#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HSPG2	3339	broad.mit.edu	37	1	22173050	22173050	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:22173050G>C	ENST00000374695.3	-	63	8286	c.8207C>G	c.(8206-8208)tCa>tGa	p.S2736*	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2736	Ig-like C2-type 13.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGCCACGTGTGAGGAGGATGA	0.622																																							uc001bfj.2		NA																	0				ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.(8206-8208)TCA>TGA		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						60.0	62.0	61.0					1																	22173050		2203	4300	6503	SO:0001587	stop_gained	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22173050G>C	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8207C>G	1.37:g.22173050G>C	ENSP00000363827:p.Ser2736*					HSPG2_uc009vqd.2_Nonsense_Mutation_p.S2737*	p.S2736*	NM_005529	NP_005520	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	63	8247	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	2736			Ig-like C2-type 13.		Q16287|Q5SZI3|Q9H3V5	Nonsense_Mutation	SNP	ENST00000374695.3	37	c.8207C>G	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.110350	0.37242	.	.	ENSG00000142798	ENST00000374695;ENST00000453796	.	.	.	4.94	4.94	0.65067	.	0.000000	0.34178	N	0.004190	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	10.8757	0.46909	0.0:0.0:0.812:0.188	.	.	.	.	X	2736;151	.	ENSP00000363827:S2736X	S	-	2	0	HSPG2	22045637	0.999000	0.42202	0.196000	0.23383	0.349000	0.29174	6.094000	0.71431	2.292000	0.77174	0.561000	0.74099	TCA		0.622	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		4	98	0	0	0	0.009096	0	4	98				
ZBTB40	9923	broad.mit.edu	37	1	22817950	22817950	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:22817950C>G	ENST00000375647.4	+	3	962	c.755C>G	c.(754-756)tCa>tGa	p.S252*	ZBTB40_ENST00000404138.1_Nonsense_Mutation_p.S252*|ZBTB40_ENST00000374651.4_Nonsense_Mutation_p.S252*	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	252					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GGTGTCTTCTCAGATGCACTC	0.348																																							uc001bft.2		NA																	0				ovary(1)	1						c.(754-756)TCA>TGA		zinc finger and BTB domain containing 40							76.0	82.0	80.0					1																	22817950		2203	4300	6503	SO:0001587	stop_gained	9923				bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:22817950C>G	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.755C>G	1.37:g.22817950C>G	ENSP00000364798:p.Ser252*					ZBTB40_uc001bfu.2_Nonsense_Mutation_p.S252*|ZBTB40_uc009vqi.1_Nonsense_Mutation_p.S252*	p.S252*	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)	4	1266	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	252					O75066|Q5TFU5|Q8N1R1	Nonsense_Mutation	SNP	ENST00000375647.4	37	c.755C>G	CCDS224.1	.	.	.	.	.	.	.	.	.	.	C	41	8.686029	0.98914	.	.	ENSG00000184677	ENST00000404138;ENST00000374649;ENST00000375647;ENST00000400239;ENST00000374651	.	.	.	5.57	5.57	0.84162	.	0.000000	0.46145	D	0.000311	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.2729	13.8082	0.63246	0.0:0.8464:0.1535:0.0	.	.	.	.	X	252;206;252;252;252	.	ENSP00000363780:S206X	S	+	2	0	ZBTB40	22690537	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	3.248000	0.51430	2.617000	0.88574	0.585000	0.79938	TCA		0.348	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870		9	75	0	0	0	0.000978	0	9	75				
ZBTB40	9923	broad.mit.edu	37	1	22818015	22818015	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:22818015C>T	ENST00000375647.4	+	3	1027	c.820C>T	c.(820-822)Cca>Tca	p.P274S	ZBTB40_ENST00000404138.1_Missense_Mutation_p.P274S|ZBTB40_ENST00000374651.4_Missense_Mutation_p.P274S	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	274					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		AATTAAAGGTCCACAGAAGGA	0.383																																							uc001bft.2		NA																	0				ovary(1)	1						c.(820-822)CCA>TCA		zinc finger and BTB domain containing 40							75.0	80.0	78.0					1																	22818015		2203	4300	6503	SO:0001583	missense	9923				bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:22818015C>T	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.820C>T	1.37:g.22818015C>T	ENSP00000364798:p.Pro274Ser					ZBTB40_uc001bfu.2_Missense_Mutation_p.P274S|ZBTB40_uc009vqi.1_Missense_Mutation_p.P274S	p.P274S	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)	4	1331	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	274					O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	c.820C>T	CCDS224.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309034	0.40895	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000400239;ENST00000374651	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.18	2.35	0.29111	.	0.353745	0.24318	N	0.039561	T	0.61502	0.2352	L	0.33485	1.01	0.09310	N	1	B;B	0.19200	0.034;0.02	B;B	0.19391	0.025;0.011	T	0.40813	-0.9543	10	0.12103	T	0.63	-0.5074	7.2345	0.26062	0.2566:0.3346:0.4088:0.0	.	274;274	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	S	274	ENSP00000384527:P274S;ENSP00000364798:P274S;ENSP00000383098:P274S;ENSP00000363782:P274S	ENSP00000363782:P274S	P	+	1	0	ZBTB40	22690602	0.079000	0.21365	0.053000	0.19242	0.933000	0.57130	2.201000	0.42734	0.370000	0.24538	0.585000	0.79938	CCA		0.383	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870		4	55	0	0	0	0.001168	0	4	55				
PAFAH2	5051	broad.mit.edu	37	1	26299085	26299085	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:26299085C>T	ENST00000374282.3	-	10	1227	c.1048G>A	c.(1048-1050)Gta>Ata	p.V350I	PAFAH2_ENST00000374284.1_Missense_Mutation_p.V350I	NM_000437.3	NP_000428.2	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2, 40kDa	350					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|phospholipid binding (GO:0005543)			NS(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	9		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		ATGGCCCGTACCATAACCTCC	0.527																																							uc001bld.3		NA																	0				ovary(2)	2						c.(1048-1050)GTA>ATA		platelet-activating factor acetylhydrolase 2							59.0	55.0	56.0					1																	26299085		2203	4300	6503	SO:0001583	missense	5051				lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding	g.chr1:26299085C>T	D87845	CCDS270.1	1p34.3	2008-09-19	2002-08-29		ENSG00000158006	ENSG00000158006			8579	protein-coding gene	gene with protein product		602344	"""platelet-activating factor acetylhydrolase 2 (40kD)"""			8955149, 9494101	Standard	NM_000437		Approved	HSD-PLA2	uc001bld.4	Q99487	OTTHUMG00000007437	ENST00000374282.3:c.1048G>A	1.37:g.26299085C>T	ENSP00000363400:p.Val350Ile					PAFAH2_uc001ble.3_Missense_Mutation_p.V350I	p.V350I	NM_000437	NP_000428	Q99487	PAFA2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)	10	1228	-		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	350					D3DPK1|O15458|Q5SY02	Missense_Mutation	SNP	ENST00000374282.3	37	c.1048G>A	CCDS270.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.504467	0.26949	.	.	ENSG00000158006	ENST00000374282;ENST00000374284	T;T	0.41400	1.0;1.0	5.57	4.61	0.57282	.	0.376195	0.22101	N	0.064606	T	0.20373	0.0490	N	0.13003	0.285	0.25333	N	0.989012	B	0.21606	0.058	B	0.18871	0.023	T	0.11542	-1.0583	10	0.15952	T	0.53	-19.7087	4.684	0.12748	0.1849:0.6536:0.0:0.1615	.	350	Q99487	PAFA2_HUMAN	I	350	ENSP00000363400:V350I;ENSP00000363402:V350I	ENSP00000363400:V350I	V	-	1	0	PAFAH2	26171672	0.878000	0.30173	1.000000	0.80357	0.724000	0.41520	1.635000	0.37134	2.642000	0.89623	0.478000	0.44815	GTA		0.527	PAFAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019544.1	NM_000437		10	77	0	0	0	0.006214	0	10	77				
