NPNT_ENST00000427316.2_Nonsense_Mutation_p.Y138*|NPNT_ENST00000453617.2_Nonsense_Mutation_p.Y125*	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	108	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		TGAACACTTACGGCAGCTACA	0.448																																							uc003hya.2		NA																	0				skin(1)	1						c.(322-324)TAC>TAA		nephronectin precursor							113.0	95.0	101.0					4																	106858224		2203	4300	6503	SO:0001587	stop_gained	255743				cell differentiation	membrane	calcium ion binding	g.chr4:106858224C>A		CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.324C>A	4.37:g.106858224C>A	ENSP00000369323:p.Tyr108*					NPNT_uc011cfc.1_Nonsense_Mutation_p.Y125*|NPNT_uc011cfd.1_Nonsense_Mutation_p.Y138*|NPNT_uc011cfe.1_Nonsense_Mutation_p.Y138*|NPNT_uc010ilt.1_Nonsense_Mutation_p.Y108*|NPNT_uc011cff.1_Nonsense_Mutation_p.Y108*|NPNT_uc010ilu.1_Nonsense_Mutation_p.Y4*	p.Y108*	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)	4	529	+		Hepatocellular(203;0.217)	108			EGF-like 2; calcium-binding (Potential).		A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Nonsense_Mutation	SNP	ENST00000379987.2	37	c.324C>A	CCDS34046.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973170	0.92919	.	.	ENSG00000168743	ENST00000504304;ENST00000379987;ENST00000453617;ENST00000427316;ENST00000514622;ENST00000305572;ENST00000506666;ENST00000503451	.	.	.	5.05	-1.81	0.07882	.	0.356307	0.33534	N	0.004819	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5725	0.56344	0.0:0.5093:0.0:0.4907	.	.	.	.	X	4;108;125;138;108;108;138;155	.	ENSP00000302557:Y108X	Y	+	3	2	NPNT	107077673	0.001000	0.12720	0.162000	0.22713	0.928000	0.56348	-1.504000	0.02275	-0.313000	0.08728	-1.170000	0.01741	TAC		0.448	NPNT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364083.1	NM_198278		23	13	1	0	9.57634e-11	0.00333	1.16735e-10	23	13				
TBCK	93627	broad.mit.edu	37	4	107016734	107016734	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:107016734C>G	ENST00000273980.5	-	26	2923	c.2476G>C	c.(2476-2478)Ggg>Cgg	p.G826R	TBCK_ENST00000432496.2_Missense_Mutation_p.G826R|TBCK_ENST00000394706.3_Missense_Mutation_p.G787R|TBCK_ENST00000394708.2_Missense_Mutation_p.G826R|TBCK_ENST00000361687.4_Missense_Mutation_p.G763R					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						GTAAGCTCCCCTTCTGCAGTG	0.463																																							uc010ilv.2		NA																	0				large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						c.(2476-2478)GGG>CGG		TBC domain-containing protein kinase-like							126.0	112.0	116.0					4																	107016734		2203	4300	6503	SO:0001583	missense	93627					intracellular	Rab GTPase activator activity	g.chr4:107016734C>G		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.2476G>C	4.37:g.107016734C>G	ENSP00000273980:p.Gly826Arg					TBCK_uc003hyb.2_Missense_Mutation_p.G569R|TBCK_uc003hye.2_Missense_Mutation_p.G787R|TBCK_uc003hyc.2_Missense_Mutation_p.G763R|TBCK_uc003hyd.2_Missense_Mutation_p.G654R|TBCK_uc003hyf.2_Missense_Mutation_p.G826R	p.G826R	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN			25	2841	-			826			Rhodanese.			Missense_Mutation	SNP	ENST00000273980.5	37	c.2476G>C	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704437	0.48412	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	5.41	5.41	0.78517	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	M	0.75777	2.31	0.58432	D	0.999999	B;B;B	0.24368	0.011;0.102;0.036	B;B;B	0.25405	0.033;0.06;0.022	T	0.06197	-1.0840	10	0.38643	T	0.18	.	12.5477	0.56210	0.0:0.9242:0.0:0.0758	.	826;787;763	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	R	826;826;763;787;826	ENSP00000273980:G826R;ENSP00000405847:G826R;ENSP00000355338:G763R;ENSP00000378196:G787R;ENSP00000378198:G826R	ENSP00000273980:G826R	G	-	1	0	TBCK	107236183	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.341000	0.43983	2.541000	0.85698	0.585000	0.79938	GGG		0.463	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115		23	10	0	0	0	0.014323	0	23	10				
SEC24B	10427	broad.mit.edu	37	4	110415918	110415918	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:110415918C>G	ENST00000265175.5	+	6	1449	c.1394C>G	c.(1393-1395)aCa>aGa	p.T465R	SEC24B_ENST00000504968.2_Missense_Mutation_p.T496R|SEC24B_ENST00000399100.2_Missense_Mutation_p.T430R	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	465					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		GGCTATCCAACACTTCAGCCT	0.493																																							uc003hzk.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1393-1395)ACA>AGA		SEC24 (S. cerevisiae) homolog B isoform a							111.0	114.0	113.0					4																	110415918		2114	4273	6387	SO:0001583	missense	10427				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding	g.chr4:110415918C>G	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1394C>G	4.37:g.110415918C>G	ENSP00000265175:p.Thr465Arg					SEC24B_uc003hzl.2_Missense_Mutation_p.T430R|SEC24B_uc011cfp.1_Missense_Mutation_p.T496R|SEC24B_uc011cfq.1_Missense_Mutation_p.T465R|SEC24B_uc011cfr.1_Missense_Mutation_p.T430R	p.T465R	NM_006323	NP_006314	O95487	SC24B_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)	6	1449	+		Hepatocellular(203;0.217)	465					B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	c.1394C>G	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407754	0.42715	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.21932	1.98;1.98;1.98	5.47	3.72	0.42706	.	.	.	.	.	T	0.20129	0.0484	L	0.39898	1.24	0.09310	N	1	P;B;P;B;P	0.41710	0.554;0.04;0.76;0.214;0.554	B;B;B;B;B	0.42798	0.221;0.082;0.323;0.398;0.323	T	0.06826	-1.0805	9	0.38643	T	0.18	10.8437	9.2128	0.37328	0.0:0.7765:0.1457:0.0777	.	380;64;496;430;465	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	R	496;430;465	ENSP00000428564:T496R;ENSP00000382051:T430R;ENSP00000265175:T465R	ENSP00000265175:T465R	T	+	2	0	SEC24B	110635367	0.018000	0.18449	0.005000	0.12908	0.718000	0.41266	2.856000	0.48341	0.651000	0.30788	0.655000	0.94253	ACA		0.493	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2			19	38	0	0	0	0.006122	0	19	38				
ANK2	287	broad.mit.edu	37	4	114277965	114277965	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:114277965G>A	ENST00000357077.4	+	38	8244	c.8191G>A	c.(8191-8193)Ggc>Agc	p.G2731S	ANK2_ENST00000264366.6_Missense_Mutation_p.G2698S|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2731					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGAAGAGCCAGGCAAATCAGA	0.413																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(8191-8193)GGC>AGC		ankyrin 2 isoform 1							71.0	70.0	70.0					4																	114277965		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114277965G>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8191G>A	4.37:g.114277965G>A	ENSP00000349588:p.Gly2731Ser					ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.G33S|ANK2_uc011cgb.1_Missense_Mutation_p.G2746S	p.G2731S	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	8291	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	2698					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.8191G>A	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305987	0.23736	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.64438	-0.09;-0.1	5.76	2.93	0.34026	.	0.990388	0.08215	N	0.980095	T	0.45538	0.1347	L	0.28274	0.84	0.09310	N	1	B;B	0.12630	0.003;0.006	B;B	0.09377	0.002;0.004	T	0.29822	-0.9999	9	.	.	.	.	5.3255	0.15905	0.0774:0.1554:0.6268:0.1404	.	2698;2731	Q01484;Q01484-4	ANK2_HUMAN;.	S	2731;2698	ENSP00000349588:G2731S;ENSP00000264366:G2698S	.	G	+	1	0	ANK2	114497414	0.000000	0.05858	0.002000	0.10522	0.136000	0.21042	0.618000	0.24373	0.754000	0.32968	0.655000	0.94253	GGC		0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		19	34	0	0	0	0.006122	0	19	34				
TRPC3	7222	broad.mit.edu	37	4	122835998	122835998	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:122835998C>T	ENST00000379645.3	-	4	1351	c.1278G>A	c.(1276-1278)gtG>gtA	p.V426V	TRPC3_ENST00000513531.1_Intron|TRPC3_ENST00000264811.5_Silent_p.V353V	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	341					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.V353V(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CCACGACCAGCACAACGAGAC	0.542																																							uc003ieg.2		NA																	1	Substitution - coding silent(1)		cervix(1)	ovary(2)	2						c.(1276-1278)GTG>GTA		transient receptor potential cation channel,							133.0	97.0	109.0					4																	122835998		2203	4300	6503	SO:0001819	synonymous_variant	7222				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr4:122835998C>T	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1278G>A	4.37:g.122835998C>T						TRPC3_uc010inr.2_Intron|TRPC3_uc003ief.2_Silent_p.V353V|TRPC3_uc011cgl.1_Silent_p.V90V	p.V426V	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN			4	1352	-			341			Helical; (Potential).		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Silent	SNP	ENST00000379645.3	37	c.1278G>A	CCDS47130.1																																																																																				0.542	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305		8	14	0	0	0	0.006214	0	8	14				
FHDC1	85462	broad.mit.edu	37	4	153897411	153897411	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:153897411A>T	ENST00000511601.1	+	12	3156	c.2968A>T	c.(2968-2970)Agg>Tgg	p.R990W	FHDC1_ENST00000260008.3_Missense_Mutation_p.R990W			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	990									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					CAAACCACTCAGGAACCTCCC	0.652																																							uc003inf.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(2968-2970)AGG>TGG		FH2 domain containing 1							31.0	38.0	36.0					4																	153897411		2203	4300	6503	SO:0001583	missense	85462				actin cytoskeleton organization		actin binding	g.chr4:153897411A>T	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2968A>T	4.37:g.153897411A>T	ENSP00000427567:p.Arg990Trp						p.R990W	NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN			11	3043	+	all_hematologic(180;0.093)		990						Missense_Mutation	SNP	ENST00000511601.1	37	c.2968A>T	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	A	19.08	3.757905	0.69648	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.57107	0.42;0.42	5.5	-1.86	0.07760	.	0.299915	0.32819	N	0.005617	T	0.60025	0.2237	L	0.34521	1.04	0.44852	D	0.997868	D	0.89917	1.0	D	0.83275	0.996	T	0.60722	-0.7207	10	0.72032	D	0.01	.	17.2474	0.87032	0.3088:0.6912:0.0:0.0	.	990	Q9C0D6	FHDC1_HUMAN	W	990	ENSP00000427567:R990W;ENSP00000260008:R990W	ENSP00000260008:R990W	R	+	1	2	FHDC1	154116861	0.349000	0.24870	0.142000	0.22268	0.995000	0.86356	0.269000	0.18589	-0.562000	0.06086	0.533000	0.62120	AGG		0.652	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393		21	7	0	0	0	0.008871	0	21	7				
FSTL5	56884	broad.mit.edu	37	4	162463753	162463753	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:162463753G>T	ENST00000306100.5	-	9	1544	c.1108C>A	c.(1108-1110)Cct>Act	p.P370T	FSTL5_ENST00000536695.1_Missense_Mutation_p.P369T|FSTL5_ENST00000427802.2_Missense_Mutation_p.P369T|FSTL5_ENST00000379164.4_Missense_Mutation_p.P369T|FSTL5_ENST00000511170.1_5'Flank	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	370	Ig-like 2.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CCAAGCTGAGGCTTTGGTATG	0.458																																							uc003iqh.2		NA																	0				ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(1108-1110)CCT>ACT		follistatin-like 5 isoform a							85.0	85.0	85.0					4																	162463753		2203	4299	6502	SO:0001583	missense	56884					extracellular region	calcium ion binding	g.chr4:162463753G>T	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1108C>A	4.37:g.162463753G>T	ENSP00000305334:p.Pro370Thr					FSTL5_uc003iqi.2_Missense_Mutation_p.P369T|FSTL5_uc010iqv.2_Missense_Mutation_p.P369T	p.P370T	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	9	1544	-	all_hematologic(180;0.24)		370			Ig-like 2.		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	c.1108C>A	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837430	0.91117	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	4.88	4.88	0.63580	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87900	0.6294	M	0.93016	3.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.91007	0.4847	10	0.87932	D	0	.	17.4015	0.87461	0.0:0.0:1.0:0.0	.	369;369;370	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	T	370;369;369;369	ENSP00000305334:P370T;ENSP00000368462:P369T;ENSP00000389270:P369T;ENSP00000440409:P369T	ENSP00000305334:P370T	P	-	1	0	FSTL5	162683203	1.000000	0.71417	0.900000	0.35374	0.979000	0.70002	9.476000	0.97823	2.422000	0.82143	0.462000	0.41574	CCT		0.458	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		17	17	1	0	1.37285e-15	0.004007	1.807e-15	17	17				
GLRA3	8001	broad.mit.edu	37	4	175565175	175565175	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr4:175565175T>A	ENST00000274093.3	-	10	1659	c.1157A>T	c.(1156-1158)tAt>tTt	p.Y386F	GLRA3_ENST00000340217.5_Missense_Mutation_p.Y371F	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	386					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	TCCCATTCCATAGGCTGTGAA	0.453																																							uc003ity.1		NA																	0				ovary(3)	3						c.(1156-1158)TAT>TTT		glycine receptor, alpha 3 isoform a	Glycine(DB00145)						161.0	138.0	145.0					4																	175565175		2203	4300	6503	SO:0001583	missense	8001				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chr4:175565175T>A	AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.1157A>T	4.37:g.175565175T>A	ENSP00000274093:p.Tyr386Phe					GLRA3_uc003itz.1_Missense_Mutation_p.Y371F	p.Y386F	NM_006529	NP_006520	O75311	GLRA3_HUMAN		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	10	1660	-		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)	386			Cytoplasmic (Probable).		D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	c.1157A>T	CCDS3822.1	.	.	.	.	.	.	.	.	.	.	T	14.16	2.452719	0.43531	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	D;D	0.83673	-1.75;-1.75	5.98	5.98	0.97165	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.500855	0.23327	N	0.049392	T	0.74222	0.3688	N	0.20685	0.6	0.37429	D	0.913956	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.71351	-0.4619	10	0.37606	T	0.19	.	16.4696	0.84102	0.0:0.0:0.0:1.0	.	371;386	O75311-2;O75311	.;GLRA3_HUMAN	F	386;371	ENSP00000274093:Y386F;ENSP00000345284:Y371F	ENSP00000274093:Y386F	Y	-	2	0	GLRA3	175801750	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.153000	0.58118	2.289000	0.77006	0.482000	0.46254	TAT		0.453	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1			15	39	0	0	0	0.00245	0	15	39				
SLC6A19	340024	broad.mit.edu	37	5	1221831	1221831	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:1221831T>C	ENST00000304460.10	+	12	1773	c.1717T>C	c.(1717-1719)Tcc>Ccc	p.S573P		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	573					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			ATTTCCCAAATCCCAGAAGAT	0.577																																							uc003jbw.3		NA																	0					0						c.(1717-1719)TCC>CCC		solute carrier family 6, member 19							97.0	90.0	92.0					5																	1221831		2203	4300	6503	SO:0001583	missense	340024				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr5:1221831T>C	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1717T>C	5.37:g.1221831T>C	ENSP00000305302:p.Ser573Pro						p.S573P	NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		12	1773	+	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		573			Extracellular (Potential).		A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	c.1717T>C	CCDS34130.1	.	.	.	.	.	.	.	.	.	.	T	6.951	0.545356	0.13312	.	.	ENSG00000174358	ENST00000304460	T	0.74209	-0.82	4.73	3.57	0.40892	.	0.223551	0.40908	N	0.000985	T	0.55386	0.1917	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.15870	0.014	T	0.40664	-0.9551	10	0.33940	T	0.23	.	4.796	0.13272	0.1401:0.1604:0.0:0.6995	.	573	Q695T7	S6A19_HUMAN	P	573	ENSP00000305302:S573P	ENSP00000305302:S573P	S	+	1	0	SLC6A19	1274831	0.001000	0.12720	0.025000	0.17156	0.762000	0.43233	0.661000	0.25023	0.693000	0.31634	0.459000	0.35465	TCC		0.577	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120		13	99	0	0	0	0.00245	0	13	99				
IRX2	153572	broad.mit.edu	37	5	2749827	2749827	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:2749827G>A	ENST00000382611.6	-	2	572	c.324C>T	c.(322-324)taC>taT	p.Y108Y	C5orf38_ENST00000515640.1_5'Flank|IRX2_ENST00000502957.1_5'UTR|C5orf38_ENST00000397835.4_5'Flank|C5orf38_ENST00000457752.2_5'Flank|C5orf38_ENST00000334000.3_5'Flank|C5orf38_ENST00000505778.1_5'Flank|IRX2_ENST00000302057.5_Silent_p.Y108Y	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	108					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		GCTGGTACGGGTAGGCCGCGC	0.672																																							uc003jda.2		NA																	0				skin(1)	1						c.(322-324)TAC>TAT		iroquois homeobox 2							87.0	76.0	80.0					5																	2749827		2203	4300	6503	SO:0001819	synonymous_variant	153572					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:2749827G>A	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.324C>T	5.37:g.2749827G>A						C5orf38_uc003jdc.2_5'Flank|C5orf38_uc011cmg.1_5'Flank|C5orf38_uc011cmh.1_5'Flank|C5orf38_uc011cmi.1_5'Flank|C5orf38_uc011cmj.1_5'Flank|IRX2_uc003jdb.2_Silent_p.Y108Y	p.Y108Y	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN		GBM - Glioblastoma multiforme(108;0.204)	2	566	-			108					Q68A19|Q7Z2I7	Silent	SNP	ENST00000382611.6	37	c.324C>T	CCDS3868.1																																																																																				0.672	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206749.2			16	72	0	0	0	0.004007	0	16	72				
DNAH5	1767	broad.mit.edu	37	5	13714584	13714584	+	Missense_Mutation	SNP	C	C	A	rs376585054		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:13714584C>A	ENST00000265104.4	-	75	13159	c.13055G>T	c.(13054-13056)cGg>cTg	p.R4352L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4352					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CACCGCCTCCCGGGTCTCATC	0.562									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(13054-13056)CGG>CTG		dynein, axonemal, heavy chain 5							82.0	80.0	81.0					5																	13714584		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13714584C>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13055G>T	5.37:g.13714584C>A	ENSP00000265104:p.Arg4352Leu					DNAH5_uc003jfc.2_Missense_Mutation_p.R520L	p.R4352L	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			75	13097	-	Lung NSC(4;0.00476)		4352					Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.13055G>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602795	0.87157	.	.	ENSG00000039139	ENST00000265104	T	0.09723	2.95	5.22	5.22	0.72569	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.44329	0.1288	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56733	-0.7930	10	0.87932	D	0	.	18.7863	0.91955	0.0:1.0:0.0:0.0	.	4352	Q8TE73	DYH5_HUMAN	L	4352	ENSP00000265104:R4352L	ENSP00000265104:R4352L	R	-	2	0	DNAH5	13767584	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	7.798000	0.85924	2.446000	0.82766	0.655000	0.94253	CGG		0.562	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		41	83	1	0	9.85521e-28	0.00623	1.40528e-27	41	83				
TRIO	7204	broad.mit.edu	37	5	14280519	14280519	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:14280519C>G	ENST00000344204.4	+	3	345	c.321C>G	c.(319-321)ctC>ctG	p.L107L	TRIO_ENST00000537187.1_Silent_p.L107L|TRIO_ENST00000509967.2_Silent_p.L58L	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	107	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TCAGGAGACTCATTTCCTATC	0.448																																							uc003jff.2		NA																	0				skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(319-321)CTC>CTG		triple functional domain (PTPRF interacting)							130.0	114.0	119.0					5																	14280519		2203	4300	6503	SO:0001819	synonymous_variant	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14280519C>G	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.321C>G	5.37:g.14280519C>G						TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Silent_p.L58L	p.L107L	NM_007118	NP_009049	O75962	TRIO_HUMAN			3	327	+	Lung NSC(4;0.000742)		107			CRAL-TRIO.		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	c.321C>G	CCDS3883.1																																																																																				0.448	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		5	57	0	0	0	0.000602	0	5	57				
TRIO	7204	broad.mit.edu	37	5	14291337	14291337	+	Splice_Site	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:14291337G>T	ENST00000344204.4	+	5	1077	c.1053G>T	c.(1051-1053)aaG>aaT	p.K351N	TRIO_ENST00000537187.1_Splice_Site_p.K351N|TRIO_ENST00000509967.2_Splice_Site_p.K302N	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	351					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ATGCTGAGAAGGTAAAGACGG	0.557																																							uc003jff.2		NA																	0				skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(1051-1053)AAG>AAT		triple functional domain (PTPRF interacting)							32.0	32.0	32.0					5																	14291337		2199	4289	6488	SO:0001630	splice_region_variant	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14291337G>T	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.1053+1G>T	5.37:g.14291337G>T						TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Missense_Mutation_p.K302N|TRIO_uc003jfh.1_5'Flank	p.K351N	NM_007118	NP_009049	O75962	TRIO_HUMAN			5	1059	+	Lung NSC(4;0.000742)		351			Spectrin 1.		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	c.1053G>T	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721025	0.68959	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.50277	0.75;0.75;0.75	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.71409	0.3336	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.76833	-0.2813	10	0.87932	D	0	.	18.0866	0.89460	0.0:0.0:1.0:0.0	.	302;351	F5H228;O75962	.;TRIO_HUMAN	N	351;351;302;38	ENSP00000339299:K351N;ENSP00000446348:K351N;ENSP00000445592:K302N	ENSP00000339299:K351N	K	+	3	2	TRIO	14344337	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.813000	0.99286	2.355000	0.79922	0.462000	0.41574	AAG		0.557	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	Missense_Mutation	15	44	1	0	3.35478e-16	0.003163	4.4283e-16	15	44				
CDH18	1016	broad.mit.edu	37	5	19543986	19543986	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:19543986G>T	ENST00000507958.1	-	11	2372	c.1382C>A	c.(1381-1383)tCa>tAa	p.S461*	CDH18_ENST00000274170.4_Nonsense_Mutation_p.S461*|CDH18_ENST00000506372.1_Nonsense_Mutation_p.S461*|CDH18_ENST00000382275.1_Nonsense_Mutation_p.S461*|CDH18_ENST00000511273.1_Nonsense_Mutation_p.S461*|CDH18_ENST00000502796.1_Nonsense_Mutation_p.S461*			Q13634	CAD18_HUMAN	cadherin 18, type 2	461	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ACCAATTTCTGAAGCAGTGAC	0.373																																							uc003jgc.2		NA																	0				ovary(5)|large_intestine(1)|skin(1)	7						c.(1381-1383)TCA>TAA		cadherin 18, type 2 preproprotein							143.0	134.0	137.0					5																	19543986		2203	4300	6503	SO:0001587	stop_gained	1016				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:19543986G>T	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1382C>A	5.37:g.19543986G>T	ENSP00000425093:p.Ser461*					CDH18_uc003jgd.2_Nonsense_Mutation_p.S461*|CDH18_uc011cnm.1_Nonsense_Mutation_p.S461*	p.S461*	NM_004934	NP_004925	Q13634	CAD18_HUMAN			8	1759	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		461			Extracellular (Potential).|Cadherin 4.		A8K0I2|B4DHG6|Q8N5Z2	Nonsense_Mutation	SNP	ENST00000507958.1	37	c.1382C>A	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	47	13.340807	0.99735	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1494	0.86774	0.0:0.0:1.0:0.0	.	.	.	.	X	461;461;461;461;461;461;407;461	.	.	S	-	2	0	CDH18	19579743	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	8.121000	0.89582	2.413000	0.81919	0.491000	0.48974	TCA		0.373	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		19	45	1	0	0.000175454	0.010504	0.000189836	19	45				
PRDM9	56979	broad.mit.edu	37	5	23527452	23527452	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:23527452A>T	ENST00000296682.3	+	11	2437	c.2255A>T	c.(2254-2256)gAg>gTg	p.E752V		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	752					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GTCTGCAGGGAGTGTGGGCGG	0.592										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(2254-2256)GAG>GTG		PR domain containing 9							48.0	68.0	61.0					5																	23527452		2119	4294	6413	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23527452A>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2255A>T	5.37:g.23527452A>T	ENSP00000296682:p.Glu752Val	HNSCC(3;0.000094)					p.E752V	NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN			11	2437	+			752			C2H2-type 10.		B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.2255A>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	A	6.336	0.430183	0.12045	.	.	ENSG00000164256	ENST00000296682	T	0.38887	1.11	3.0	3.0	0.34707	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26011	0.0634	N	0.12527	0.23	0.26536	N	0.974174	B	0.19583	0.037	B	0.23018	0.043	T	0.18304	-1.0341	9	0.52906	T	0.07	.	9.6653	0.39981	1.0:0.0:0.0:0.0	.	752	Q9NQV7	PRDM9_HUMAN	V	752	ENSP00000296682:E752V	ENSP00000296682:E752V	E	+	2	0	PRDM9	23563209	0.000000	0.05858	1.000000	0.80357	0.039000	0.13416	0.105000	0.15333	1.602000	0.50124	0.397000	0.26171	GAG		0.592	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		100	96	0	0	0	0.01441	0	100	96				
NPR3	4883	broad.mit.edu	37	5	32774833	32774833	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:32774833G>C	ENST00000265074.8	+	4	1422	c.1079G>C	c.(1078-1080)gGa>gCa	p.G360A	NPR3_ENST00000434067.2_Missense_Mutation_p.G144A|NPR3_ENST00000415685.2_Missense_Mutation_p.G144A|NPR3_ENST00000415167.2_Missense_Mutation_p.G360A	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	360					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	TTTGTTGAAGGATTCCACGAT	0.438																																							uc003jhv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1078-1080)GGA>GCA		natriuretic peptide receptor C/guanylate cyclase	Nesiritide(DB04899)						205.0	196.0	199.0					5																	32774833		1902	4111	6013	SO:0001583	missense	4883				osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity	g.chr5:32774833G>C		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.1079G>C	5.37:g.32774833G>C	ENSP00000265074:p.Gly360Ala					NPR3_uc010iuo.2_Missense_Mutation_p.G144A|NPR3_uc011cnz.1_Missense_Mutation_p.G144A|NPR3_uc003jhu.2_Missense_Mutation_p.G360A	p.G360A	NM_000908	NP_000899	P17342	ANPRC_HUMAN			4	1297	+			360			Extracellular (Potential).		A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	c.1079G>C	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035567	0.93630	.	.	ENSG00000113389	ENST00000509104;ENST00000434067;ENST00000415685;ENST00000265074;ENST00000415167	D;D;D;T;T	0.81821	-1.54;-1.54;-1.54;2.05;2.05	5.77	5.77	0.91146	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.84238	0.5428	L	0.31476	0.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.79203	-0.1900	10	0.16896	T	0.51	-13.2896	19.9832	0.97338	0.0:0.0:1.0:0.0	.	144;144;360;360	E7EPG9;B4DT84;P17342;Q60I31	.;.;ANPRC_HUMAN;.	A	137;144;144;360;360	ENSP00000425325:G137A;ENSP00000388408:G144A;ENSP00000402490:G144A;ENSP00000265074:G360A;ENSP00000398028:G360A	ENSP00000265074:G360A	G	+	2	0	NPR3	32810590	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.599000	0.98280	2.722000	0.93159	0.655000	0.94253	GGA		0.438	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908		21	218	0	0	0	0.010504	0	21	218				
SLC45A2	51151	broad.mit.edu	37	5	33944822	33944822	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:33944822C>G	ENST00000296589.4	-	7	1670	c.1524G>C	c.(1522-1524)gtG>gtC	p.V508V	SLC45A2_ENST00000342059.3_Silent_p.V449V	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	508					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						ACGCTGTGATCACCACGACGA	0.547																																					Ovarian(31;380 859 8490 22203 49048)	Ovarian(31;380 859 8490 22203 49048)	uc003jid.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(1522-1524)GTG>GTC		membrane-associated transporter protein isoform							89.0	72.0	77.0					5																	33944822		2203	4300	6503	SO:0001819	synonymous_variant	51151				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane		g.chr5:33944822C>G	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1524G>C	5.37:g.33944822C>G							p.V508V	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN			7	1616	-			508			Helical; Name=12; (Potential).		Q6P2P0|Q9BTM3	Silent	SNP	ENST00000296589.4	37	c.1524G>C	CCDS3901.1																																																																																				0.547	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		11	51	0	0	0	0.010729	0	11	51				
SPEF2	79925	broad.mit.edu	37	5	35712959	35712959	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:35712959A>C	ENST00000356031.3	+	20	3039	c.2885A>C	c.(2884-2886)aAg>aCg	p.K962T	SPEF2_ENST00000440995.2_Missense_Mutation_p.K957T|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	962					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGAAAAGGGAAGAAAGGTGAG	0.353																																							uc003jjo.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(2884-2886)AAG>ACG		KPL2 protein isoform 1							89.0	86.0	87.0					5																	35712959		1816	4075	5891	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35712959A>C	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2885A>C	5.37:g.35712959A>C	ENSP00000348314:p.Lys962Thr					SPEF2_uc003jjp.1_Missense_Mutation_p.K448T	p.K962T	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		20	2996	+	all_lung(31;7.56e-05)		962					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.2885A>C	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.133121	0.56828	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.07444	3.2;3.19	4.86	4.86	0.63082	.	0.271361	0.28465	N	0.015255	T	0.17789	0.0427	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.00931	-1.1510	10	0.62326	D	0.03	.	11.1235	0.48304	1.0:0.0:0.0:0.0	.	957;962	Q9C093-2;Q9C093	.;SPEF2_HUMAN	T	962;957	ENSP00000348314:K962T;ENSP00000412125:K957T	ENSP00000348314:K962T	K	+	2	0	SPEF2	35748716	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.043000	0.57354	1.954000	0.56735	0.533000	0.62120	AAG		0.353	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		33	27	0	0	0	0.004878	0	33	27				
ITGA2	3673	broad.mit.edu	37	5	52360854	52360854	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:52360854T>A	ENST00000296585.5	+	14	1858	c.1715T>A	c.(1714-1716)gTg>gAg	p.V572E		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	572					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TTTAATGATGTGATTGTTGGT	0.428																																							uc003joy.2		NA																	0				lung(1)	1						c.(1714-1716)GTG>GAG		integrin alpha 2 precursor							165.0	159.0	161.0					5																	52360854		2203	4300	6503	SO:0001583	missense	3673				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	g.chr5:52360854T>A		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1715T>A	5.37:g.52360854T>A	ENSP00000296585:p.Val572Glu					ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.V496E|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	p.V572E	NM_002203	NP_002194	P17301	ITA2_HUMAN			14	1858	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	572			Extracellular (Potential).|FG-GAP 6.		Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	c.1715T>A	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.498802	0.64298	.	.	ENSG00000164171	ENST00000296585	T	0.71103	-0.54	5.67	4.51	0.55191	.	0.115279	0.64402	D	0.000013	D	0.86142	0.5862	M	0.92367	3.3	0.52501	D	0.999956	D;D	0.76494	0.999;0.997	D;D	0.78314	0.991;0.973	D	0.88713	0.3224	10	0.87932	D	0	.	11.356	0.49615	0.0:0.0708:0.0:0.9292	.	572;572	E7ESP4;P17301	.;ITA2_HUMAN	E	572	ENSP00000296585:V572E	ENSP00000296585:V572E	V	+	2	0	ITGA2	52396611	1.000000	0.71417	0.997000	0.53966	0.365000	0.29674	5.739000	0.68622	2.288000	0.76882	0.533000	0.62120	GTG		0.428	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203		39	49	0	0	0	0.005524	0	39	49				
RNF180	285671	broad.mit.edu	37	5	63509437	63509437	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:63509437G>T	ENST00000389100.4	+	4	356	c.284G>T	c.(283-285)gGg>gTg	p.G95V	RNF180_ENST00000296615.6_Missense_Mutation_p.G95V|RNF180_ENST00000381081.2_Intron	NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	95					adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		GCCCGTTTAGGGGGCTTTAAT	0.458																																							uc003jti.2		NA																	0					0						c.(283-285)GGG>GTG		ring finger protein 180 isoform 1							135.0	149.0	144.0					5																	63509437		2203	4300	6503	SO:0001583	missense	285671					integral to membrane|nuclear envelope	zinc ion binding	g.chr5:63509437G>T	AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.284G>T	5.37:g.63509437G>T	ENSP00000373752:p.Gly95Val					RNF180_uc003jth.3_Missense_Mutation_p.G95V|RNF180_uc010iws.2_Intron	p.G95V	NM_001113561	NP_001107033	Q86T96	RN180_HUMAN		Lung(70;0.114)	4	394	+		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)	95			Cytoplasmic (Potential).		Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	ENST00000389100.4	37	c.284G>T	CCDS47219.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.180961	0.78677	.	.	ENSG00000164197	ENST00000296615;ENST00000389100;ENST00000504296	D	0.90788	-2.73	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.96479	0.8851	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96473	0.9350	10	0.87932	D	0	-10.131	19.6529	0.95825	0.0:0.0:1.0:0.0	.	95;95	Q86T96;Q86T96-2	RN180_HUMAN;.	V	95	ENSP00000373752:G95V	ENSP00000296615:G95V	G	+	2	0	RNF180	63545193	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.580000	0.90784	2.890000	0.99128	0.655000	0.94253	GGG		0.458	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368394.1	NM_178532		29	169	1	0	2.61193e-14	0.009535	3.38964e-14	29	169				