TRIM63	84676	broad.mit.edu	37	1	26387753	26387753	+	Silent	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:26387753G>C	ENST00000374272.3	-	3	543	c.405C>G	c.(403-405)ctC>ctG	p.L135L	TRIM63_ENST00000483052.1_5'UTR	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	135	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCACACGTGAGACAGTAGA	0.552																																							uc001bli.1		NA																	0				kidney(1)	1						c.(403-405)CTC>CTG		muscle specific ring finger protein 1							156.0	116.0	130.0					1																	26387753		2203	4300	6503	SO:0001819	synonymous_variant	84676					cytoplasm|microtubule|nucleus	ligase activity|signal transducer activity|titin binding|zinc ion binding	g.chr1:26387753G>C	AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.405C>G	1.37:g.26387753G>C							p.L135L	NM_032588	NP_115977	Q969Q1	TRI63_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	3	541	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	135			Interaction with TTN.|B box-type.		B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Silent	SNP	ENST00000374272.3	37	c.405C>G	CCDS273.1																																																																																				0.552	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019750.1	NM_032588		6	72	0	0	0	0.00308	0	6	72				
ZMYM6	9204	broad.mit.edu	37	1	35477597	35477597	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:35477597A>G	ENST00000357182.4	-	8	1183	c.956T>C	c.(955-957)gTt>gCt	p.V319A	ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000487874.1_Missense_Mutation_p.V319A|ZMYM6_ENST00000373340.2_Missense_Mutation_p.V319A	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	319					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				ATGACATGAAACCTGGACACC	0.343																																							uc001byh.2		NA																	0				ovary(3)	3						c.(955-957)GTT>GCT		zinc finger protein 258							117.0	107.0	110.0					1																	35477597		2203	4300	6503	SO:0001583	missense	9204				multicellular organismal development	nucleus	DNA binding|zinc ion binding	g.chr1:35477597A>G	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.956T>C	1.37:g.35477597A>G	ENSP00000349708:p.Val319Ala					ZMYM6_uc001byf.1_Missense_Mutation_p.V319A|ZMYM6_uc010oht.1_Missense_Mutation_p.V222A|ZMYM6_uc009vup.2_Missense_Mutation_p.V125A|ZMYM6_uc009vuq.1_Missense_Mutation_p.V319A|ZMYM6_uc009vur.1_Missense_Mutation_p.V125A	p.V319A	NM_007167	NP_009098	O95789	ZMYM6_HUMAN			8	1184	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)	319			MYM-type 4.		B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	37	c.956T>C	CCDS387.2	.	.	.	.	.	.	.	.	.	.	A	18.72	3.684178	0.68157	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	T;T	0.25414	1.8;2.99	5.13	5.13	0.70059	.	0.067905	0.56097	D	0.000023	T	0.41719	0.1171	M	0.66939	2.045	0.47065	D	0.999302	D;P;P	0.63880	0.993;0.885;0.532	P;P;B	0.54460	0.753;0.695;0.431	T	0.25363	-1.0134	10	0.42905	T	0.14	-18.3348	15.4	0.74830	1.0:0.0:0.0:0.0	.	222;319;319	B4DWC0;O95789;O95789-1	.;ZMYM6_HUMAN;.	A	319	ENSP00000362437:V319A;ENSP00000349708:V319A	ENSP00000349708:V319A	V	-	2	0	ZMYM6	35250184	1.000000	0.71417	0.958000	0.39756	0.979000	0.70002	4.644000	0.61397	2.281000	0.76405	0.528000	0.53228	GTT		0.343	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167		11	52	0	0	0	0.008291	0	11	52				
COL8A2	1296	broad.mit.edu	37	1	36564747	36564747	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:36564747C>G	ENST00000397799.1	-	4	759	c.535G>C	c.(535-537)Ggg>Cgg	p.G179R	COL8A2_ENST00000303143.4_Missense_Mutation_p.G179R|COL8A2_ENST00000481785.1_Missense_Mutation_p.G114R			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	179	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCTGGCACCCCTTGGGCACCT	0.697																																							uc001bzv.1		NA																	0				central_nervous_system(1)	1						c.(535-537)GGG>CGG		collagen, type VIII, alpha 2 precursor							4.0	5.0	4.0					1																	36564747		1648	3509	5157	SO:0001583	missense	1296				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging	g.chr1:36564747C>G	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.535G>C	1.37:g.36564747C>G	ENSP00000380901:p.Gly179Arg					COL8A2_uc001bzw.1_Missense_Mutation_p.G114R	p.G179R	NM_005202	NP_005193	P25067	CO8A2_HUMAN			2	542	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	179			Triple-helical region.		Q5JV31|Q8TEJ5	Missense_Mutation	SNP	ENST00000397799.1	37	c.535G>C	CCDS403.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039480	0.35989	.	.	ENSG00000171812	ENST00000303143;ENST00000397799;ENST00000481785;ENST00000373172	D;D;D	0.95482	-3.72;-3.72;-3.64	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.98495	0.9498	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99777	1.1026	10	0.87932	D	0	.	17.1232	0.86707	0.0:1.0:0.0:0.0	.	179	P25067	CO8A2_HUMAN	R	179;179;114;179	ENSP00000305913:G179R;ENSP00000380901:G179R;ENSP00000436433:G114R	ENSP00000305913:G179R	G	-	1	0	COL8A2	36337334	1.000000	0.71417	0.971000	0.41717	0.200000	0.23975	7.575000	0.82447	2.372000	0.80975	0.511000	0.50034	GGG		0.697	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202		9	15	0	0	0	0.004482	0	9	15				
B4GALT2	8704	broad.mit.edu	37	1	44447061	44447061	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:44447061T>C	ENST00000356836.6	+	2	1019	c.229T>C	c.(229-231)Tcc>Ccc	p.S77P	B4GALT2_ENST00000372324.1_Missense_Mutation_p.S77P|B4GALT2_ENST00000434555.2_Silent_p.A25A|B4GALT2_ENST00000309519.7_Missense_Mutation_p.S106P	NM_001005417.2|NM_030587.2	NP_001005417.1|NP_085076.2	O60909	B4GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2	77					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			N-Acetyl-D-glucosamine(DB00141)	CGCCTCTAGCTCCGGGCTCCC	0.701																																							uc001clg.2		NA																	0				ovary(1)|skin(1)	2						c.(229-231)TCC>CCC		UDP-Gal:betaGlcNAc beta 1,4-	N-Acetyl-D-glucosamine(DB00141)						21.0	25.0	23.0					1																	44447061		2202	4291	6493	SO:0001583	missense	8704				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|lactose synthase activity|metal ion binding|N-acetyllactosamine synthase activity	g.chr1:44447061T>C	AF038660	CCDS506.1, CCDS55596.1	1p34-p33	2013-02-19			ENSG00000117411	ENSG00000117411		"""Beta 4-glycosyltransferases"""	925	protein-coding gene	gene with protein product		604013				9405390, 9597550	Standard	NM_003780		Approved	beta4Gal-T2	uc010okl.2	O60909	OTTHUMG00000008296	ENST00000356836.6:c.229T>C	1.37:g.44447061T>C	ENSP00000349293:p.Ser77Pro					B4GALT2_uc001clh.2_Silent_p.A25A|B4GALT2_uc010okl.1_Missense_Mutation_p.S106P|B4GALT2_uc001cli.2_Missense_Mutation_p.S77P	p.S77P	NM_003780	NP_003771	O60909	B4GT2_HUMAN			2	599	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)	77			Lumenal (Potential).		B3KTP0|B4DE14|D3DPY6|D3DPY7|O60511|Q4V9L9|Q5T4X5|Q5T4Y5|Q9BUP6|Q9NSY7	Missense_Mutation	SNP	ENST00000356836.6	37	c.229T>C	CCDS506.1	.	.	.	.	.	.	.	.	.	.	T	13.64	2.296261	0.40594	.	.	ENSG00000117411	ENST00000372324;ENST00000356836;ENST00000309519	T;T;T	0.46819	0.88;0.88;0.86	4.77	3.64	0.41730	.	4.677100	0.04582	N	0.395157	T	0.29458	0.0734	N	0.08118	0	0.35978	D	0.835827	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.16364	-1.0405	9	.	.	.	-26.3128	9.0048	0.36104	0.0:0.0883:0.0:0.9117	.	106;77	B4DE14;O60909	.;B4GT2_HUMAN	P	77;77;106	ENSP00000361399:S77P;ENSP00000349293:S77P;ENSP00000310696:S106P	.	S	+	1	0	B4GALT2	44219648	1.000000	0.71417	0.996000	0.52242	0.832000	0.47134	2.790000	0.47821	1.775000	0.52247	0.533000	0.62120	TCC		0.701	B4GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022840.1	NM_003780		4	70	0	0	0	0.000602	0	4	70				