CWC27	10283	broad.mit.edu	37	5	64314067	64314067	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:64314067C>A	ENST00000381070.3	+	14	1555	c.1338C>A	c.(1336-1338)atC>atA	p.I446I	CWC27_ENST00000545000.1_3'UTR|RP11-307L14.1_ENST00000607786.1_lincRNA|RP11-307L14.2_ENST00000606057.1_lincRNA	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	446					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						CATTTGAAATCTATGATCCTC	0.358																																							uc003jtn.1		NA																	0					0						c.(1336-1338)ATC>ATA		serologically defined colon cancer antigen 10							117.0	121.0	119.0					5																	64314067		2203	4300	6503	SO:0001819	synonymous_variant	10283				protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity	g.chr5:64314067C>A	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.1338C>A	5.37:g.64314067C>A						CWC27_uc010iwt.1_3'UTR	p.I446I	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN			14	1557	+			446					O60529|O60530|Q96EM3	Silent	SNP	ENST00000381070.3	37	c.1338C>A	CCDS3982.2																																																																																				0.358	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869		13	52	1	0	0.000219431	0.00245	0.000236311	13	52				
ARHGEF28	64283	broad.mit.edu	37	5	73148476	73148476	+	Splice_Site	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:73148476G>T	ENST00000426542.2	+	13	1769	c.1749G>T	c.(1747-1749)gaG>gaT	p.E583D	ARHGEF28_ENST00000296794.6_Splice_Site_p.E583D|ARHGEF28_ENST00000287898.5_Splice_Site_p.E583D|ARHGEF28_ENST00000545377.1_Splice_Site_p.E583D|ARHGEF28_ENST00000296799.4_Splice_Site_p.E270D|ARHGEF28_ENST00000437974.1_Splice_Site_p.E583D|ARHGEF28_ENST00000513042.2_Splice_Site_p.E583D			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	583					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GTCTTGTAGAGCAAAGAGCTT	0.373																																							uc011csq.1		NA																	0					0						c.(1747-1749)GAG>GAT		Rho-guanine nucleotide exchange factor							163.0	153.0	156.0					5																	73148476		1881	4113	5994	SO:0001630	splice_region_variant	64283				cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding	g.chr5:73148476G>T		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.1748-1G>T	5.37:g.73148476G>T						RGNEF_uc003kcx.2_Missense_Mutation_p.E583D|RGNEF_uc003kcy.1_3'UTR|RGNEF_uc010izf.2_Missense_Mutation_p.E583D|RGNEF_uc011csr.1_Missense_Mutation_p.E270D	p.E583D	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)	13	1760	+		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)	583					B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	c.1749G>T	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417373	0.42918	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.13420	2.81;2.78;2.79;2.59;2.78;2.79;2.63	6.17	1.36	0.22044	.	.	.	.	.	T	0.10165	0.0249	M	0.66939	2.045	0.32920	D	0.515697	B;B;B;B	0.29232	0.153;0.153;0.153;0.238	B;B;B;B	0.28709	0.062;0.062;0.057;0.093	T	0.32079	-0.9920	9	0.05833	T	0.94	.	1.6598	0.02789	0.3588:0.1271:0.3835:0.1306	.	270;583;583;583	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	D	583;583;583;583;583;583;270	ENSP00000296794:E583D;ENSP00000441913:E583D;ENSP00000441436:E583D;ENSP00000287898:E583D;ENSP00000411459:E583D;ENSP00000412175:E583D;ENSP00000296799:E270D	ENSP00000287898:E583D	E	+	3	2	RP11-428C6.1	73184232	0.998000	0.40836	0.993000	0.49108	0.984000	0.73092	0.315000	0.19451	-0.034000	0.13713	0.655000	0.94253	GAG		0.373	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		Missense_Mutation	31	67	1	0	2.42023e-17	0.003271	3.25043e-17	31	67				
F2RL2	2151	broad.mit.edu	37	5	75913421	75913421	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:75913421A>T	ENST00000296641.4	-	2	1314	c.1111T>A	c.(1111-1113)Tac>Aac	p.Y371N	IQGAP2_ENST00000396234.3_Intron|IQGAP2_ENST00000274364.6_Intron|IQGAP2_ENST00000502745.1_Intron|F2RL2_ENST00000504899.1_Missense_Mutation_p.Y349N|IQGAP2_ENST00000379730.3_Intron	NM_004101.3	NP_004092.1	O00254	PAR3_HUMAN	coagulation factor II (thrombin) receptor-like 2	371					blood coagulation (GO:0007596)|metabolic process (GO:0008152)|platelet activation (GO:0030168)|response to wounding (GO:0009611)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|thrombin receptor activity (GO:0015057)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(3)	32		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)		TTTGTAAGGTAAGCAGTGGAG	0.368																																							uc003kem.2		NA																	0				skin(2)|ovary(1)	3						c.(1111-1113)TAC>AAC		coagulation factor II (thrombin) receptor-like 2							91.0	89.0	89.0					5																	75913421		2203	4299	6502	SO:0001583	missense	2151				platelet activation	extracellular region|integral to plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|thrombin receptor activity	g.chr5:75913421A>T	U92971	CCDS4031.1, CCDS58959.1	5q13	2012-08-08			ENSG00000164220	ENSG00000164220		"""GPCR / Class A : Protease activated receptors"""	3539	protein-coding gene	gene with protein product	"""proteinase-activated receptor-3"""	601919				9087410, 9722561	Standard	NM_004101		Approved	PAR3	uc003kem.4	O00254	OTTHUMG00000102119	ENST00000296641.4:c.1111T>A	5.37:g.75913421A>T	ENSP00000296641:p.Tyr371Asn					IQGAP2_uc003kek.2_Intron|IQGAP2_uc010izv.2_Intron|IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron|F2RL2_uc011csw.1_Missense_Mutation_p.Y349N	p.Y371N	NM_004101	NP_004092	O00254	PAR3_HUMAN		all cancers(79;4.43e-43)	2	1296	-		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)	371			Cytoplasmic (Potential).		B2R754|B4DQ13|Q52M68|Q7Z3W3	Missense_Mutation	SNP	ENST00000296641.4	37	c.1111T>A	CCDS4031.1	.	.	.	.	.	.	.	.	.	.	A	16.78	3.216614	0.58452	.	.	ENSG00000164220	ENST00000296641;ENST00000504899	T;T	0.65916	-0.18;-0.15	4.58	2.78	0.32641	.	2.181110	0.02224	N	0.064257	T	0.54398	0.1856	N	0.17248	0.465	0.20975	N	0.999813	P	0.44877	0.845	P	0.46659	0.523	T	0.47142	-0.9140	10	0.27082	T	0.32	-2.372	8.3339	0.32202	0.8636:0.0:0.1364:0.0	.	371	O00254	PAR3_HUMAN	N	371;349	ENSP00000296641:Y371N;ENSP00000426703:Y349N	ENSP00000296641:Y371N	Y	-	1	0	F2RL2	75949177	1.000000	0.71417	0.052000	0.19188	0.136000	0.21042	5.137000	0.64789	0.400000	0.25396	0.460000	0.39030	TAC		0.368	F2RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219958.3			5	25	0	0	0	0.000602	0	5	25				
PCSK1	5122	broad.mit.edu	37	5	95728928	95728928	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:95728928G>T	ENST00000311106.3	-	14	2276	c.2039C>A	c.(2038-2040)cCg>cAg	p.P680Q	PCSK1_ENST00000513085.1_5'UTR|PCSK1_ENST00000508626.1_Missense_Mutation_p.P633Q|CTD-2337A12.1_ENST00000502645.2_RNA	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	680					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTGCTTTGGCGGTGAGTTTTT	0.532																																							uc003kls.1		NA																	0				ovary(2)	2						c.(2038-2040)CCG>CAG		proprotein convertase subtilisin/kexin type 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						109.0	114.0	112.0					5																	95728928		2203	4300	6503	SO:0001583	missense	5122				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity	g.chr5:95728928G>T		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.2039C>A	5.37:g.95728928G>T	ENSP00000308024:p.Pro680Gln					PCSK1_uc010jbi.1_Missense_Mutation_p.P370Q	p.P680Q	NM_000439	NP_000430	P29120	NEC1_HUMAN		all cancers(79;3.44e-16)	14	2245	-		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)	680					B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	ENST00000311106.3	37	c.2039C>A	CCDS4081.1	.	.	.	.	.	.	.	.	.	.	G	5.011	0.187713	0.09547	.	.	ENSG00000175426	ENST00000311106;ENST00000508626	T;T	0.67345	-0.1;-0.26	5.62	0.51	0.16983	.	0.651799	0.16664	N	0.204653	T	0.40645	0.1125	N	0.24115	0.695	0.09310	N	1	B;B	0.26975	0.165;0.052	B;B	0.20577	0.03;0.03	T	0.09997	-1.0649	10	0.17832	T	0.49	-0.4041	2.2699	0.04088	0.2724:0.1182:0.488:0.1215	.	633;680	E9PHA1;P29120	.;NEC1_HUMAN	Q	680;633	ENSP00000308024:P680Q;ENSP00000421600:P633Q	ENSP00000308024:P680Q	P	-	2	0	PCSK1	95754684	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.754000	0.26390	0.302000	0.22762	-0.136000	0.14681	CCG		0.532	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439		38	67	1	0	8.73648e-17	0.004289	1.15984e-16	38	67				
PGGT1B	5229	broad.mit.edu	37	5	114588852	114588852	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:114588852C>A	ENST00000419445.1	-	2	261	c.241G>T	c.(241-243)Gtc>Ttc	p.V81F	PGGT1B_ENST00000379615.3_Missense_Mutation_p.V81F	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit	81					negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		GTGGGAAGGACCTGCAGGGAA	0.388																																							uc003kqw.3		NA																	0					0						c.(241-243)GTC>TTC		geranylgeranyltransferase type 1 beta	Pravastatin(DB00175)						120.0	118.0	119.0					5																	114588852		2202	4300	6502	SO:0001583	missense	5229				protein geranylgeranylation	CAAX-protein geranylgeranyltransferase complex	CAAX-protein geranylgeranyltransferase activity	g.chr5:114588852C>A		CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.241G>T	5.37:g.114588852C>A	ENSP00000404676:p.Val81Phe					PGGT1B_uc003kqx.3_5'UTR|PGGT1B_uc010jch.2_Missense_Mutation_p.V81F	p.V81F	NM_005023	NP_005014	P53609	PGTB1_HUMAN		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)	2	262	-		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)	81					Q5MJP9	Missense_Mutation	SNP	ENST00000419445.1	37	c.241G>T	CCDS4116.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632902	0.67015	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	T;T	0.50277	0.81;0.75	5.92	5.92	0.95590	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.055638	0.64402	D	0.000001	T	0.65396	0.2687	M	0.76170	2.325	0.80722	D	1	D;P	0.61697	0.99;0.878	P;B	0.54346	0.749;0.197	T	0.67975	-0.5531	10	0.87932	D	0	-16.4178	20.3151	0.98650	0.0:1.0:0.0:0.0	.	81;81	P53609-2;P53609	.;PGTB1_HUMAN	F	81	ENSP00000404676:V81F;ENSP00000368935:V81F	ENSP00000368935:V81F	V	-	1	0	PGGT1B	114616751	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.997000	0.70646	2.809000	0.96659	0.467000	0.42956	GTC		0.388	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250855.2	NM_005023		12	44	1	0	6.42651e-13	0.010729	8.00283e-13	12	44				
SLC25A48	153328	broad.mit.edu	37	5	135207197	135207197	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:135207197G>T	ENST00000420621.1	+	5	641	c.469G>T	c.(469-471)Gca>Tca	p.A157S	SLC25A48_ENST00000274513.5_Missense_Mutation_p.A157S|SLC25A48_ENST00000412661.2_Intron|SLC25A48_ENST00000425402.1_Intron|SLC25A48_ENST00000433282.2_Missense_Mutation_p.A103S			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	157					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						GGAGCAGCCAGCATACCAGGG	0.612																																							uc003laz.1		NA																	0					0						c.(469-471)GCA>TCA		RecName: Full=Putative mitochondrial carrier protein FLJ44862;							58.0	66.0	64.0					5																	135207197		1951	4142	6093	SO:0001583	missense	153328				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr5:135207197G>T		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.469G>T	5.37:g.135207197G>T	ENSP00000407973:p.Ala157Ser					LOC153328_uc003lba.2_Intron	p.A157S			Q6ZT89	S2548_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		5	641	+			157			Solcar 2.		Q8TAV9	Missense_Mutation	SNP	ENST00000420621.1	37	c.469G>T		.	.	.	.	.	.	.	.	.	.	G	8.183	0.794200	0.16327	.	.	ENSG00000145832	ENST00000274513;ENST00000420621;ENST00000433282	T;T;T	0.78364	-1.17;-1.17;-1.17	5.77	3.7	0.42460	.	0.878941	0.10197	N	0.703950	T	0.64327	0.2588	.	.	.	0.09310	N	1	B	0.20550	0.046	B	0.19946	0.027	T	0.50021	-0.8876	9	0.21540	T	0.41	-6.4508	10.0026	0.41938	0.101:0.1435:0.7555:0.0	.	157	Q6ZT89-2	.	S	157;157;103	ENSP00000274513:A157S;ENSP00000407973:A157S;ENSP00000399834:A103S	ENSP00000274513:A157S	A	+	1	0	SLC25A48	135235096	0.645000	0.27286	0.139000	0.22197	0.039000	0.13416	3.643000	0.54374	1.416000	0.47057	0.561000	0.74099	GCA		0.612	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_145282		21	67	1	0	5.35356e-11	0.00278	6.54324e-11	21	67				
SMAD5	4090	broad.mit.edu	37	5	135489586	135489586	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:135489586A>G	ENST00000545279.1	+	3	497	c.137A>G	c.(136-138)aAg>aGg	p.K46R	SMAD5_ENST00000545620.1_Missense_Mutation_p.K46R|SMAD5_ENST00000514641.2_3'UTR	NM_001001419.1|NM_005903.5	NP_001001419.1|NP_005894.3	Q99717	SMAD5_HUMAN	SMAD family member 5	46	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.|Poly-Lys.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAAAAGAAAAAGGGTGCCATG	0.473																																							uc003lbj.1		NA																	0					0						c.(136-138)AAG>AGG		SMAD family member 5							103.0	112.0	109.0					5																	135489586		2151	4292	6443	SO:0001583	missense	4090				BMP signaling pathway|embryonic pattern specification|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding	g.chr5:135489586A>G	U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000545279.1:c.137A>G	5.37:g.135489586A>G	ENSP00000441954:p.Lys46Arg					SMAD5_uc003lbk.1_Missense_Mutation_p.K46R|SMAD5_uc003lbl.1_Missense_Mutation_p.K46R	p.K46R	NM_001001419	NP_001001419	Q99717	SMAD5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		4	581	+			46			Poly-Lys.|MH1.		O14688|Q15798|Q9UQA1	Missense_Mutation	SNP	ENST00000545279.1	37	c.137A>G		.	.	.	.	.	.	.	.	.	.	A	21.7	4.182200	0.78677	.	.	ENSG00000113658	ENST00000507118;ENST00000511116;ENST00000545279;ENST00000545620;ENST00000506223	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.80369	0.4610	M	0.67397	2.05	0.52099	D	0.999949	P	0.44776	0.843	P	0.52957	0.714	T	0.76449	-0.2955	10	0.17369	T	0.5	.	16.3594	0.83251	1.0:0.0:0.0:0.0	.	46	F5GWU7	.	R	46	ENSP00000425749:K46R;ENSP00000424279:K46R;ENSP00000441954:K46R;ENSP00000446474:K46R;ENSP00000422954:K46R	ENSP00000422954:K46R	K	+	2	0	SMAD5	135517485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.233000	0.95337	2.266000	0.75297	0.455000	0.32223	AAG		0.473	SMAD5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005903		3	48	0	0	0	0.004672	0	3	48				
PCDHA5	56143	broad.mit.edu	37	5	140201577	140201577	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:140201577C>G	ENST00000529859.1	+	1	217	c.217C>G	c.(217-219)Ctt>Gtt	p.L73V	PCDHA5_ENST00000378126.3_Missense_Mutation_p.L73V|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.L73V|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Q49fs*50(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCGGGGACCTTCTGGAGGT	0.642																																							uc003lhl.2		NA																	1	Deletion - Frameshift(1)	p.Q49fs*50(1)	breast(1)	ovary(1)|breast(1)|skin(1)	3						c.(217-219)CTT>GTT		protocadherin alpha 5 isoform 1 precursor							79.0	92.0	88.0					5																	140201577		2203	4300	6503	SO:0001583	missense	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140201577C>G	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.217C>G	5.37:g.140201577C>G	ENSP00000436557:p.Leu73Val					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.L73V|PCDHA5_uc003lhj.1_Missense_Mutation_p.L73V	p.L73V	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	217	+			73			Extracellular (Potential).|Cadherin 1.		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	c.217C>G	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885562	0.33255	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.28255	1.62;1.62;1.62	3.97	2.77	0.32553	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43590	0.1254	M	0.86343	2.81	0.09310	N	1	P;P;P	0.46220	0.712;0.664;0.874	P;P;P	0.49361	0.608;0.473;0.511	T	0.46721	-0.9171	9	0.72032	D	0.01	.	3.3204	0.07048	0.2116:0.51:0.0:0.2784	.	73;73;73	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	V	73	ENSP00000433416:L73V;ENSP00000436557:L73V;ENSP00000367366:L73V	ENSP00000367366:L73V	L	+	1	0	PCDHA5	140181761	0.000000	0.05858	1.000000	0.80357	0.941000	0.58515	0.206000	0.17375	1.937000	0.56155	0.580000	0.79431	CTT		0.642	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		70	100	0	0	0	0.01441	0	70	100				
PCDHB2	56133	broad.mit.edu	37	5	140475866	140475866	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:140475866C>T	ENST00000194155.4	+	1	1640	c.1492C>T	c.(1492-1494)Ccg>Tcg	p.P498S		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	498	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCCAGGACCCGCACCTGCC	0.672																																							uc003lil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(1492-1494)CCG>TCG		protocadherin beta 2 precursor							58.0	62.0	61.0					5																	140475866		2202	4295	6497	SO:0001583	missense	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140475866C>T	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1492C>T	5.37:g.140475866C>T	ENSP00000194155:p.Pro498Ser					PCDHB2_uc003lim.1_Missense_Mutation_p.P159S	p.P498S	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1630	+			498			Extracellular (Potential).|Cadherin 5.		Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	c.1492C>T	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	6.259	0.415813	0.11870	.	.	ENSG00000112852	ENST00000194155	T	0.62941	-0.01	4.34	1.08	0.20341	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.32133	0.0819	N	0.02334	-0.595	0.09310	N	1	B	0.32040	0.353	B	0.30572	0.117	T	0.20273	-1.0280	9	0.48119	T	0.1	.	6.0256	0.19652	0.1118:0.3709:0.4336:0.0837	.	498	Q9Y5E7	PCDB2_HUMAN	S	498	ENSP00000194155:P498S	ENSP00000194155:P498S	P	+	1	0	PCDHB2	140456050	0.000000	0.05858	0.879000	0.34478	0.658000	0.38924	-1.685000	0.01930	0.386000	0.24997	0.556000	0.70494	CCG		0.672	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		32	182	0	0	0	0.00623	0	32	182				
PCDHB7	56129	broad.mit.edu	37	5	140552496	140552496	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:140552496G>T	ENST00000231137.3	+	1	254	c.80G>T	c.(79-81)gGc>gTc	p.G27V		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	27					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTTGGGCTGGCGCCGAACCG	0.502																																							uc003lit.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(79-81)GGC>GTC		protocadherin beta 7 precursor							171.0	151.0	158.0					5																	140552496		2203	4300	6503	SO:0001583	missense	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140552496G>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.80G>T	5.37:g.140552496G>T	ENSP00000231137:p.Gly27Val						p.G27V	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	254	+			27			Extracellular (Potential).		A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	c.80G>T	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	G	0.837	-0.743253	0.03088	.	.	ENSG00000113212	ENST00000231137	T	0.49720	0.77	4.78	0.61	0.17580	.	.	.	.	.	T	0.34221	0.0890	L	0.43152	1.355	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.26326	-1.0106	9	0.44086	T	0.13	.	3.7791	0.08673	0.076:0.2642:0.3885:0.2713	.	27	Q9Y5E2	PCDB7_HUMAN	V	27	ENSP00000231137:G27V	ENSP00000231137:G27V	G	+	2	0	PCDHB7	140532680	0.000000	0.05858	0.002000	0.10522	0.173000	0.22820	-0.246000	0.08878	0.119000	0.18210	0.650000	0.86243	GGC		0.502	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		40	60	1	0	4.32679e-17	0.006999	5.76074e-17	40	60				
PCDHB16	57717	broad.mit.edu	37	5	140563434	140563434	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:140563434G>C	ENST00000361016.2	+	1	2455	c.1300G>C	c.(1300-1302)Gag>Cag	p.E434Q		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGAAAACGGAGCACAACAT	0.502																																							uc003liv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1300-1302)GAG>CAG		protocadherin beta 16 precursor							121.0	115.0	117.0					5																	140563434		2203	4300	6503	SO:0001583	missense	57717				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140563434G>C	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1300G>C	5.37:g.140563434G>C	ENSP00000354293:p.Glu434Gln					PCDHB16_uc010jfw.1_Missense_Mutation_p.E106Q	p.E434Q	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2455	+			434			Extracellular (Potential).|Cadherin 4.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	c.1300G>C	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	0.001	-2.965439	0.00049	.	.	ENSG00000196963	ENST00000361016	T	0.01767	4.65	4.3	-0.466	0.12153	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01092	0.0036	N	0.13272	0.32	0.09310	N	1	B	0.11235	0.004	B	0.14023	0.01	T	0.49390	-0.8945	9	0.12430	T	0.62	.	5.3594	0.16079	0.1843:0.1544:0.5757:0.0857	.	434	Q9NRJ7	PCDBG_HUMAN	Q	434	ENSP00000354293:E434Q	ENSP00000354293:E434Q	E	+	1	0	PCDHB16	140543618	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-4.043000	0.00307	-0.671000	0.05274	-0.353000	0.07706	GAG		0.502	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		28	133	0	0	0	0.005443	0	28	133				
PCDHGA2	56113	broad.mit.edu	37	5	140719169	140719169	+	Missense_Mutation	SNP	G	G	C	rs201113857		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:140719169G>C	ENST00000394576.2	+	1	631	c.631G>C	c.(631-633)Gtt>Ctt	p.V211L	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	211	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACCACCTCGTTCTCGTGGC	0.587																																							uc003ljk.1		NA																	0				skin(2)|ovary(1)	3						c.(631-633)GTT>CTT		protocadherin gamma subfamily A, 2 isoform 1							78.0	74.0	75.0					5																	140719169		2203	4300	6503	SO:0001583	missense	56113				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140719169G>C	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.631G>C	5.37:g.140719169G>C	ENSP00000378077:p.Val211Leu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.V211L	p.V211L	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	816	+			211			Extracellular (Potential).|Cadherin 2.		Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	c.631G>C	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	5.116	0.207033	0.09704	.	.	ENSG00000081853	ENST00000394576	T	0.52983	0.64	5.14	-4.35	0.03656	Cadherin (4);Cadherin-like (1);	0.207503	0.23325	N	0.049411	T	0.24699	0.0599	N	0.16833	0.445	0.09310	N	1	B;B	0.12630	0.004;0.006	B;B	0.24701	0.02;0.055	T	0.11616	-1.0580	10	0.30854	T	0.27	.	7.7333	0.28799	0.4496:0.3227:0.2278:0.0	.	211;211	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	L	211	ENSP00000378077:V211L	ENSP00000378077:V211L	V	+	1	0	PCDHGA2	140699353	0.000000	0.05858	0.002000	0.10522	0.316000	0.28119	-1.217000	0.02979	-0.923000	0.03785	0.563000	0.77884	GTT		0.587	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		35	50	0	0	0	0.012213	0	35	50				
PCDHGB3	56102	broad.mit.edu	37	5	140778972	140778972	+	Intron	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:140778972G>T	ENST00000576222.1	+	1	2546				PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGCAAGCCGCCCCTCTCCT	0.512																																							uc003lkf.1		NA																	0					0						c.(1276-1278)CCG>CCT		protocadherin gamma subfamily B, 5 isoform 1							51.0	58.0	55.0					5																	140778972		2023	4179	6202	SO:0001627	intron_variant	56101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140778972G>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26596G>T	5.37:g.140778972G>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Silent_p.P426P	p.P426P	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1278	+			426			Cadherin 4.|Extracellular (Potential).		A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	37	c.1278G>T	CCDS58980.1																																																																																				0.512	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		20	52	1	0	2.32416e-17	0.014323	3.1305e-17	20	52				
ARHGEF37	389337	broad.mit.edu	37	5	149008500	149008500	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:149008500C>T	ENST00000333677.6	+	12	1952	c.1789C>T	c.(1789-1791)Cta>Tta	p.L597L		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	597						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						CAGCCCAGCTCTAGTGCCCTC	0.592																																							uc003lra.1		NA																	0					0						c.(1789-1791)CTA>TTA		hypothetical protein LOC389337							43.0	47.0	45.0					5																	149008500		1944	4141	6085	SO:0001819	synonymous_variant	389337				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	g.chr5:149008500C>T	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.1789C>T	5.37:g.149008500C>T							p.L597L	NM_001001669	NP_001001669	A1IGU5	ARH37_HUMAN			12	1853	+			597					Q6ZW51	Silent	SNP	ENST00000333677.6	37	c.1789C>T	CCDS43385.1																																																																																				0.592	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373763.1	NM_001001669		15	21	0	0	0	0.00245	0	15	21				
CSF1R	1436	broad.mit.edu	37	5	149459794	149459794	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:149459794A>T	ENST00000286301.3	-	4	704	c.413T>A	c.(412-414)gTc>gAc	p.V138D	CSF1R_ENST00000543093.1_Missense_Mutation_p.V138D	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	138	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	CACCAGCGAGACGCCTGCTTC	0.642																																							uc003lrl.2		NA																	0				haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54						c.(412-414)GTC>GAC		colony stimulating factor 1 receptor precursor	Imatinib(DB00619)|Sunitinib(DB01268)						63.0	55.0	58.0					5																	149459794		2203	4300	6503	SO:0001583	missense	1436				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity	g.chr5:149459794A>T	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.413T>A	5.37:g.149459794A>T	ENSP00000286301:p.Val138Asp					CSF1R_uc011dcd.1_5'UTR|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Missense_Mutation_p.V138D|CSF1R_uc011dce.1_Missense_Mutation_p.V138D|CSF1R_uc011dcf.1_Missense_Mutation_p.V138D	p.V138D	NM_005211	NP_005202	P07333	CSF1R_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		3	608	-			138			Extracellular (Potential).|Ig-like C2-type 2.		B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	ENST00000286301.3	37	c.413T>A	CCDS4302.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.983064	0.53827	.	.	ENSG00000182578	ENST00000286301;ENST00000543093	T;T	0.08008	3.14;3.14	4.62	3.46	0.39613	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.268921	0.26032	N	0.026759	T	0.22975	0.0555	M	0.72894	2.215	0.28752	N	0.901409	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.995;0.962	T	0.03545	-1.1026	10	0.87932	D	0	.	6.8825	0.24181	0.8926:0.0:0.1074:0.0	.	138;138;138	B4DG86;B5A955;P07333	.;.;CSF1R_HUMAN	D	138	ENSP00000286301:V138D;ENSP00000445282:V138D	ENSP00000286301:V138D	V	-	2	0	CSF1R	149439987	0.907000	0.30839	0.052000	0.19188	0.024000	0.10985	2.669000	0.46825	0.744000	0.32741	0.459000	0.35465	GTC		0.642	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211		11	42	0	0	0	0.013537	0	11	42				
GPX3	2878	broad.mit.edu	37	5	150405018	150405018	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:150405018G>A	ENST00000388825.4	+	2	297	c.205G>A	c.(205-207)Gtg>Atg	p.V69M	GPX3_ENST00000517973.1_Intron|GPX3_ENST00000521722.1_3'UTR	NM_002084.3	NP_002075.2	P22352	GPX3_HUMAN	glutathione peroxidase 3 (plasma)	69					hydrogen peroxide catabolic process (GO:0042744)|protein homotetramerization (GO:0051289)|response to lipid hydroperoxide (GO:0006982)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	glutathione peroxidase activity (GO:0004602)|selenium binding (GO:0008430)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(3)|lung(1)|skin(1)	6		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Glutathione(DB00143)	CTTTGTCAACGTGGCCAGCTA	0.522																																							uc011dcm.1		NA																	0					0						c.(205-207)GTG>ATG		glutathione peroxidase 3 precursor	Glutathione(DB00143)						82.0	82.0	82.0					5																	150405018		1994	4179	6173	SO:0001583	missense	2878				hydrogen peroxide catabolic process|protein homotetramerization|response to lipid hydroperoxide	extracellular space	glutathione peroxidase activity|selenium binding|transcription factor binding	g.chr5:150405018G>A		CCDS43389.1	5q23	2012-03-01			ENSG00000211445	ENSG00000211445	1.11.1.9		4555	protein-coding gene	gene with protein product		138321				3619451, 8287691	Standard	NM_002084		Approved		uc021yga.1	P22352	OTTHUMG00000163693	ENST00000388825.4:c.205G>A	5.37:g.150405018G>A	ENSP00000373477:p.Val69Met					GPX3_uc003ltc.2_RNA|GPX3_uc003ltd.2_RNA	p.V69M	NM_002084	NP_002075	P22352	GPX3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	422	+		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	69					O43787|Q86W78|Q9NZ74|Q9UEL1	Missense_Mutation	SNP	ENST00000388825.4	37	c.205G>A	CCDS43389.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557254	0.86231	.	.	ENSG00000211445	ENST00000388825;ENST00000458211;ENST00000521650	T;T	0.16897	2.31;2.31	5.8	4.93	0.64822	Thioredoxin-like fold (2);	0.000000	0.64402	D	0.000002	T	0.58977	0.2160	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76369	-0.2984	10	0.87932	D	0	.	15.0675	0.72008	0.068:0.0:0.932:0.0	.	69	P22352	GPX3_HUMAN	M	69;69;78	ENSP00000373477:V69M;ENSP00000427873:V78M	ENSP00000373477:V69M	V	+	1	0	GPX3	150385211	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.825000	0.75293	1.451000	0.47736	0.655000	0.94253	GTG		0.522	GPX3-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000374772.1			4	71	0	0	0	0.009096	0	4	71				
LARP1	23367	broad.mit.edu	37	5	154188019	154188019	+	Splice_Site	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:154188019A>T	ENST00000336314.4	+	16	2492	c.2468A>T	c.(2467-2469)gAg>gTg	p.E823V		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	900					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTCCCATCAGAGCGGAAACGC	0.493																																							uc003lvp.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(2698-2700)GAG>GTG		la related protein isoform 2							74.0	73.0	73.0					5																	154188019		2203	4300	6503	SO:0001630	splice_region_variant	23367						protein binding|RNA binding	g.chr5:154188019A>T	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2468-1A>T	5.37:g.154188019A>T						LARP1_uc003lvo.2_Missense_Mutation_p.E823V	p.E900V	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		16	3128	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	900					O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	37	c.2699A>T	CCDS4328.1	.	.	.	.	.	.	.	.	.	.	A	34	5.375780	0.95923	.	.	ENSG00000155506	ENST00000336314	T	0.29397	1.57	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.63920	0.2552	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.987;0.991	T	0.71384	-0.4609	9	.	.	.	.	16.3668	0.83335	1.0:0.0:0.0:0.0	.	900;823	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	V	823	ENSP00000336721:E823V	.	E	+	2	0	LARP1	154168212	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.103000	0.94232	2.268000	0.75426	0.454000	0.30748	GAG		0.493	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	Missense_Mutation	23	34	0	0	0	0.014323	0	23	34				
CCNJL	79616	broad.mit.edu	37	5	159680645	159680645	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:159680645C>T	ENST00000393977.3	-	7	1333	c.1048G>A	c.(1048-1050)Gtg>Atg	p.V350M	CCNJL_ENST00000257536.7_Missense_Mutation_p.V302M|CCNJL_ENST00000377503.2_5'UTR	NM_024565.5	NP_078841.3	Q8IV13	CCNJL_HUMAN	cyclin J-like	350						nucleus (GO:0005634)				endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGTCCTGCACGGGGGTCTGG	0.677																																							uc003lyb.1		NA																	0					0						c.(1048-1050)GTG>ATG		cyclin J-like							40.0	47.0	44.0					5																	159680645		2009	4153	6162	SO:0001583	missense	79616					nucleus		g.chr5:159680645C>T	BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000393977.3:c.1048G>A	5.37:g.159680645C>T	ENSP00000377547:p.Val350Met					CCNJL_uc011dee.1_Missense_Mutation_p.V302M|CCNJL_uc003lyc.1_RNA	p.V350M	NM_024565	NP_078841	Q8IV13	CCNJL_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		7	1300	-	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	350					Q6ZN43|Q9H7W8	Missense_Mutation	SNP	ENST00000393977.3	37	c.1048G>A	CCDS4350.2	.	.	.	.	.	.	.	.	.	.	C	11.00	1.510972	0.27036	.	.	ENSG00000135083	ENST00000393977;ENST00000257536	T;T	0.36157	1.68;1.27	5.2	3.4	0.38934	.	0.473189	0.22795	N	0.055546	T	0.23210	0.0561	L	0.46157	1.445	0.80722	D	1	B;P	0.37525	0.181;0.598	B;B	0.27887	0.069;0.084	T	0.04090	-1.0978	10	0.32370	T	0.25	-18.2105	5.7144	0.17952	0.1575:0.6786:0.0:0.1639	.	302;350	B4DZA8;Q8IV13	.;CCNJL_HUMAN	M	350;302	ENSP00000377547:V350M;ENSP00000257536:V302M	ENSP00000257536:V302M	V	-	1	0	CCNJL	159613223	0.999000	0.42202	0.183000	0.23137	0.485000	0.33311	2.930000	0.48924	0.569000	0.29329	-0.136000	0.14681	GTG		0.677	CCNJL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252674.1	NM_024565		28	33	0	0	0	0.00632	0	28	33				