F3	2152	broad.mit.edu	37	1	94998772	94998772	+	Silent	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:94998772C>G	ENST00000334047.7	-	4	628	c.465G>C	c.(463-465)gtG>gtC	p.V155V	F3_ENST00000370207.4_Silent_p.V155V|F3_ENST00000480356.1_5'UTR	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	155					activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	CGGTCACATTCACTTTTGTTC	0.403																																					Melanoma(40;358 1339 15970 39161)	Melanoma(40;358 1339 15970 39161)	uc001dqr.2		NA																	0				central_nervous_system(1)	1						c.(463-465)GTG>GTC		coagulation factor III precursor	Coagulation factor VIIa(DB00036)						127.0	112.0	117.0					1																	94998772		2203	4300	6503	SO:0001819	synonymous_variant	2152				activation of caspase activity|activation of plasma proteins involved in acute inflammatory response|anti-apoptosis|blood coagulation, extrinsic pathway|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of protein kinase B signaling cascade	extracellular matrix|extracellular space|integral to membrane	cell surface binding|phospholipid binding|protease binding	g.chr1:94998772C>G	BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.465G>C	1.37:g.94998772C>G						F3_uc001dqp.2_RNA|F3_uc001dqq.2_RNA|F3_uc001dqs.2_Silent_p.V155V	p.V155V	NM_001993	NP_001984	P13726	TF_HUMAN		all cancers(265;0.0232)|Epithelial(280;0.121)	4	644	-		all_lung(203;0.00106)|Lung NSC(277;0.00475)	155			Extracellular (Potential).		D3DT47|Q6FHG2|Q86WH4	Silent	SNP	ENST00000334047.7	37	c.465G>C	CCDS750.1																																																																																				0.403	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029593.1	NM_001993		23	18	0	0	0	0.002299	0	23	18				
PLPPR4	9890	broad.mit.edu	37	1	99771934	99771934	+	Missense_Mutation	SNP	C	C	G	rs200541722		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:99771934C>G	ENST00000370185.3	+	7	2157	c.1660C>G	c.(1660-1662)Cgg>Ggg	p.R554G	LPPR4_ENST00000370184.1_Missense_Mutation_p.R396G|LPPR4_ENST00000457765.1_Missense_Mutation_p.R496G	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		554					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CAGCTCTGCTCGGGCCAAGTG	0.537																																							uc001dse.2		NA																	0				ovary(3)	3						c.(1660-1662)CGG>GGG		plasticity related gene 1							70.0	77.0	74.0					1																	99771934		2203	4300	6503	SO:0001583	missense	9890						phosphatidate phosphatase activity	g.chr1:99771934C>G																												ENST00000370185.3:c.1660C>G	1.37:g.99771934C>G	ENSP00000359204:p.Arg554Gly					LPPR4_uc010oue.1_Missense_Mutation_p.R496G	p.R554G	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	7	1766	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	554					E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	c.1660C>G	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.453726	0.43531	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000370184	T;T;T	0.36878	1.76;1.62;1.23	5.62	3.49	0.39957	.	0.126219	0.51477	D	0.000083	T	0.45895	0.1365	M	0.65975	2.015	0.44201	D	0.997028	P;D	0.76494	0.897;0.999	B;D	0.68765	0.35;0.96	T	0.47636	-0.9102	9	.	.	.	-18.7664	14.9754	0.71267	0.3796:0.6204:0.0:0.0	.	496;554	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	G	554;496;396	ENSP00000359204:R554G;ENSP00000394913:R496G;ENSP00000359203:R396G	.	R	+	1	2	RP4-788L13.1	99544522	0.394000	0.25246	0.931000	0.37212	0.989000	0.77384	0.999000	0.29757	1.297000	0.44761	0.591000	0.81541	CGG		0.537	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			13	139	0	0	0	0.00245	0	13	139				
LINGO4	339398	broad.mit.edu	37	1	151773522	151773522	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:151773522C>T	ENST00000368820.3	-	2	2596	c.1659G>A	c.(1657-1659)ctG>ctA	p.L553L	RP11-98D18.17_ENST00000601909.1_lincRNA	NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	553						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAAGGGCAATCAGGCCAAAGC	0.562																																							uc001ezf.1		NA																	0				large_intestine(1)	1						c.(1657-1659)CTG>CTA		leucine rich repeat and Ig domain containing 4							113.0	114.0	114.0					1																	151773522		2203	4300	6503	SO:0001819	synonymous_variant	339398					integral to membrane		g.chr1:151773522C>T		CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.1659G>A	1.37:g.151773522C>T							p.L553L	NM_001004432	NP_001004432	Q6UY18	LIGO4_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)		2	1849	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		553			Helical; (Potential).			Silent	SNP	ENST00000368820.3	37	c.1659G>A	CCDS30855.1																																																																																				0.562	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036639.1	XM_291387		9	309	0	0	0	0.006214	0	9	309				
FDPS	2224	broad.mit.edu	37	1	155288031	155288031	+	Silent	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:155288031C>G	ENST00000356657.6	+	6	795	c.633C>G	c.(631-633)ctC>ctG	p.L211L	FDPS_ENST00000368356.4_Silent_p.L211L|RUSC1_ENST00000368352.5_5'Flank|FDPS_ENST00000447866.1_Silent_p.L145L|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000446880.1_RNA	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	211					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	TGCTGAAGCTCTATTGCCGGG	0.542																																							uc001fkc.2		NA																	0					0						c.(631-633)CTC>CTG		farnesyl diphosphate synthase isoform a	Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)						77.0	73.0	74.0					1																	155288031		2203	4300	6503	SO:0001819	synonymous_variant	2224				cholesterol biosynthetic process|interspecies interaction between organisms|isoprenoid biosynthetic process	cytosol|nucleus	dimethylallyltranstransferase activity|geranyltranstransferase activity|metal ion binding	g.chr1:155288031C>G	J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.633C>G	1.37:g.155288031C>G						RAG1AP1_uc010pey.1_Intron|FDPS_uc001fkd.2_Silent_p.L145L|FDPS_uc001fke.2_Silent_p.L211L|FDPS_uc001fkf.2_Silent_p.L145L|C1orf104_uc001fkh.1_Intron|RUSC1_uc001fkj.2_5'Flank|RUSC1_uc001fkk.2_5'Flank	p.L211L	NM_002004	NP_001995	P14324	FPPS_HUMAN	Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		6	852	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		211					D3DV91|E9PCI9|Q96G29	Silent	SNP	ENST00000356657.6	37	c.633C>G	CCDS1110.1																																																																																				0.542	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039053.1	NM_002004		7	143	0	0	0	0.00308	0	7	143				
CD1A	909	broad.mit.edu	37	1	158225110	158225110	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:158225110C>A	ENST00000289429.5	+	2	828	c.295C>A	c.(295-297)Cgt>Agt	p.R99S		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	99					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	TGAGGGAATTCGTAGATACGC	0.468																																							uc001frt.2		NA																	0				pancreas(2)|skin(1)	3						c.(295-297)CGT>AGT		CD1A antigen precursor	Antithymocyte globulin(DB00098)						88.0	84.0	85.0					1																	158225110		2203	4300	6503	SO:0001583	missense	909				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex		g.chr1:158225110C>A	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.295C>A	1.37:g.158225110C>A	ENSP00000289429:p.Arg99Ser						p.R99S	NM_001763	NP_001754	P06126	CD1A_HUMAN			2	828	+	all_hematologic(112;0.0378)		99			Extracellular (Potential).		D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	ENST00000289429.5	37	c.295C>A	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.620600	0.28801	.	.	ENSG00000158477	ENST00000289429	T	0.06608	3.28	4.07	-0.567	0.11763	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.769060	0.03408	N	0.204308	T	0.02727	0.0082	L	0.42245	1.32	0.09310	N	1	B	0.30455	0.28	B	0.35278	0.199	T	0.46992	-0.9151	10	0.66056	D	0.02	0.0237	6.903	0.24293	0.4838:0.3544:0.1618:0.0	.	99	P06126	CD1A_HUMAN	S	99	ENSP00000289429:R99S	ENSP00000289429:R99S	R	+	1	0	CD1A	156491734	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.176000	0.09811	0.106000	0.17784	-0.203000	0.12734	CGT		0.468	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763		7	86	1	0	2.0095e-06	0.001984	2.17542e-06	7	86				
CD1B	910	broad.mit.edu	37	1	158300725	158300725	+	Silent	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:158300725G>T	ENST00000368168.3	-	2	296	c.189C>A	c.(187-189)ggC>ggA	p.G63G		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	63					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					ATATGGCAGTGCCTGAGTCGC	0.468																																							uc001frx.2		NA																	0				ovary(2)	2						c.(187-189)GGC>GGA		CD1B antigen precursor							244.0	235.0	238.0					1																	158300725		2203	4300	6503	SO:0001819	synonymous_variant	910				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding	g.chr1:158300725G>T	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.189C>A	1.37:g.158300725G>T						CD1B_uc001frw.2_5'UTR|CD1B_uc010pic.1_Silent_p.G63G	p.G63G	NM_001764	NP_001755	P29016	CD1B_HUMAN			2	297	-	all_hematologic(112;0.0378)		63			Extracellular (Potential).		Q5TDK9|Q5TDL0|Q9UMM2	Silent	SNP	ENST00000368168.3	37	c.189C>A	CCDS1176.1	.	.	.	.	.	.	.	.	.	.	G	0.038	-1.296926	0.01364	.	.	ENSG00000158485	ENST00000451207	.	.	.	4.01	-0.702	0.11265	.	.	.	.	.	T	0.07638	0.0192	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.35895	-0.9770	4	.	.	.	-1.2017	2.2996	0.04159	0.1011:0.1631:0.4021:0.3337	.	.	.	.	N	31	.	.	H	-	1	0	CD1B	156567349	0.001000	0.12720	0.000000	0.03702	0.021000	0.10359	0.135000	0.15952	-0.214000	0.10078	0.655000	0.94253	CAC		0.468	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764		125	362	1	0	4.43683e-73	0.00361	5.54017e-73	125	362				
ARHGAP30	257106	broad.mit.edu	37	1	161018914	161018914	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:161018914G>A	ENST00000368013.3	-	12	2217	c.1897C>T	c.(1897-1899)Ctg>Ttg	p.L633L	ARHGAP30_ENST00000368016.3_Silent_p.L633L|ARHGAP30_ENST00000368015.1_Silent_p.L456L	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	633					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TCTCCCTCCAGACTCCCTGAA	0.577																																							uc001fxl.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(1897-1899)CTG>TTG		Rho GTPase activating protein 30 isoform 1							141.0	136.0	137.0					1																	161018914		2203	4300	6503	SO:0001819	synonymous_variant	257106				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr1:161018914G>A	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.1897C>T	1.37:g.161018914G>A						ARHGAP30_uc001fxk.2_Silent_p.L633L|ARHGAP30_uc001fxm.2_Silent_p.L479L|ARHGAP30_uc009wtx.2_Silent_p.L306L|ARHGAP30_uc001fxn.1_Silent_p.L479L	p.L633L	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00122)		12	2243	-	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		633					Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	ENST00000368013.3	37	c.1897C>T	CCDS30918.1																																																																																				0.577	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720		27	266	0	0	0	0.00632	0	27	266				
CENPL	91687	broad.mit.edu	37	1	173772523	173772523	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:173772523G>C	ENST00000345664.6	-	4	754	c.541C>G	c.(541-543)Ctg>Gtg	p.L181V	CENPL_ENST00000356198.2_Missense_Mutation_p.L227V|CENPL_ENST00000367710.3_Missense_Mutation_p.L181V	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	181					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						AATAAGGGCAGACAGGTGAAA	0.423																																							uc001gje.3		NA																	0					0						c.(541-543)CTG>GTG		centromere protein L isoform 2							96.0	104.0	101.0					1																	173772523		2203	4300	6503	SO:0001583	missense	91687				mitotic prometaphase	chromosome, centromeric region|cytosol|nucleus		g.chr1:173772523G>C	BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.541C>G	1.37:g.173772523G>C	ENSP00000323543:p.Leu181Val					CENPL_uc009wwg.2_Missense_Mutation_p.L55V|CENPL_uc001gjg.3_Missense_Mutation_p.L227V|CENPL_uc001gjf.3_Missense_Mutation_p.L181V	p.L181V	NM_033319	NP_201576	Q8N0S6	CENPL_HUMAN			4	755	-			181					Q5TEL5|Q96ND4	Missense_Mutation	SNP	ENST00000345664.6	37	c.541C>G	CCDS30938.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960950	0.34565	.	.	ENSG00000120334	ENST00000356198;ENST00000345664;ENST00000367710	T;T;T	0.65178	0.58;-0.14;-0.14	5.03	0.98	0.19750	.	0.077214	0.52532	N	0.000063	T	0.38772	0.1053	M	0.70275	2.135	0.45205	D	0.998215	B;B	0.33073	0.396;0.035	B;B	0.31812	0.136;0.037	T	0.27226	-1.0080	10	0.56958	D	0.05	.	5.7964	0.18389	0.3122:0.1393:0.5485:0.0	.	227;181	Q8N0S6-2;Q8N0S6	.;CENPL_HUMAN	V	227;181;181	ENSP00000348527:L227V;ENSP00000323543:L181V;ENSP00000356683:L181V	ENSP00000323543:L181V	L	-	1	2	CENPL	172039146	1.000000	0.71417	0.742000	0.31022	0.993000	0.82548	1.223000	0.32527	-0.071000	0.12886	0.655000	0.94253	CTG		0.423	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1	NM_033319		5	177	0	0	0	0.000602	0	5	177				
TNR	7143	broad.mit.edu	37	1	175334287	175334287	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:175334287C>T	ENST00000367674.2	-	12	3154	c.2446G>A	c.(2446-2448)Gag>Aag	p.E816K	TNR_ENST00000263525.2_Missense_Mutation_p.E816K			Q92752	TENR_HUMAN	tenascin R	816	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.E816Q(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TCCATCATCTCTTCCTCCTCA	0.532																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(2446-2448)GAG>AAG		tenascin R precursor							126.0	116.0	119.0					1																	175334287		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175334287C>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2446G>A	1.37:g.175334287C>T	ENSP00000356646:p.Glu816Lys					TNR_uc009wwu.1_Missense_Mutation_p.E816K	p.E816K	NM_003285	NP_003276	Q92752	TENR_HUMAN			10	2527	-	Renal(580;0.146)		816			Fibronectin type-III 6.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.2446G>A	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662748	0.47572	.	.	ENSG00000116147	ENST00000367674;ENST00000263525	T;T	0.53857	0.6;0.6	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.344691	0.31847	N	0.006971	T	0.46795	0.1411	L	0.41492	1.28	0.39223	D	0.96353	B	0.22003	0.063	B	0.27170	0.077	T	0.40590	-0.9555	10	0.38643	T	0.18	.	14.1106	0.65120	0.0:0.928:0.0:0.072	.	816	Q92752	TENR_HUMAN	K	816	ENSP00000356646:E816K;ENSP00000263525:E816K	ENSP00000263525:E816K	E	-	1	0	TNR	173600910	1.000000	0.71417	0.990000	0.47175	0.277000	0.26821	5.614000	0.67695	2.793000	0.96121	0.655000	0.94253	GAG		0.532	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		25	91	0	0	0	0.004656	0	25	91				