GABRA6	2559	broad.mit.edu	37	5	161128640	161128640	+	Missense_Mutation	SNP	C	C	G	rs375047095		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:161128640C>G	ENST00000274545.5	+	9	1656	c.1223C>G	c.(1222-1224)tCg>tGg	p.S408W	GABRA6_ENST00000523217.1_Missense_Mutation_p.S398W			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	408				S -> P (in Ref. 1; AAB36480). {ECO:0000305}.	gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CCACCACTCTCGCCAGCCTTT	0.468										TCGA Ovarian(5;0.080)																													uc003lyu.2		NA																	0				ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(1222-1224)TCG>TGG		gamma-aminobutyric acid A receptor, alpha 6	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						110.0	103.0	106.0					5																	161128640		2203	4300	6503	SO:0001583	missense	2559				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	g.chr5:161128640C>G		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1223C>G	5.37:g.161128640C>G	ENSP00000274545:p.Ser408Trp	TCGA Ovarian(5;0.080)				GABRA6_uc003lyv.2_Missense_Mutation_p.S179W	p.S408W	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		9	1561	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	408	S -> P (in Ref. 1; AAB36480).		Cytoplasmic (Probable).		A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	c.1223C>G	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	C	9.717	1.158576	0.21454	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.84370	-1.84;-1.84	5.16	2.17	0.27698	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.833312	0.10917	N	0.619919	T	0.79969	0.4538	L	0.39898	1.24	0.09310	N	1	P	0.44578	0.838	B	0.42995	0.404	T	0.69131	-0.5226	10	0.87932	D	0	.	8.0502	0.30572	0.0:0.7341:0.1372:0.1287	.	408	Q16445	GBRA6_HUMAN	W	408;398	ENSP00000274545:S408W;ENSP00000430527:S398W	ENSP00000274545:S408W	S	+	2	0	GABRA6	161061218	0.947000	0.32204	0.005000	0.12908	0.178000	0.23041	1.171000	0.31896	0.663000	0.31027	0.655000	0.94253	TCG		0.468	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2			33	46	0	0	0	0.009535	0	33	46				
EIF4E1B	253314	broad.mit.edu	37	5	176070182	176070182	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:176070182C>A	ENST00000318682.6	+	4	699	c.115C>A	c.(115-117)Ccc>Acc	p.P39T	EIF4E1B_ENST00000504597.1_Missense_Mutation_p.P39T	NM_001099408.1	NP_001092878.1	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E family member 1B	39					regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)			breast(1)|large_intestine(1)|lung(2)|pancreas(1)	5	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCAAACTCTCCCAGGACTTT	0.612																																							uc010jkf.1		NA																	0					0						c.(115-117)CCC>ACC		eukaryotic translation initiation factor 4E							47.0	58.0	54.0					5																	176070182		1933	4137	6070	SO:0001583	missense	253314				regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity	g.chr5:176070182C>A		CCDS47345.1	5q35.2	2008-06-12			ENSG00000175766	ENSG00000175766			33179	protein-coding gene	gene with protein product						16191198	Standard	NM_001099408		Approved	FLJ36951	uc010jkf.1	A6NMX2	OTTHUMG00000163227	ENST00000318682.6:c.115C>A	5.37:g.176070182C>A	ENSP00000323714:p.Pro39Thr						p.P39T	NM_001099408	NP_001092878	A6NMX2	I4E1B_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		4	699	+	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	39						Missense_Mutation	SNP	ENST00000318682.6	37	c.115C>A	CCDS47345.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.420105	0.25552	.	.	ENSG00000175766	ENST00000318682;ENST00000510660;ENST00000504597	T;T	0.43688	0.94;0.94	4.11	3.22	0.36961	Translation Initiation factor eIF- 4e-like  domain (1);	.	.	.	.	T	0.25306	0.0615	N	0.24115	0.695	0.09310	N	1	B	0.33694	0.421	B	0.27500	0.08	T	0.08743	-1.0707	9	0.24483	T	0.36	.	9.658	0.39939	0.209:0.791:0.0:0.0	.	39	A6NMX2	I4E1B_HUMAN	T	39	ENSP00000323714:P39T;ENSP00000427633:P39T	ENSP00000323714:P39T	P	+	1	0	EIF4E1B	176002788	0.003000	0.15002	0.002000	0.10522	0.029000	0.11900	0.434000	0.21494	1.023000	0.39654	0.561000	0.74099	CCC		0.612	EIF4E1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372187.1	NM_001099408		14	37	1	0	0.000219431	0.00245	0.000236311	14	37				
EIF4E1B	253314	broad.mit.edu	37	5	176072502	176072502	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:176072502G>T	ENST00000318682.6	+	8	1183	c.599G>T	c.(598-600)gGc>gTc	p.G200V	TSPAN17_ENST00000310032.8_5'Flank|EIF4E1B_ENST00000512734.1_3'UTR|TSPAN17_ENST00000508164.1_5'Flank|TSPAN17_ENST00000503045.1_5'Flank|TSPAN17_ENST00000515708.1_5'Flank|TSPAN17_ENST00000298564.10_5'Flank|EIF4E1B_ENST00000504597.1_Missense_Mutation_p.G200V|TSPAN17_ENST00000405525.2_5'Flank	NM_001099408.1	NP_001092878.1	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E family member 1B	200					regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)			breast(1)|large_intestine(1)|lung(2)|pancreas(1)	5	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AACCAGGCGGGCGTGCTGCAC	0.627																																							uc010jkf.1		NA																	0					0						c.(598-600)GGC>GTC		eukaryotic translation initiation factor 4E							54.0	70.0	65.0					5																	176072502		2167	4244	6411	SO:0001583	missense	253314				regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity	g.chr5:176072502G>T		CCDS47345.1	5q35.2	2008-06-12			ENSG00000175766	ENSG00000175766			33179	protein-coding gene	gene with protein product						16191198	Standard	NM_001099408		Approved	FLJ36951	uc010jkf.1	A6NMX2	OTTHUMG00000163227	ENST00000318682.6:c.599G>T	5.37:g.176072502G>T	ENSP00000323714:p.Gly200Val					TSPAN17_uc003mes.3_5'Flank|TSPAN17_uc003met.2_5'Flank|TSPAN17_uc003meu.2_5'Flank|TSPAN17_uc003mev.2_5'Flank|TSPAN17_uc003mew.2_5'Flank	p.G200V	NM_001099408	NP_001092878	A6NMX2	I4E1B_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		8	1183	+	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	200						Missense_Mutation	SNP	ENST00000318682.6	37	c.599G>T	CCDS47345.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838340	0.32513	.	.	ENSG00000175766	ENST00000318682;ENST00000504597;ENST00000505497	T;T	0.39229	1.09;1.09	5.03	3.09	0.35607	Translation Initiation factor eIF- 4e-like  domain (2);	0.609966	0.15979	N	0.235408	T	0.41259	0.1151	N	0.21324	0.655	0.20074	N	0.999933	P	0.41569	0.755	P	0.48770	0.589	T	0.36817	-0.9732	10	0.42905	T	0.14	.	16.4281	0.83831	0.0:0.3879:0.6121:0.0	.	200	A6NMX2	I4E1B_HUMAN	V	200;200;128	ENSP00000323714:G200V;ENSP00000427633:G200V	ENSP00000323714:G200V	G	+	2	0	EIF4E1B	176005108	0.991000	0.36638	0.301000	0.25044	0.216000	0.24613	3.133000	0.50531	1.112000	0.41740	-0.502000	0.04539	GGC		0.627	EIF4E1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372187.1	NM_001099408		12	16	1	0	2.27111e-07	0.013537	2.61659e-07	12	16				
UNC5A	90249	broad.mit.edu	37	5	176295796	176295796	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:176295796C>A	ENST00000329542.4	+	5	826	c.552C>A	c.(550-552)ctC>ctA	p.L184L	UNC5A_ENST00000261961.3_Silent_p.L144L	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	184	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGAGTGGCTCCGGAACGAGG	0.682																																							uc003mey.2		NA																	0				skin(1)	1						c.(550-552)CTC>CTA		netrin receptor Unc5h1 precursor							68.0	57.0	60.0					5																	176295796		2202	4300	6502	SO:0001819	synonymous_variant	90249				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane		g.chr5:176295796C>A	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.552C>A	5.37:g.176295796C>A						UNC5A_uc003mex.1_Silent_p.L184L|UNC5A_uc010jkg.1_Silent_p.L144L	p.L184L	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		5	744	+	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	184			Ig-like C2-type.|Extracellular (Potential).		B2RXE6|Q8TF26|Q96GP4	Silent	SNP	ENST00000329542.4	37	c.552C>A	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	C	9.519	1.107699	0.20714	.	.	ENSG00000113763	ENST00000509580	.	.	.	4.52	-2.95	0.05564	.	.	.	.	.	T	0.42381	0.1200	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31586	-0.9938	4	.	.	.	-28.8936	4.2804	0.10829	0.1828:0.1916:0.4849:0.1407	.	.	.	.	T	150	.	.	P	+	1	0	UNC5A	176228402	1.000000	0.71417	0.444000	0.26895	0.919000	0.55068	0.738000	0.26158	-0.649000	0.05430	0.561000	0.74099	CCG		0.682	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300		11	36	1	0	9.31168e-06	0.001855	1.03913e-05	11	36				
PHYKPL	85007	broad.mit.edu	37	5	177642304	177642304	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:177642304A>G	ENST00000308158.5	-	9	1289	c.1055T>C	c.(1054-1056)aTc>aCc	p.I352T	PHYKPL_ENST00000481811.1_5'UTR	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	352						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	GGGATGTTTGATTTTTTGCTG	0.577																																							uc003miz.2		NA																	0				pancreas(1)	1						c.(1054-1056)ATC>ACC		alanine-glyoxylate aminotransferase 2-like 2	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)						46.0	41.0	42.0					5																	177642304		2203	4300	6503	SO:0001583	missense	85007					mitochondrion	pyridoxal phosphate binding|transaminase activity	g.chr5:177642304A>G	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1055T>C	5.37:g.177642304A>G	ENSP00000310978:p.Ile352Thr					AGXT2L2_uc003miy.2_Missense_Mutation_p.I77T|AGXT2L2_uc003mjc.2_Missense_Mutation_p.I311T|AGXT2L2_uc003mja.2_RNA|AGXT2L2_uc003mjb.2_Missense_Mutation_p.I77T|AGXT2L2_uc003mjd.1_Missense_Mutation_p.I210T	p.I352T	NM_153373	NP_699204	Q8IUZ5	AT2L2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.181)|all cancers(165;0.235)	9	1307	-	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	352					A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	ENST00000308158.5	37	c.1055T>C	CCDS4434.1	.	.	.	.	.	.	.	.	.	.	A	4.117	0.019819	0.08006	.	.	ENSG00000175309	ENST00000308158	D	0.85171	-1.95	5.3	-1.63	0.08345	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	1.281430	0.04937	N	0.457883	T	0.55433	0.1920	N	0.00554	-1.385	0.18873	N	0.999982	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.49560	-0.8927	10	0.33141	T	0.24	-4.3421	2.1317	0.03752	0.1615:0.1221:0.2209:0.4955	.	352;352	A8K7P6;Q8IUZ5	.;AT2L2_HUMAN	T	352	ENSP00000310978:I352T	ENSP00000310978:I352T	I	-	2	0	AGXT2L2	177574910	0.000000	0.05858	0.996000	0.52242	0.465000	0.32709	-0.223000	0.09177	-0.061000	0.13110	-1.288000	0.01363	ATC		0.577	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921		7	31	0	0	0	0.001984	0	7	31				
NEDD9	4739	broad.mit.edu	37	6	11190595	11190595	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:11190595T>A	ENST00000379446.5	-	5	1673	c.1507A>T	c.(1507-1509)Agc>Tgc	p.S503C	NEDD9_ENST00000504387.1_Missense_Mutation_p.S503C|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	503					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			AAGTCATGGCTGGTTTGACTC	0.517																																							uc003mzv.2		NA																	0					0						c.(1507-1509)AGC>TGC		neural precursor cell expressed, developmentally							115.0	110.0	111.0					6																	11190595		2203	4300	6503	SO:0001583	missense	4739				actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding	g.chr6:11190595T>A	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.1507A>T	6.37:g.11190595T>A	ENSP00000368759:p.Ser503Cys					NEDD9_uc010joz.2_Missense_Mutation_p.S503C|NEDD9_uc003mzw.3_Missense_Mutation_p.S357C	p.S503C	NM_006403	NP_006394	Q14511	CASL_HUMAN	Epithelial(50;0.0647)|all cancers(50;0.179)		5	1674	-	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	503					A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	ENST00000379446.5	37	c.1507A>T	CCDS4520.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.967550	0.53507	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.25579	1.79;1.79	5.67	5.67	0.87782	Serine rich protein interaction (1);	0.171571	0.64402	D	0.000004	T	0.14700	0.0355	L	0.45137	1.4	0.80722	D	1	P;P;P	0.43885	0.704;0.552;0.82	B;B;B	0.43728	0.387;0.32;0.429	T	0.02567	-1.1140	10	0.38643	T	0.18	-28.3906	11.0626	0.47957	0.1384:0.0:0.0:0.8616	.	503;503;503	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	C	503	ENSP00000368759:S503C;ENSP00000422871:S503C	ENSP00000368759:S503C	S	-	1	0	NEDD9	11298581	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.374000	0.44274	2.164000	0.68074	0.533000	0.62120	AGC		0.517	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403		16	59	0	0	0	0.003163	0	16	59				
NUP153	9972	broad.mit.edu	37	6	17688669	17688669	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:17688669C>T	ENST00000262077.2	-	2	291	c.292G>A	c.(292-294)Gat>Aat	p.D98N	NUP153_ENST00000537253.1_Missense_Mutation_p.D98N	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	98					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			ATTCTCCCATCAGTAATATTA	0.413																																							uc003ncd.1		NA																	0				lung(4)|ovary(2)|breast(2)|skin(1)	9						c.(292-294)GAT>AAT		nucleoporin 153kDa							112.0	104.0	107.0					6																	17688669		2203	4300	6503	SO:0001583	missense	9972				carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding	g.chr6:17688669C>T	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.292G>A	6.37:g.17688669C>T	ENSP00000262077:p.Asp98Asn					NUP153_uc011dje.1_Missense_Mutation_p.D98N|NUP153_uc010jpl.1_Missense_Mutation_p.D98N	p.D98N	NM_005124	NP_005115	P49790	NU153_HUMAN	all cancers(50;0.0981)|Epithelial(50;0.112)		2	492	-	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	98					B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	c.292G>A	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025810	0.75390	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.11930	2.73;2.77	5.37	5.37	0.77165	.	0.000000	0.51477	D	0.000090	T	0.24275	0.0588	L	0.54323	1.7	0.50813	D	0.999894	D;D;P	0.89917	0.999;1.0;0.834	D;D;B	0.71656	0.974;0.972;0.33	T	0.00510	-1.1697	10	0.52906	T	0.07	-14.2853	16.8895	0.86083	0.0:1.0:0.0:0.0	.	98;120;98	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	N	98;120;98	ENSP00000262077:D98N;ENSP00000444029:D98N	ENSP00000262077:D98N	D	-	1	0	NUP153	17796648	1.000000	0.71417	0.988000	0.46212	0.524000	0.34500	5.184000	0.65070	2.494000	0.84150	0.650000	0.86243	GAT		0.413	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1			25	41	0	0	0	0.003954	0	25	41				
FAM65B	9750	broad.mit.edu	37	6	24850828	24850828	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:24850828G>C	ENST00000259698.4	-	10	970	c.795C>G	c.(793-795)atC>atG	p.I265M	FAM65B_ENST00000378023.4_Missense_Mutation_p.I265M|FAM65B_ENST00000510784.2_Missense_Mutation_p.I299M|FAM65B_ENST00000538035.1_Missense_Mutation_p.I294M|FAM65B_ENST00000540914.1_Missense_Mutation_p.I265M	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	265					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						ACTGTACCTTGATGGAGATGA	0.512																																							uc003neo.1		NA																	0				ovary(1)	1						c.(793-795)ATC>ATG		hypothetical protein LOC9750 isoform 1							125.0	134.0	131.0					6																	24850828		2038	4191	6229	SO:0001583	missense	9750				cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding	g.chr6:24850828G>C	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.795C>G	6.37:g.24850828G>C	ENSP00000259698:p.Ile265Met					FAM65B_uc011djs.1_Missense_Mutation_p.I294M|FAM65B_uc011dju.1_Missense_Mutation_p.I299M|FAM65B_uc003nep.2_Missense_Mutation_p.I265M|FAM65B_uc011djt.1_Missense_Mutation_p.I265M	p.I265M	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN			10	971	-			265					A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	c.795C>G	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163755	0.57476	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45	5.34	3.44	0.39384	.	0.000000	0.85682	D	0.000000	T	0.09949	0.0244	M	0.69463	2.115	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.02391	-1.1166	10	0.87932	D	0	-31.4088	3.6919	0.08350	0.3553:0.0:0.4722:0.1725	.	299;294;265;265	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	M	265;294;265;265;299	ENSP00000259698:I265M;ENSP00000441138:I294M;ENSP00000367262:I265M;ENSP00000438425:I265M;ENSP00000441305:I299M	ENSP00000259698:I265M	I	-	3	3	FAM65B	24958807	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.435000	0.44811	1.293000	0.44690	0.555000	0.69702	ATC		0.512	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			15	40	0	0	0	0.00245	0	15	40				
HIST1H2BC	8347	broad.mit.edu	37	6	26123920	26123920	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:26123920A>C	ENST00000314332.5	-	1	218	c.213T>G	c.(211-213)ttT>ttG	p.F71L	HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.F71L			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	71					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						CGATGCGCTCAAATATGTCGT	0.572																																							uc003ngk.3		NA																	0				ovary(1)	1						c.(211-213)TTT>TTG		histone cluster 1, H2bc							133.0	129.0	130.0					6																	26123920		2203	4300	6503	SO:0001583	missense	8347				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26123920A>C	Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.213T>G	6.37:g.26123920A>C	ENSP00000321744:p.Phe71Leu					HIST1H2BC_uc003ngl.2_Missense_Mutation_p.F71L|HIST1H2AC_uc003ngm.2_5'Flank|HIST1H2AC_uc003ngn.2_5'Flank|HIST1H2AC_uc003ngo.2_5'Flank|HIST1H2AC_uc003ngp.2_5'Flank	p.F71L	NM_003526	NP_003517	P62807	H2B1C_HUMAN			1	235	-			71					P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000314332.5	37	c.213T>G	CCDS4584.1	.	.	.	.	.	.	.	.	.	.	.	18.85	3.711439	0.68730	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.63744	-0.06;-0.06	5.61	3.75	0.43078	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.44138	0.1279	.	.	.	0.31623	N	0.650069	P	0.38863	0.65	B	0.42798	0.398	T	0.42103	-0.9471	8	0.66056	D	0.02	.	9.2973	0.37824	0.2246:0.0:0.7754:0.0	.	71	P62807	H2B1C_HUMAN	L	71	ENSP00000321744:F71L;ENSP00000380180:F71L	ENSP00000321744:F71L	F	-	3	2	HIST1H2BC	26231899	1.000000	0.71417	1.000000	0.80357	0.373000	0.29922	1.467000	0.35321	0.812000	0.34326	-0.182000	0.12963	TTT		0.572	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526		70	100	0	0	0	0.01441	0	70	100				
HIST1H3E	8353	broad.mit.edu	37	6	26225469	26225469	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:26225469C>A	ENST00000360408.1	+	1	87	c.87C>A	c.(85-87)agC>agA	p.S29R		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	29					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				CTCGCAAGAGCGCTCCGGCCA	0.607																																							uc003nhb.2		NA																	0					0						c.(85-87)AGC>AGA		histone cluster 1, H3f							47.0	49.0	49.0					6																	26225469		2203	4300	6503	SO:0001583	missense	8353				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26225469C>A	M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.87C>A	6.37:g.26225469C>A	ENSP00000353581:p.Ser29Arg					HIST1H3E_uc003nhc.3_Missense_Mutation_p.S29R	p.S29R	NM_021018	NP_066298	P68431	H31_HUMAN			2	447	+		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)	29					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000360408.1	37	c.87C>A	CCDS4596.1	.	.	.	.	.	.	.	.	.	.	.	9.306	1.054452	0.19907	.	.	ENSG00000196966	ENST00000360408	T	0.45276	0.9	4.54	4.54	0.55810	.	.	.	.	.	T	0.52306	0.1726	.	.	.	0.36320	D	0.858178	.	.	.	.	.	.	T	0.59241	-0.7491	6	0.87932	D	0	.	16.8198	0.85743	0.0:1.0:0.0:0.0	.	.	.	.	R	29	ENSP00000353581:S29R	ENSP00000353581:S29R	S	+	3	2	HIST1H3E	26333448	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	3.038000	0.49783	2.541000	0.85698	0.491000	0.48974	AGC		0.607	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040097.1	NM_003532		17	71	1	0	3.45872e-05	0.004007	3.83196e-05	17	71				
OR2J2	26707	broad.mit.edu	37	6	29142013	29142013	+	Missense_Mutation	SNP	A	A	G	rs369758145		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:29142013A>G	ENST00000377167.2	+	1	703	c.601A>G	c.(601-603)Atg>Gtg	p.M201V		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						GCTGACCCTCATGGTCATGAG	0.483																																							uc011dlm.1		NA																	0					0						c.(601-603)ATG>GTG		olfactory receptor, family 2, subfamily J,		A	VAL/MET	1,3909		0,1,1954	157.0	135.0	142.0		601	-1.5	1.0	6		142	0,8310		0,0,4155	no	missense	OR2J2	NM_030905.2	21	0,1,6109	GG,GA,AA		0.0,0.0256,0.0082	benign	201/313	29142013	1,12219	1955	4155	6110	SO:0001583	missense	26707				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29142013A>G		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.601A>G	6.37:g.29142013A>G	ENSP00000366372:p.Met201Val						p.M201V	NM_030905	NP_112167	O76002	OR2J2_HUMAN			1	703	+			201			Helical; Name=5; (Potential).		A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	37	c.601A>G	CCDS43434.1	.	.	.	.	.	.	.	.	.	.	A	1.524	-0.546053	0.04024	2.56E-4	0.0	ENSG00000204700	ENST00000377167	T	0.00034	8.87	2.0	-1.52	0.08637	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.03891	-0.335	0.09310	N	1	B	0.22414	0.069	B	0.31016	0.123	T	0.20273	-1.0280	9	0.66056	D	0.02	.	2.3134	0.04192	0.43:0.2871:0.0:0.2829	.	201	O76002	OR2J2_HUMAN	V	201	ENSP00000366372:M201V	ENSP00000366372:M201V	M	+	1	0	OR2J2	29249992	0.000000	0.05858	0.994000	0.49952	0.241000	0.25554	-1.045000	0.03528	0.021000	0.15133	0.172000	0.16884	ATG		0.483	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2			13	119	0	0	0	0.010504	0	13	119				
MOG	4340	broad.mit.edu	37	6	29640726	29640726	+	IGR	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:29640726G>A	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376881.3_Missense_Mutation_p.H368Y|ZFP57_ENST00000376883.1_Missense_Mutation_p.H368Y|ZFP57_ENST00000488757.1_Missense_Mutation_p.H388Y	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						AAAGAACAATGGGGGCAACAG	0.517																																							uc011dlw.1		NA																	0				ovary(3)|skin(2)	5						c.(1162-1164)CAT>TAT		zinc finger protein 57 homolog							325.0	353.0	344.0					6																	29640726		1267	2556	3823	SO:0001628	intergenic_variant	346171				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding	g.chr6:29640726G>A		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640726G>A						ZFP57_uc003nnl.3_Missense_Mutation_p.H368Y	p.H388Y	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN			4	1313	-			304			C2H2-type 5.		A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	ENST00000376917.3	37	c.1162C>T	CCDS34370.1	.	.	.	.	.	.	.	.	.	.	G	0.590	-0.833240	0.02713	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.75050	-0.9;-0.9;-0.9	4.27	-0.955	0.10356	.	0.754799	0.11284	N	0.580014	T	0.35068	0.0919	L	0.35542	1.07	0.09310	N	1	B;B	0.21147	0.052;0.052	B;B	0.18263	0.021;0.012	T	0.27806	-1.0063	10	0.87932	D	0	-2.6001	0.2151	0.00161	0.281:0.1466:0.2737:0.2987	.	388;368	Q9NU63-3;Q9NU63-2	.;.	Y	388;368;368	ENSP00000418259:H388Y;ENSP00000366078:H368Y;ENSP00000366080:H368Y	ENSP00000366078:H368Y	H	-	1	0	ZFP57	29748705	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.046000	0.14035	-0.199000	0.10317	0.563000	0.77884	CAT		0.517	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		51	265	0	0	0	0.01441	0	51	265				
PHF1	5252	broad.mit.edu	37	6	33383646	33383646	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:33383646C>T	ENST00000374516.3	+	15	1746	c.1475C>T	c.(1474-1476)tCg>tTg	p.S492L	PHF1_ENST00000374512.3_Nonsense_Mutation_p.R457*|CUTA_ENST00000492510.1_5'Flank	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	492					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				GCCCCCCACTCGATGACTGCC	0.537																																							uc003oeh.2		NA																	0					0						c.(1474-1476)TCG>TTG		PHD finger protein 1 isoform b							138.0	121.0	127.0					6																	33383646		2203	4300	6503	SO:0001583	missense	5252				chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:33383646C>T	AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.1475C>T	6.37:g.33383646C>T	ENSP00000363640:p.Ser492Leu					PHF1_uc011drh.1_RNA|PHF1_uc003oei.2_Nonsense_Mutation_p.R457*|PHF1_uc010jux.2_Missense_Mutation_p.S292L	p.S492L	NM_024165	NP_077084	O43189	PHF1_HUMAN			15	1711	+		Ovarian(999;0.0443)	492					B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	ENST00000374516.3	37	c.1475C>T	CCDS4777.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.538143|5.538143	0.96460|0.96460	.|.	.|.	ENSG00000112511|ENSG00000112511	ENST00000374512|ENST00000374516;ENST00000427826	.|T	.|0.25250	.|1.81	4.36|4.36	4.36|4.36	0.52297|0.52297	.|.	.|0.158528	.|0.30151	.|N	.|0.010284	.|T	.|0.07683	.|0.0193	.|.	.|.	.|.	0.29391|0.29391	N|N	0.862643|0.862643	.|B	.|0.20261	.|0.043	.|B	.|0.15484	.|0.013	.|T	.|0.12889	.|-1.0530	.|9	0.02654|0.27082	T|T	1|0.32	-3.6673|-3.6673	12.6244|12.6244	0.56622|0.56622	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|492	.|O43189	.|PHF1_HUMAN	X|L	457|492;106	.|ENSP00000363640:S492L	ENSP00000363636:R457X|ENSP00000363640:S492L	R|S	+|+	1|2	2|0	PHF1|PHF1	33491624|33491624	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.150000|2.150000	0.42254|0.42254	2.446000|2.446000	0.82766|0.82766	0.655000|0.655000	0.94253|0.94253	CGA|TCG		0.537	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076175.3			66	87	0	0	0	0.01441	0	66	87				
ABCC10	89845	broad.mit.edu	37	6	43400666	43400666	+	Silent	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:43400666G>C	ENST00000372530.4	+	3	1163	c.948G>C	c.(946-948)ggG>ggC	p.G316G	ABCC10_ENST00000244533.3_Silent_p.G273G|ABCC10_ENST00000443426.2_Intron	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	316	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TGGAAGAGGGGCAGGAGCCAC	0.592																																							uc003ouy.1		NA																	0				ovary(6)|central_nervous_system(1)	7						c.(946-948)GGG>GGC		ATP-binding cassette, sub-family C, member 10							45.0	48.0	47.0					6																	43400666		2203	4300	6503	SO:0001819	synonymous_variant	89845					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr6:43400666G>C	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.948G>C	6.37:g.43400666G>C						ABCC10_uc003ouz.1_Silent_p.G273G|ABCC10_uc010jyo.1_5'Flank	p.G316G	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		3	1163	+	all_lung(25;0.00536)		316			ABC transmembrane type-1 1.		Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	37	c.948G>C	CCDS56430.1																																																																																				0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450		21	43	0	0	0	0.008871	0	21	43				
GCLC	2729	broad.mit.edu	37	6	53387311	53387311	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:53387311C>A	ENST00000229416.6	-	2	648	c.165G>T	c.(163-165)ttG>ttT	p.L55F	GCLC_ENST00000514004.1_Missense_Mutation_p.L55F	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	55			L -> S (in dbSNP:rs2066512).		apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	CAAAAGATACCAACATGTATT	0.403																																							uc003pbw.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(163-165)TTG>TTT		glutamate-cysteine ligase, catalytic subunit	L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)						71.0	70.0	71.0					6																	53387311		2203	4300	6503	SO:0001583	missense	2729				anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding	g.chr6:53387311C>A	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.165G>T	6.37:g.53387311C>A	ENSP00000229416:p.Leu55Phe					GCLC_uc003pbx.2_Missense_Mutation_p.L55F	p.L55F	NM_001498	NP_001489	P48506	GSH1_HUMAN			2	553	-	Lung NSC(77;0.0137)		55					Q14399	Missense_Mutation	SNP	ENST00000229416.6	37	c.165G>T	CCDS4952.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.36|19.36	3.813146|3.813146	0.70912|0.70912	.|.	.|.	ENSG00000001084|ENSG00000001084	ENST00000229416;ENST00000514004;ENST00000514933;ENST00000505197|ENST00000513939	T;T;T;T|.	0.76060|.	-0.74;-0.74;-0.99;-0.16|.	5.67|5.67	4.79|4.79	0.61399|0.61399	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75781|0.75781	0.3896|0.3896	M|M	0.89601|0.89601	3.045|3.045	0.58432|0.58432	D|D	0.999998|0.999998	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.79711|0.79711	-0.1689|-0.1689	10|5	0.72032|.	D|.	0.01|.	.|.	12.3676|12.3676	0.55236|0.55236	0.0:0.8667:0.0:0.1333|0.0:0.8667:0.0:0.1333	.|.	55|.	P48506|.	GSH1_HUMAN|.	F|L	55;55;2;2|43	ENSP00000229416:L55F;ENSP00000421908:L55F;ENSP00000423615:L2F;ENSP00000427403:L2F|.	ENSP00000229416:L55F|.	L|W	-|-	3|2	2|0	GCLC|GCLC	53495270|53495270	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.913000|1.913000	0.39956|0.39956	2.676000|2.676000	0.91093|0.91093	0.585000|0.585000	0.79938|0.79938	TTG|TGG		0.403	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2			3	35	1	0	0.004672	0.004672	0.0049056	3	35				
FAM83B	222584	broad.mit.edu	37	6	54805944	54805944	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:54805944C>G	ENST00000306858.7	+	5	2291	c.2175C>G	c.(2173-2175)acC>acG	p.T725T	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	725										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					AGGAAGTTACCAAGAGAAACT	0.393																																							uc003pck.2		NA																	0				ovary(6)	6						c.(2173-2175)ACC>ACG		hypothetical protein LOC222584							90.0	92.0	91.0					6																	54805944		2203	4300	6503	SO:0001819	synonymous_variant	222584							g.chr6:54805944C>G	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2175C>G	6.37:g.54805944C>G							p.T725T	NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN			5	2291	+	Lung NSC(77;0.0178)|Renal(3;0.122)		725					Q2M1P3|Q96DQ2	Silent	SNP	ENST00000306858.7	37	c.2175C>G	CCDS34479.1																																																																																				0.393	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		22	42	0	0	0	0.00278	0	22	42				
BAI3	577	broad.mit.edu	37	6	70071320	70071320	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:70071320G>C	ENST00000370598.1	+	29	4976	c.4155G>C	c.(4153-4155)aaG>aaC	p.K1385N	BAI3_ENST00000238918.8_Missense_Mutation_p.K591N|BAI3_ENST00000546190.1_Missense_Mutation_p.K349N	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1385					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CAGCTGTGAAGAATTTCATGG	0.438																																							uc003pev.3		NA																	0				lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(4153-4155)AAG>AAC		brain-specific angiogenesis inhibitor 3							107.0	113.0	111.0					6																	70071320		2203	4300	6503	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:70071320G>C	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4155G>C	6.37:g.70071320G>C	ENSP00000359630:p.Lys1385Asn					BAI3_uc010kak.2_Missense_Mutation_p.K1385N|BAI3_uc011dxx.1_Missense_Mutation_p.K591N	p.K1385N	NM_001704	NP_001695	O60242	BAI3_HUMAN			29	4603	+		all_lung(197;0.212)	1385			Cytoplasmic (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.4155G>C	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255861	0.39896	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.07567	3.18;3.18;3.18	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.16896	0.0406	L	0.51422	1.61	0.58432	D	0.999992	D;B	0.57899	0.981;0.058	D;B	0.69824	0.966;0.046	T	0.01004	-1.1484	10	0.32370	T	0.25	.	20.1141	0.97919	0.0:0.0:1.0:0.0	.	591;1385	B7Z356;O60242	.;BAI3_HUMAN	N	1385;591;349	ENSP00000359630:K1385N;ENSP00000238918:K591N;ENSP00000441821:K349N	ENSP00000238918:K591N	K	+	3	2	BAI3	70128041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.447000	0.66606	2.766000	0.95052	0.650000	0.86243	AAG		0.438	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			10	74	0	0	0	0.006214	0	10	74				
BCKDHB	594	broad.mit.edu	37	6	80816606	80816606	+	Splice_Site	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:80816606G>C	ENST00000320393.6	+	1	243	c.196G>C	c.(196-198)Ggg>Cgg	p.G66R	BCKDHB_ENST00000545529.1_Splice_Site_p.G66R|BCKDHB_ENST00000369760.4_Splice_Site_p.G66R|BCKDHB_ENST00000356489.5_Splice_Site_p.G66R	NM_183050.2	NP_898871.1	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1, beta polypeptide	66					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(1)	15		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		CCGGGAGTACGGTGAGCCCTG	0.701																																							uc003pjd.2		NA																	0					0						c.(196-198)GGG>CGG		branched chain keto acid dehydrogenase E1 beta							7.0	8.0	8.0					6																	80816606		2170	4252	6422	SO:0001630	splice_region_variant	594				branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding	g.chr6:80816606G>C	M55575	CCDS4994.1	6q14.1	2008-07-31	2008-07-31		ENSG00000083123	ENSG00000083123			987	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	248611					Standard	NM_183050		Approved		uc003pje.2	P21953	OTTHUMG00000016430	ENST00000320393.6:c.196+1G>C	6.37:g.80816606G>C						BCKDHB_uc003pje.2_Missense_Mutation_p.G66R	p.G66R	NM_000056	NP_000047	P21953	ODBB_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0291)	1	263	+		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)	66					Q5T2J3|Q9BQL0	Missense_Mutation	SNP	ENST00000320393.6	37	c.196G>C	CCDS4994.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166830	0.38217	.	.	ENSG00000083123	ENST00000369760;ENST00000320393;ENST00000356489;ENST00000545529	D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83	5.04	5.04	0.67666	.	0.045076	0.85682	D	0.000000	D	0.84302	0.5442	M	0.70595	2.14	0.80722	D	1	P	0.37141	0.584	B	0.28385	0.089	D	0.86142	0.1582	10	0.49607	T	0.09	-14.3751	14.0823	0.64932	0.0:0.0:1.0:0.0	.	66	P21953	ODBB_HUMAN	R	66	ENSP00000358775:G66R;ENSP00000318351:G66R;ENSP00000348880:G66R;ENSP00000443564:G66R	ENSP00000318351:G66R	G	+	1	0	BCKDHB	80873325	1.000000	0.71417	0.996000	0.52242	0.004000	0.04260	4.055000	0.57441	2.787000	0.95880	0.508000	0.49915	GGG		0.701	BCKDHB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043911.2	NM_000056	Missense_Mutation	3	5	0	0	0	0.004672	0	3	5				
HACE1	57531	broad.mit.edu	37	6	105233031	105233031	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:105233031G>A	ENST00000262903.4	-	12	1514	c.1238C>T	c.(1237-1239)cCt>cTt	p.P413L	HACE1_ENST00000517995.1_5'Flank|HACE1_ENST00000369125.2_Missense_Mutation_p.P413L	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	413					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		ATAGCTCCCAGGTCCTGGAGG	0.433																																							uc003pqu.1		NA																	0				ovary(5)|lung(2)	7						c.(1237-1239)CCT>CTT		HECT domain and ankyrin repeat containing, E3							111.0	104.0	106.0					6																	105233031		2203	4300	6503	SO:0001583	missense	57531				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity	g.chr6:105233031G>A	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.1238C>T	6.37:g.105233031G>A	ENSP00000262903:p.Pro413Leu					HACE1_uc010kcy.1_5'UTR|HACE1_uc010kcz.1_Missense_Mutation_p.P413L|HACE1_uc010kcx.1_5'UTR|HACE1_uc003pqt.1_Missense_Mutation_p.P66L	p.P413L	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)	12	1515	-		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)	413					A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	c.1238C>T	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.488545	0.44249	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.35789	1.29;1.3	4.27	4.27	0.50696	.	0.495245	0.21994	N	0.066115	T	0.10551	0.0258	N	0.08118	0	0.41986	D	0.990823	B;B;B	0.13594	0.008;0.004;0.001	B;B;B	0.10450	0.005;0.002;0.004	T	0.05194	-1.0900	10	0.48119	T	0.1	.	13.0587	0.58996	0.0:0.1617:0.8383:0.0	.	413;413;66	E9PGP0;Q8IYU2;Q8IYU2-3	.;HACE1_HUMAN;.	L	413	ENSP00000262903:P413L;ENSP00000358121:P413L	ENSP00000262903:P413L	P	-	2	0	HACE1	105339724	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.783000	0.47766	2.375000	0.81037	0.460000	0.39030	CCT		0.433	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095		15	31	0	0	0	0.003163	0	15	31				
ATG5	9474	broad.mit.edu	37	6	106727555	106727555	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:106727555G>A	ENST00000369076.3	-	5	782	c.459C>T	c.(457-459)ctC>ctT	p.L153L	ATG5_ENST00000369070.1_Silent_p.L75L|ATG5_ENST00000343245.3_Silent_p.L153L|ATG5_ENST00000360666.4_Intron	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	153					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		ATCCCATCCAGAGTTGCTTGT	0.303																																							uc003prf.2		NA																	0				large_intestine(1)	1						c.(457-459)CTC>CTT		APG5 autophagy 5-like							103.0	96.0	98.0					6																	106727555		2203	4300	6503	SO:0001819	synonymous_variant	9474				apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding	g.chr6:106727555G>A	Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.459C>T	6.37:g.106727555G>A						ATG5_uc010kdb.2_Silent_p.L153L|ATG5_uc003prg.2_Silent_p.L75L|ATG5_uc010kdc.2_Intron	p.L153L	NM_004849	NP_004840	Q9H1Y0	ATG5_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)	5	812	-	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	153					O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Silent	SNP	ENST00000369076.3	37	c.459C>T	CCDS5055.1																																																																																				0.303	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043476.1	NM_004849		7	29	0	0	0	0.00308	0	7	29				
TAAR6	319100	broad.mit.edu	37	6	132891745	132891745	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:132891745G>T	ENST00000275198.1	+	1	285	c.285G>T	c.(283-285)gaG>gaT	p.E95D		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	95					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		GGACGGTGGAGAGCTGCTGGT	0.502																																							uc011eck.1		NA																	0				ovary(2)|skin(1)	3						c.(283-285)GAG>GAT		trace amine associated receptor 6							186.0	170.0	175.0					6																	132891745		2203	4300	6503	SO:0001583	missense	319100					plasma membrane	G-protein coupled receptor activity	g.chr6:132891745G>T	AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.285G>T	6.37:g.132891745G>T	ENSP00000275198:p.Glu95Asp						p.E95D	NM_175067	NP_778237	Q96RI8	TAAR6_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)	1	285	+	Breast(56;0.112)		95			Extracellular (Potential).		Q5VUQ4	Missense_Mutation	SNP	ENST00000275198.1	37	c.285G>T	CCDS5155.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.253394	0.59212	.	.	ENSG00000146383	ENST00000275198;ENST00000539228	T	0.37235	1.21	4.99	4.12	0.48240	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000090	T	0.18173	0.0436	M	0.67953	2.075	0.25403	N	0.988429	B	0.17465	0.022	B	0.24006	0.05	T	0.19095	-1.0316	10	0.56958	D	0.05	-13.4846	6.6417	0.22913	0.1514:0.1527:0.6959:0.0	.	95	Q96RI8	TAAR6_HUMAN	D	95;78	ENSP00000275198:E95D	ENSP00000275198:E95D	E	+	3	2	TAAR6	132933438	0.168000	0.22989	1.000000	0.80357	0.924000	0.55760	0.494000	0.22467	1.305000	0.44909	0.563000	0.77884	GAG		0.502	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042255.1	NM_175067		32	93	1	0	1.74807e-11	0.010818	2.14789e-11	32	93				
SYNE1	23345	broad.mit.edu	37	6	152738009	152738009	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:152738009C>A	ENST00000367255.5	-	41	6164	c.5563G>T	c.(5563-5565)Gag>Tag	p.E1855*	SYNE1_ENST00000423061.1_Nonsense_Mutation_p.E1862*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.E1892*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.E1862*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.E1855*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1855					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGCTGGCCTCCTCAAACAGC	0.602										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(5563-5565)GAG>TAG		spectrin repeat containing, nuclear envelope 1							74.0	74.0	74.0					6																	152738009		2203	4300	6503	SO:0001587	stop_gained	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152738009C>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5563G>T	6.37:g.152738009C>A	ENSP00000356224:p.Glu1855*	HNSCC(10;0.0054)				SYNE1_uc003qot.3_Nonsense_Mutation_p.E1862*|SYNE1_uc003qou.3_Nonsense_Mutation_p.E1855*|SYNE1_uc010kjb.1_Nonsense_Mutation_p.E1838*	p.E1855*	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	41	6165	-		Ovarian(120;0.0955)	1855			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	c.5563G>T	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	51	17.481802	0.99887	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.	.	.	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	1855;1862;1855;1862;1892	.	ENSP00000265368:E1855X	E	-	1	0	SYNE1	152779702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.591000	0.82666	2.937000	0.99478	0.650000	0.86243	GAG		0.602	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		9	60	1	0	1.76689e-08	0.006214	2.06659e-08	9	60				
IGF2R	3482	broad.mit.edu	37	6	160430048	160430048	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:160430048C>G	ENST00000356956.1	+	3	444	c.296C>G	c.(295-297)tCt>tGt	p.S99C	AIRN_ENST00000609176.1_RNA|AIRN_ENST00000601203.1_RNA	NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	99					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	ATAGGTGACTCTGTTTTGAGA	0.403																																							uc003qta.2		NA																	0				ovary(3)	3						c.(295-297)TCT>TGT		insulin-like growth factor 2 receptor precursor							119.0	116.0	117.0					6																	160430048		2203	4300	6503	SO:0001583	missense	3482				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity	g.chr6:160430048C>G	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.296C>G	6.37:g.160430048C>G	ENSP00000349437:p.Ser99Cys						p.S99C	NM_000876	NP_000867	P11717	MPRI_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	3	444	+		Breast(66;0.000777)|Ovarian(120;0.0305)	99			1.|Lumenal (Potential).		Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	c.296C>G	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	C	9.917	1.211065	0.22289	.	.	ENSG00000197081	ENST00000356956	T	0.32023	1.47	5.49	1.74	0.24563	Mannose-6-phosphate receptor, binding (1);	0.554792	0.20309	N	0.094866	T	0.20618	0.0496	M	0.67397	2.05	0.09310	N	0.999992	D	0.64830	0.994	P	0.51385	0.668	T	0.06481	-1.0824	10	0.44086	T	0.13	-22.2019	6.6666	0.23044	0.126:0.6652:0.0:0.2088	.	99	P11717	MPRI_HUMAN	C	99	ENSP00000349437:S99C	ENSP00000349437:S99C	S	+	2	0	IGF2R	160350038	0.338000	0.24775	0.042000	0.18584	0.002000	0.02628	0.741000	0.26202	0.091000	0.17302	-0.152000	0.13540	TCT		0.403	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876		20	53	0	0	0	0.010504	0	20	53				
PLG	5340	broad.mit.edu	37	6	161139345	161139345	+	Silent	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:161139345T>A	ENST00000308192.9	+	8	870	c.807T>A	c.(805-807)tcT>tcA	p.S269S		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	269					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CACCATCTTCTGGTCCCACCT	0.502																																							uc003qtm.3		NA																	0				skin(3)|ovary(1)	4						c.(805-807)TCT>TCA		plasminogen	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)						110.0	100.0	104.0					6																	161139345		2203	4300	6503	SO:0001819	synonymous_variant	5340				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity	g.chr6:161139345T>A	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.807T>A	6.37:g.161139345T>A							p.S269S	NM_000301	NP_000292	P00747	PLMN_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	8	870	+			269					Q15146|Q5TEH4|Q6PA00	Silent	SNP	ENST00000308192.9	37	c.807T>A	CCDS5279.1																																																																																				0.502	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301		27	52	0	0	0	0.005443	0	27	52				
AGPAT4	56895	broad.mit.edu	37	6	161567608	161567608	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr6:161567608G>C	ENST00000320285.4	-	7	1003	c.791C>G	c.(790-792)cCt>cGt	p.P264R	AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000457520.2_Missense_Mutation_p.P102R|AGPAT4_ENST00000366911.5_3'UTR	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	264					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		ATCGTCTTCAGGGATGTCTTC	0.587																																							uc003qtr.1		NA																	0					0						c.(790-792)CCT>CGT		1-acylglycerol-3-phosphate O-acyltransferase 4							123.0	101.0	108.0					6																	161567608		2203	4300	6503	SO:0001583	missense	56895				phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding	g.chr6:161567608G>C	AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.791C>G	6.37:g.161567608G>C	ENSP00000314036:p.Pro264Arg					AGPAT4_uc003qts.1_Missense_Mutation_p.P124R|AGPAT4_uc011egb.1_Missense_Mutation_p.P102R	p.P264R	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)	7	1018	-		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)	264					B4DSF9|Q5TEF0	Missense_Mutation	SNP	ENST00000320285.4	37	c.791C>G	CCDS5280.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.83|18.83	3.707808|3.707808	0.68615|0.68615	.|.	.|.	ENSG00000026652|ENSG00000026652	ENST00000437165|ENST00000320285;ENST00000457520	.|D	.|0.92699	.|-3.09	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95934|0.95934	0.8676|0.8676	M|M	0.84948|0.84948	2.725|2.725	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.87578	.|0.976;0.998	D|D	0.96461|0.96461	0.9341|0.9341	5|10	.|0.87932	.|D	.|0	-9.4473|-9.4473	16.0633|16.0633	0.80853|0.80853	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|102;264	.|B4DSF9;Q9NRZ5	.|.;PLCD_HUMAN	V|R	43|264;102	.|ENSP00000314036:P264R	.|ENSP00000314036:P264R	L|P	-|-	1|2	2|0	AGPAT4|AGPAT4	161487598|161487598	1.000000|1.000000	0.71417|0.71417	0.714000|0.714000	0.30535|0.30535	0.405000|0.405000	0.30901|0.30901	9.170000|9.170000	0.94795|0.94795	2.455000|2.455000	0.83008|0.83008	0.561000|0.561000	0.74099|0.74099	CTG|CCT		0.587	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133		9	57	0	0	0	0.006214	0	9	57				
EIF2AK1	27102	broad.mit.edu	37	7	6094328	6094328	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:6094328A>T	ENST00000199389.6	-	2	272	c.126T>A	c.(124-126)gaT>gaA	p.D42E	RNU6-218P_ENST00000517120.1_RNA|EIF2AK1_ENST00000536084.1_5'UTR	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	42					negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		CTGCTGGAACATCAGATTCTA	0.338																																							uc003spp.2		NA																	0				upper_aerodigestive_tract(1)|stomach(1)|lung(1)|central_nervous_system(1)	4						c.(124-126)GAT>GAA		eukaryotic translation initiation factor 2-alpha							78.0	79.0	79.0					7																	6094328		2203	4300	6503	SO:0001583	missense	27102				negative regulation of hemoglobin biosynthetic process|negative regulation of translational initiation by iron|protein autophosphorylation|response to external stimulus|response to stress	cytoplasm	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|heme binding|protein homodimerization activity	g.chr7:6094328A>T	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.126T>A	7.37:g.6094328A>T	ENSP00000199389:p.Asp42Glu					EIF2AK1_uc003spq.2_Missense_Mutation_p.D42E|EIF2AK1_uc011jwm.1_5'UTR	p.D42E	NM_014413	NP_055228	Q9BQI3	E2AK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)	2	272	-		Ovarian(82;0.0423)	42					A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	ENST00000199389.6	37	c.126T>A	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	.	10.27	1.305265	0.23736	.	.	ENSG00000086232	ENST00000199389;ENST00000446699	T;T	0.11604	2.76;2.76	5.42	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.23572	0.0570	M	0.63843	1.955	0.80722	D	1	D;D	0.67145	0.996;0.993	P;P	0.61658	0.892;0.784	T	0.00565	-1.1668	10	0.46703	T	0.11	-30.9081	9.0607	0.36433	0.8469:0.0:0.1531:0.0	.	42;42	Q9BQI3-2;Q9BQI3	.;E2AK1_HUMAN	E	42	ENSP00000199389:D42E;ENSP00000397590:D42E	ENSP00000199389:D42E	D	-	3	2	EIF2AK1	6060854	0.986000	0.35501	0.996000	0.52242	0.783000	0.44284	0.632000	0.24583	0.906000	0.36621	0.459000	0.35465	GAT		0.338	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413		5	61	0	0	0	0.001168	0	5	61				
THSD7A	221981	broad.mit.edu	37	7	11676584	11676584	+	Silent	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:11676584T>C	ENST00000423059.4	-	2	446	c.195A>G	c.(193-195)ccA>ccG	p.P65P	THSD7A_ENST00000480061.1_5'UTR	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	65	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ATCGGCCCCATGGACCTACAA	0.443										HNSCC(18;0.044)																													uc003ssf.3		NA																	0				ovary(3)	3						c.(193-195)CCA>CCG		thrombospondin, type I, domain containing 7A							61.0	61.0	61.0					7																	11676584		1965	4145	6110	SO:0001819	synonymous_variant	221981					integral to membrane		g.chr7:11676584T>C		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.195A>G	7.37:g.11676584T>C		HNSCC(18;0.044)					p.P65P	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	2	447	-			65			TSP type-1 1.|Extracellular (Potential).			Silent	SNP	ENST00000423059.4	37	c.195A>G	CCDS47543.1																																																																																				0.443	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		16	59	0	0	0	0.003163	0	16	59				
HOXA1	3198	broad.mit.edu	37	7	27134078	27134078	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:27134078G>C	ENST00000343060.4	-	2	1050	c.989C>G	c.(988-990)aCt>aGt	p.T330S	HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOXA1_ENST00000355633.5_3'UTR|HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000429611.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	330					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGTAGTCAGAGTGTCTGAGGT	0.597																																							uc003sye.2		NA																	0				ovary(3)	3						c.(988-990)ACT>AGT		homeobox A1 isoform a							46.0	49.0	48.0					7																	27134078		2203	4300	6503	SO:0001583	missense	3198					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27134078G>C		CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.989C>G	7.37:g.27134078G>C	ENSP00000343246:p.Thr330Ser					HOXA1_uc003syd.2_3'UTR|uc003syg.2_5'Flank	p.T330S	NM_005522	NP_005513	P49639	HXA1_HUMAN			2	1083	-			330					A4D184|B2R8U7|O43363	Missense_Mutation	SNP	ENST00000343060.4	37	c.989C>G	CCDS5401.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732141	0.30684	.	.	ENSG00000105991	ENST00000343060	D	0.89875	-2.58	5.31	5.31	0.75309	.	0.355002	0.33127	N	0.005256	T	0.81688	0.4875	L	0.34521	1.04	0.80722	D	1	B	0.29037	0.231	B	0.24006	0.05	T	0.77466	-0.2577	10	0.15952	T	0.53	.	13.8923	0.63747	0.0:0.0:0.8477:0.1523	.	330	P49639	HXA1_HUMAN	S	330	ENSP00000343246:T330S	ENSP00000343246:T330S	T	-	2	0	HOXA1	27100603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.242000	0.51384	2.495000	0.84180	0.655000	0.94253	ACT		0.597	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1			7	60	0	0	0	0.00308	0	7	60				
AEBP1	165	broad.mit.edu	37	7	44144413	44144413	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:44144413G>A	ENST00000223357.3	+	1	454	c.149G>A	c.(148-150)cGg>cAg	p.R50Q		NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	50	Pro-rich.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CCTGAGCCCCGGGAGGACGAC	0.726																																							uc003tkb.2		NA																	0					0						c.(148-150)CGG>CAG		adipocyte enhancer binding protein 1 precursor							19.0	16.0	17.0					7																	44144413		2194	4298	6492	SO:0001583	missense	165				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:44144413G>A	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.149G>A	7.37:g.44144413G>A	ENSP00000223357:p.Arg50Gln						p.R50Q	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN			1	454	+			50			Pro-rich.		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	c.149G>A	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514599	0.44763	.	.	ENSG00000106624	ENST00000223357	D	0.95342	-3.68	3.9	0.901	0.19284	.	6.016910	0.00649	N	0.000548	D	0.88887	0.6559	N	0.19112	0.55	0.80722	D	1	B	0.22211	0.066	B	0.09377	0.004	T	0.76971	-0.2761	10	0.72032	D	0.01	-9.814	4.1464	0.10217	0.3046:0.1776:0.5178:0.0	.	50	Q8IUX7	AEBP1_HUMAN	Q	50	ENSP00000223357:R50Q	ENSP00000223357:R50Q	R	+	2	0	AEBP1	44110938	0.013000	0.17824	0.961000	0.40146	0.274000	0.26718	0.169000	0.16641	0.110000	0.17919	0.511000	0.50034	CGG		0.726	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129		3	14	0	0	0	0.004672	0	3	14				
PKD1L1	168507	broad.mit.edu	37	7	47842862	47842862	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:47842862C>A	ENST00000289672.2	-	53	7958	c.7908G>T	c.(7906-7908)atG>atT	p.M2636I	C7orf69_ENST00000258776.4_Intron|C7orf69_ENST00000418326.2_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2636					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGCAGGATGCCATTGTGTTTT	0.478																																							uc003tny.1		NA																	0				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(7906-7908)ATG>ATT		polycystin-1L1							154.0	137.0	143.0					7																	47842862		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47842862C>A	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7908G>T	7.37:g.47842862C>A	ENSP00000289672:p.Met2636Ile					C7orf69_uc003tnz.3_Intron|C7orf69_uc003toa.1_Intron	p.M2636I	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			53	7908	-			2636			Helical; (Potential).		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.7908G>T	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.165985	0.38217	.	.	ENSG00000158683	ENST00000289672	T	0.71222	-0.55	5.18	2.22	0.28083	Polycystin cation channel, PKD1/PKD2 (1);	0.658399	0.13304	N	0.398008	T	0.58452	0.2123	L	0.48642	1.525	0.09310	N	1	B	0.29909	0.261	B	0.30251	0.113	T	0.44329	-0.9335	10	0.25106	T	0.35	-2.6648	6.2091	0.20619	0.1342:0.6514:0.1313:0.083	.	2636	Q8TDX9	PK1L1_HUMAN	I	2636	ENSP00000289672:M2636I	ENSP00000289672:M2636I	M	-	3	0	PKD1L1	47809387	0.000000	0.05858	0.002000	0.10522	0.063000	0.16089	0.171000	0.16685	1.207000	0.43291	0.551000	0.68910	ATG		0.478	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		15	43	1	0	0.00316338	0.003163	0.00333672	15	43				
EGFR	1956	broad.mit.edu	37	7	55224477	55224477	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:55224477C>A	ENST00000275493.2	+	10	1336	c.1159C>A	c.(1159-1161)Ctg>Atg	p.L387M	EGFR_ENST00000442591.1_Missense_Mutation_p.L387M|EGFR_ENST00000454757.2_Missense_Mutation_p.L334M|EGFR_ENST00000420316.2_Missense_Mutation_p.L387M|EGFR_ENST00000342916.3_Missense_Mutation_p.L387M|EGFR_ENST00000455089.1_Missense_Mutation_p.L342M|EGFR_ENST00000344576.2_Missense_Mutation_p.L387M	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	387					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L387V(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TACTCCTCCTCTGGATCCACA	0.363		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		2	Substitution - Missense(2)		breast(2)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(1159-1161)CTG>ATG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						105.0	101.0	102.0					7																	55224477		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55224477C>A		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1159C>A	7.37:g.55224477C>A	ENSP00000275493:p.Leu387Met	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc003tqh.2_Missense_Mutation_p.L387M|EGFR_uc003tqi.2_Missense_Mutation_p.L387M|EGFR_uc003tqj.2_Missense_Mutation_p.L387M|EGFR_uc010kzg.1_Missense_Mutation_p.L342M|EGFR_uc011kco.1_Missense_Mutation_p.L334M|EGFR_uc011kcp.1_RNA|EGFR_uc011kcq.1_RNA	p.L387M	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		10	1405	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		387			Extracellular (Potential).		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.1159C>A	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.134241	0.37630	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.95	5.07	0.68467	EGF receptor, L domain (1);	0.060160	0.64402	D	0.000001	T	0.52451	0.1735	N	0.17901	0.54	0.43583	D	0.995927	D;D;P;P;P	0.76494	0.966;0.999;0.819;0.926;0.904	D;D;P;P;P	0.75020	0.929;0.985;0.714;0.903;0.803	T	0.54105	-0.8343	10	0.41790	T	0.15	.	13.7679	0.63006	0.0:0.9258:0.0:0.0742	.	342;387;387;387;387	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	M	342;387;257;387;387;387;387;334;181	ENSP00000415559:L342M;ENSP00000342376:L387M;ENSP00000345973:L387M;ENSP00000413843:L387M;ENSP00000275493:L387M;ENSP00000410031:L387M;ENSP00000395243:L334M	ENSP00000275493:L387M	L	+	1	2	EGFR	55191971	0.767000	0.28508	0.975000	0.42487	0.043000	0.13939	1.493000	0.35605	1.516000	0.48900	0.655000	0.94253	CTG		0.363	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		37	30	1	0	1.04594e-18	0.00623	1.42966e-18	37	30				
EGFR	1956	broad.mit.edu	37	7	55259524	55259524	+	Missense_Mutation	SNP	T	T	A	rs121913444		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:55259524T>A	ENST00000275493.2	+	21	2759	c.2582T>A	c.(2581-2583)cTg>cAg	p.L861Q	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Missense_Mutation_p.L808Q|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Missense_Mutation_p.L816Q	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	861	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> Q (found in a lung cancer sample; constitutively activated kinase with higher levels of basal autophosphorylation; more sensitive to gefitinib than wild-type; dbSNP:rs121913444). {ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L861Q(53)|p.L861R(6)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CTGGCCAAACTGCTGGGTGCG	0.557		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		59	Substitution - Missense(59)	p.L861Q(96)|p.L861R(10)|p.A859_L883>V(2)|p.L861F(1)|p.L861V(1)|p.L861P(1)	lung(57)|upper_aerodigestive_tract(1)|central_nervous_system(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2581-2583)CTG>CAG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						102.0	96.0	98.0					7																	55259524		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259524T>A		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2582T>A	7.37:g.55259524T>A	ENSP00000275493:p.Leu861Gln	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.L816Q|EGFR_uc011kco.1_Missense_Mutation_p.L808Q|uc003tqo.2_5'Flank	p.L861Q	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2828	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		861		L -> Q (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2582T>A	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955260	0.73902	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.82255	-1.59;-1.59;-1.59	5.82	5.82	0.92795	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85513	0.5714	N	0.25332	0.735	0.58432	D	0.999998	P;D	0.76494	0.481;0.999	B;D	0.71414	0.287;0.973	D	0.87493	0.2428	10	0.87932	D	0	.	15.0046	0.71501	0.0:0.0:0.0:1.0	.	816;861	Q504U8;P00533	.;EGFR_HUMAN	Q	816;731;861;808	ENSP00000415559:L816Q;ENSP00000275493:L861Q;ENSP00000395243:L808Q	ENSP00000275493:L861Q	L	+	2	0	EGFR	55227018	1.000000	0.71417	0.971000	0.41717	0.664000	0.39144	7.911000	0.87458	2.221000	0.72209	0.528000	0.53228	CTG		0.557	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		96	60	0	0	0	0.01441	0	96	60				
ZNF716	441234	broad.mit.edu	37	7	57528740	57528740	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:57528740C>T	ENST00000420713.1	+	4	685	c.573C>T	c.(571-573)ggC>ggT	p.G191G		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						AAAACGATGGCAAATCATTTT	0.338																																							uc011kdi.1		NA																	0				ovary(2)	2						c.(571-573)GGC>GGT		zinc finger protein 716							76.0	65.0	69.0					7																	57528740		692	1591	2283	SO:0001819	synonymous_variant	441234							g.chr7:57528740C>T	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.573C>T	7.37:g.57528740C>T							p.G191G	NM_001159279	NP_001152751					4	685	+									Silent	SNP	ENST00000420713.1	37	c.573C>T	CCDS55112.1																																																																																				0.338	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		10	10	0	0	0	0.006214	0	10	10				
MUC17	140453	broad.mit.edu	37	7	100684210	100684210	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:100684210C>A	ENST00000306151.4	+	3	9577	c.9513C>A	c.(9511-9513)gtC>gtA	p.V3171V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3171	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATATGCCTGTCAGCACCATGC	0.473																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(9511-9513)GTC>GTA		mucin 17 precursor							282.0	286.0	285.0					7																	100684210		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100684210C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9513C>A	7.37:g.100684210C>A						MUC17_uc010lho.1_RNA	p.V3171V	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	9566	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3171			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|51.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.9513C>A	CCDS34711.1																																																																																				0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		8	402	1	0	0.000157383	0.00308	0.000170683	8	402				
MUC17	140453	broad.mit.edu	37	7	100686420	100686420	+	Missense_Mutation	SNP	C	C	G	rs374275687		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:100686420C>G	ENST00000306151.4	+	3	11787	c.11723C>G	c.(11722-11724)cCt>cGt	p.P3908R		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3908					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTTTTACCCCTTCTACTGAC	0.478																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(11722-11724)CCT>CGT		mucin 17 precursor							150.0	146.0	147.0					7																	100686420		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100686420C>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11723C>G	7.37:g.100686420C>G	ENSP00000302716:p.Pro3908Arg					MUC17_uc010lho.1_RNA	p.P3908R	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	11776	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3908			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.11723C>G	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	10.38	1.333590	0.24167	.	.	ENSG00000169876	ENST00000306151	T	0.01998	4.51	1.44	-1.36	0.09085	.	.	.	.	.	T	0.02047	0.0064	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.58391	0.838	T	0.46414	-0.9193	9	0.21014	T	0.42	.	2.4618	0.04543	0.0:0.4293:0.3237:0.247	.	3908	Q685J3	MUC17_HUMAN	R	3908	ENSP00000302716:P3908R	ENSP00000302716:P3908R	P	+	2	0	MUC17	100473140	0.000000	0.05858	0.001000	0.08648	0.419000	0.31324	0.338000	0.19858	-0.030000	0.13804	0.177000	0.17058	CCT		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		16	116	0	0	0	0.006122	0	16	116				
MUC17	140453	broad.mit.edu	37	7	100686595	100686595	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:100686595A>G	ENST00000306151.4	+	3	11962	c.11898A>G	c.(11896-11898)atA>atG	p.I3966M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3966					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCCCTGTGATAACTTCCACTG	0.453																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(11896-11898)ATA>ATG		mucin 17 precursor							148.0	148.0	148.0					7																	100686595		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100686595A>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11898A>G	7.37:g.100686595A>G	ENSP00000302716:p.Ile3966Met					MUC17_uc010lho.1_RNA	p.I3966M	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	11951	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3966			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.11898A>G	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	4.226	0.040779	0.08196	.	.	ENSG00000169876	ENST00000306151	T	0.01838	4.61	1.19	-2.38	0.06622	.	.	.	.	.	T	0.01627	0.0052	N	0.08118	0	0.09310	N	1	D	0.61697	0.99	P	0.49829	0.623	T	0.42965	-0.9420	9	0.45353	T	0.12	.	2.1061	0.03691	0.3758:0.3409:0.2833:0.0	.	3966	Q685J3	MUC17_HUMAN	M	3966	ENSP00000302716:I3966M	ENSP00000302716:I3966M	I	+	3	3	MUC17	100473315	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-2.063000	0.01388	-0.446000	0.07149	0.348000	0.21847	ATA		0.453	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		5	128	0	0	0	0.001168	0	5	128				
TMEM168	64418	broad.mit.edu	37	7	112424094	112424094	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:112424094T>C	ENST00000312814.6	-	2	1347	c.787A>G	c.(787-789)Aga>Gga	p.R263G	TMEM168_ENST00000454074.1_Missense_Mutation_p.R263G	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	263						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						GAAAGTCTTCTGCAAATTCTT	0.353																																							uc003vgn.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(787-789)AGA>GGA		transmembrane protein 168							140.0	157.0	151.0					7																	112424094		2203	4299	6502	SO:0001583	missense	64418					integral to membrane|transport vesicle		g.chr7:112424094T>C		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.787A>G	7.37:g.112424094T>C	ENSP00000323068:p.Arg263Gly					TMEM168_uc010lju.2_Missense_Mutation_p.R263G|TMEM168_uc011kmr.1_Intron	p.R263G	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN			2	1179	-			263					A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	ENST00000312814.6	37	c.787A>G	CCDS5757.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.236798	0.58886	.	.	ENSG00000146802	ENST00000312814;ENST00000454074	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.75133	0.3808	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.76997	-0.2751	9	0.66056	D	0.02	-28.3794	13.0568	0.58984	0.0:0.0:0.1339:0.8661	.	263	Q9H0V1	TM168_HUMAN	G	263	.	ENSP00000323068:R263G	R	-	1	2	TMEM168	112211330	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.228000	0.51270	2.323000	0.78572	0.528000	0.53228	AGA		0.353	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484		29	128	0	0	0	0.00632	0	29	128				
FLNC	2318	broad.mit.edu	37	7	128494176	128494176	+	Silent	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:128494176C>G	ENST00000325888.8	+	40	6894	c.6633C>G	c.(6631-6633)acC>acG	p.T2211T	FLNC_ENST00000346177.6_Silent_p.T2178T|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2211	Intradomain insert; mediate targeting to Z lines.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGGAGTCCACCCAGGTCGGCG	0.692																																							uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(6631-6633)ACC>ACG		gamma filamin isoform a							21.0	27.0	25.0					7																	128494176		1986	4146	6132	SO:0001819	synonymous_variant	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128494176C>G	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6633C>G	7.37:g.128494176C>G						FLNC_uc003voa.3_Silent_p.T2178T	p.T2211T	NM_001458	NP_001449	Q14315	FLNC_HUMAN			40	6842	+			2211			Intradomain insert.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	c.6633C>G	CCDS43644.1																																																																																				0.692	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			14	16	0	0	0	0.00245	0	14	16				
FLNC	2318	broad.mit.edu	37	7	128494178	128494178	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:128494178A>T	ENST00000325888.8	+	40	6896	c.6635A>T	c.(6634-6636)cAg>cTg	p.Q2212L	FLNC_ENST00000346177.6_Missense_Mutation_p.Q2179L|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2212	Intradomain insert; mediate targeting to Z lines.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GAGTCCACCCAGGTCGGCGGG	0.692																																							uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(6634-6636)CAG>CTG		gamma filamin isoform a							21.0	27.0	25.0					7																	128494178		1981	4144	6125	SO:0001583	missense	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128494178A>T	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6635A>T	7.37:g.128494178A>T	ENSP00000327145:p.Gln2212Leu					FLNC_uc003voa.3_Missense_Mutation_p.Q2179L	p.Q2212L	NM_001458	NP_001449	Q14315	FLNC_HUMAN			40	6844	+			2212			Intradomain insert.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	c.6635A>T	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.593868	0.66219	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85629	-1.99;-2.01	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.83751	0.5322	N	0.08118	0	0.58432	D	0.999996	D;B	0.57899	0.981;0.276	D;B	0.67900	0.954;0.045	D	0.87383	0.2358	10	0.87932	D	0	.	13.8104	0.63260	1.0:0.0:0.0:0.0	.	2179;2212	Q14315-2;Q14315	.;FLNC_HUMAN	L	2212;2179	ENSP00000327145:Q2212L;ENSP00000344002:Q2179L	ENSP00000327145:Q2212L	Q	+	2	0	FLNC	128281414	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.907000	0.69908	2.145000	0.66743	0.533000	0.62120	CAG		0.692	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			13	16	0	0	0	0.001855	0	13	16				