KIAA1614	57710	broad.mit.edu	37	1	180885798	180885798	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:180885798C>A	ENST00000367588.4	+	2	614	c.559C>A	c.(559-561)Cct>Act	p.P187T		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	187										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						GAGCCCGTGGCCTCCAGAAGC	0.647																																							uc001gok.2		NA																	0				ovary(3)|skin(1)	4						c.(559-561)CCT>ACT		hypothetical protein LOC57710							47.0	51.0	50.0					1																	180885798		1906	4114	6020	SO:0001583	missense	57710							g.chr1:180885798C>A	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.559C>A	1.37:g.180885798C>A	ENSP00000356560:p.Pro187Thr						p.P187T	NM_020950	NP_066001	Q5VZ46	K1614_HUMAN			2	626	+			187					Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	c.559C>A	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	C	2.102	-0.405816	0.04832	.	.	ENSG00000135835	ENST00000367588	T	0.05319	3.46	4.28	-2.53	0.06326	.	0.771237	0.10763	N	0.636945	T	0.02380	0.0073	N	0.14661	0.345	0.26244	N	0.978828	B	0.27656	0.184	B	0.29353	0.101	T	0.43196	-0.9406	9	0.02654	T	1	-0.0792	1.1154	0.01713	0.1496:0.3356:0.1466:0.3682	.	187	Q5VZ46	K1614_HUMAN	T	187	ENSP00000356560:P187T	ENSP00000356560:P187T	P	+	1	0	KIAA1614	179152421	0.051000	0.20477	0.375000	0.26029	0.180000	0.23129	-0.830000	0.04410	-0.448000	0.07128	0.563000	0.77884	CCT		0.647	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531		42	117	1	0	5.20837e-25	0.00874	6.30346e-25	42	117				
FCAMR	83953	broad.mit.edu	37	1	207143467	207143467	+	Missense_Mutation	SNP	C	C	T	rs267598336		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:207143467C>T	ENST00000324852.4	-	1	478	c.4G>A	c.(4-6)Gat>Aat	p.D2N	FCAMR_ENST00000400962.3_Missense_Mutation_p.D2N|FCAMR_ENST00000450945.2_Missense_Mutation_p.D2N	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	0					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						GCCTCTCCATCCATCTCAGTC	0.493																																					Ovarian(199;1883 2142 16966 44409 45154)	Ovarian(199;1883 2142 16966 44409 45154)	uc001hfa.3		NA																	0				ovary(1)	1						c.(4-6)GAT>AAT		Fc receptor, IgA, IgM, high affinity isoform 2							129.0	117.0	121.0					1																	207143467		1568	3582	5150	SO:0001583	missense	83953					integral to membrane|plasma membrane	receptor activity	g.chr1:207143467C>T	AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.4G>A	1.37:g.207143467C>T	ENSP00000316491:p.Asp2Asn					FCAMR_uc001hfb.2_Missense_Mutation_p.D2N|FCAMR_uc009xca.1_Missense_Mutation_p.D2N|FCAMR_uc001hfc.2_Missense_Mutation_p.D2N	p.D2N	NM_001122980	NP_001116452	Q8WWV6	FCAMR_HUMAN			1	504	-			Error:Variant_position_missing_in_Q8WWV6_after_alignment					Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	ENST00000324852.4	37	c.4G>A	CCDS53468.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898067	0.72639	.	.	ENSG00000162897	ENST00000400962;ENST00000324852;ENST00000450945;ENST00000367087	T;T;T	0.10382	2.88;3.25;2.88	5.17	4.26	0.50523	.	1.183850	0.06110	N	0.667003	T	0.07052	0.0179	N	0.08118	0	0.22591	N	0.998959	P	0.34977	0.478	B	0.31442	0.13	T	0.32268	-0.9913	10	0.87932	D	0	0.0951	9.1739	0.37100	0.0:0.9033:0.0:0.0967	.	2	D2KTA8	.	N	2	ENSP00000383746:D2N;ENSP00000316491:D2N;ENSP00000392707:D2N	ENSP00000316491:D2N	D	-	1	0	FCAMR	205210090	0.208000	0.23494	0.842000	0.33263	0.011000	0.07611	0.249000	0.18216	1.403000	0.46800	0.655000	0.94253	GAT		0.493	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088969.2	NM_032029		7	115	0	0	0	0.00308	0	7	115				
CENPF	1063	broad.mit.edu	37	1	214818019	214818019	+	Silent	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:214818019C>G	ENST00000366955.3	+	13	5274	c.5106C>G	c.(5104-5106)ctC>ctG	p.L1702L		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1798					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGCAGGACCTCAATCTAGACA	0.438																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	0				ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(5104-5106)CTC>CTG		centromere protein F							73.0	71.0	71.0					1																	214818019		2203	4300	6503	SO:0001819	synonymous_variant	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214818019C>G	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5106C>G	1.37:g.214818019C>G							p.L1702L	NM_016343	NP_057427	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	13	5280	+			1798					Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	c.5106C>G	CCDS31023.1																																																																																				0.438	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		4	82	0	0	0	0.009096	0	4	82				
OBSCN	84033	broad.mit.edu	37	1	228466505	228466505	+	Silent	SNP	C	C	T	rs367606070		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr1:228466505C>T	ENST00000422127.1	+	26	7019	c.6975C>T	c.(6973-6975)ggC>ggT	p.G2325G	OBSCN_ENST00000366709.4_5'UTR|RP5-1139B12.3_ENST00000602947.1_RNA|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000570156.2_Silent_p.G2754G|OBSCN_ENST00000284548.11_Silent_p.G2325G|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000359599.6_Silent_p.G1172G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2325	Ig-like 23.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGTTCAAGGGCAGTCAGGAGC	0.642																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(6973-6975)GGC>GGT		obscurin, cytoskeletal calmodulin and		C	,	2,4244		0,2,2121	41.0	49.0	47.0		6975,6975	-7.9	0.0	1		47	0,8456		0,0,4228	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	0,2,6349	TT,TC,CC		0.0,0.0471,0.0157	,	2325/7969,2325/6621	228466505	2,12700	2123	4228	6351	SO:0001819	synonymous_variant	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228466505C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.6975C>T	1.37:g.228466505C>T						OBSCN_uc001hsn.2_Silent_p.G2325G|OBSCN_uc001hsp.1_Silent_p.G24G|OBSCN_uc001hsq.1_5'Flank	p.G2325G	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			26	7019	+		Prostate(94;0.0405)	2325			Ig-like 23.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	c.6975C>T	CCDS58065.1																																																																																				0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		17	68	0	0	0	0.00499	0	17	68				
RBM17	84991	broad.mit.edu	37	10	6157223	6157223	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:6157223G>A	ENST00000446108.1	+	11	1695	c.1051G>A	c.(1051-1053)Gaa>Aaa	p.E351K	RBM17_ENST00000476706.1_3'UTR|RBM17_ENST00000379888.4_Missense_Mutation_p.E351K	NM_001145547.1	NP_001139019.1	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	351	RRM.				alternative mRNA splicing, via spliceosome (GO:0000380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	19						CCCTGATGATGAAGCAGTACG	0.338																																							uc001ijb.2		NA																	0					0						c.(1051-1053)GAA>AAA		RNA binding motif protein 17							63.0	62.0	62.0					10																	6157223		2203	4300	6503	SO:0001583	missense	84991				mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding	g.chr10:6157223G>A	AF083384	CCDS7077.1	10p15.1	2013-01-28			ENSG00000134453	ENSG00000134453		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	16944	protein-coding gene	gene with protein product	"""splicing factor 45kDa"""	606935				9731529	Standard	NM_032905		Approved	SPF45, MGC14439	uc001ijb.3	Q96I25	OTTHUMG00000017618	ENST00000446108.1:c.1051G>A	10.37:g.6157223G>A	ENSP00000388638:p.Glu351Lys					RBM17_uc010qav.1_Missense_Mutation_p.E351K|RBM17_uc001ijc.2_RNA	p.E351K	NM_032905	NP_116294	Q96I25	SPF45_HUMAN			11	1277	+			351			RRM.		Q96GY6	Missense_Mutation	SNP	ENST00000446108.1	37	c.1051G>A	CCDS7077.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744410	0.89663	.	.	ENSG00000134453	ENST00000379888;ENST00000446108	.	.	.	4.74	4.74	0.60224	RNA recognition motif domain, eukaryote (1);Nucleotide-binding, alpha-beta plait (1);	0.046406	0.85682	D	0.000000	D	0.84347	0.5452	M	0.90309	3.105	0.80722	D	1	D	0.60575	0.988	D	0.67382	0.951	D	0.86499	0.1802	9	0.44086	T	0.13	-25.3393	18.1207	0.89571	0.0:0.0:1.0:0.0	.	351	Q96I25	SPF45_HUMAN	K	351	.	ENSP00000369218:E351K	E	+	1	0	RBM17	6197229	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.692000	0.91284	2.310000	0.77875	0.655000	0.94253	GAA		0.338	RBM17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046635.1	NM_032905		3	25	0	0	0	0.004672	0	3	25				