NUP205	23165	broad.mit.edu	37	7	135258468	135258468	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:135258468C>G	ENST00000285968.6	+	3	264	c.238C>G	c.(238-240)Caa>Gaa	p.Q80E	NUP205_ENST00000489493.1_3'UTR|NUP205_ENST00000440390.2_5'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	80					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CATTCAGGGTCAACAGGGAAC	0.393																																							uc003vsw.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(238-240)CAA>GAA		nucleoporin 205kDa							110.0	101.0	104.0					7																	135258468		2203	4300	6503	SO:0001583	missense	23165				carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr7:135258468C>G	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.238C>G	7.37:g.135258468C>G	ENSP00000285968:p.Gln80Glu					NUP205_uc011kqa.1_RNA	p.Q80E	NM_015135	NP_055950	Q92621	NU205_HUMAN			3	269	+			80					A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	c.238C>G	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.127787	0.37533	.	.	ENSG00000155561	ENST00000285968	T	0.28069	1.63	5.1	5.1	0.69264	.	0.215051	0.49916	D	0.000130	T	0.24275	0.0588	L	0.52126	1.63	0.80722	D	1	P	0.39576	0.679	B	0.37047	0.24	T	0.05954	-1.0854	10	0.02654	T	1	-3.8146	13.47	0.61278	0.1566:0.8434:0.0:0.0	.	80	Q92621	NU205_HUMAN	E	80	ENSP00000285968:Q80E	ENSP00000285968:Q80E	Q	+	1	0	NUP205	134909008	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.715000	0.68430	2.373000	0.80994	0.484000	0.47621	CAA		0.393	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			9	26	0	0	0	0.004482	0	9	26				
CASP2	835	broad.mit.edu	37	7	143000948	143000948	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:143000948G>A	ENST00000310447.5	+	9	1280	c.1039G>A	c.(1039-1041)Gat>Aat	p.D347N	CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	347					aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					CGAGGAGAGTGATGCCGGTAA	0.502																																							uc003wco.2		NA																	0				lung(2)|ovary(1)	3						c.(1039-1041)GAT>AAT		caspase 2 isoform 1 preproprotein							109.0	93.0	98.0					7																	143000948		2203	4300	6503	SO:0001583	missense	835				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding	g.chr7:143000948G>A	AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.1039G>A	7.37:g.143000948G>A	ENSP00000312664:p.Asp347Asn					CASP2_uc003wcp.2_3'UTR|CASP2_uc011kta.1_Missense_Mutation_p.D231N|CASP2_uc003wcq.2_RNA|CASP2_uc011ktb.1_Missense_Mutation_p.D97N	p.D347N	NM_032982	NP_116764	P42575	CASP2_HUMAN			9	1186	+	Melanoma(164;0.059)		347					A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	37	c.1039G>A	CCDS5879.1	.	.	.	.	.	.	.	.	.	.	G	36	5.687120	0.96784	.	.	ENSG00000106144	ENST00000310447	T	0.20738	2.05	5.81	5.81	0.92471	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);	0.228496	0.50627	D	0.000106	T	0.43122	0.1233	M	0.63208	1.945	0.80722	D	1	D	0.59357	0.985	P	0.59546	0.859	T	0.05354	-1.0890	10	0.45353	T	0.12	.	20.1472	0.98082	0.0:0.0:1.0:0.0	.	347	P42575	CASP2_HUMAN	N	347	ENSP00000312664:D347N	ENSP00000312664:D347N	D	+	1	0	CASP2	142711070	1.000000	0.71417	0.813000	0.32504	0.877000	0.50540	9.148000	0.94652	2.766000	0.95052	0.644000	0.83932	GAT		0.502	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982		6	14	0	0	0	0.001168	0	6	14				
PDIA4	9601	broad.mit.edu	37	7	148703045	148703045	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:148703045C>A	ENST00000286091.4	-	8	1464	c.1232G>T	c.(1231-1233)aGg>aTg	p.R411M		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	411					cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CAGGGGGCGCCTGGTGTAGCG	0.632											OREG0018420	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003wff.2		NA																	0				lung(5)|ovary(1)	6						c.(1231-1233)AGG>ATG		protein disulfide isomerase A4 precursor							56.0	58.0	57.0					7																	148703045		2203	4300	6503	SO:0001583	missense	9601				cell redox homeostasis|glycerol ether metabolic process|protein secretion	endoplasmic reticulum lumen|melanosome	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr7:148703045C>A	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1232G>T	7.37:g.148703045C>A	ENSP00000286091:p.Arg411Met		OREG0018420	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1719		p.R411M	NM_004911	NP_004902	P13667	PDIA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00385)		8	1514	-	Melanoma(164;0.15)		411					A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	c.1232G>T	CCDS5893.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059972	0.55325	.	.	ENSG00000155660	ENST00000286091	T	0.13778	2.56	5.11	1.08	0.20341	Thioredoxin-like fold (1);	0.208935	0.50627	D	0.000118	T	0.12135	0.0295	N	0.22421	0.69	0.30183	N	0.800242	P	0.42296	0.775	P	0.47891	0.56	T	0.06807	-1.0806	10	0.54805	T	0.06	.	8.3992	0.32574	0.0:0.2017:0.0:0.7983	.	411	P13667	PDIA4_HUMAN	M	411	ENSP00000286091:R411M	ENSP00000286091:R411M	R	-	2	0	PDIA4	148333978	1.000000	0.71417	0.907000	0.35723	0.708000	0.40852	3.184000	0.50926	0.046000	0.15833	-0.367000	0.07326	AGG		0.632	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911		25	38	1	0	3.83957e-06	0.00278	4.33712e-06	25	38				
ZNF212	7988	broad.mit.edu	37	7	148951158	148951158	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:148951158C>G	ENST00000335870.2	+	5	1268	c.1140C>G	c.(1138-1140)tgC>tgG	p.C380W		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			GCTTCAGCTGCAAGGTGAGCC	0.612																																							uc003wfp.2		NA																	0				ovary(1)	1						c.(1138-1140)TGC>TGG		zinc finger protein 212							60.0	49.0	53.0					7																	148951158		2203	4300	6503	SO:0001583	missense	7988				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding	g.chr7:148951158C>G	U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.1140C>G	7.37:g.148951158C>G	ENSP00000338572:p.Cys380Trp						p.C380W	NM_012256	NP_036388	Q9UDV6	ZN212_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00171)		5	1236	+	Melanoma(164;0.15)		380			C2H2-type 2.		B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	ENST00000335870.2	37	c.1140C>G	CCDS5896.1	.	.	.	.	.	.	.	.	.	.	C	4.539	0.100036	0.08731	.	.	ENSG00000170260	ENST00000335870	T	0.27890	1.64	5.13	0.627	0.17675	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.104828	0.43579	D	0.000547	T	0.26882	0.0658	N	0.16098	0.37	0.22947	N	0.998527	D	0.63880	0.993	P	0.62813	0.907	T	0.08391	-1.0724	10	0.37606	T	0.19	-12.3889	5.3107	0.15829	0.0:0.4551:0.1431:0.4018	.	380	Q9UDV6	ZN212_HUMAN	W	380	ENSP00000338572:C380W	ENSP00000338572:C380W	C	+	3	2	ZNF212	148582091	0.000000	0.05858	0.128000	0.21923	0.004000	0.04260	-0.031000	0.12287	0.141000	0.18875	0.655000	0.94253	TGC		0.612	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256		9	9	0	0	0	0.004482	0	9	9				
AGAP3	116988	broad.mit.edu	37	7	150784108	150784108	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:150784108G>C	ENST00000397238.2	+	1	280	c.280G>C	c.(280-282)Gag>Cag	p.E94Q	AGAP3_ENST00000473312.1_Missense_Mutation_p.E94Q|AGAP3_ENST00000463381.1_Intron|AGAP3_ENST00000479901.1_Missense_Mutation_p.E94Q	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	58	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						CGAGCGCATCGAGGATTTGGC	0.662																																							uc003wjg.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(280-282)GAG>CAG		centaurin, gamma 3 isoform a							28.0	33.0	31.0					7																	150784108		2189	4298	6487	SO:0001583	missense	116988				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding	g.chr7:150784108G>C	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.280G>C	7.37:g.150784108G>C	ENSP00000380413:p.Glu94Gln					AGAP3_uc003wje.1_Intron|AGAP3_uc003wjf.1_Missense_Mutation_p.E94Q|AGAP3_uc010lpy.1_Missense_Mutation_p.E94Q	p.E94Q	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN			1	283	+			58					B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000397238.2	37	c.280G>C	CCDS43681.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116556	0.37339	.	.	ENSG00000133612	ENST00000473312;ENST00000479901;ENST00000397238;ENST00000335355	D;D;T	0.87412	-2.03;-2.25;-0.42	2.42	2.42	0.29668	.	0.220594	0.28549	U	0.014957	T	0.74635	0.3742	N	0.20685	0.6	0.80722	D	1	B;P;B	0.45768	0.114;0.866;0.118	B;B;B	0.37550	0.014;0.253;0.014	T	0.75442	-0.3316	10	0.48119	T	0.1	.	10.4985	0.44791	0.0:0.0:1.0:0.0	.	94;94;94	C9J975;Q96P47-4;E9PAL8	.;.;.	Q	94;94;94;58	ENSP00000418921:E94Q;ENSP00000418125:E94Q;ENSP00000380413:E94Q	ENSP00000334157:E58Q	E	+	1	0	AGAP3	150415041	1.000000	0.71417	0.999000	0.59377	0.626000	0.37791	6.667000	0.74451	1.329000	0.45376	0.185000	0.17295	GAG		0.662	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351908.3	NM_031946		6	16	0	0	0	0.001168	0	6	16				
GALNTL5	168391	broad.mit.edu	37	7	151680215	151680215	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:151680215G>A	ENST00000392800.2	+	4	767	c.513G>A	c.(511-513)ttG>ttA	p.L171L	GALNTL5_ENST00000431418.2_Silent_p.L171L	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	171	Catalytic subdomain A.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		AAATTATTTTGGTAGATGACA	0.388																																							uc003wkp.2		NA																	0				ovary(2)	2						c.(511-513)TTG>TTA		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							117.0	110.0	112.0					7																	151680215		2203	4300	6503	SO:0001819	synonymous_variant	168391					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups	g.chr7:151680215G>A	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.513G>A	7.37:g.151680215G>A						GALNTL5_uc003wkq.2_Intron|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_Silent_p.L60L	p.L171L	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)	4	736	+	all_neural(206;0.187)	all_hematologic(28;0.0749)	171			Catalytic subdomain A.|Lumenal (Potential).		Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Silent	SNP	ENST00000392800.2	37	c.513G>A	CCDS5929.1																																																																																				0.388	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292		28	54	0	0	0	0.00632	0	28	54				
PTPRN2	5799	broad.mit.edu	37	7	157475553	157475553	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:157475553G>T	ENST00000389418.4	-	13	1874	c.1865C>A	c.(1864-1866)tCc>tAc	p.S622Y	PTPRN2_ENST00000404321.2_Missense_Mutation_p.S645Y|PTPRN2_ENST00000389416.4_Missense_Mutation_p.S605Y|PTPRN2_ENST00000409483.1_Missense_Mutation_p.S584Y|PTPRN2_ENST00000389413.3_Missense_Mutation_p.S593Y	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	622					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GCAGGCGAGGGAGACCAGGGT	0.597																																							uc003wno.2		NA																	0				ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(1864-1866)TCC>TAC		protein tyrosine phosphatase, receptor type, N							113.0	115.0	114.0					7																	157475553		2203	4300	6503	SO:0001583	missense	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157475553G>T	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1865C>A	7.37:g.157475553G>T	ENSP00000374069:p.Ser622Tyr					PTPRN2_uc003wnp.2_Missense_Mutation_p.S605Y|PTPRN2_uc003wnq.2_Missense_Mutation_p.S593Y|PTPRN2_uc003wnr.2_Missense_Mutation_p.S584Y|PTPRN2_uc011kwa.1_Missense_Mutation_p.S645Y	p.S622Y	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	13	1986	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	622			Helical; (Potential).		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	c.1865C>A	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875028	0.51695	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.03386	3.96;4.01;3.95;3.96;3.95	4.73	4.73	0.59995	.	0.114036	0.34879	N	0.003607	T	0.15478	0.0373	L	0.56769	1.78	0.44762	D	0.997765	D;D;D;D;D	0.89917	0.997;0.994;0.997;1.0;0.994	D;P;D;D;P	0.71184	0.946;0.837;0.946;0.972;0.837	T	0.00587	-1.1657	10	0.72032	D	0.01	.	17.7244	0.88361	0.0:0.0:1.0:0.0	.	645;584;593;605;622	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	Y	584;593;605;622;645	ENSP00000387114:S584Y;ENSP00000374064:S593Y;ENSP00000374067:S605Y;ENSP00000374069:S622Y;ENSP00000385464:S645Y	ENSP00000374064:S593Y	S	-	2	0	PTPRN2	157168314	1.000000	0.71417	0.202000	0.23494	0.643000	0.38383	5.464000	0.66719	2.140000	0.66376	0.655000	0.94253	TCC		0.597	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			32	39	1	0	6.04164e-23	0.010818	8.5359e-23	32	39				
DLGAP2	9228	broad.mit.edu	37	8	1513916	1513916	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:1513916T>C	ENST00000421627.2	+	3	1192	c.1058T>C	c.(1057-1059)aTg>aCg	p.M353T	RP11-666I19.2_ENST00000518063.1_RNA	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	432					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TGCAGGAGAATGAGAAGTGGG	0.557																																							uc003wpl.2		NA																	0					0						c.(1057-1059)ATG>ACG		discs large-associated protein 2							48.0	52.0	51.0					8																	1513916		2149	4290	6439	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1513916T>C	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1058T>C	8.37:g.1513916T>C	ENSP00000400258:p.Met353Thr					DLGAP2_uc003wpm.2_Missense_Mutation_p.M353T	p.M353T	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	3	1155	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	432					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.1058T>C	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.29|16.29	3.081050|3.081050	0.55753|0.55753	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	D|.	0.90676|.	-2.71|.	4.55|4.55	3.35|3.35	0.38373|0.38373	.|.	0.035068|.	0.85682|.	D|.	0.000000|.	T|.	0.69958|.	0.3169|.	M|M	0.84219|0.84219	2.685|2.685	0.35178|0.35178	D|D	0.772189|0.772189	D;D|.	0.65815|.	0.995;0.992|.	D;D|.	0.76575|.	0.988;0.972|.	T|.	0.77059|.	-0.2728|.	10|.	0.87932|.	D|.	0|.	-7.6506|-7.6506	10.4528|10.4528	0.44533|0.44533	0.0:0.0791:0.0:0.9209|0.0:0.0791:0.0:0.9209	.|.	432;432|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	T|R	398;353|370	ENSP00000400258:M353T|.	ENSP00000348366:M398T|.	M|X	+|+	2|1	0|0	DLGAP2|DLGAP2	1501323|1501323	1.000000|1.000000	0.71417|0.71417	0.823000|0.823000	0.32752|0.32752	0.647000|0.647000	0.38526|0.38526	5.839000|5.839000	0.69395|0.69395	0.680000|0.680000	0.31366|0.31366	0.477000|0.477000	0.44152|0.44152	ATG|TGA		0.557	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		4	35	0	0	0	0.000602	0	4	35				
DLGAP2	9228	broad.mit.edu	37	8	1645345	1645345	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:1645345G>A	ENST00000421627.2	+	11	2723	c.2589G>A	c.(2587-2589)caG>caA	p.Q863Q		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	942					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CGACGTCGCAGGACCTGGCCG	0.647																																							uc003wpl.2		NA																	0					0						c.(2587-2589)CAG>CAA		discs large-associated protein 2							28.0	33.0	31.0					8																	1645345		2005	4161	6166	SO:0001819	synonymous_variant	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1645345G>A	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2589G>A	8.37:g.1645345G>A						DLGAP2_uc003wpm.2_Silent_p.Q849Q	p.Q863Q	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	11	2686	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	942					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	c.2589G>A	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	8.247	0.808224	0.16467	.	.	ENSG00000198010	ENST00000520901	.	.	.	4.61	2.35	0.29111	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51212	-0.8734	4	.	.	.	-14.095	8.0518	0.30583	0.3112:0.0:0.6888:0.0	.	.	.	.	K	866	.	.	R	+	2	0	DLGAP2	1632752	1.000000	0.71417	0.998000	0.56505	0.857000	0.48899	1.782000	0.38654	1.062000	0.40625	0.561000	0.74099	AGG		0.647	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		10	47	0	0	0	0.006214	0	10	47				
BLK	640	broad.mit.edu	37	8	11412886	11412886	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:11412886G>C	ENST00000259089.4	+	8	1257	c.665G>C	c.(664-666)cGc>cCc	p.R222P	RP11-148O21.6_ENST00000602626.1_lincRNA|BLK_ENST00000529894.1_Missense_Mutation_p.R151P|RP11-148O21.4_ENST00000528629.1_RNA|RP11-148O21.3_ENST00000527922.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	222					B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CCCTGTGTGCGCCCGGCCCCG	0.617																																							uc003wty.2		NA																	0				large_intestine(1)|stomach(1)|ovary(1)	3						c.(664-666)CGC>CCC		B lymphoid tyrosine kinase							72.0	75.0	74.0					8																	11412886		2203	4300	6503	SO:0001583	missense	640				intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr8:11412886G>C	BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.665G>C	8.37:g.11412886G>C	ENSP00000259089:p.Arg222Pro					BLK_uc003wtz.2_Missense_Mutation_p.R151P	p.R222P	NM_001715	NP_001706	P51451	BLK_HUMAN	STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)	8	1246	+			222					Q16291|Q96IN1	Missense_Mutation	SNP	ENST00000259089.4	37	c.665G>C	CCDS5982.1	.	.	.	.	.	.	.	.	.	.	G	4.855	0.158996	0.09236	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	T;T	0.27104	1.69;1.69	4.73	-1.72	0.08107	SH2 motif (1);	1.086440	0.07179	N	0.853729	T	0.10723	0.0262	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31613	-0.9937	10	0.62326	D	0.03	.	0.7319	0.00958	0.3688:0.2544:0.2089:0.1679	.	222	P51451	BLK_HUMAN	P	222;222;151	ENSP00000259089:R222P;ENSP00000433663:R151P	ENSP00000259089:R222P	R	+	2	0	BLK	11450295	0.000000	0.05858	0.002000	0.10522	0.030000	0.12068	0.053000	0.14184	-0.086000	0.12550	-0.379000	0.06801	CGC		0.617	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1			13	63	0	0	0	0.001855	0	13	63				
GATA4	2626	broad.mit.edu	37	8	11606499	11606499	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:11606499C>T	ENST00000335135.4	+	3	1246	c.688C>T	c.(688-690)Cga>Tga	p.R230*	GATA4_ENST00000532059.1_Nonsense_Mutation_p.R231*|GATA4_ENST00000528712.1_Nonsense_Mutation_p.R24*	NM_002052.3	NP_002043.2	P43694	GATA4_HUMAN	GATA binding protein 4	230					atrial septum morphogenesis (GO:0060413)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle morphogenesis (GO:0003208)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion development (GO:0003197)|endoderm development (GO:0007492)|endoderm formation (GO:0001706)|epithelial cell fate commitment (GO:0072148)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|lung lobe formation (GO:0060464)|male gonad development (GO:0008584)|negative regulation of autophagy (GO:0010507)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to mechanical stimulus (GO:0009612)|seminiferous tubule development (GO:0072520)|Sertoli cell differentiation (GO:0060008)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(10)	13	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		GCTCTGGAGGCGAGATGGGAC	0.567																																							uc003wuc.2		NA																	0				central_nervous_system(1)	1						c.(688-690)CGA>TGA		GATA binding protein 4							125.0	116.0	119.0					8																	11606499		2203	4300	6503	SO:0001587	stop_gained	2626				atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr8:11606499C>T	AK097060	CCDS5983.1	8p23.1-p22	2013-01-25	2001-11-28		ENSG00000136574	ENSG00000136574		"""GATA zinc finger domain containing"""	4173	protein-coding gene	gene with protein product		600576	"""GATA-binding protein 4"""			7665171	Standard	NM_002052		Approved		uc003wuc.2	P43694	OTTHUMG00000090800	ENST00000335135.4:c.688C>T	8.37:g.11606499C>T	ENSP00000334458:p.Arg230*					GATA4_uc003wub.1_Nonsense_Mutation_p.R24*|GATA4_uc011kxc.1_Nonsense_Mutation_p.R231*	p.R230*	NM_002052	NP_002043	P43694	GATA4_HUMAN	STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)	3	1242	+	all_epithelial(15;0.0839)		230			GATA-type 1.		B7ZKX0|B7ZKZ4|Q3MJ45|Q5IFM8	Nonsense_Mutation	SNP	ENST00000335135.4	37	c.688C>T	CCDS5983.1	.	.	.	.	.	.	.	.	.	.	C	36	5.636846	0.96693	.	.	ENSG00000136574	ENST00000528712;ENST00000526716;ENST00000335135;ENST00000259090;ENST00000532059	.	.	.	5.61	3.8	0.43715	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6593	0.34081	0.2839:0.6434:0.0:0.0728	.	.	.	.	X	24;24;230;229;231	.	ENSP00000259090:R229X	R	+	1	2	GATA4	11643908	1.000000	0.71417	0.960000	0.40013	0.776000	0.43924	1.846000	0.39289	0.829000	0.34733	-0.181000	0.13052	CGA		0.567	GATA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207587.2	NM_002052		18	98	0	0	0	0.006122	0	18	98				
UNC5D	137970	broad.mit.edu	37	8	35624523	35624523	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:35624523T>A	ENST00000404895.2	+	15	2745	c.2417T>A	c.(2416-2418)aTc>aAc	p.I806N	UNC5D_ENST00000416672.1_Missense_Mutation_p.I811N|UNC5D_ENST00000453357.2_Missense_Mutation_p.I801N|UNC5D_ENST00000287272.2_Missense_Mutation_p.I737N|UNC5D_ENST00000420357.1_Missense_Mutation_p.I739N|UNC5D_ENST00000449677.1_Missense_Mutation_p.I382N	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	806					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TCCTGCAAAATCTGCATTCGG	0.557																																							uc003xjr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(2416-2418)ATC>AAC		unc-5 homolog D precursor							125.0	105.0	112.0					8																	35624523		2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35624523T>A	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2417T>A	8.37:g.35624523T>A	ENSP00000385143:p.Ile806Asn					UNC5D_uc003xjs.1_Missense_Mutation_p.I801N|UNC5D_uc003xju.1_Missense_Mutation_p.I382N	p.I806N	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	15	2745	+			806			Cytoplasmic (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.2417T>A	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	T	24.9	4.586926	0.86851	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.59364	0.3;0.73;0.72;0.31;0.27;2.19	5.83	4.66	0.58398	.	0.048165	0.85682	N	0.000000	T	0.74168	0.3681	M	0.78456	2.415	0.58432	D	0.999997	D;D;D	0.76494	0.994;0.999;0.998	P;D;D	0.68943	0.87;0.961;0.915	T	0.76958	-0.2766	10	0.87932	D	0	-25.0344	12.332	0.55046	0.1267:0.0:0.0:0.8733	.	382;801;806	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	N	806;739;737;811;801;382	ENSP00000385143:I806N;ENSP00000392739:I739N;ENSP00000287272:I737N;ENSP00000412652:I811N;ENSP00000394303:I801N;ENSP00000397211:I382N	ENSP00000287272:I737N	I	+	2	0	UNC5D	35744065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.009000	0.39289	0.533000	0.62120	ATC		0.557	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			5	59	0	0	0	0.000602	0	5	59				
FGFR1	2260	broad.mit.edu	37	8	38314957	38314957	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:38314957C>A	ENST00000447712.2	-	2	949	c.8G>T	c.(7-9)aGc>aTc	p.S3I	FGFR1_ENST00000335922.5_5'UTR|FGFR1_ENST00000356207.5_Missense_Mutation_p.S3I|FGFR1_ENST00000397091.5_Missense_Mutation_p.S3I|FGFR1_ENST00000397113.2_Missense_Mutation_p.S3I|FGFR1_ENST00000425967.3_Missense_Mutation_p.S36I|FGFR1_ENST00000532791.1_Missense_Mutation_p.S3I|FGFR1_ENST00000397108.4_Missense_Mutation_p.S3I|FGFR1_ENST00000341462.5_Missense_Mutation_p.S3I|FGFR1_ENST00000326324.6_Missense_Mutation_p.S3I|FGFR1_ENST00000397103.1_Missense_Mutation_p.S3I	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	3					angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GCACTTCCAGCTCCACATCCC	0.572		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														Melanoma(146;1153 1840 21453 21841 43625)	Melanoma(146;1153 1840 21453 21841 43625)	uc003xlp.2		1		Dom	yes		8	8p11.2-p11.1	2260	T	fibroblast growth factor receptor 1	yes	Pfeiffer syndrome|Kallman syndrome	L	BCR|FOP|ZNF198|CEP1		MPD|NHL		0				lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15						c.(7-9)AGC>ATC		fibroblast growth factor receptor 1 isoform 1	Palifermin(DB00039)						70.0	62.0	65.0					8																	38314957		2203	4300	6503	SO:0001583	missense	2260				axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity	g.chr8:38314957C>A	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.8G>T	8.37:g.38314957C>A	ENSP00000400162:p.Ser3Ile					FGFR1_uc011lbo.1_Missense_Mutation_p.S3I|FGFR1_uc011lbp.1_Missense_Mutation_p.S3I|FGFR1_uc011lbq.1_Missense_Mutation_p.S3I|FGFR1_uc010lwk.2_5'UTR|FGFR1_uc011lbs.1_5'UTR|FGFR1_uc011lbt.1_Missense_Mutation_p.S3I|FGFR1_uc011lbu.1_Missense_Mutation_p.S36I|FGFR1_uc011lbv.1_Missense_Mutation_p.S3I|FGFR1_uc011lbw.1_Missense_Mutation_p.S3I|FGFR1_uc011lbx.1_Missense_Mutation_p.S3I|FGFR1_uc003xlv.2_Missense_Mutation_p.S3I|FGFR1_uc003xlu.2_Missense_Mutation_p.S3I|FGFR1_uc003xlw.1_RNA	p.S3I	NM_023110	NP_075598	P11362	FGFR1_HUMAN	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		2	950	-	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	3					A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	ENST00000447712.2	37	c.8G>T	CCDS6107.2	.	.	.	.	.	.	.	.	.	.	C	16.31	3.088447	0.55968	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000356207;ENST00000326324;ENST00000397103;ENST00000397108;ENST00000326296;ENST00000525001;ENST00000526742;ENST00000529552;ENST00000530568;ENST00000434187;ENST00000413133	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.79940	-1.19;-1.21;-1.21;-1.2;-1.22;-1.19;-1.32;-1.3;-1.31;-1.19;-1.06;-1.09;-1.1;-0.96;-0.27;-1.27	5.46	5.46	0.80206	.	0.425981	0.27172	N	0.020592	T	0.79639	0.4480	N	0.12182	0.205	0.25256	N	0.989634	P;B;B;P;B;B;D;B;D;P;B	0.63880	0.954;0.299;0.276;0.492;0.198;0.011;0.993;0.059;0.992;0.835;0.098	P;B;B;B;B;B;P;B;D;P;B	0.68192	0.467;0.012;0.153;0.232;0.008;0.005;0.851;0.033;0.956;0.474;0.073	T	0.73164	-0.4069	10	0.62326	D	0.03	.	12.5617	0.56286	0.0:0.8328:0.1672:0.0	.	3;3;3;36;3;3;3;3;3;3;3	B5A959;P11362-3;P11362-7;P11362-21;B5A958;P11362-14;P11362-4;P11362;P11362-16;P11362-18;P11362-2	.;.;.;.;.;.;.;FGFR1_HUMAN;.;.;.	I	3;36;3;3;3;3;3;3;3;3;3;3;3;3;3;3;3;3	ENSP00000380280:S3I;ENSP00000393312:S36I;ENSP00000400162:S3I;ENSP00000340636:S3I;ENSP00000432972:S3I;ENSP00000380302:S3I;ENSP00000348537:S3I;ENSP00000327229:S3I;ENSP00000380292:S3I;ENSP00000380297:S3I;ENSP00000434712:S3I;ENSP00000433569:S3I;ENSP00000435283:S3I;ENSP00000434473:S3I;ENSP00000392645:S3I;ENSP00000400708:S3I	ENSP00000311337:S3I	S	-	2	0	FGFR1	38434114	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.447000	0.44917	2.562000	0.86427	0.462000	0.41574	AGC		0.572	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				24	13	1	0	1.64293e-13	0.00333	2.06822e-13	24	13				
PXDNL	137902	broad.mit.edu	37	8	52336147	52336147	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:52336147G>C	ENST00000356297.4	-	14	1883	c.1783C>G	c.(1783-1785)Ctt>Gtt	p.L595V	PXDNL_ENST00000543296.1_Missense_Mutation_p.L595V	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	595	Ig-like C2-type 4.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTGACTGTAAGAAACATGTTG	0.453																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(1783-1785)CTT>GTT		peroxidasin homolog-like precursor							101.0	106.0	104.0					8																	52336147		2070	4222	6292	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52336147G>C		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1783C>G	8.37:g.52336147G>C	ENSP00000348645:p.Leu595Val						p.L595V	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN			14	1884	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	595			Ig-like C2-type 4.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.1783C>G	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.155303	0.38021	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	D;D	0.85171	-1.95;-1.95	4.59	3.71	0.42584	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85208	0.5644	L	0.48986	1.54	0.32950	D	0.519543	P	0.51351	0.944	P	0.55303	0.773	D	0.83794	0.0232	9	0.21540	T	0.41	.	9.0433	0.36331	0.1054:0.0:0.8946:0.0	.	595	A1KZ92	PXDNL_HUMAN	V	595	ENSP00000348645:L595V;ENSP00000444865:L595V	ENSP00000348645:L595V	L	-	1	0	PXDNL	52498700	1.000000	0.71417	0.021000	0.16686	0.055000	0.15305	5.020000	0.64066	1.029000	0.39812	0.650000	0.86243	CTT		0.453	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		10	15	0	0	0	0.008291	0	10	15				
PRDM14	63978	broad.mit.edu	37	8	70980575	70980575	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:70980575C>A	ENST00000276594.2	-	4	1003	c.802G>T	c.(802-804)Gtg>Ttg	p.V268L		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	268	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CTGCAGAACACACCAAAATGT	0.478																																					NSCLC(129;99 1813 5906 40656 46114)	NSCLC(129;99 1813 5906 40656 46114)	uc003xym.2		NA																	0				ovary(3)	3						c.(802-804)GTG>TTG		PR domain containing 14							95.0	87.0	90.0					8																	70980575		2203	4300	6503	SO:0001583	missense	63978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:70980575C>A	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.802G>T	8.37:g.70980575C>A	ENSP00000276594:p.Val268Leu						p.V268L	NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)		4	1004	-	Breast(64;0.193)		268			SET.		Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	c.802G>T	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.920626	0.73213	.	.	ENSG00000147596	ENST00000276594	D	0.81739	-1.53	5.12	5.12	0.69794	SET domain (3);	0.000000	0.45361	D	0.000368	D	0.90913	0.7144	M	0.87180	2.865	0.54753	D	0.999982	D	0.71674	0.998	D	0.71184	0.972	D	0.92278	0.5831	10	0.87932	D	0	-21.0885	18.3636	0.90383	0.0:1.0:0.0:0.0	.	268	Q9GZV8	PRD14_HUMAN	L	268	ENSP00000276594:V268L	ENSP00000276594:V268L	V	-	1	0	PRDM14	71143129	1.000000	0.71417	0.962000	0.40283	0.160000	0.22226	5.489000	0.66875	2.651000	0.90000	0.650000	0.86243	GTG		0.478	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			14	16	1	0	0.000151284	0.001855	0.000165233	14	16				
PI15	51050	broad.mit.edu	37	8	75756296	75756296	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:75756296G>A	ENST00000260113.2	+	3	533	c.354G>A	c.(352-354)ctG>ctA	p.L118L	RP11-758M4.4_ENST00000522914.1_RNA|RP11-758M4.4_ENST00000523860.1_RNA|PI15_ENST00000523773.1_Silent_p.L118L|RP11-758M4.4_ENST00000518128.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	118	SCP.					extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			CTTACTTACTGAGATTTTTGG	0.423																																							uc003yal.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(352-354)CTG>CTA		protease inhibitor 15 preproprotein							159.0	154.0	156.0					8																	75756296		2203	4300	6503	SO:0001819	synonymous_variant	51050					extracellular region	peptidase inhibitor activity	g.chr8:75756296G>A	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.354G>A	8.37:g.75756296G>A						uc003yak.1_Intron|PI15_uc003yam.2_Silent_p.L118L	p.L118L	NM_015886	NP_056970	O43692	PI15_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)		3	533	+	Breast(64;0.137)		118					Q68CY1	Silent	SNP	ENST00000260113.2	37	c.354G>A	CCDS6218.1																																																																																				0.423	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886		7	40	0	0	0	0.00308	0	7	40				
ZFHX4	79776	broad.mit.edu	37	8	77690655	77690655	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:77690655A>T	ENST00000521891.2	+	4	3753	c.3305A>T	c.(3304-3306)gAt>gTt	p.D1102V	ZFHX4_ENST00000518282.1_Missense_Mutation_p.D1076V|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D1076V|ZFHX4_ENST00000517683.1_3'UTR|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D1076V	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1076					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTTGTTAAAGATTGCCCACCA	0.527										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(3226-3228)GAT>GTT		zinc finger homeodomain 4							97.0	106.0	103.0					8																	77690655		1996	4169	6165	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77690655A>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3305A>T	8.37:g.77690655A>T	ENSP00000430497:p.Asp1102Val	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.D1102V|ZFHX4_uc003yaw.1_Missense_Mutation_p.D1076V	p.D1076V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		4	3614	+			1076					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.3227A>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	9.947	1.219092	0.22373	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.22	5.22	0.72569	.	0.141869	0.31507	U	0.007538	T	0.44307	0.1287	L	0.50333	1.59	0.80722	D	1	P;P;P	0.44478	0.747;0.836;0.836	B;P;P	0.45276	0.283;0.475;0.475	T	0.33854	-0.9852	10	0.38643	T	0.18	.	15.5609	0.76244	1.0:0.0:0.0:0.0	.	1076;1076;1102	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	V	1102;1102;1076;1076;1076	ENSP00000430497:D1102V;ENSP00000399605:D1076V;ENSP00000050961:D1076V;ENSP00000430848:D1076V	ENSP00000050961:D1076V	D	+	2	0	ZFHX4	77853210	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.087000	0.94110	2.320000	0.78422	0.528000	0.53228	GAT		0.527	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		3	49	0	0	0	0.009096	0	3	49				
ZFPM2	23414	broad.mit.edu	37	8	106814840	106814840	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:106814840A>T	ENST00000407775.2	+	8	2780	c.2530A>T	c.(2530-2532)Acc>Tcc	p.T844S	ZFPM2_ENST00000520492.1_Missense_Mutation_p.T712S|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.T575S|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.T712S	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	844					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TGAGCGGACGACCACGTCTCC	0.458																																							uc003ymd.2		NA																	0				ovary(4)|large_intestine(1)	5						c.(2530-2532)ACC>TCC		zinc finger protein, multitype 2							49.0	44.0	46.0					8																	106814840		1956	4166	6122	SO:0001583	missense	23414				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding	g.chr8:106814840A>T	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2530A>T	8.37:g.106814840A>T	ENSP00000384179:p.Thr844Ser					ZFPM2_uc011lhs.1_Missense_Mutation_p.T575S	p.T844S	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)		8	2553	+			844					Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	c.2530A>T	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	A	1.583	-0.531076	0.04112	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.17370	2.28;2.78;2.78;3.98	5.86	4.66	0.58398	.	0.135969	0.64402	N	0.000002	T	0.05410	0.0143	N	0.02011	-0.69	0.24779	N	0.992824	B	0.02656	0.0	B	0.01281	0.0	T	0.37888	-0.9686	10	0.08837	T	0.75	.	8.6656	0.34118	0.6209:0.0:0.0:0.3791	.	844	Q8WW38	FOG2_HUMAN	S	844;712;712;575	ENSP00000384179:T844S;ENSP00000430757:T712S;ENSP00000428720:T712S;ENSP00000367733:T575S	ENSP00000367733:T575S	T	+	1	0	ZFPM2	106884016	0.994000	0.37717	0.047000	0.18901	0.988000	0.76386	3.688000	0.54699	2.241000	0.73720	0.533000	0.62120	ACC		0.458	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			5	15	0	0	0	0.000602	0	5	15				
GPR20	2843	broad.mit.edu	37	8	142367614	142367614	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:142367614G>A	ENST00000377741.3	-	2	500	c.410C>T	c.(409-411)tCc>tTc	p.S137F	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	137					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			GAAGAGGATGGAGCAGTGCAT	0.682																																							uc003ywf.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(409-411)TCC>TTC		G protein-coupled receptor 20							63.0	66.0	65.0					8																	142367614		2203	4300	6503	SO:0001583	missense	2843					integral to plasma membrane	G-protein coupled receptor activity	g.chr8:142367614G>A	U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.410C>T	8.37:g.142367614G>A	ENSP00000366970:p.Ser137Phe						p.S137F	NM_005293	NP_005284	Q99678	GPR20_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0415)		2	499	-	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		137			Helical; Name=3; (Potential).		Q17R96	Missense_Mutation	SNP	ENST00000377741.3	37	c.410C>T	CCDS34949.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425165	0.83667	.	.	ENSG00000204882	ENST00000377741	T	0.56103	0.48	4.84	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.116646	0.53938	D	0.000060	T	0.81531	0.4842	H	0.98507	4.25	0.49051	D	0.999743	D	0.89917	1.0	D	0.97110	1.0	D	0.87226	0.2257	10	0.87932	D	0	-54.3277	11.7555	0.51872	0.0:0.3645:0.6355:0.0	.	137	Q99678	GPR20_HUMAN	F	137	ENSP00000366970:S137F	ENSP00000366970:S137F	S	-	2	0	GPR20	142436796	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.952000	0.49097	2.248000	0.74166	0.561000	0.74099	TCC		0.682	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378968.1	NM_005293		17	47	0	0	0	0.004007	0	17	47				
LYPD2	137797	broad.mit.edu	37	8	143832527	143832527	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:143832527G>T	ENST00000359228.3	-	2	202	c.120C>A	c.(118-120)atC>atA	p.I40I		NM_205545.1	NP_991108.1	Q6UXB3	LYPD2_HUMAN	LY6/PLAUR domain containing 2	40	UPAR/Ly6.					anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					TGCAGGTGGCGATGGTGACAC	0.657																																							uc003ywz.2		NA																	0					0						c.(118-120)ATC>ATA		LY6/PLAUR domain containing 2 precursor							260.0	206.0	224.0					8																	143832527		2203	4300	6503	SO:0001819	synonymous_variant	137797					anchored to membrane|plasma membrane		g.chr8:143832527G>T	AY358432	CCDS6388.1	8q24.3	2005-08-30		2005-08-30	ENSG00000197353	ENSG00000197353			25215	protein-coding gene	gene with protein product				LYPDC2		12975309	Standard	NM_205545		Approved	RGTR430, UNQ430	uc003ywz.3	Q6UXB3	OTTHUMG00000164686	ENST00000359228.3:c.120C>A	8.37:g.143832527G>T							p.I40I	NM_205545	NP_991108	Q6UXB3	LYPD2_HUMAN			2	203	-	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		40			UPAR/Ly6.		A8K2R6|Q0VD64|Q0VF31	Silent	SNP	ENST00000359228.3	37	c.120C>A	CCDS6388.1																																																																																				0.657	LYPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379742.1	NM_205545		23	150	1	0	3.5997e-14	0.014323	4.65843e-14	23	150				
RANBP6	26953	broad.mit.edu	37	9	6013819	6013819	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:6013819A>C	ENST00000259569.5	-	1	1799	c.1789T>G	c.(1789-1791)Tca>Gca	p.S597A	RANBP6_ENST00000485372.1_5'UTR	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	597					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		TTTAAGTCTGATTGTGTCTTC	0.368																																							uc003zjr.2		NA																	0				ovary(3)	3						c.(1789-1791)TCA>GCA		RAN binding protein 6							163.0	160.0	161.0					9																	6013819		2203	4300	6503	SO:0001583	missense	26953				protein transport	cytoplasm|nucleus	binding	g.chr9:6013819A>C	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.1789T>G	9.37:g.6013819A>C	ENSP00000259569:p.Ser597Ala					RANBP6_uc011lmf.1_Missense_Mutation_p.S245A|RANBP6_uc003zjs.2_Missense_Mutation_p.S185A	p.S597A	NM_012416	NP_036548	O60518	RNBP6_HUMAN		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)	1	1800	-		Acute lymphoblastic leukemia(23;0.158)	597					Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	c.1789T>G	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	A	8.551	0.875597	0.17395	.	.	ENSG00000137040	ENST00000259569	T	0.25749	1.78	4.39	0.382	0.16234	Armadillo-type fold (1);	0.058085	0.64402	U	0.000002	T	0.11623	0.0283	N	0.14661	0.345	0.30898	N	0.729572	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.27331	-1.0077	10	0.15499	T	0.54	-6.9147	8.5186	0.33262	0.397:0.0:0.0:0.603	.	185;597	B4DTX6;O60518	.;RNBP6_HUMAN	A	597	ENSP00000259569:S597A	ENSP00000259569:S597A	S	-	1	0	RANBP6	6003819	0.995000	0.38212	0.998000	0.56505	0.984000	0.73092	2.714000	0.47202	0.293000	0.22520	-0.309000	0.09137	TCA		0.368	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416		8	59	0	0	0	0.004482	0	8	59				
SPATA31A6	389730	broad.mit.edu	37	9	43627428	43627428	+	Missense_Mutation	SNP	G	G	A	rs11261835	byFrequency	TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:43627428G>A	ENST00000332857.6	-	4	1287	c.1259C>T	c.(1258-1260)cCc>cTc	p.P420L	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	420					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P420L(1)									GTGCAGAGAGGGGAGGCCCCA	0.498													G|||	2290	0.457268	0.3593	0.4424	5008	,	,		13778	0.6508		0.4891	False		,,,				2504	0.3681						uc011lrb.1		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(1258-1260)CCC>CTC		hypothetical protein LOC389730							4.0	6.0	5.0					9																	43627428		577	1492	2069	SO:0001583	missense	389730					integral to membrane		g.chr9:43627428G>A		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1259C>T	9.37:g.43627428G>A	ENSP00000329825:p.Pro420Leu						p.P420L	NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN			4	1288	-			420						Missense_Mutation	SNP	ENST00000332857.6	37	c.1259C>T	CCDS47973.1	1071	0.49038461538461536	187	0.3800813008130081	164	0.4530386740331492	357	0.6241258741258742	363	0.4788918205804749	G	16.62	3.174501	0.57692	.	.	ENSG00000185775	ENST00000332857	T	0.64618	-0.11	2.56	2.56	0.30785	.	0.000000	0.52532	D	0.000070	T	0.00012	0.0000	M	0.62154	1.92	0.26385	P	0.9766778	D	0.89917	1.0	D	0.97110	1.0	T	0.49986	-0.8880	9	0.87932	D	0	-6.7679	8.8215	0.35030	0.0:0.0:1.0:0.0	rs11261835	420	Q5VVP1	F75A6_HUMAN	L	420	ENSP00000329825:P420L	ENSP00000329825:P420L	P	-	2	0	FAM75A6	43567424	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.801000	0.47908	1.746000	0.51805	0.449000	0.29647	CCC		0.498	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		4	35	0	0	0	0.009096	0	4	35				
MAMDC2	256691	broad.mit.edu	37	9	72783656	72783656	+	Silent	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:72783656T>C	ENST00000377182.4	+	10	2060	c.1443T>C	c.(1441-1443)tgT>tgC	p.C481C	MAMDC2-AS1_ENST00000591368.1_RNA|MAMDC2_ENST00000460688.1_3'UTR|MAMDC2-AS1_ENST00000448377.3_RNA|MAMDC2-AS1_ENST00000535188.1_RNA|MAMDC2-AS1_ENST00000377178.3_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	481	MAM 3. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						TCTGGGACTGTGGGCTTGTAG	0.398																																							uc004ahm.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(1441-1443)TGT>TGC		MAM domain containing 2 precursor							165.0	158.0	160.0					9																	72783656		2203	4300	6503	SO:0001819	synonymous_variant	256691					endoplasmic reticulum|membrane		g.chr9:72783656T>C	BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1443T>C	9.37:g.72783656T>C						MAMDC2_uc004ahn.2_RNA|uc004aho.1_Intron	p.C481C	NM_153267	NP_694999	Q7Z304	MAMC2_HUMAN			10	2060	+			481			MAM 3.		Q5VW47|Q8WX43|Q96BM4	Silent	SNP	ENST00000377182.4	37	c.1443T>C	CCDS6631.1																																																																																				0.398	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	NM_153267		6	12	0	0	0	0.001168	0	6	12				
PRUNE2	158471	broad.mit.edu	37	9	79322624	79322624	+	Silent	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:79322624A>T	ENST00000376718.3	-	8	4689	c.4566T>A	c.(4564-4566)ctT>ctA	p.L1522L	PRUNE2_ENST00000428286.1_Silent_p.L1163L	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1522					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CGGCTCCTGGAAGGCTATTTT	0.418																																							uc010mpk.2		NA																	0					0						c.(4564-4566)CTT>CTA		prune homolog 2							54.0	49.0	51.0					9																	79322624		1568	3582	5150	SO:0001819	synonymous_variant	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79322624A>T	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4566T>A	9.37:g.79322624A>T							p.L1522L	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN			8	4690	-			1522					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	c.4566T>A	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	A	4.439	0.081174	0.08533	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.61	4.44	0.53790	.	.	.	.	.	T	0.35008	0.0917	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.21518	-1.0243	4	.	.	.	0.1577	7.0296	0.24960	0.775:0.1499:0.0751:0.0	.	.	.	.	T	844	.	.	S	-	1	0	PRUNE2	78512444	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	0.947000	0.29082	1.027000	0.39758	0.533000	0.62120	TCC		0.418	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		16	14	0	0	0	0.003163	0	16	14				
SUSD3	203328	broad.mit.edu	37	9	95846817	95846817	+	Splice_Site	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:95846817A>T	ENST00000375472.3	+	5	593		c.e5-1		SUSD3_ENST00000375469.1_Splice_Site	NM_145006.2	NP_659443.1	Q96L08	SUSD3_HUMAN	sushi domain containing 3							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	13						CTCTCTCCACAGAGACCATGG	0.602																																							uc004atb.2		NA																	0				breast(2)|skin(2)|ovary(1)|lung(1)	6						c.e5-2		sushi domain containing 3							79.0	77.0	78.0					9																	95846817		2203	4300	6503	SO:0001630	splice_region_variant	203328					integral to membrane		g.chr9:95846817A>T	AK128289	CCDS6701.1, CCDS69620.1, CCDS75857.1	9q22.32	2004-01-29			ENSG00000157303	ENSG00000157303			28391	protein-coding gene	gene with protein product						12975309	Standard	NM_001287007		Approved	MGC26847	uc004atb.3	Q96L08	OTTHUMG00000020241	ENST00000375472.3:c.558-1A>T	9.37:g.95846817A>T						SUSD3_uc004atc.2_Splice_Site_p.T173_splice	p.T186_splice	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN			5	594	+								Q49AA6|Q6UXV7	Splice_Site	SNP	ENST00000375472.3	37	c.558_splice	CCDS6701.1	.	.	.	.	.	.	.	.	.	.	A	11.86	1.765771	0.31228	.	.	ENSG00000157303	ENST00000375472;ENST00000375469	.	.	.	4.07	2.94	0.34122	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3105	0.21163	0.8888:0.0:0.1112:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SUSD3	94886638	1.000000	0.71417	0.997000	0.53966	0.543000	0.35085	3.322000	0.52007	0.927000	0.37143	-0.379000	0.06801	.		0.602	SUSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053120.1	NM_145006	Intron	18	27	0	0	0	0.008871	0	18	27				
GABBR2	9568	broad.mit.edu	37	9	101148033	101148033	+	Silent	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:101148033T>C	ENST00000259455.2	-	11	2010	c.1551A>G	c.(1549-1551)ccA>ccG	p.P517P		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	517					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TGTTCATGTATGGACTCGACA	0.383																																							uc004ays.2		NA																	0				ovary(2)|skin(2)	4						c.(1549-1551)CCA>CCG		G protein-coupled receptor 51 precursor	Baclofen(DB00181)						155.0	139.0	145.0					9																	101148033		2203	4300	6503	SO:0001819	synonymous_variant	9568				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr9:101148033T>C	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.1551A>G	9.37:g.101148033T>C							p.P517P	NM_005458	NP_005449	O75899	GABR2_HUMAN			11	1707	-		Acute lymphoblastic leukemia(62;0.0527)	517			Cytoplasmic (Potential).		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	ENST00000259455.2	37	c.1551A>G	CCDS6736.1																																																																																				0.383	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1			8	19	0	0	0	0.00308	0	8	19				
OR13C8	138802	broad.mit.edu	37	9	107332000	107332000	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:107332000C>A	ENST00000335040.1	+	1	552	c.552C>A	c.(550-552)atC>atA	p.I184I		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						TTCTGGCTATCTTGAAACTGG	0.383																																							uc011lvo.1		NA																	0				ovary(1)|skin(1)	2						c.(550-552)ATC>ATA		olfactory receptor, family 13, subfamily C,							173.0	168.0	170.0					9																	107332000		2203	4300	6503	SO:0001819	synonymous_variant	138802				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107332000C>A		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.552C>A	9.37:g.107332000C>A							p.I184I	NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN			1	552	+			184			Extracellular (Potential).		Q5VVG0|Q96R44	Silent	SNP	ENST00000335040.1	37	c.552C>A	CCDS35090.1																																																																																				0.383	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1			16	45	1	0	8.60227e-14	0.004007	1.09786e-13	16	45				
PTGS1	5742	broad.mit.edu	37	9	125154703	125154703	+	Silent	SNP	G	G	T	rs199581775		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:125154703G>T	ENST00000362012.2	+	11	1685	c.1680G>T	c.(1678-1680)acG>acT	p.T560T	PTGS1_ENST00000373698.5_Silent_p.T451T|PTGS1_ENST00000540753.1_Silent_p.T498T|PTGS1_ENST00000223423.4_Silent_p.T523T	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	560					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTGTCAAGACGGCCACACTGA	0.567																																							uc004bmg.1		NA																	0				ovary(1)|skin(1)	2						c.(1678-1680)ACG>ACT		prostaglandin-endoperoxide synthase 1 isoform 1	Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dipyrone(DB04817)|Etodolac(DB00749)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Mesalazine(DB00244)|Minoxidil(DB00350)|Nabumetone(DB00461)|Naproxen(DB00788)|Phenacetin(DB03783)|Piroxicam(DB00554)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Tolmetin(DB00500)						112.0	103.0	106.0					9																	125154703		2203	4300	6503	SO:0001819	synonymous_variant	5742				cyclooxygenase pathway|hormone biosynthetic process|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum membrane|Golgi apparatus|microsome|plasma membrane	heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity	g.chr9:125154703G>T	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1680G>T	9.37:g.125154703G>T						PTGS1_uc011lys.1_Silent_p.T498T|PTGS1_uc010mwb.1_Silent_p.T414T|PTGS1_uc004bmf.1_Silent_p.T523T|PTGS1_uc004bmh.1_Silent_p.T451T|PTGS1_uc011lyt.1_Silent_p.T451T	p.T560T	NM_000962	NP_000953	P23219	PGH1_HUMAN			11	1815	+			560					A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Silent	SNP	ENST00000362012.2	37	c.1680G>T	CCDS6842.1																																																																																				0.567	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1			11	56	1	0	3.86212e-05	0.008291	4.23824e-05	11	56				
SARDH	1757	broad.mit.edu	37	9	136582475	136582475	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:136582475C>T	ENST00000371872.4	-	8	1380	c.1123G>A	c.(1123-1125)Gga>Aga	p.G375R	SARDH_ENST00000439388.1_Missense_Mutation_p.G375R|SARDH_ENST00000422262.2_Missense_Mutation_p.G207R	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	375					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GACTTGATTCCTGTCTTCTCC	0.587																																							uc004cep.3		NA																	0					0						c.(1123-1125)GGA>AGA		sarcosine dehydrogenase precursor							119.0	109.0	113.0					9																	136582475		2203	4300	6503	SO:0001583	missense	1757				glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity	g.chr9:136582475C>T		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1123G>A	9.37:g.136582475C>T	ENSP00000360938:p.Gly375Arg					SARDH_uc004ceo.2_Missense_Mutation_p.G375R|SARDH_uc011mdn.1_Missense_Mutation_p.G375R|SARDH_uc011mdo.1_Missense_Mutation_p.G207R	p.G375R	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)	8	1257	-			375					B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	c.1123G>A	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384884	0.61956	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227;ENST00000535281	T;T;T	0.80304	-1.36;-1.36;-1.36	3.95	3.95	0.45737	FAD dependent oxidoreductase (1);	0.125306	0.52532	D	0.000062	D	0.90277	0.6959	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92411	0.5937	10	0.87932	D	0	-27.1688	16.0188	0.80464	0.0:1.0:0.0:0.0	.	375	Q9UL12	SARDH_HUMAN	R	375;375;207;375;375;375	ENSP00000360938:G375R;ENSP00000403084:G375R;ENSP00000415537:G207R	ENSP00000360938:G375R	G	-	1	0	SARDH	135572296	1.000000	0.71417	0.697000	0.30258	0.123000	0.20343	7.704000	0.84595	1.760000	0.52011	0.462000	0.41574	GGA		0.587	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1			15	41	0	0	0	0.00499	0	15	41				
SOHLH1	402381	broad.mit.edu	37	9	138588558	138588558	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr9:138588558G>T	ENST00000298466.5	-	5	621	c.561C>A	c.(559-561)tcC>tcA	p.S187S	SOHLH1_ENST00000425225.1_Silent_p.S187S	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	187					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CCCACTGCCTGGAGGACGCAA	0.652																																							uc004cgl.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(559-561)TCC>TCA		spermatogenesis and oogenesis specific basic							56.0	54.0	55.0					9																	138588558		2203	4300	6503	SO:0001819	synonymous_variant	402381				cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr9:138588558G>T	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.561C>A	9.37:g.138588558G>T						SOHLH1_uc010nbe.2_Silent_p.S187S	p.S187S	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)	5	622	-		Myeloproliferative disorder(178;0.0511)	187					C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Silent	SNP	ENST00000298466.5	37	c.561C>A	CCDS35174.1																																																																																				0.652	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415		13	23	1	0	1.5842e-08	0.001855	1.87667e-08	13	23				
VCX	26609	broad.mit.edu	37	X	7811644	7811644	+	Missense_Mutation	SNP	G	G	A	rs199801261		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:7811644G>A	ENST00000381059.3	+	3	427	c.208G>A	c.(208-210)Gcg>Acg	p.A70T	VCX_ENST00000341408.4_Missense_Mutation_p.A70T	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	70			A -> G (in dbSNP:rs6639946). {ECO:0000269|PubMed:10607842, ECO:0000269|PubMed:15489334}.		chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GGCGGAGAGCGCGCCAGCGGC	0.692																																							uc004crz.2		NA																	0					0						c.(208-210)GCG>ACG		variable charge, X chromosome							8.0	11.0	10.0					X																	7811644		1996	3724	5720	SO:0001583	missense	26609				chromatin organization|ribosome assembly|spermatogenesis	nucleolus	chromatin binding	g.chrX:7811644G>A	AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.208G>A	X.37:g.7811644G>A	ENSP00000370447:p.Ala70Thr						p.A70T	NM_013452	NP_038480	Q9H320	VCX1_HUMAN			3	427	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	70	A -> G (in Ref. 2; AAF28174).				A0JNS5|Q4V774|Q9P0H3	Missense_Mutation	SNP	ENST00000381059.3	37	c.208G>A	CCDS14128.1	.	.	.	.	.	.	.	.	.	.	-	12.46	1.945570	0.34377	.	.	ENSG00000182583	ENST00000381059;ENST00000341408	T;T	0.17213	2.29;2.29	0.167	0.167	0.15006	.	.	.	.	.	T	0.05456	0.0144	N	0.08118	0	0.09310	N	0.999996	B	0.34290	0.447	B	0.16722	0.016	T	0.38200	-0.9672	9	0.12430	T	0.62	.	6.1566	0.20340	4.0E-4:0.0:0.9996:0.0	.	70	Q9H320	VCX1_HUMAN	T	70	ENSP00000370447:A70T;ENSP00000344144:A70T	ENSP00000344144:A70T	A	+	1	0	VCX	7771644	0.006000	0.16342	0.009000	0.14445	0.009000	0.06853	1.341000	0.33907	0.270000	0.21984	0.274000	0.19336	GCG		0.692	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071474.1	NM_013452		3	9	0	0	0	0.009096	0	3	9				
ATXN3L	92552	broad.mit.edu	37	X	13337384	13337384	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:13337384G>T	ENST00000380622.2	-	1	1134	c.670C>A	c.(670-672)Caa>Aaa	p.Q224K	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	224					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TCCTCATCTTGGTCTGATGTT	0.383																																							uc010ned.2		NA																	0				lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(670-672)CAA>AAA		ataxin 3-like							251.0	231.0	237.0					X																	13337384		1568	3582	5150	SO:0001583	missense	92552				protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity	g.chrX:13337384G>T		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.670C>A	X.37:g.13337384G>T	ENSP00000369996:p.Gln224Lys						p.Q224K	NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN			1	1135	-			224			UIM 1.		B2RNY8	Missense_Mutation	SNP	ENST00000380622.2	37	c.670C>A	CCDS48080.1	.	.	.	.	.	.	.	.	.	.	g	6.548	0.469354	0.12461	.	.	ENSG00000123594	ENST00000380622	T	0.16457	2.34	0.652	-1.3	0.09259	Ubiquitin interacting motif (3);	0.154734	0.64402	D	0.000020	T	0.06690	0.0171	N	0.08118	0	0.26826	N	0.968684	B	0.11235	0.004	B	0.17098	0.017	T	0.17137	-1.0379	10	0.56958	D	0.05	.	3.5666	0.07903	0.0:0.5116:0.2621:0.2263	.	224	Q9H3M9	ATX3L_HUMAN	K	224	ENSP00000369996:Q224K	ENSP00000369996:Q224K	Q	-	1	0	ATXN3L	13247305	1.000000	0.71417	0.001000	0.08648	0.002000	0.02628	1.836000	0.39191	-1.103000	0.03019	-0.608000	0.04076	CAA		0.383	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995		68	228	1	0	4.98926e-31	0.01441	7.20324e-31	68	228				
MAGEB6	158809	broad.mit.edu	37	X	26212723	26212723	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:26212723G>A	ENST00000379034.1	+	2	909	c.760G>A	c.(760-762)Gaa>Aaa	p.E254K		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	254	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						TGAATTGAAAGAAATGGATTC	0.527																																							uc004dbr.2		NA																	0				ovary(3)	3						c.(760-762)GAA>AAA		melanoma antigen family B, 6							70.0	59.0	63.0					X																	26212723		2202	4300	6502	SO:0001583	missense	158809							g.chrX:26212723G>A	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.760G>A	X.37:g.26212723G>A	ENSP00000368320:p.Glu254Lys					MAGEB6_uc010ngc.1_Missense_Mutation_p.E34K	p.E254K	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN			2	909	+			254			MAGE.		Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	c.760G>A	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362713	0.41902	.	.	ENSG00000176746	ENST00000379034	T	0.08634	3.07	3.1	2.24	0.28232	.	0.129052	0.49916	U	0.000130	T	0.22003	0.0530	M	0.83852	2.665	0.09310	N	1	P	0.50943	0.94	P	0.60117	0.869	T	0.02805	-1.1108	10	0.56958	D	0.05	.	5.4584	0.16604	0.158:0.0:0.842:0.0	.	254	Q8N7X4	MAGB6_HUMAN	K	254	ENSP00000368320:E254K	ENSP00000368320:E254K	E	+	1	0	MAGEB6	26122644	0.067000	0.21026	0.004000	0.12327	0.001000	0.01503	1.308000	0.33528	0.712000	0.32039	-0.198000	0.12761	GAA		0.527	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		20	53	0	0	0	0.008871	0	20	53				
MAGEB10	139422	broad.mit.edu	37	X	27840147	27840147	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:27840147G>T	ENST00000356790.2	+	3	969	c.724G>T	c.(724-726)Ggg>Tgg	p.G242W		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	242	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						CTTCATGTTTGGGGAGCCCAG	0.453																																							uc004dbw.2		NA																	0				lung(1)|breast(1)|central_nervous_system(1)	3						c.(724-726)GGG>TGG		melanoma antigen family B, 10							49.0	47.0	48.0					X																	27840147		2202	4300	6502	SO:0001583	missense	139422							g.chrX:27840147G>T		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.724G>T	X.37:g.27840147G>T	ENSP00000368304:p.Gly242Trp						p.G242W	NM_182506	NP_872312	Q96LZ2	MAGBA_HUMAN			3	951	+			242			MAGE.		Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	37	c.724G>T	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253421	0.39797	.	.	ENSG00000177689	ENST00000356790	T	0.06218	3.33	2.17	2.17	0.27698	.	0.000000	0.85682	U	0.000000	T	0.28101	0.0693	M	0.93507	3.425	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.04090	-1.0978	10	0.87932	D	0	.	7.0396	0.25013	0.0:0.0:1.0:0.0	.	242	Q96LZ2	MAGBA_HUMAN	W	242	ENSP00000368304:G242W	ENSP00000368304:G242W	G	+	1	0	MAGEB10	27750068	0.010000	0.17322	0.008000	0.14137	0.294000	0.27393	1.141000	0.31528	1.344000	0.45657	0.422000	0.28245	GGG		0.453	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1	NM_182506		11	29	1	0	3.86212e-05	0.008291	4.23824e-05	11	29				
DMD	1756	broad.mit.edu	37	X	31792208	31792208	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:31792208C>G	ENST00000357033.4	-	51	7617	c.7411G>C	c.(7411-7413)Gct>Cct	p.A2471P	DMD_ENST00000541735.1_Missense_Mutation_p.A11P|DMD_ENST00000378707.3_Missense_Mutation_p.A11P|DMD_ENST00000359836.1_Missense_Mutation_p.A11P|DMD_ENST00000343523.2_Missense_Mutation_p.A11P|DMD_ENST00000474231.1_Missense_Mutation_p.A11P|DMD_ENST00000378677.2_Missense_Mutation_p.A2467P	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2471					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTGCCAGAGCAGGTACCTCC	0.468																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(7411-7413)GCT>CCT		dystrophin Dp427m isoform							103.0	88.0	93.0					X																	31792208		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:31792208C>G	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.7411G>C	X.37:g.31792208C>G	ENSP00000354923:p.Ala2471Pro					DMD_uc004dcr.1_Missense_Mutation_p.A11P|DMD_uc004dcs.1_Missense_Mutation_p.A11P|DMD_uc004dct.1_Missense_Mutation_p.A11P|DMD_uc004dcu.1_Missense_Mutation_p.A11P|DMD_uc004dcv.1_Missense_Mutation_p.A11P|DMD_uc004dcw.2_Missense_Mutation_p.A1127P|DMD_uc004dcx.2_Missense_Mutation_p.A1130P|DMD_uc004dcz.2_Missense_Mutation_p.A2348P|DMD_uc004dcy.1_Missense_Mutation_p.A2467P|DMD_uc004ddb.1_Missense_Mutation_p.A2463P|DMD_uc004ddd.1_Missense_Mutation_p.A11P	p.A2471P	NM_004006	NP_003997	P11532	DMD_HUMAN			51	7655	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	2471					E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.7411G>C	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.101557|4.101557	0.76983|0.76983	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231|ENST00000465285	T;T;T;T;T;T;T;T|.	0.35789|.	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29|.	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	0.000000|.	0.36815|.	U|.	0.002399|.	T|T	0.71634|0.71634	0.3363|0.3363	L|L	0.58669|0.58669	1.825|1.825	0.53005|0.53005	D|D	0.99996|0.99996	B;D;D;D;D;D;D;D;D;D|.	0.89917|.	0.04;1.0;0.999;1.0;1.0;0.992;0.993;0.993;1.0;1.0|.	B;D;D;D;D;D;D;D;D;D|.	0.91635|.	0.06;0.999;0.998;0.999;0.999;0.953;0.978;0.978;0.999;0.997|.	T|T	0.70439|0.70439	-0.4871|-0.4871	10|5	0.66056|.	D|.	0.02|.	.|.	17.6536|17.6536	0.88171|0.88171	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2463;2471;2467;1130;1127;11;11;11;11;11|.	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3|.	.;DMD_HUMAN;.;.;.;.;.;.;.;.|.	P|S	2463;1130;1127;167;2467;2471;11;11;2471;2348;11;11;11|199	ENSP00000350765:A167P;ENSP00000367948:A2467P;ENSP00000354923:A2471P;ENSP00000352894:A11P;ENSP00000340057:A11P;ENSP00000367979:A11P;ENSP00000444119:A11P;ENSP00000417123:A11P|.	ENSP00000340057:A11P|.	A|C	-|-	1|2	0|0	DMD|DMD	31702129|31702129	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.223000|6.223000	0.72257|0.72257	2.096000|2.096000	0.63516|0.63516	0.594000|0.594000	0.82650|0.82650	GCT|TGC		0.468	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		10	45	0	0	0	0.006214	0	10	45				
FAM47B	170062	broad.mit.edu	37	X	34962518	34962518	+	Silent	SNP	C	C	A	rs200918267		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:34962518C>A	ENST00000329357.5	+	1	1606	c.1570C>A	c.(1570-1572)Cgg>Agg	p.R524R		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	524										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						CGAATTCTTACGGATAAAATA	0.493																																							uc004ddi.1		NA																	0				ovary(3)|breast(1)	4						c.(1570-1572)CGG>AGG		hypothetical protein LOC170062							97.0	88.0	91.0					X																	34962518		2202	4300	6502	SO:0001819	synonymous_variant	170062							g.chrX:34962518C>A	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1570C>A	X.37:g.34962518C>A							p.R524R	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	1588	+			524					Q5JQN5|Q6PIG3	Silent	SNP	ENST00000329357.5	37	c.1570C>A	CCDS14236.1																																																																																				0.493	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		40	34	1	0	5.71845e-15	0.005524	7.4842e-15	40	34				
FAM47C	442444	broad.mit.edu	37	X	37027388	37027388	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:37027388G>A	ENST00000358047.3	+	1	957	c.905G>A	c.(904-906)gGa>gAa	p.G302E		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	302										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCTGAGACTGGAGTGCCTGAT	0.602																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(904-906)GGA>GAA		hypothetical protein LOC442444							82.0	71.0	75.0					X																	37027388		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37027388G>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.905G>A	X.37:g.37027388G>A	ENSP00000367913:p.Gly302Glu						p.G302E	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	919	+			302					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.905G>A	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	g	8.271	0.813262	0.16537	.	.	ENSG00000198173	ENST00000358047	T	0.14516	2.5	0.932	0.932	0.19466	.	.	.	.	.	T	0.11750	0.0286	M	0.68593	2.085	0.09310	N	0.999991	B	0.31730	0.337	B	0.33690	0.168	T	0.36504	-0.9745	9	0.02654	T	1	.	5.1555	0.15032	0.0:0.3711:0.6289:0.0	.	302	Q5HY64	FA47C_HUMAN	E	302	ENSP00000367913:G302E	ENSP00000367913:G302E	G	+	2	0	FAM47C	36937309	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-0.966000	0.03825	0.171000	0.19730	0.173000	0.16961	GGA		0.602	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		15	81	0	0	0	0.003163	0	15	81				
CXorf36	79742	broad.mit.edu	37	X	45013318	45013318	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:45013318G>T	ENST00000398000.2	-	4	872	c.798C>A	c.(796-798)gaC>gaA	p.D266E	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	266						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						GGTAGGCAAGGTCGGCTGCCT	0.557																																							uc004dgg.2		NA																	0				lung(1)	1						c.(796-798)GAC>GAA		hypothetical protein LOC79742 isoform 1							95.0	80.0	85.0					X																	45013318		1568	3582	5150	SO:0001583	missense	79742					extracellular region		g.chrX:45013318G>T	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.798C>A	X.37:g.45013318G>T	ENSP00000381086:p.Asp266Glu						p.D266E	NM_176819	NP_789789	Q9H7Y0	CX036_HUMAN			4	873	-			266					A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	ENST00000398000.2	37	c.798C>A	CCDS48096.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750638	0.69533	.	.	ENSG00000147113	ENST00000398000	T	0.33438	1.41	5.49	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.49643	0.1569	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.42932	-0.9422	10	0.36615	T	0.2	.	8.865	0.35280	0.1664:0.0:0.8336:0.0	.	266	Q9H7Y0	CX036_HUMAN	E	266	ENSP00000381086:D266E	ENSP00000381086:D266E	D	-	3	2	CXorf36	44898262	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	1.876000	0.39588	2.457000	0.83068	0.529000	0.55759	GAC		0.557	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689		9	73	1	0	7.48243e-07	0.006214	8.55664e-07	9	73				
SLC9A7	84679	broad.mit.edu	37	X	46618393	46618393	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:46618393C>T	ENST00000328306.4	-	1	97	c.72G>A	c.(70-72)ctG>ctA	p.L24L		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	24					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						gcagcggcagcagcagcagcc	0.796																																					Pancreas(118;454 1696 1930 13865 39976)	Pancreas(118;454 1696 1930 13865 39976)	uc004dgu.1		NA																	0				ovary(2)	2						c.(70-72)CTG>CTA		solute carrier family 9, member 7							2.0	2.0	2.0					X																	46618393		1023	2249	3272	SO:0001819	synonymous_variant	84679				regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity	g.chrX:46618393C>T	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.72G>A	X.37:g.46618393C>T						SLC9A7_uc004dgv.1_Silent_p.L24L	p.L24L	NM_032591	NP_115980	Q96T83	SL9A7_HUMAN			1	80	-			24					O75827|Q5JXP9	Silent	SNP	ENST00000328306.4	37	c.72G>A	CCDS14269.1																																																																																				0.796	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591		6	6	0	0	0	0.001168	0	6	6				