NEBL	10529	broad.mit.edu	37	10	21120446	21120446	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:21120446G>C	ENST00000377122.4	-	15	1912	c.1516C>G	c.(1516-1518)Ctt>Gtt	p.L506V	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	506					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGGACATCAAGAGTGTCTGTG	0.423																																							uc001iqi.2		NA																	0				ovary(2)	2						c.(1516-1518)CTT>GTT		nebulette sarcomeric isoform							173.0	160.0	165.0					10																	21120446		2203	4300	6503	SO:0001583	missense	10529				regulation of actin filament length		actin binding|structural constituent of muscle	g.chr10:21120446G>C	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.1516C>G	10.37:g.21120446G>C	ENSP00000366326:p.Leu506Val					NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	p.L506V	NM_006393	NP_006384	O76041	NEBL_HUMAN			15	1913	-			506			Nebulin 14.		B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000377122.4	37	c.1516C>G	CCDS7134.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.776312	0.70107	.	.	ENSG00000078114	ENST00000377122	T	0.45668	0.89	5.54	5.54	0.83059	.	0.234215	0.37178	N	0.002202	T	0.58264	0.2110	M	0.71581	2.175	0.80722	D	1	B	0.31054	0.306	P	0.47981	0.563	T	0.49588	-0.8924	10	0.15066	T	0.55	.	19.4449	0.94843	0.0:0.0:1.0:0.0	.	506	O76041	NEBL_HUMAN	V	506	ENSP00000366326:L506V	ENSP00000366326:L506V	L	-	1	0	NEBL	21160452	0.477000	0.25909	0.021000	0.16686	0.983000	0.72400	3.668000	0.54554	2.779000	0.95612	0.591000	0.81541	CTT		0.423	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393		5	94	0	0	0	0.001168	0	5	94				
ZFAND4	93550	broad.mit.edu	37	10	46122313	46122313	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:46122313C>G	ENST00000344646.5	-	7	1173	c.958G>C	c.(958-960)Gat>Cat	p.D320H	ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374371.2_Intron|ZFAND4_ENST00000374366.3_Missense_Mutation_p.D246H	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	320							zinc ion binding (GO:0008270)										CAGCTATTATCTTCCTTAAGA	0.433																																							uc001jcp.3		NA																	0					0						c.(958-960)GAT>CAT		AN1, ubiquitin-like, homolog							113.0	111.0	112.0					10																	46122313		2203	4300	6503	SO:0001583	missense	93550						zinc ion binding	g.chr10:46122313C>G	AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.958G>C	10.37:g.46122313C>G	ENSP00000339484:p.Asp320His					ANUBL1_uc001jcl.3_5'UTR|ANUBL1_uc001jcm.3_Missense_Mutation_p.D320H|ANUBL1_uc009xmu.2_Missense_Mutation_p.D246H|ANUBL1_uc001jcn.3_Missense_Mutation_p.D246H|ANUBL1_uc001jco.3_Intron	p.D320H	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN			7	1200	-			320					A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	ENST00000344646.5	37	c.958G>C	CCDS7214.1	.	.	.	.	.	.	.	.	.	.	C	4.792	0.147336	0.09134	.	.	ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370	T;T	0.27256	1.68;1.68	5.62	3.75	0.43078	.	2.731850	0.00931	N	0.002709	T	0.32823	0.0842	L	0.47716	1.5	0.25316	N	0.989156	B	0.23540	0.087	B	0.29176	0.099	T	0.41752	-0.9491	10	0.62326	D	0.03	-26.1871	11.6089	0.51047	0.1258:0.802:0.0:0.0722	.	320	Q86XD8	ANUB1_HUMAN	H	320;246;202	ENSP00000339484:D320H;ENSP00000363486:D246H	ENSP00000339484:D320H	D	-	1	0	ANUBL1	45442319	0.992000	0.36948	0.125000	0.21846	0.156000	0.22039	1.684000	0.37649	0.329000	0.23460	-0.813000	0.03139	GAT		0.433	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047790.1	NM_174890		7	56	0	0	0	0.001984	0	7	56				
AGAP6	414189	broad.mit.edu	37	10	51768776	51768776	+	Silent	SNP	G	G	T	rs77193201	byFrequency	TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:51768776G>T	ENST00000374056.4	+	7	1220	c.822G>T	c.(820-822)ctG>ctT	p.L274L	AGAP6_ENST00000412531.3_Silent_p.L297L			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	274	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						GGAAATGGCTGAAGACATGGA	0.438																																							uc001jix.3		NA																	0				skin(1)	1						c.(889-891)CTG>CTT		ArfGAP with GTPase domain, ankyrin repeat and PH																																				SO:0001819	synonymous_variant	414189				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:51768776G>T		CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.822G>T	10.37:g.51768776G>T							p.L297L	NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN			8	1289	+			297						Silent	SNP	ENST00000374056.4	37	c.891G>T																																																																																					0.438	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001077665		12	481	1	0	1.36491e-13	0.001855	1.61059e-13	12	481				
UNC5B	219699	broad.mit.edu	37	10	73056370	73056370	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:73056370G>A	ENST00000335350.6	+	15	2777	c.2361G>A	c.(2359-2361)caG>caA	p.Q787Q	UNC5B_ENST00000373192.4_Silent_p.Q776Q	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	787	UPA domain. {ECO:0000250}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GTGGCAGCCAGAAGGCCCTCC	0.607																																							uc001jro.2		NA																	0				ovary(2)|lung(1)	3						c.(2359-2361)CAG>CAA		unc-5 homolog B precursor							48.0	41.0	44.0					10																	73056370		2203	4300	6503	SO:0001819	synonymous_variant	219699				apoptosis|axon guidance|regulation of apoptosis	integral to membrane		g.chr10:73056370G>A	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2361G>A	10.37:g.73056370G>A						UNC5B_uc001jrp.2_Silent_p.Q776Q	p.Q787Q	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN			15	2806	+			787			Cytoplasmic (Potential).		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Silent	SNP	ENST00000335350.6	37	c.2361G>A	CCDS7309.1																																																																																				0.607	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		3	57	0	0	0	0.009096	0	3	57				
DLG5	9231	broad.mit.edu	37	10	79580869	79580869	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:79580869G>C	ENST00000372391.2	-	15	3378	c.3373C>G	c.(3373-3375)Cca>Gca	p.P1125A	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Intron	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1125					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			ATCACTACTGGAGCAAGCTTC	0.597																																							uc001jzk.2		NA																	0				ovary(5)|breast(3)	8						c.(3373-3375)CCA>GCA		discs large homolog 5							46.0	49.0	48.0					10																	79580869		2203	4300	6503	SO:0001583	missense	9231				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity	g.chr10:79580869G>C	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3373C>G	10.37:g.79580869G>C	ENSP00000361467:p.Pro1125Ala					DLG5_uc001jzi.2_5'Flank|DLG5_uc001jzj.2_Intron|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Missense_Mutation_p.P729A	p.P1125A	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)		15	3443	-	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		1125					A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	c.3373C>G	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958380	0.53400	.	.	ENSG00000151208	ENST00000372391;ENST00000372392	T	0.16457	2.34	5.69	3.82	0.43975	.	0.000000	0.36482	N	0.002568	T	0.23766	0.0575	L	0.59436	1.845	0.80722	D	1	P;P	0.47253	0.849;0.892	P;B	0.47251	0.542;0.341	T	0.01280	-1.1397	10	0.87932	D	0	.	11.0759	0.48032	0.07:0.1383:0.7917:0.0	.	1015;1125	Q8TDM6-4;Q8TDM6	.;DLG5_HUMAN	A	1125;674	ENSP00000361467:P1125A	ENSP00000361467:P1125A	P	-	1	0	DLG5	79250875	1.000000	0.71417	0.022000	0.16811	0.990000	0.78478	4.332000	0.59279	0.730000	0.32425	0.655000	0.94253	CCA		0.597	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			5	79	0	0	0	0.000602	0	5	79				
ALDH18A1	5832	broad.mit.edu	37	10	97388160	97388160	+	Nonsense_Mutation	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:97388160T>A	ENST00000371224.2	-	8	1035	c.898A>T	c.(898-900)Aag>Tag	p.K300*	ALDH18A1_ENST00000371221.3_Nonsense_Mutation_p.K298*	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	300	Glutamate 5-kinase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		ACTCTAGACTTGGTTCCAAAT	0.408																																							uc001kkz.2		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(898-900)AAG>TAG		pyrroline-5-carboxylate synthetase isoform 1	L-Glutamic Acid(DB00142)						141.0	139.0	140.0					10																	97388160		2203	4300	6503	SO:0001587	stop_gained	5832				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity	g.chr10:97388160T>A	X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.898A>T	10.37:g.97388160T>A	ENSP00000360268:p.Lys300*					ALDH18A1_uc001kky.2_Nonsense_Mutation_p.K298*|ALDH18A1_uc010qog.1_Nonsense_Mutation_p.K189*|ALDH18A1_uc010qoh.1_Nonsense_Mutation_p.K88*	p.K300*	NM_002860	NP_002851	P54886	P5CS_HUMAN		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	8	1140	-		Colorectal(252;0.0402)	300			Glutamate 5-kinase.		B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Nonsense_Mutation	SNP	ENST00000371224.2	37	c.898A>T	CCDS7443.1	.	.	.	.	.	.	.	.	.	.	T	39	7.682535	0.98431	.	.	ENSG00000059573	ENST00000371224;ENST00000371221	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.4629	14.4129	0.67128	0.0:0.0:0.0:1.0	.	.	.	.	X	300;298	.	ENSP00000360265:K298X	K	-	1	0	ALDH18A1	97378150	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.583000	0.82559	2.288000	0.76882	0.533000	0.62120	AAG		0.408	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049552.1	NM_002860		48	86	0	0	0	0.00361	0	48	86				
R3HCC1L	27291	broad.mit.edu	37	10	99968718	99968718	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:99968718G>C	ENST00000298999.3	+	5	1150	c.847G>C	c.(847-849)Gat>Cat	p.D283H	R3HCC1L_ENST00000370584.3_Missense_Mutation_p.D283H|R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370586.2_Intron	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	283							nucleotide binding (GO:0000166)										AACTTGCGTAGATTTTGAAGT	0.423																																							uc001kow.3		NA																	0				large_intestine(1)|skin(1)	2						c.(847-849)GAT>CAT		growth inhibition and differentiation related							109.0	103.0	105.0					10																	99968718		2203	4300	6503	SO:0001583	missense	27291						nucleotide binding	g.chr10:99968718G>C	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.847G>C	10.37:g.99968718G>C	ENSP00000298999:p.Asp283His					C10orf28_uc001kox.3_Missense_Mutation_p.D283H|C10orf28_uc001koy.3_Missense_Mutation_p.D283H|C10orf28_uc009xvx.2_Missense_Mutation_p.D283H|C10orf28_uc009xvy.2_Intron|C10orf28_uc001koz.3_Intron	p.D283H	NM_014472	NP_055287	Q4KMY3	Q4KMY3_HUMAN		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)	4	1142	+		Colorectal(252;0.234)	283					O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	c.847G>C	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.741064	0.30865	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.09073	3.02;3.02	5.42	5.42	0.78866	.	0.192872	0.36740	N	0.002429	T	0.26666	0.0652	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69479	0.964;0.964	T	0.00238	-1.1889	9	.	.	.	-10.398	14.7205	0.69302	0.0:0.0:1.0:0.0	.	283;283	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	H	283	ENSP00000359616:D283H;ENSP00000298999:D283H	.	D	+	1	0	C10orf28	99958708	0.791000	0.28800	0.787000	0.31911	0.016000	0.09150	1.979000	0.40608	2.539000	0.85634	0.655000	0.94253	GAT		0.423	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472		16	67	0	0	0	0.003163	0	16	67				
R3HCC1L	27291	broad.mit.edu	37	10	99968962	99968962	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:99968962G>C	ENST00000298999.3	+	5	1394	c.1091G>C	c.(1090-1092)gGa>gCa	p.G364A	R3HCC1L_ENST00000370584.3_Missense_Mutation_p.G364A|R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370586.2_Intron	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	364							nucleotide binding (GO:0000166)										AGAGATAGTGGATTTAAGAAT	0.398																																							uc001kow.3		NA																	0				large_intestine(1)|skin(1)	2						c.(1090-1092)GGA>GCA		growth inhibition and differentiation related							174.0	152.0	159.0					10																	99968962		2203	4300	6503	SO:0001583	missense	27291						nucleotide binding	g.chr10:99968962G>C	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1091G>C	10.37:g.99968962G>C	ENSP00000298999:p.Gly364Ala					C10orf28_uc001kox.3_Missense_Mutation_p.G364A|C10orf28_uc001koy.3_Missense_Mutation_p.G364A|C10orf28_uc009xvx.2_Missense_Mutation_p.G364A|C10orf28_uc009xvy.2_Intron|C10orf28_uc001koz.3_Intron	p.G364A	NM_014472	NP_055287	Q4KMY3	Q4KMY3_HUMAN		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)	4	1386	+		Colorectal(252;0.234)	364					O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	c.1091G>C	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	G	1.387	-0.581770	0.03854	.	.	ENSG00000166024	ENST00000370584;ENST00000298999	T;T	0.08720	3.06;3.06	5.38	-2.56	0.06268	.	0.779398	0.11862	N	0.522301	T	0.09069	0.0224	L	0.56769	1.78	0.09310	N	0.99999	B;B	0.33694	0.421;0.167	B;B	0.33750	0.169;0.169	T	0.19031	-1.0318	9	.	.	.	0.6794	11.0055	0.47631	0.6352:0.0:0.3648:0.0	.	364;364	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	A	364	ENSP00000359616:G364A;ENSP00000298999:G364A	.	G	+	2	0	C10orf28	99958952	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.023000	0.12456	-0.629000	0.05575	-0.797000	0.03246	GGA		0.398	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472		23	113	0	0	0	0.00278	0	23	113				
HIF1AN	55662	broad.mit.edu	37	10	102300398	102300398	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:102300398C>A	ENST00000299163.6	+	3	536	c.436C>A	c.(436-438)Ctg>Atg	p.L146M	HIF1AN_ENST00000528044.1_3'UTR	NM_017902.2	NP_060372.2	Q9NWT6	HIF1N_HUMAN	hypoxia inducible factor 1, alpha subunit inhibitor	146	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cellular response to hypoxia (GO:0071456)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|oxidation-reduction process (GO:0055114)|peptidyl-asparagine hydroxylation (GO:0042265)|peptidyl-aspartic acid hydroxylation (GO:0042264)|peptidyl-histidine hydroxylation (GO:0036138)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of vasculogenesis (GO:2001214)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ankyrin repeat binding (GO:0071532)|carboxylic acid binding (GO:0031406)|cofactor binding (GO:0048037)|iron ion binding (GO:0005506)|NF-kappaB binding (GO:0051059)|Notch binding (GO:0005112)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-asparagine 3-dioxygenase activity (GO:0036140)|peptidyl-histidine dioxygenase activity (GO:0036139)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	10		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		TAGGTTGTATCTGCAGCAAAC	0.463																																							uc001krj.3		NA																	0					0						c.(436-438)CTG>ATG		hypoxia-inducible factor 1, alpha subunit							171.0	161.0	164.0					10																	102300398		2203	4300	6503	SO:0001583	missense	55662				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|protein binding	g.chr10:102300398C>A	AK000622	CCDS7498.1	10q24	2008-12-18	2008-12-02		ENSG00000166135	ENSG00000166135	1.14.11.16		17113	protein-coding gene	gene with protein product	"""Peptide-aspartate beta-dioxygenase"""	606615				11641274	Standard	NM_017902		Approved	FLJ20615, DKFZp762F1811, FLJ22027, FIH1	uc001krj.4	Q9NWT6	OTTHUMG00000018911	ENST00000299163.6:c.436C>A	10.37:g.102300398C>A	ENSP00000299163:p.Leu146Met						p.L146M	NM_017902	NP_060372	Q9NWT6	HIF1N_HUMAN		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)	3	511	+		Colorectal(252;0.234)	146			JmjC.|Interaction with HIF1A.|Interaction with VHL.		D3DR69|Q5W147|Q969Q7|Q9NPV5	Missense_Mutation	SNP	ENST00000299163.6	37	c.436C>A	CCDS7498.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.901088	0.72754	.	.	ENSG00000166135	ENST00000533589;ENST00000299163;ENST00000442724	T;T	0.74737	-0.87;-0.87	5.61	4.71	0.59529	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	D	0.82688	0.5091	M	0.73319	2.225	0.58432	D	0.999999	P	0.51449	0.945	P	0.58520	0.84	D	0.83486	0.0067	10	0.48119	T	0.1	-10.5671	14.7017	0.69160	0.0:0.93:0.0:0.07	.	146	Q9NWT6	HIF1N_HUMAN	M	39;146;179	ENSP00000433360:L39M;ENSP00000299163:L146M	ENSP00000299163:L146M	L	+	1	2	HIF1AN	102290388	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.053000	0.30442	1.370000	0.46153	0.561000	0.74099	CTG		0.463	HIF1AN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049865.5	NM_017902		7	184	1	0	1.06961e-07	0.00308	1.18511e-07	7	184				