TIMP1	7076	broad.mit.edu	37	X	47444660	47444660	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:47444660C>A	ENST00000218388.4	+	4	428	c.258C>A	c.(256-258)acC>acA	p.T86T	TIMP1_ENST00000377017.1_Silent_p.T22T|SYN1_ENST00000340666.4_Intron|SYN1_ENST00000295987.7_Intron|MIR4769_ENST00000584126.1_RNA|TIMP1_ENST00000456754.2_Silent_p.T86T|TIMP1_ENST00000377018.2_Missense_Mutation_p.P10H	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1	86	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|large_intestine(2)	3						TCGTCTACACCCCCGCCATGG	0.562																																							uc004dif.2		NA																	0					0						c.(256-258)ACC>ACA		tissue inhibitor of metalloproteinase 1							57.0	49.0	51.0					X																	47444660		2203	4300	6503	SO:0001819	synonymous_variant	7076				erythrocyte maturation|negative regulation of membrane protein ectodomain proteolysis|platelet activation|platelet degranulation|positive regulation of cell proliferation	platelet alpha granule lumen	metal ion binding|metalloendopeptidase inhibitor activity|protein binding	g.chrX:47444660C>A		CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.258C>A	X.37:g.47444660C>A						SYN1_uc004did.2_Intron|SYN1_uc004die.2_Intron|TIMP1_uc011mlr.1_Missense_Mutation_p.P10H|TIMP1_uc010nht.1_Missense_Mutation_p.P10H	p.T86T	NM_003254	NP_003245	P01033	TIMP1_HUMAN			4	450	+			86			NTR.		Q14252|Q9UCU1	Silent	SNP	ENST00000218388.4	37	c.258C>A	CCDS14281.1	.	.	.	.	.	.	.	.	.	.	c	18.69	3.678107	0.68042	.	.	ENSG00000102265	ENST00000377018	.	.	.	4.98	4.1	0.47936	.	.	.	.	.	T	0.64159	0.2573	.	.	.	0.23506	N	0.997538	D	0.89917	1.0	D	0.81914	0.995	T	0.53107	-0.8485	7	0.87932	D	0	.	9.7058	0.40214	0.0:0.8957:0.0:0.1043	.	10	B4DJK3	.	H	10	.	ENSP00000366217:P10H	P	+	2	0	TIMP1	47329604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.680000	0.25306	2.209000	0.71365	0.579000	0.79373	CCC		0.562	TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056423.1	NM_003254		5	18	1	0	0.00116845	0.001168	0.0012467	5	18				
ZNF182	7569	broad.mit.edu	37	X	47836869	47836869	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:47836869T>C	ENST00000396965.1	-	7	967	c.617A>G	c.(616-618)tAt>tGt	p.Y206C	ZNF182_ENST00000305127.6_Missense_Mutation_p.Y206C|ZNF182_ENST00000376943.3_Missense_Mutation_p.Y187C	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						TTTATAGCCATAGGGCTTCAT	0.358																																							uc004dir.2		NA																	0				ovary(2)|lung(1)	3						c.(616-618)TAT>TGT		zinc finger protein 21 isoform 1							64.0	59.0	61.0					X																	47836869		2203	4300	6503	SO:0001583	missense	7569				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:47836869T>C	AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.617A>G	X.37:g.47836869T>C	ENSP00000380165:p.Tyr206Cys					ZNF182_uc004dis.2_Missense_Mutation_p.Y187C|ZNF182_uc004dit.2_Missense_Mutation_p.Y206C|ZNF182_uc011mlu.1_Missense_Mutation_p.Y186C	p.Y206C	NM_006962	NP_008893	P17025	ZN182_HUMAN			7	963	-			206			C2H2-type 1; degenerate.		A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	ENST00000396965.1	37	c.617A>G	CCDS35236.1	.	.	.	.	.	.	.	.	.	.	T	0.174	-1.068419	0.01934	.	.	ENSG00000147118	ENST00000376943;ENST00000396965;ENST00000305127	T;T;T	0.37235	1.21;1.21;1.21	4.43	1.72	0.24424	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27731	0.0682	L	0.45352	1.415	0.09310	N	1	B;B;B	0.14805	0.003;0.011;0.002	B;B;B	0.17098	0.015;0.017;0.003	T	0.28364	-1.0046	9	0.62326	D	0.03	.	4.5203	0.11956	0.1734:0.1053:0.0:0.7212	.	186;187;206	B4DRM0;Q96QH7;P17025	.;.;ZN182_HUMAN	C	187;206;206	ENSP00000366142:Y187C;ENSP00000380165:Y206C;ENSP00000306351:Y206C	ENSP00000306351:Y206C	Y	-	2	0	ZNF182	47721813	0.000000	0.05858	0.976000	0.42696	0.091000	0.18340	0.219000	0.17641	0.620000	0.30215	0.481000	0.45027	TAT		0.358	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277055.1	NM_006962		22	35	0	0	0	0.014323	0	22	35				
CACNA1F	778	broad.mit.edu	37	X	49068380	49068380	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:49068380G>T	ENST00000376265.2	-	35	4172	c.4111C>A	c.(4111-4113)Cag>Aag	p.Q1371K	CACNA1F_ENST00000376251.1_Missense_Mutation_p.Q1306K|CACNA1F_ENST00000323022.5_Missense_Mutation_p.Q1360K	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1371					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AGCACAGCCTGTGGAAAGGTC	0.562																																							uc004dnb.2		NA																	0				breast(3)|ovary(1)|kidney(1)|skin(1)	6						c.(4111-4113)CAG>AAG		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						259.0	150.0	187.0					X																	49068380		2203	4300	6503	SO:0001583	missense	778				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chrX:49068380G>T	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4111C>A	X.37:g.49068380G>T	ENSP00000365441:p.Gln1371Lys					CACNA1F_uc010nip.2_Missense_Mutation_p.Q1360K	p.Q1371K	NM_005183	NP_005174	O60840	CAC1F_HUMAN			35	4173	-			1371			Extracellular (Potential).|IV.		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	c.4111C>A	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.729266	0.69074	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.98455	-4.94;-4.94;-4.94	5.05	5.05	0.67936	Ion transport (1);	0.240322	0.42548	D	0.000692	D	0.98726	0.9572	M	0.75085	2.285	0.45216	D	0.998227	D;D	0.61697	0.976;0.99	P;D	0.71656	0.722;0.974	D	0.99871	1.1096	10	0.87932	D	0	.	16.1657	0.81754	0.0:0.0:1.0:0.0	.	1360;1371	F5CIQ9;O60840	.;CAC1F_HUMAN	K	1306;1360;1371	ENSP00000365427:Q1306K;ENSP00000321618:Q1360K;ENSP00000365441:Q1371K	ENSP00000321618:Q1360K	Q	-	1	0	CACNA1F	48955324	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.169000	0.50809	2.067000	0.61834	0.600000	0.82982	CAG		0.562	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		13	42	1	0	2.27111e-07	0.013537	2.61659e-07	13	42				
IQSEC2	23096	broad.mit.edu	37	X	53267475	53267475	+	Silent	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:53267475C>T	ENST00000375368.5	-	11	3299	c.3099G>A	c.(3097-3099)ggG>ggA	p.G1033G	IQSEC2_ENST00000375365.2_Silent_p.G838G|IQSEC2_ENST00000396435.3_Silent_p.G1043G			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1033	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GCAACTTGATCCCAAACTGGT	0.507																																							uc004dsd.2		NA																	0				ovary(3)	3						c.(3127-3129)GGG>GGA		IQ motif and Sec7 domain 2 isoform1							74.0	52.0	59.0					X																	53267475		2203	4300	6503	SO:0001819	synonymous_variant	23096				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity	g.chrX:53267475C>T	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3099G>A	X.37:g.53267475C>T						IQSEC2_uc004dsc.2_Silent_p.G838G	p.G1043G	NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN			12	3330	-			1033			PH.		B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	ENST00000375368.5	37	c.3129G>A																																																																																					0.507	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345		10	23	0	0	0	0.010729	0	10	23				
HUWE1	10075	broad.mit.edu	37	X	53571710	53571710	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:53571710C>A	ENST00000342160.3	-	71	11519	c.11062G>T	c.(11062-11064)Gag>Tag	p.E3688*	HUWE1_ENST00000474288.1_5'UTR|HUWE1_ENST00000262854.6_Nonsense_Mutation_p.E3688*			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3688					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ACCACATTCTCAGCCATGTCA	0.488																																							uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(11062-11064)GAG>TAG		HECT, UBA and WWE domain containing 1							72.0	60.0	64.0					X																	53571710		2203	4300	6503	SO:0001587	stop_gained	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53571710C>A	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11062G>T	X.37:g.53571710C>A	ENSP00000340648:p.Glu3688*					HUWE1_uc004dsn.2_Nonsense_Mutation_p.E2496*|HUWE1_uc004dsq.1_Nonsense_Mutation_p.E3*	p.E3688*	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN			72	11464	-			3688					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Nonsense_Mutation	SNP	ENST00000342160.3	37	c.11062G>T	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	55|55	23.515619|23.515619	0.99955|0.99955	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052;ENST00000426907	.|.	.|.	.|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.060327|.	0.64402|.	D|.	0.000005|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.37606|.	T|.	0.19|.	.|.	17.4736|17.4736	0.87653|0.87653	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	3688|2721;525	.|.	ENSP00000262854:E3688X|.	E|X	-|-	1|2	0|2	HUWE1|HUWE1	53588435|53588435	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.028000|7.028000	0.76470|0.76470	2.396000|2.396000	0.81511|0.81511	0.534000|0.534000	0.68092|0.68092	GAG|TGA		0.488	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		19	45	1	0	1.33834e-09	0.007413	1.60184e-09	19	45				
ITIH6	347365	broad.mit.edu	37	X	54800519	54800519	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:54800519C>A	ENST00000218436.6	-	6	927	c.898G>T	c.(898-900)Gaa>Taa	p.E300*		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	300	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										GTTACCTGTTCCATCTTGGTA	0.463																																							uc004dtj.2		NA																	0				lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(898-900)GAA>TAA		inter-alpha (globulin) inhibitor H5-like							84.0	66.0	72.0					X																	54800519		2203	4300	6503	SO:0001587	stop_gained	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54800519C>A	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.898G>T	X.37:g.54800519C>A	ENSP00000218436:p.Glu300*						p.E300*	NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN			6	928	-			300			VWFA.		A6NN03	Nonsense_Mutation	SNP	ENST00000218436.6	37	c.898G>T	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	c	17.26	3.345048	0.61073	.	.	ENSG00000102313	ENST00000218436	.	.	.	4.14	-2.93	0.05598	.	0.517401	0.17130	U	0.185857	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.3486	0.04278	0.1405:0.0882:0.2797:0.4916	.	.	.	.	X	300	.	ENSP00000218436:E300X	E	-	1	0	ITIH5L	54817244	0.097000	0.21791	0.019000	0.16419	0.361000	0.29550	0.747000	0.26290	-0.641000	0.05487	-0.759000	0.03464	GAA		0.463	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		4	15	1	0	0.00909568	0.009096	0.00942198	4	15				
SPIN4	139886	broad.mit.edu	37	X	62570542	62570542	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:62570542T>A	ENST00000335144.3	-	1	676	c.157A>T	c.(157-159)Aac>Tac	p.N53Y	SPIN4-AS1_ENST00000451979.1_RNA|SPIN4_ENST00000374884.2_Missense_Mutation_p.N35Y	NM_001012968.2	NP_001012986.2	Q56A73	SPIN4_HUMAN	spindlin family, member 4	53					gamete generation (GO:0007276)					endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	11						ACTGGCTCGTTGCCTTCCTTC	0.527																																							uc004dvf.2		NA																	0				ovary(1)|lung(1)	2						c.(157-159)AAC>TAC		spindlin family, member 4							36.0	39.0	38.0					X																	62570542		2073	4172	6245	SO:0001583	missense	139886				gamete generation			g.chrX:62570542T>A	AK126931	CCDS43964.1	Xq11.1	2008-02-05			ENSG00000186767	ENSG00000186767			27040	protein-coding gene	gene with protein product						12477932	Standard	NM_001012968		Approved	FLJ44984	uc004dvf.3	Q56A73	OTTHUMG00000021696	ENST00000335144.3:c.157A>T	X.37:g.62570542T>A	ENSP00000334163:p.Asn53Tyr						p.N53Y	NM_001012968	NP_001012986	Q56A73	SPIN4_HUMAN			1	677	-			53					B3KX90|Q5JUL2	Missense_Mutation	SNP	ENST00000335144.3	37	c.157A>T	CCDS43964.1	.	.	.	.	.	.	.	.	.	.	.	13.06	2.123650	0.37436	.	.	ENSG00000186767	ENST00000374884;ENST00000335144	T;T	0.45276	0.9;0.9	3.9	3.9	0.45041	.	0.059943	0.64402	D	0.000005	T	0.35219	0.0924	L	0.46157	1.445	0.35370	D	0.788972	B	0.16396	0.017	B	0.15484	0.013	T	0.47222	-0.9134	10	0.59425	D	0.04	-34.2899	10.1886	0.43013	0.0:0.0:0.0:1.0	.	53	Q56A73	SPIN4_HUMAN	Y	35;53	ENSP00000364018:N35Y;ENSP00000334163:N53Y	ENSP00000334163:N53Y	N	-	1	0	SPIN4	62487267	1.000000	0.71417	0.981000	0.43875	0.814000	0.46013	2.789000	0.47813	1.765000	0.52091	0.345000	0.21793	AAC		0.527	SPIN4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001012968		8	22	0	0	0	0.004482	0	8	22				
MED12	9968	broad.mit.edu	37	X	70348450	70348450	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:70348450C>A	ENST00000374080.3	+	24	3389	c.3357C>A	c.(3355-3357)gtC>gtA	p.V1119V	MED12_ENST00000333646.6_Silent_p.V1119V|MED12_ENST00000374102.1_Silent_p.V1119V			Q93074	MED12_HUMAN	mediator complex subunit 12	1119					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					TCCTCCAGGTCAGTGACCTAT	0.532			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome				OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(3355-3357)GTC>GTA		mediator complex subunit 12							127.0	102.0	110.0					X																	70348450		2030	4171	6201	SO:0001819	synonymous_variant	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70348450C>A	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3357C>A	X.37:g.70348450C>A			OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1121	MED12_uc011mpq.1_Silent_p.V1119V|MED12_uc004dyz.2_Silent_p.V1119V|MED12_uc004dza.2_Silent_p.V966V|MED12_uc010nla.2_5'Flank	p.V1119V	NM_005120	NP_005111	Q93074	MED12_HUMAN			24	3556	+	Renal(35;0.156)		1119					O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	37	c.3357C>A	CCDS43970.1																																																																																				0.532	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		18	37	1	0	2.5808e-16	0.006122	3.41641e-16	18	37				
SYTL4	94121	broad.mit.edu	37	X	99956569	99956570	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:99956569_99956570CC>AA	ENST00000372989.1	-	5	541_542	c.210_211GG>TT	c.(208-213)ctGGgc>ctTTgc	p.G71C	SYTL4_ENST00000276141.6_Missense_Mutation_p.G71C|SYTL4_ENST00000372981.1_Missense_Mutation_p.G71C|SYTL4_ENST00000454200.2_Missense_Mutation_p.G71C|SYTL4_ENST00000455616.1_Missense_Mutation_p.G71C|SYTL4_ENST00000263033.5_Missense_Mutation_p.G71C	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	71	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTCAAACGGCCCAGGCTCTCCT	0.545																																							uc004egd.3		NA																	0				ovary(2)	2						c.(208-213)CTGGGC>CTTTGC		synaptotagmin-like 4	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)																																			SO:0001583	missense	94121				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding	g.chrX:99956569_99956570CC>AA		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.210_211delinsAA	X.37:g.99956569_99956570delinsAA	ENSP00000362080:p.Gly71Cys					SYTL4_uc010nnc.2_Missense_Mutation_p.G71C|SYTL4_uc004ege.3_Missense_Mutation_p.G71C|SYTL4_uc004egf.3_Missense_Mutation_p.G71C|SYTL4_uc004egg.3_Missense_Mutation_p.G71C	p.G71C	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN			5	566_567	-			71			RabBD.|FYVE-type.		Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	DNP	ENST00000372989.1	37	c.210_211GG>TT	CCDS14472.1																																																																																				0.545	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737		28	51	0	0	0	0.004672	0	28	51				
ZMAT1	84460	broad.mit.edu	37	X	101139699	101139699	+	Nonsense_Mutation	SNP	T	T	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:101139699T>A	ENST00000372782.3	-	7	747	c.700A>T	c.(700-702)Aga>Tga	p.R234*	ZMAT1_ENST00000458570.1_Nonsense_Mutation_p.R63*|ZMAT1_ENST00000540921.1_Nonsense_Mutation_p.R234*|ZMAT1_ENST00000494068.1_5'UTR	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	234						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TCTAGTCCTCTGGCTTTCTGC	0.408																																							uc004eim.2		NA																	0				ovary(1)	1						c.(187-189)AGA>TGA		zinc finger, matrin type 1 isoform 3							197.0	174.0	182.0					X																	101139699		2203	4300	6503	SO:0001587	stop_gained	84460					nucleus	zinc ion binding	g.chrX:101139699T>A	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.700A>T	X.37:g.101139699T>A	ENSP00000361868:p.Arg234*					ZMAT1_uc011mrl.1_Nonsense_Mutation_p.R234*|ZMAT1_uc004ein.2_Nonsense_Mutation_p.R63*|ZMAT1_uc011mrm.1_Nonsense_Mutation_p.R63*	p.R63*	NM_032441	NP_115817	Q5H9K5	ZMAT1_HUMAN			2	3685	-			63					Q8NDS3|Q96JN6	Nonsense_Mutation	SNP	ENST00000372782.3	37	c.187A>T	CCDS35348.1	.	.	.	.	.	.	.	.	.	.	T	45	11.392575	0.99555	.	.	ENSG00000166432	ENST00000372782;ENST00000540921;ENST00000458570	.	.	.	4.37	4.37	0.52481	.	0.282926	0.25780	N	0.028349	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.6246	7.1583	0.25649	0.0:0.0:0.2258:0.7742	.	.	.	.	X	234;234;63	.	ENSP00000361868:R234X	R	-	1	2	ZMAT1	101026355	0.729000	0.28090	0.090000	0.20809	0.504000	0.33889	1.669000	0.37492	1.921000	0.55644	0.437000	0.28790	AGA		0.408	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1			27	67	0	0	0	0.005443	0	27	67				
GPRASP2	114928	broad.mit.edu	37	X	101970387	101970387	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:101970387G>T	ENST00000535209.1	+	4	1421	c.590G>T	c.(589-591)gGa>gTa	p.G197V	GPRASP2_ENST00000543253.1_Missense_Mutation_p.G197V|GPRASP2_ENST00000332262.5_Missense_Mutation_p.G197V			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	197						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						CCCTGGTTTGGACCAGGGGAG	0.527																																							uc004ejk.2		NA																	0				ovary(1)	1						c.(589-591)GGA>GTA		G protein-coupled receptor associated sorting							109.0	120.0	116.0					X																	101970387		2203	4300	6503	SO:0001583	missense	114928					cytoplasm	protein binding	g.chrX:101970387G>T	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.590G>T	X.37:g.101970387G>T	ENSP00000437394:p.Gly197Val					GPRASP2_uc004ejl.2_Missense_Mutation_p.G197V|GPRASP2_uc004ejm.2_Missense_Mutation_p.G197V|GPRASP2_uc011mrp.1_5'Flank	p.G197V	NM_138437	NP_612446	Q96D09	GASP2_HUMAN			4	1924	+			197					D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	c.590G>T	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	1.099	-0.661545	0.03454	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.08720	3.06;3.06;3.06	5.05	2.16	0.27623	.	0.324668	0.22580	N	0.058238	T	0.07369	0.0186	L	0.55481	1.735	0.29647	N	0.844226	B	0.22480	0.07	B	0.19666	0.026	T	0.22800	-1.0206	10	0.29301	T	0.29	.	3.6673	0.08261	0.0903:0.3077:0.4403:0.1617	.	197	Q96D09	GASP2_HUMAN	V	197	ENSP00000437872:G197V;ENSP00000437394:G197V;ENSP00000339057:G197V	ENSP00000339057:G197V	G	+	2	0	GPRASP2	101857043	0.943000	0.32029	0.249000	0.24280	0.003000	0.03518	0.883000	0.28200	0.183000	0.20059	-0.237000	0.12165	GGA		0.527	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		34	141	1	0	4.3181e-19	0.013726	5.95511e-19	34	141				
RAB9B	51209	broad.mit.edu	37	X	103080378	103080378	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:103080378C>T	ENST00000243298.2	-	3	621	c.337G>A	c.(337-339)Gac>Aac	p.D113N		NM_016370.2	NP_057454.1	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	113					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|lung(11)	14						TGCTCAGGGTCCTTCACATCC	0.483																																							uc004ell.1		NA																	0				lung(3)	3						c.(337-339)GAC>AAC		RAB9B, member RAS oncogene family							161.0	160.0	161.0					X																	103080378		2203	4300	6503	SO:0001583	missense	51209				Golgi to endosome transport|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding	g.chrX:103080378C>T	AB036693	CCDS14515.1	Xq22.1-q22.3	2010-04-19			ENSG00000123570	ENSG00000123570		"""RAB, member RAS oncogene"""	14090	protein-coding gene	gene with protein product		300285				11043518	Standard	NM_016370		Approved	RAB9L	uc004ell.2	Q9NP90	OTTHUMG00000022112	ENST00000243298.2:c.337G>A	X.37:g.103080378C>T	ENSP00000243298:p.Asp113Asn					RAB9B_uc004eli.1_Intron	p.D113N	NM_016370	NP_057454	Q9NP90	RAB9B_HUMAN			3	622	-			113					B2R8M0|Q52LX2	Missense_Mutation	SNP	ENST00000243298.2	37	c.337G>A	CCDS14515.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827753	0.50845	.	.	ENSG00000123570	ENST00000243298	T	0.69306	-0.39	5.67	5.67	0.87782	Small GTP-binding protein domain (1);	0.134386	0.64402	D	0.000003	T	0.52306	0.1726	N	0.16130	0.375	0.80722	D	1	B	0.10296	0.003	B	0.17722	0.019	T	0.47923	-0.9079	10	0.42905	T	0.14	-2.2034	16.0063	0.80363	0.0:1.0:0.0:0.0	.	113	Q9NP90	RAB9B_HUMAN	N	113	ENSP00000243298:D113N	ENSP00000243298:D113N	D	-	1	0	RAB9B	102967034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.820000	0.62671	2.381000	0.81170	0.600000	0.82982	GAC		0.483	RAB9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057746.1			41	147	0	0	0	0.007835	0	41	147				
ESX1	80712	broad.mit.edu	37	X	103499225	103499225	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:103499225C>A	ENST00000372588.4	-	2	199	c.116G>T	c.(115-117)aGg>aTg	p.R39M		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	39					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CTCTCCTCCCCTTGCCATCAG	0.592																																					Pancreas(200;1705 2227 25194 28471 45274)	Pancreas(200;1705 2227 25194 28471 45274)	uc004ely.2		NA																	0				ovary(1)	1						c.(115-117)AGG>ATG		extraembryonic, spermatogenesis, homeobox							166.0	151.0	156.0					X																	103499225		2203	4300	6503	SO:0001583	missense	80712				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:103499225C>A	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.116G>T	X.37:g.103499225C>A	ENSP00000361669:p.Arg39Met						p.R39M	NM_153448	NP_703149	Q8N693	ESX1_HUMAN			2	174	-			39					B0QYU3|Q7Z6K7	Missense_Mutation	SNP	ENST00000372588.4	37	c.116G>T	CCDS14516.1	.	.	.	.	.	.	.	.	.	.	c	3.766	-0.048577	0.07407	.	.	ENSG00000123576	ENST00000372588	D	0.91237	-2.81	3.75	-7.5	0.01351	.	.	.	.	.	T	0.71151	0.3306	N	0.03608	-0.345	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.58858	-0.7562	9	0.54805	T	0.06	13.5566	0.8467	0.01163	0.3473:0.1771:0.1068:0.3688	.	39	Q8N693	ESX1_HUMAN	M	39	ENSP00000361669:R39M	ENSP00000361669:R39M	R	-	2	0	ESX1	103385881	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.257000	0.00537	-3.926000	0.00090	-1.604000	0.00809	AGG		0.592	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448		42	152	1	0	1.57019e-19	0.007835	2.17847e-19	42	152				
AGTR2	186	broad.mit.edu	37	X	115304569	115304569	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:115304569A>G	ENST00000371906.4	+	3	1226	c.1036A>G	c.(1036-1038)Agt>Ggt	p.S346G		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	346					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	GAAAAGAGAGAGTATGTCTTG	0.428																																							uc004eqh.3		NA																	0				ovary(2)|lung(1)	3						c.(1036-1038)AGT>GGT		angiotensin II receptor, type 2							109.0	101.0	103.0					X																	115304569		2203	4300	6503	SO:0001583	missense	186				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity	g.chrX:115304569A>G	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.1036A>G	X.37:g.115304569A>G	ENSP00000360973:p.Ser346Gly						p.S346G	NM_000686	NP_000677	P50052	AGTR2_HUMAN			3	1243	+			346			Cytoplasmic (Potential).		B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	c.1036A>G	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	A	7.417	0.635999	0.14386	.	.	ENSG00000180772	ENST00000371906	T	0.40225	1.04	4.87	4.87	0.63330	.	0.387954	0.29225	N	0.012775	T	0.22704	0.0548	N	0.08118	0	0.29012	N	0.886806	B	0.10296	0.003	B	0.06405	0.002	T	0.10800	-1.0614	10	0.26408	T	0.33	-1.6862	11.3098	0.49358	1.0:0.0:0.0:0.0	.	346	P50052	AGTR2_HUMAN	G	346	ENSP00000360973:S346G	ENSP00000360973:S346G	S	+	1	0	AGTR2	115218597	0.022000	0.18835	0.562000	0.28370	0.194000	0.23727	2.099000	0.41767	1.796000	0.52611	0.412000	0.27726	AGT		0.428	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686		22	56	0	0	0	0.012319	0	22	56				
LONRF3	79836	broad.mit.edu	37	X	118123528	118123528	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:118123528C>T	ENST00000371628.3	+	4	1248	c.1217C>T	c.(1216-1218)cCa>cTa	p.P406L	LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000422289.2_Missense_Mutation_p.P150L|LONRF3_ENST00000304778.7_Missense_Mutation_p.P365L	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	406							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GCTACCTCTCCAAAAGCTGCT	0.498																																							uc004eqw.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1216-1218)CCA>CTA		LON peptidase N-terminal domain and ring finger							85.0	66.0	73.0					X																	118123528		2203	4300	6503	SO:0001583	missense	79836				proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding	g.chrX:118123528C>T	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1217C>T	X.37:g.118123528C>T	ENSP00000360690:p.Pro406Leu					LONRF3_uc004eqx.2_Missense_Mutation_p.P365L|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_Missense_Mutation_p.P150L	p.P406L	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN			4	1248	+			406					Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	c.1217C>T	CCDS35374.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454491	0.26161	.	.	ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289	T;T;T;D	0.84370	-1.39;-1.39;-1.18;-1.84	4.32	0.688	0.18027	.	0.708168	0.13594	N	0.376390	T	0.71492	0.3346	N	0.19112	0.55	0.09310	N	1	B;B;B	0.29955	0.263;0.071;0.0	B;B;B	0.32677	0.15;0.075;0.001	T	0.56872	-0.7907	10	0.22706	T	0.39	0.0847	6.5966	0.22677	0.4495:0.3915:0.1589:0.0	.	150;365;406	B3KUN7;Q496Y0-2;Q496Y0	.;.;LONF3_HUMAN	L	365;365;406;150	ENSP00000360691:P365L;ENSP00000307732:P365L;ENSP00000360690:P406L;ENSP00000408894:P150L	ENSP00000307732:P365L	P	+	2	0	LONRF3	118007556	0.114000	0.22134	0.000000	0.03702	0.045000	0.14185	2.795000	0.47861	-0.126000	0.11682	0.513000	0.50165	CCA		0.498	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778		8	30	0	0	0	0.004482	0	8	30				
DCAF12L2	340578	broad.mit.edu	37	X	125298677	125298677	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:125298677G>T	ENST00000360028.2	-	1	1257	c.1231C>A	c.(1231-1233)Ctc>Atc	p.L411I	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.L411I			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	411										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TCTTGGTTGAGCCAGCCTCTG	0.612													G|||	2	0.000529801	0.0015	0.0	3775	,	,		12717	0.0		0.0	False		,,,				2504	0.0						uc004euk.1		NA																	0				lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(1231-1233)CTC>ATC		DDB1 and CUL4 associated factor 12-like 2							91.0	96.0	94.0					X																	125298677		2203	4300	6503	SO:0001583	missense	340578							g.chrX:125298677G>T	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1231C>A	X.37:g.125298677G>T	ENSP00000353128:p.Leu411Ile						p.L411I	NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN			1	1258	-			411					B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.1231C>A	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972156	0.34754	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.21191	2.02;2.02	4.14	3.25	0.37280	.	0.000000	0.32802	N	0.005635	T	0.18257	0.0438	L	0.47016	1.485	0.30332	N	0.786568	B	0.17465	0.022	B	0.17433	0.018	T	0.08889	-1.0700	10	0.34782	T	0.22	.	10.2038	0.43101	0.0:0.0:0.8005:0.1995	.	411	Q5VW00	DC122_HUMAN	I	411	ENSP00000441489:L411I;ENSP00000353128:L411I	ENSP00000353128:L411I	L	-	1	0	DCAF12L2	125126358	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.831000	0.62752	1.043000	0.40175	0.600000	0.82982	CTC		0.612	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		31	106	1	0	1.62565e-12	0.012213	2.01354e-12	31	106				
GPR119	139760	broad.mit.edu	37	X	129519241	129519241	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:129519241G>T	ENST00000276218.2	-	1	270	c.181C>A	c.(181-183)Cta>Ata	p.L61I		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	61					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						TCTGTGAGTAGGCCAGAGATG	0.567																																							uc011muv.1		NA																	0				ovary(2)	2						c.(181-183)CTA>ATA		G protein-coupled receptor 119							135.0	114.0	121.0					X																	129519241		2203	4300	6503	SO:0001583	missense	139760					integral to membrane|plasma membrane	lipid binding	g.chrX:129519241G>T	AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.181C>A	X.37:g.129519241G>T	ENSP00000276218:p.Leu61Ile						p.L61I	NM_178471	NP_848566	Q8TDV5	GP119_HUMAN			1	181	-			61			Extracellular (Potential).		Q495H7|Q4VBN3	Missense_Mutation	SNP	ENST00000276218.2	37	c.181C>A	CCDS14625.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823275	0.32237	.	.	ENSG00000147262	ENST00000276218	T	0.72167	-0.63	4.92	4.05	0.47172	GPCR, rhodopsin-like superfamily (1);	0.200496	0.33753	N	0.004593	T	0.68183	0.2973	L	0.37507	1.11	0.26700	N	0.97118	D	0.57899	0.981	P	0.54210	0.745	T	0.61826	-0.6983	10	0.72032	D	0.01	-5.2075	7.6806	0.28511	0.0925:0.1602:0.7473:0.0	.	61	Q8TDV5	GP119_HUMAN	I	61	ENSP00000276218:L61I	ENSP00000276218:L61I	L	-	1	2	GPR119	129346922	1.000000	0.71417	0.564000	0.28396	0.768000	0.43524	2.573000	0.46007	1.051000	0.40369	0.513000	0.50165	CTA		0.567	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058270.1	NM_178471		89	89	1	0	1.09326e-46	0.01441	1.58832e-46	89	89				
FRMD7	90167	broad.mit.edu	37	X	131212132	131212132	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:131212132T>C	ENST00000298542.4	-	12	2088	c.1913A>G	c.(1912-1914)gAt>gGt	p.D638G	FRMD7_ENST00000370879.1_Missense_Mutation_p.D518G|FRMD7_ENST00000464296.1_Missense_Mutation_p.D623G	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	638					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					TGTACTTTGATCCATTAGAAC	0.413																																							uc004ewn.2		NA																	0				skin(1)	1						c.(1912-1914)GAT>GGT		FERM domain containing 7							110.0	94.0	99.0					X																	131212132		2203	4300	6503	SO:0001583	missense	90167				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding	g.chrX:131212132T>C	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1913A>G	X.37:g.131212132T>C	ENSP00000298542:p.Asp638Gly					FRMD7_uc011muy.1_Missense_Mutation_p.D623G	p.D638G	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN			12	2091	-	Acute lymphoblastic leukemia(192;0.000127)		638					C0LLJ3|Q5JX99	Missense_Mutation	SNP	ENST00000298542.4	37	c.1913A>G	CCDS35397.1	.	.	.	.	.	.	.	.	.	.	T	1.123	-0.654746	0.03480	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.86297	-2.1;-1.76;-1.87	5.73	2.38	0.29361	.	0.786874	0.11600	N	0.547871	T	0.72700	0.3493	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.59910	-0.7365	10	0.48119	T	0.1	.	0.395	0.00417	0.3039:0.2242:0.1216:0.3504	.	623;638	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	G	518;638;623	ENSP00000359916:D518G;ENSP00000298542:D638G;ENSP00000417996:D623G	ENSP00000298542:D638G	D	-	2	0	FRMD7	131039813	0.060000	0.20803	0.196000	0.23383	0.418000	0.31294	0.689000	0.25437	0.314000	0.23086	-0.314000	0.08810	GAT		0.413	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	NM_194277		22	68	0	0	0	0.00278	0	22	68				
FAM127C	441518	broad.mit.edu	37	X	134156260	134156260	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:134156260A>T	ENST00000391440.1	-	1	299	c.230T>A	c.(229-231)cTg>cAg	p.L77Q		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	77										breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					CACCCACTGCAGGGCGGGCCC	0.602																																							uc004eyc.1		NA																	0					0						c.(229-231)CTG>CAG		family with sequence similarity 127, member C							50.0	54.0	53.0					X																	134156260		2120	4214	6334	SO:0001583	missense	441518							g.chrX:134156260A>T	BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.230T>A	X.37:g.134156260A>T	ENSP00000375268:p.Leu77Gln						p.L77Q	NM_001078173	NP_001071641	Q17RB0	F127C_HUMAN			1	307	-	Acute lymphoblastic leukemia(192;0.000127)		77						Missense_Mutation	SNP	ENST00000391440.1	37	c.230T>A	CCDS43996.1	.	.	.	.	.	.	.	.	.	.	a	16.07	3.018164	0.54576	.	.	ENSG00000212747	ENST00000391440	T	0.35048	1.33	2.35	2.35	0.29111	.	0.272984	0.18516	U	0.138919	T	0.47600	0.1454	M	0.65498	2.005	0.29937	N	0.821378	D	0.76494	0.999	D	0.67231	0.95	T	0.40608	-0.9554	10	0.20046	T	0.44	.	5.8999	0.18960	1.0:0.0:0.0:0.0	.	77	Q17RB0	F127C_HUMAN	Q	77	ENSP00000375268:L77Q	ENSP00000375268:L77Q	L	-	2	0	FAM127C	133983926	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.174000	0.42482	1.178000	0.42870	0.356000	0.21956	CTG		0.602	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058389.2	NM_001078173		25	78	0	0	0	0.003954	0	25	78				
PASD1	139135	broad.mit.edu	37	X	150840242	150840242	+	Silent	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:150840242C>A	ENST00000370357.4	+	13	1673	c.1428C>A	c.(1426-1428)gcC>gcA	p.A476A		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	476						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CTTGTGTTGCCTTCAACCAGG	0.463																																							uc004fev.3		NA																	0				ovary(3)	3						c.(1426-1428)GCC>GCA		PAS domain containing 1							83.0	77.0	79.0					X																	150840242		2203	4300	6503	SO:0001819	synonymous_variant	139135					nucleus	signal transducer activity	g.chrX:150840242C>A	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1428C>A	X.37:g.150840242C>A							p.A476A	NM_173493	NP_775764	Q8IV76	PASD1_HUMAN			13	1760	+	Acute lymphoblastic leukemia(192;6.56e-05)		476					Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	ENST00000370357.4	37	c.1428C>A	CCDS35431.1																																																																																				0.463	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493		10	45	1	0	0.00829132	0.008291	0.00868614	10	45				
GABRQ	55879	broad.mit.edu	37	X	151818215	151818215	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:151818215G>T	ENST00000370306.2	+	6	641	c.621G>T	c.(619-621)acG>acT	p.T207T		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	207					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGGTTACACGGTTGAAGACA	0.438																																							uc004ffp.1		NA																	0				ovary(2)|pancreas(1)	3						c.(619-621)ACG>ACT		gamma-aminobutyric acid (GABA) receptor, theta							140.0	117.0	125.0					X																	151818215		2203	4300	6503	SO:0001819	synonymous_variant	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151818215G>T	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.621G>T	X.37:g.151818215G>T							p.T207T	NM_018558	NP_061028	Q9UN88	GBRT_HUMAN			6	641	+	Acute lymphoblastic leukemia(192;6.56e-05)		207			Extracellular (Potential).		A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	37	c.621G>T	CCDS14707.1																																																																																				0.438	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		20	68	1	0	3.99206e-14	0.007413	5.13741e-14	20	68				
OPN1LW	5956	broad.mit.edu	37	X	153420089	153420089	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:153420089G>C	ENST00000369951.4	+	4	679	c.619G>C	c.(619-621)Gtg>Ctg	p.V207L	OPN1LW_ENST00000463296.1_Intron	NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	207					phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGCCCAGACGTGTTCAGCGG	0.622																																							uc004fjz.3		NA																	0					0						c.(619-621)GTG>CTG		opsin 1 (cone pigments), long-wave-sensitive							90.0	65.0	74.0					X																	153420089		2182	4236	6418	SO:0001583	missense	5956				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity	g.chrX:153420089G>C	Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.619G>C	X.37:g.153420089G>C	ENSP00000358967:p.Val207Leu						p.V207L	NM_020061	NP_064445	P04000	OPSR_HUMAN			4	652	+	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		207			Extracellular.			Missense_Mutation	SNP	ENST00000369951.4	37	c.619G>C	CCDS14742.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.615221	0.66672	.	.	ENSG00000102076	ENST00000369951;ENST00000442922	T;T	0.36878	1.23;1.23	4.27	3.32	0.38043	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.45094	0.1325	M	0.84948	2.725	0.42717	D	0.99366	P	0.38788	0.647	B	0.41571	0.36	T	0.53408	-0.8443	10	0.45353	T	0.12	.	11.3283	0.49460	0.0:0.0:0.8176:0.1824	.	207	P04000	OPSR_HUMAN	L	207;70	ENSP00000358967:V207L;ENSP00000402493:V70L	ENSP00000358967:V207L	V	+	1	0	OPN1LW	153073283	0.983000	0.35010	0.921000	0.36526	0.730000	0.41778	1.833000	0.39161	1.888000	0.54679	0.372000	0.22366	GTG		0.622	OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082839.2	NM_020061		15	87	0	0	0	0.00278	0	15	87				
GDI1	2664	broad.mit.edu	37	X	153670994	153670994	+	Missense_Mutation	SNP	A	A	C	rs368376382		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:153670994A>C	ENST00000447750.2	+	11	1654	c.1319A>C	c.(1318-1320)gAc>gCc	p.D440A	GDI1_ENST00000465640.1_3'UTR|FAM50A_ENST00000393600.3_5'Flank	NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	440					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAACAGAACGACGTCTTTGGA	0.557																																							uc004fli.3		NA																	0					0						c.(1318-1320)GAC>GCC		GDP dissociation inhibitor 1							163.0	131.0	142.0					X																	153670994		2203	4300	6503	SO:0001583	missense	2664				protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding	g.chrX:153670994A>C	X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.1319A>C	X.37:g.153670994A>C	ENSP00000394071:p.Asp440Ala					GDI1_uc004flj.2_Missense_Mutation_p.D105A|FAM50A_uc004fll.3_5'Flank	p.D440A	NM_001493	NP_001484	P31150	GDIA_HUMAN			11	1661	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		440					P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Missense_Mutation	SNP	ENST00000447750.2	37	c.1319A>C	CCDS35452.1	.	.	.	.	.	.	.	.	.	.	A	12.19	1.863245	0.32884	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	D	0.83250	-1.7	5.38	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.75568	0.3867	L	0.39397	1.21	0.80722	D	1	B	0.23442	0.085	B	0.28139	0.086	T	0.73623	-0.3924	10	0.54805	T	0.06	-20.8882	8.4451	0.32836	0.8235:0.0:0.0:0.1765	.	440	P31150	GDIA_HUMAN	A	440;410	ENSP00000394071:D440A	ENSP00000358756:D410A	D	+	2	0	GDI1	153324188	1.000000	0.71417	0.459000	0.27081	0.322000	0.28314	7.136000	0.77285	1.786000	0.52430	0.486000	0.48141	GAC		0.557	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081649.2	NM_001493		24	136	0	0	0	0.014323	0	24	136				
PLXNA3	55558	broad.mit.edu	37	X	153699969	153699969	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:153699969G>A	ENST00000369682.3	+	32	5683	c.5508G>A	c.(5506-5508)aaG>aaA	p.K1836K		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1836					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ATGTCACCAAGTACCGCCAGG	0.587																																							uc004flm.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(5506-5508)AAG>AAA		plexin A3 precursor							83.0	63.0	70.0					X																	153699969		2203	4300	6503	SO:0001819	synonymous_variant	55558				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity	g.chrX:153699969G>A	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.5508G>A	X.37:g.153699969G>A							p.K1836K	NM_017514	NP_059984	P51805	PLXA3_HUMAN			32	5681	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		1836			Cytoplasmic (Potential).		Q5HY36	Silent	SNP	ENST00000369682.3	37	c.5508G>A	CCDS14752.1																																																																																				0.587	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514		23	50	0	0	0	0.014323	0	23	50				
MPP1	4354	broad.mit.edu	37	X	154013434	154013434	+	Splice_Site	SNP	T	T	C			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:154013434T>C	ENST00000369534.3	-	7	825		c.e7-2		MPP1_ENST00000393531.1_Splice_Site|MPP1_ENST00000413259.3_Splice_Site|MPP1_ENST00000462825.1_Splice_Site	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa						nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCCACTCGCCTGGTAGGAAAA	0.547																																							uc004fmp.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.e7-1		palmitoylated membrane protein 1							62.0	52.0	56.0					X																	154013434		2203	4300	6503	SO:0001630	splice_region_variant	4354				regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding	g.chrX:154013434T>C		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.678-2A>G	X.37:g.154013434T>C						MPP1_uc010nvg.1_Splice_Site_p.W206_splice|MPP1_uc011mzv.1_Splice_Site_p.W196_splice|MPP1_uc004fmq.1_Splice_Site_p.W180_splice|MPP1_uc011mzw.1_Splice_Site_p.W209_splice|MPP1_uc010nvh.1_Intron	p.W226_splice	NM_002436	NP_002427	Q00013	EM55_HUMAN			7	793	-	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)							B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Splice_Site	SNP	ENST00000369534.3	37	c.678_splice	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	T	8.998	0.979413	0.18812	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000453245;ENST00000393529;ENST00000428488	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7547	0.57328	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MPP1	153666628	1.000000	0.71417	0.906000	0.35671	0.072000	0.16883	7.347000	0.79356	1.685000	0.51034	0.417000	0.27973	.		0.547	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	Intron	17	14	0	0	0	0.004007	0	17	14				
FUNDC2	65991	broad.mit.edu	37	X	154282872	154282872	+	Silent	SNP	G	G	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:154282872G>T	ENST00000369498.3	+	5	749	c.495G>T	c.(493-495)gtG>gtT	p.V165V	FUNDC2_ENST00000484175.1_3'UTR	NM_023934.3	NP_076423.2	Q9BWH2	FUND2_HUMAN	FUN14 domain containing 2	165						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GTTTTCAGGTGGTGTCATTTG	0.373																																							uc004fmw.2		NA																	0					0						c.(493-495)GTG>GTT		FUN14 domain containing 2							166.0	150.0	155.0					X																	154282872		2203	4300	6503	SO:0001819	synonymous_variant	65991					mitochondrion		g.chrX:154282872G>T	AF267862	CCDS14763.1	Xq28	2010-03-12			ENSG00000165775	ENSG00000165775			24925	protein-coding gene	gene with protein product						12477932	Standard	NM_023934		Approved	HCBP6, DC44	uc004fmw.3	Q9BWH2	OTTHUMG00000013504	ENST00000369498.3:c.495G>T	X.37:g.154282872G>T							p.V165V	NM_023934	NP_076423	Q9BWH2	FUND2_HUMAN			5	645	+	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		165					B2R7W5|D3DWY5|Q8NHX8|Q9H2I6	Silent	SNP	ENST00000369498.3	37	c.495G>T	CCDS14763.1																																																																																				0.373	FUNDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037641.3	NM_023934		29	96	1	0	2.47511e-08	0.008361	2.88762e-08	29	96				
VAMP7	6845	broad.mit.edu	37	X	155119210	155119210	+	Silent	SNP	G	G	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:155119210G>A	ENST00000286448.6	+	2	246	c.81G>A	c.(79-81)gaG>gaA	p.E27E	VAMP7_ENST00000262640.6_Silent_p.E27E|VAMP7_ENST00000460621.1_Splice_Site_p.E27E|VAMP7_ENST00000479687.1_3'UTR	NM_001145149.2|NM_005638.5	NP_001138621.1|NP_005629.1	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7	27	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				calcium ion-dependent exocytosis (GO:0017156)|endosome to lysosome transport (GO:0008333)|eosinophil degranulation (GO:0043308)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane protein transport (GO:0043001)|membrane organization (GO:0061024)|neutrophil degranulation (GO:0043312)|phagocytosis, engulfment (GO:0006911)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of protein targeting to vacuolar membrane (GO:1900483)|SNARE complex assembly (GO:0035493)|triglyceride transport (GO:0034197)|vesicle fusion (GO:0006906)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle-mediated transport (GO:0016192)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)				large_intestine(1)|lung(8)	9	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACTTCCTGGAGGTGACAGAGC	0.458																																							uc004fnr.2		NA																	0					0						c.(79-81)GAG>GAA		vesicle-associated membrane protein 7 isoform 1							271.0	260.0	264.0					X																	155119210		2203	4296	6499	SO:0001819	synonymous_variant	6845				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding	g.chrX:155119210G>A	AJ295938	CCDS14770.4, CCDS48199.1, CCDS55548.1	Xq28 and Yq12	2013-02-13	2007-12-05	2007-12-05	ENSG00000124333	ENSG00000124333		"""Pseudoautosomal regions / PAR2"", ""Vesicle-associated membrane proteins"""	11486	protein-coding gene	gene with protein product		300053	"""synaptobrevin-like 1"""	SYBL1		8640232, 11440841	Standard	NM_001145149		Approved	VAMP-7, TI-VAMP	uc004fns.3	P51809	OTTHUMG00000022679	ENST00000286448.6:c.81G>A	X.37:g.155119210G>A						VAMP7_uc004fnt.2_Silent_p.E27E|VAMP7_uc011naa.1_Missense_Mutation_p.S10N|VAMP7_uc011nab.1_5'UTR|VAMP7_uc004fns.2_Silent_p.E27E|VAMP7_uc011nac.1_5'UTR	p.E27E	NM_005638	NP_005629	P51809	VAMP7_HUMAN			2	255	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		27			Longin.|Cytoplasmic (Potential).		Q53GY7|Q7Z409|Q9H4A7	Silent	SNP	ENST00000286448.6	37	c.81G>A	CCDS14770.4																																																																																				0.458	VAMP7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058843.1	NM_005638		12	60	0	0	0	0.010729	0	12	60				
IL9R	3581	broad.mit.edu	37	X	155235830	155235830	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:155235830C>A	ENST00000244174.5	+	7	1043	c.864C>A	c.(862-864)taC>taA	p.Y288*	IL9R_ENST00000540897.1_Nonsense_Mutation_p.Y313*|IL9R_ENST00000424344.3_Nonsense_Mutation_p.Y267*|IL9R_ENST00000494962.1_3'UTR|IL9R_ENST00000369423.2_Nonsense_Mutation_p.Y323*	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	288			Y -> C (in dbSNP:rs3093514). {ECO:0000269|Ref.4}.		cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCCCGACCTACCTCCTGTTCA	0.582																																							uc004fnv.1		NA																	0					0						c.(862-864)TAC>TAA		interleukin 9 receptor precursor																																				SO:0001587	stop_gained	3581				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity	g.chrX:155235830C>A	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.864C>A	X.37:g.155235830C>A	ENSP00000244174:p.Tyr288*					IL9R_uc010nvn.2_Nonsense_Mutation_p.Y267*|IL9R_uc004fnu.1_Nonsense_Mutation_p.Y323*	p.Y288*	NM_002186	NP_002177	Q01113	IL9R_HUMAN			7	1043	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		288			Helical; (Potential).		B9ZVT0|Q14634|Q8WWU1|Q96TF0	Nonsense_Mutation	SNP	ENST00000244174.5	37	c.864C>A	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	c	15.38	2.815725	0.50527	.	.	ENSG00000124334	ENST00000244174;ENST00000424344;ENST00000455739;ENST00000369423;ENST00000540897	.	.	.	1.57	0.654	0.17833	.	1.632470	0.03529	N	0.222121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1625	3.6708	0.08273	0.0:0.7375:0.0:0.2625	.	.	.	.	X	288;267;267;323;313	.	ENSP00000244174:Y288X	Y	+	3	2	IL9R	154889024	0.377000	0.25106	0.111000	0.21465	0.005000	0.04900	0.777000	0.26718	0.153000	0.19213	0.287000	0.19450	TAC		0.582	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186		31	31	1	0	1.36615e-20	0.013726	1.9126e-20	31	31				
PTAFR	5724	broad.mit.edu	37	1	28476723	28476723	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:28476723delG	ENST00000373857.3	-	2	1444	c.810delC	c.(808-810)gccfs	p.A270fs	PTAFR_ENST00000305392.3_Frame_Shift_Del_p.A270fs|PTAFR_ENST00000539896.1_Frame_Shift_Del_p.A270fs	NM_000952.4|NM_001164722.2|NM_001164723.2	NP_000943.1|NP_001158194.1|NP_001158195.1	P25105	PTAFR_HUMAN	platelet-activating factor receptor	270					chemotaxis (GO:0006935)|cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|inositol trisphosphate biosynthetic process (GO:0032959)|interferon-gamma-mediated signaling pathway (GO:0060333)|phosphatidylinositol-mediated signaling (GO:0048015)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|phospholipid binding (GO:0005543)|platelet activating factor receptor activity (GO:0004992)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|stomach(1)	15		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		CATCATTAATGGCCTGGTGGA	0.547																																							uc001bpl.2		NA																	0					0						c.(808-810)GCCfs		platelet-activating factor receptor							111.0	101.0	104.0					1																	28476723		2203	4300	6503	SO:0001589	frameshift_variant	5724				chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity	g.chr1:28476723delG	BC063000	CCDS318.1	1p35-p34.3	2012-08-20			ENSG00000169403	ENSG00000169403		"""GPCR / Class A : Platelet-activating factor receptors"""	9582	protein-coding gene	gene with protein product		173393				1322356	Standard	NM_001164721		Approved		uc001bpl.3	P25105	OTTHUMG00000003953	ENST00000373857.3:c.810delC	1.37:g.28476723delG	ENSP00000362965:p.Ala270fs					PTAFR_uc001bpm.3_Frame_Shift_Del_p.A270fs|PTAFR_uc009vte.2_Frame_Shift_Del_p.A270fs	p.A270fs	NM_000952	NP_000943	P25105	PTAFR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)	2	937	-		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)	270			Extracellular (Potential).		A3KMC8|A8K2H5	Frame_Shift_Del	DEL	ENST00000373857.3	37	c.810delC	CCDS318.1																																																																																				0.547	PTAFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011258.1	NM_000952		17	31	NA	NA	NA	NA	NA	17	31	---	---	---	---
PLPPR4	9890	broad.mit.edu	37	1	99771495	99771495	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr1:99771495delG	ENST00000370185.3	+	7	1718	c.1221delG	c.(1219-1221)aagfs	p.K407fs	LPPR4_ENST00000457765.1_Frame_Shift_Del_p.K349fs|LPPR4_ENST00000370184.1_Frame_Shift_Del_p.K249fs	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		407					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CCATGGGGAAGGAGAACATGG	0.483																																							uc001dse.2		NA																	0				ovary(3)	3						c.(1219-1221)AAGfs		plasticity related gene 1							62.0	62.0	62.0					1																	99771495		2203	4300	6503	SO:0001589	frameshift_variant	9890						phosphatidate phosphatase activity	g.chr1:99771495delG																												ENST00000370185.3:c.1221delG	1.37:g.99771495delG	ENSP00000359204:p.Lys407fs					LPPR4_uc010oue.1_Frame_Shift_Del_p.K349fs	p.K407fs	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	7	1327	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	407					E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Frame_Shift_Del	DEL	ENST00000370185.3	37	c.1221delG	CCDS757.1																																																																																				0.483	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			17	48	NA	NA	NA	NA	NA	17	48	---	---	---	---
ABHD12B	145447	broad.mit.edu	37	14	51345565	51345565	+	Splice_Site	DEL	G	G	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr14:51345565delG	ENST00000337334.2	+	3	350	c.335delG	c.(334-336)tgg>tg	p.W112fs	PYGL_ENST00000532462.1_Intron|ABHD12B_ENST00000353130.1_Intron|ABHD12B_ENST00000554241.1_Intron|ABHD12B_ENST00000395752.1_Splice_Site_p.W5fs	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B	112							hydrolase activity (GO:0016787)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					CTAGGGATCTGGTGAGTGCAC	0.517																																							uc001wys.2		NA																	0				breast(1)	1						c.(334-336)TGGfs		abhydrolase domain containing 12B isoform b							187.0	193.0	191.0					14																	51345565		2037	4175	6212	SO:0001630	splice_region_variant	145447						hydrolase activity	g.chr14:51345565delG	BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.335+1G>-	14.37:g.51345565delG						ABHD12B_uc001wyq.2_Frame_Shift_Del_p.W5fs|ABHD12B_uc001wyr.2_Intron|ABHD12B_uc010any.2_RNA	p.W112fs	NM_181533	NP_853511	Q7Z5M8	AB12B_HUMAN			3	350	+	all_epithelial(31;0.00481)|Breast(41;0.148)		112					Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	Frame_Shift_Del	DEL	ENST00000337334.2	37	c.335delG	CCDS55916.1																																																																																				0.517	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411030.1		Frame_Shift_Del	51	64	NA	NA	NA	NA	NA	51	64	---	---	---	---
ABCC11	85320	broad.mit.edu	37	16	48234288	48234288	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr16:48234288delG	ENST00000394747.1	-	14	2330	c.1981delC	c.(1981-1983)ctgfs	p.L661fs	ABCC11_ENST00000537808.1_Frame_Shift_Del_p.L661fs|ABCC11_ENST00000394748.1_Frame_Shift_Del_p.L661fs|ABCC11_ENST00000353782.5_Frame_Shift_Del_p.L661fs|ABCC11_ENST00000356608.2_Frame_Shift_Del_p.L661fs	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	661	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	ACAGCAGACAGGGGGTCGTCC	0.612																																							uc002eff.1		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1981-1983)CTGfs		ATP-binding cassette, sub-family C, member 11							90.0	75.0	80.0					16																	48234288		2201	4300	6501	SO:0001589	frameshift_variant	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48234288delG	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1981delC	16.37:g.48234288delG	ENSP00000378230:p.Leu661fs					ABCC11_uc002efg.1_Frame_Shift_Del_p.L661fs|ABCC11_uc002efh.1_Frame_Shift_Del_p.L661fs|ABCC11_uc010vgk.1_RNA	p.L661fs	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN			14	2331	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	661			ABC transporter 1.|Cytoplasmic (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Frame_Shift_Del	DEL	ENST00000394747.1	37	c.1981delC	CCDS10732.1																																																																																				0.612	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		17	40	NA	NA	NA	NA	NA	17	40	---	---	---	---
TTC31	64427	broad.mit.edu	37	2	74718451	74718451	+	Frame_Shift_Del	DEL	C	C	-	rs541931650		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr2:74718451delC	ENST00000233623.5	+	7	640	c.633delC	c.(631-633)agcfs	p.S211fs	TTC31_ENST00000410003.1_Frame_Shift_Del_p.S211fs|TTC31_ENST00000442235.2_Frame_Shift_Del_p.S67fs|TTC31_ENST00000463189.1_3'UTR	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	211								p.P213fs*46(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						GAGATGAGAGCCCCCCATCCA	0.542																																							uc002slt.2		NA																	1	Deletion - Frameshift(1)		large_intestine(1)		0						c.(631-633)AGCfs		tetratricopeptide repeat domain 31							94.0	103.0	100.0					2																	74718451		1920	4117	6037	SO:0001589	frameshift_variant	64427						binding	g.chr2:74718451delC	AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.633delC	2.37:g.74718451delC	ENSP00000233623:p.Ser211fs					TTC31_uc002sls.2_Frame_Shift_Del_p.S140fs|TTC31_uc010yrv.1_Frame_Shift_Del_p.S67fs|TTC31_uc002slu.2_Frame_Shift_Del_p.S67fs	p.S211fs	NM_022492	NP_071937	Q49AM3	TTC31_HUMAN			7	656	+			211					Q4KN40|Q53FD4|Q9H9F7	Frame_Shift_Del	DEL	ENST00000233623.5	37	c.633delC	CCDS42701.1																																																																																				0.542	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328422.1	NM_022492		35	49	NA	NA	NA	NA	NA	35	49	---	---	---	---
TMEM161B	153396	broad.mit.edu	37	5	87492083	87492083	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr5:87492083delA	ENST00000296595.6	-	12	1533	c.1409delT	c.(1408-1410)ctcfs	p.L470fs	TMEM161B_ENST00000515293.1_5'Flank|TMEM161B_ENST00000506536.1_3'UTR|TMEM161B_ENST00000514135.1_Intron|TMEM161B_ENST00000512429.1_Frame_Shift_Del_p.L459fs|TMEM161B_ENST00000511218.1_Frame_Shift_Del_p.L261fs	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	470						integral component of membrane (GO:0016021)				endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		TGTAGAAAAGAGGCAAGCAGC	0.378																																							uc003kjc.2		NA																	0				skin(2)	2						c.(1408-1410)CTCfs		transmembrane protein 161B							47.0	48.0	47.0					5																	87492083		2203	4299	6502	SO:0001589	frameshift_variant	153396					integral to membrane		g.chr5:87492083delA	BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.1409delT	5.37:g.87492083delA	ENSP00000296595:p.Leu470fs					TMEM161B_uc011cty.1_Frame_Shift_Del_p.L459fs|TMEM161B_uc010jax.2_RNA|TMEM161B_uc011ctx.1_Frame_Shift_Del_p.L261fs	p.L470fs	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)	12	1534	-		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)	470			Helical; (Potential).		Q5CZH7|Q6UWQ6	Frame_Shift_Del	DEL	ENST00000296595.6	37	c.1409delT	CCDS4065.1																																																																																				0.378	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254094.1	NM_153354		8	18	NA	NA	NA	NA	NA	8	18	---	---	---	---
BMPER	168667	broad.mit.edu	37	7	34006128	34006129	+	Frame_Shift_Ins	INS	-	-	A			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:34006128_34006129insA	ENST00000297161.2	+	5	731_732	c.357_358insA	c.(358-360)aaafs	p.K120fs	BMPER_ENST00000426693.1_Frame_Shift_Ins_p.K120fs	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	120	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						ACAGCTCCTTCAAATGGCAGAG	0.45																																							uc011kap.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(355-360)TTCAAAfs		BMP-binding endothelial regulator precursor																																				SO:0001589	frameshift_variant	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34006128_34006129insA		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.360dupA	7.37:g.34006131_34006131dupA	ENSP00000297161:p.Lys120fs						p.F119fs	NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN			4	471_472	+			119_120			VWFC 2.		A8K1P8|Q8TF36	Frame_Shift_Ins	INS	ENST00000297161.2	37	c.357_358insA	CCDS5442.1																																																																																				0.450	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		20	61	NA	NA	NA	NA	NA	20	61	---	---	---	---
POU6F2	11281	broad.mit.edu	37	7	39503780	39503780	+	Splice_Site	DEL	G	G	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:39503780delG	ENST00000403058.1	+	11	1725		c.e11-1		POU6F2_ENST00000559001.1_Splice_Site|POU6F2_ENST00000518318.2_Intron	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2						central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						TTCCCCCCCAGACACACCATC	0.532																																							uc003thb.1		NA																	0				central_nervous_system(1)	1						c.e10-1		POU class 6 homeobox 2 isoform 1							150.0	156.0	154.0					7																	39503780		2203	4300	6503	SO:0001630	splice_region_variant	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39503780delG	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1572-1G>-	7.37:g.39503780delG							p.R524_splice	NM_007252	NP_009183	P78424	PO6F2_HUMAN			10	1614	+								A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Splice_Site	DEL	ENST00000403058.1	37	c.1572_splice	CCDS34620.2																																																																																				0.532	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	Intron	68	214	NA	NA	NA	NA	NA	68	214	---	---	---	---
EGFR	1956	broad.mit.edu	37	7	55270296	55270296	+	Frame_Shift_Del	DEL	C	C	-	rs373990043		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:55270296delC	ENST00000275493.2	+	27	3426	c.3249delC	c.(3247-3249)gacfs	p.D1084fs	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Frame_Shift_Del_p.D1031fs|EGFR_ENST00000455089.1_Frame_Shift_Del_p.D1039fs	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	1084					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	ACAGCATAGACGACACCTTCC	0.567		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		0				lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(3247-3249)GACfs		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						130.0	91.0	104.0					7																	55270296		2203	4300	6503	SO:0001589	frameshift_variant	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55270296delC		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.3249delC	7.37:g.55270296delC	ENSP00000275493:p.Asp1084fs	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Frame_Shift_Del_p.D1038fs|EGFR_uc011kco.1_Frame_Shift_Del_p.D1030fs	p.D1083fs	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		27	3495	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		1083			Cytoplasmic (Potential).		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Frame_Shift_Del	DEL	ENST00000275493.2	37	c.3249delC	CCDS5514.1																																																																																				0.567	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		8	13	NA	NA	NA	NA	NA	8	13	---	---	---	---
NRCAM	4897	broad.mit.edu	37	7	107832248	107832248	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr7:107832248delC	ENST00000425651.2	-	15	1827	c.1828delG	c.(1828-1830)gacfs	p.D610fs	NRCAM_ENST00000413765.2_Frame_Shift_Del_p.D591fs|NRCAM_ENST00000379022.4_Frame_Shift_Del_p.D610fs|NRCAM_ENST00000379028.3_Frame_Shift_Del_p.D610fs|NRCAM_ENST00000351718.4_Frame_Shift_Del_p.D604fs|NRCAM_ENST00000379024.4_Frame_Shift_Del_p.D591fs	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	610	Ig-like 6.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GTCCCGCTGTCATCGTCACTG	0.512																																							uc003vfb.2		NA																	0				ovary(3)|breast(2)	5						c.(1828-1830)GACfs		neuronal cell adhesion molecule isoform A							129.0	99.0	109.0					7																	107832248		2203	4300	6503	SO:0001589	frameshift_variant	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107832248delC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.1828delG	7.37:g.107832248delC	ENSP00000401244:p.Asp610fs					NRCAM_uc003vfc.2_Frame_Shift_Del_p.D604fs|NRCAM_uc011kmk.1_Frame_Shift_Del_p.D605fs|NRCAM_uc003vfd.2_Frame_Shift_Del_p.D586fs|NRCAM_uc003vfe.2_Frame_Shift_Del_p.D586fs	p.D610fs	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN			18	2299	-			610			Ig-like 6.|Extracellular (Potential).		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Frame_Shift_Del	DEL	ENST00000425651.2	37	c.1828delG	CCDS47686.1																																																																																				0.512	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		14	36	NA	NA	NA	NA	NA	14	36	---	---	---	---
FABP9	646480	broad.mit.edu	37	8	82370844	82370845	+	Frame_Shift_Ins	INS	-	-	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chr8:82370844_82370845insT	ENST00000379071.2	-	3	395_396	c.340_341insA	c.(340-342)atgfs	p.M114fs	RP11-157I4.4_ENST00000524085.2_RNA	NM_001080526.1	NP_001073995.1	Q0Z7S8	FABP9_HUMAN	fatty acid binding protein 9, testis	114					acrosome assembly (GO:0001675)	acrosomal vesicle (GO:0001669)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6			Epithelial(68;0.186)			TACCACTACCATTTTTTCATCC	0.317																																							uc011lfo.1		NA																	0					0						c.(340-342)ATGfs		fatty acid binding protein 9, testis																																				SO:0001589	frameshift_variant	646480						lipid binding|transporter activity	g.chr8:82370844_82370845insT			8q21.13	2013-03-01			ENSG00000205186	ENSG00000205186		"""Fatty acid binding protein family"""	3563	protein-coding gene	gene with protein product						7958448	Standard	NM_001080526		Approved	PERF, T-FABP, PERF15	uc011lfo.2	Q0Z7S8	OTTHUMG00000164601	ENST00000379071.2:c.341dupA	8.37:g.82370850_82370850dupT	ENSP00000368362:p.Met114fs						p.M114fs	NM_001080526	NP_001073995	Q0Z7S8	FABP9_HUMAN	Epithelial(68;0.186)		3	340_341	-			114						Frame_Shift_Ins	INS	ENST00000379071.2	37	c.340_341insA																																																																																					0.317	FABP9-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379367.2	NM_001080526		9	9	NA	NA	NA	NA	NA	9	9	---	---	---	---
NLGN4X	57502	broad.mit.edu	37	X	5821599	5821600	+	Frame_Shift_Ins	INS	-	-	T			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:5821599_5821600insT	ENST00000381095.3	-	5	1746_1747	c.1119_1120insA	c.(1117-1122)caagggfs	p.G374fs	NLGN4X_ENST00000381093.2_Frame_Shift_Ins_p.G394fs|NLGN4X_ENST00000275857.6_Frame_Shift_Ins_p.G374fs|NLGN4X_ENST00000538097.1_Frame_Shift_Ins_p.G374fs|NLGN4X_ENST00000381092.1_Frame_Shift_Ins_p.G374fs	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	374					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AGGCCTTCCCCTTGGTTGACGC	0.579																																							uc010ndh.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(1117-1122)CAAGGGfs		X-linked neuroligin 4 precursor																																				SO:0001589	frameshift_variant	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821599_5821600insT	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1120dupA	X.37:g.5821601_5821601dupT	ENSP00000370485:p.Gly374fs					NLGN4X_uc004crp.2_Frame_Shift_Ins_p.Q393fs|NLGN4X_uc004crq.2_Frame_Shift_Ins_p.Q373fs|NLGN4X_uc010ndi.2_Frame_Shift_Ins_p.Q410fs|NLGN4X_uc004crr.2_Frame_Shift_Ins_p.Q373fs|NLGN4X_uc010ndj.2_Frame_Shift_Ins_p.Q373fs	p.Q373fs	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			5	1620_1621	-			373_374			Extracellular (Potential).		Q6UX10|Q9ULG0	Frame_Shift_Ins	INS	ENST00000381095.3	37	c.1119_1120insA	CCDS14126.1																																																																																				0.579	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		13	40	NA	NA	NA	NA	NA	13	40	---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67938187	67938187	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:67938187delG	ENST00000252336.6	+	5	1563	c.1191delG	c.(1189-1191)gtgfs	p.V397fs	STARD8_ENST00000374599.3_Frame_Shift_Del_p.V477fs|STARD8_ENST00000374597.3_Frame_Shift_Del_p.V397fs	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	397					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						CTGAACCAGTGGCACAGGAAG	0.697																																							uc004dxa.2		NA																	0				breast(3)|ovary(2)|pancreas(1)	6						c.(1189-1191)GTGfs		StAR-related lipid transfer (START) domain							11.0	12.0	12.0					X																	67938187		2192	4274	6466	SO:0001589	frameshift_variant	9754				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity	g.chrX:67938187delG	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1191delG	X.37:g.67938187delG	ENSP00000252336:p.Val397fs					STARD8_uc004dxb.2_Frame_Shift_Del_p.V477fs|STARD8_uc004dxc.3_Frame_Shift_Del_p.V397fs	p.V397fs	NM_014725	NP_055540	Q92502	STAR8_HUMAN			5	1563	+			397					A8K6T2|D3DVT9|Q5JST0|Q68DG7	Frame_Shift_Del	DEL	ENST00000252336.6	37	c.1191delG	CCDS14390.1																																																																																				0.697	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		7	19	NA	NA	NA	NA	NA	7	19	---	---	---	---
GUCY2F	2986	broad.mit.edu	37	X	108631849	108631849	+	Frame_Shift_Del	DEL	G	G	-	rs370514556		TCGA-78-7147-01A-11D-2036-08	TCGA-78-7147-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	a030f9a1-a066-4c6e-82c3-24c893e38466	55464e8c-b3cb-4ceb-841d-bfdbd4a49a6e	g.chrX:108631849delG	ENST00000218006.2	-	15	3116	c.2825delC	c.(2824-2826)ccafs	p.P942fs		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	942	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						ATTCCTCTTTGGGAGGCCTGA	0.458																																							uc004eod.3		NA																	0				lung(4)|breast(3)|central_nervous_system(1)	8						c.(2824-2826)CCAfs		guanylate cyclase 2F precursor							150.0	132.0	138.0					X																	108631849		2203	4300	6503	SO:0001589	frameshift_variant	2986				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	g.chrX:108631849delG	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.2825delC	X.37:g.108631849delG	ENSP00000218006:p.Pro942fs					GUCY2F_uc011msq.1_RNA	p.P942fs	NM_001522	NP_001513	P51841	GUC2F_HUMAN			15	3101	-			942			Guanylate cyclase.|Cytoplasmic (Potential).		Q9UJF1	Frame_Shift_Del	DEL	ENST00000218006.2	37	c.2825delC	CCDS14545.1																																																																																				0.458	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522		21	114	NA	NA	NA	NA	NA	21	114	---	---	---	---