SORCS3	22986	broad.mit.edu	37	10	106802863	106802863	+	Silent	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:106802863C>G	ENST00000369701.3	+	5	1232	c.1005C>G	c.(1003-1005)cgC>cgG	p.R335R		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	335					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TGCATGAACGCATCACACCCA	0.453																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	0				ovary(6)|skin(3)|central_nervous_system(1)	10						c.(1003-1005)CGC>CGG		VPS10 domain receptor protein SORCS 3 precursor							254.0	230.0	238.0					10																	106802863		2203	4300	6503	SO:0001819	synonymous_variant	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106802863C>G	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1005C>G	10.37:g.106802863C>G							p.R335R	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	5	1232	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	335			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Silent	SNP	ENST00000369701.3	37	c.1005C>G	CCDS7558.1																																																																																				0.453	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		73	116	0	0	0	0.00361	0	73	116				
PRLHR	2834	broad.mit.edu	37	10	120354367	120354367	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr10:120354367G>A	ENST00000369169.1	-	1	389	c.390C>T	c.(388-390)ggC>ggT	p.G130G	PRLHR_ENST00000239032.2_Silent_p.G130G			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	130					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		ACAGGCCGCCGCCGAACACCC	0.657																																							uc001ldp.1		NA																	0					0						c.(388-390)GGC>GGT		G protein-coupled receptor 10							39.0	36.0	37.0					10																	120354367		2202	4299	6501	SO:0001819	synonymous_variant	2834				female pregnancy	integral to plasma membrane	neuropeptide Y receptor activity	g.chr10:120354367G>A	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.390C>T	10.37:g.120354367G>A							p.G130G	NM_004248	NP_004239	P49683	PRLHR_HUMAN		all cancers(201;0.0166)	2	529	-		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)	130			Helical; Name=3; (Potential).		O75194|Q502U8|Q5VXR9	Silent	SNP	ENST00000369169.1	37	c.390C>T	CCDS7606.1																																																																																				0.657	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050610.1	NM_004248		15	36	0	0	0	0.004007	0	15	36				
OR5AP2	338675	broad.mit.edu	37	11	56409829	56409829	+	Silent	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:56409829T>A	ENST00000302981.1	-	1	86	c.87A>T	c.(85-87)ctA>ctT	p.L29L	OR5AP2_ENST00000544374.1_Silent_p.L30L	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						GGACTCCTTGTAGATCTGGAT	0.398																																							uc001njb.1		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(85-87)CTA>CTT		olfactory receptor, family 5, subfamily AP,							100.0	93.0	96.0					11																	56409829		2201	4296	6497	SO:0001819	synonymous_variant	338675				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56409829T>A	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.87A>T	11.37:g.56409829T>A							p.L29L	NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN			1	87	-			29			Extracellular (Potential).		B2RNM8	Silent	SNP	ENST00000302981.1	37	c.87A>T	CCDS31534.1																																																																																				0.398	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925		8	41	0	0	0	0.00308	0	8	41				
AHNAK	79026	broad.mit.edu	37	11	62286885	62286885	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:62286885C>A	ENST00000378024.4	-	5	15278	c.15004G>T	c.(15004-15006)Gag>Tag	p.E5002*	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5002					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AGCTCTGCCTCAGGAACAGTG	0.413																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(15004-15006)GAG>TAG		AHNAK nucleoprotein isoform 1							108.0	114.0	112.0					11																	62286885		2202	4299	6501	SO:0001587	stop_gained	79026				nervous system development	nucleus	protein binding	g.chr11:62286885C>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.15004G>T	11.37:g.62286885C>A	ENSP00000367263:p.Glu5002*					AHNAK_uc001ntk.1_Intron	p.E5002*	NM_001620	NP_001611	Q09666	AHNK_HUMAN			5	15304	-		Melanoma(852;0.155)	5002					A1A586	Nonsense_Mutation	SNP	ENST00000378024.4	37	c.15004G>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	C	56	25.993172	0.99967	.	.	ENSG00000124942	ENST00000378024	.	.	.	4.48	4.48	0.54585	.	0.000000	0.43747	D	0.000526	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	17.1273	0.86717	0.0:1.0:0.0:0.0	.	.	.	.	X	5002	.	ENSP00000367263:E5002X	E	-	1	0	AHNAK	62043461	0.883000	0.30277	1.000000	0.80357	0.997000	0.91878	2.578000	0.46051	2.221000	0.72209	0.549000	0.68633	GAG		0.413	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		25	97	1	0	9.90768e-06	0.004656	1.06282e-05	25	97				
HRASLS2	54979	broad.mit.edu	37	11	63325879	63325879	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:63325879G>A	ENST00000255695.1	-	3	430	c.372C>T	c.(370-372)gtC>gtT	p.V124V		NM_017878.1	NP_060348.1	Q9NWW9	HRSL2_HUMAN	HRAS-like suppressor 2	124					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6						CACTGCGGGAGACGCCATAGC	0.622																																							uc001nxg.1		NA																	0					0						c.(370-372)GTC>GTT		HRAS-like suppressor 2							149.0	111.0	123.0					11																	63325879		2201	4298	6499	SO:0001819	synonymous_variant	54979				lipid catabolic process	cytoplasm	acyltransferase activity|hydrolase activity	g.chr11:63325879G>A		CCDS8046.1	11q12.2	2008-07-18			ENSG00000133328	ENSG00000133328			17824	protein-coding gene	gene with protein product		613866					Standard	NM_017878		Approved	FLJ20556	uc001nxg.1	Q9NWW9	OTTHUMG00000167851	ENST00000255695.1:c.372C>T	11.37:g.63325879G>A							p.V124V	NM_017878	NP_060348	Q9NWW9	HRSL2_HUMAN			3	431	-			124					B9A7L8	Silent	SNP	ENST00000255695.1	37	c.372C>T	CCDS8046.1																																																																																				0.622	HRASLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396631.1	NM_017878		3	56	0	0	0	0.004672	0	3	56				
CATSPER1	117144	broad.mit.edu	37	11	65790439	65790439	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:65790439C>T	ENST00000312106.5	-	2	1447	c.1310G>A	c.(1309-1311)cGg>cAg	p.R437Q		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	437					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						GATCATTTCCCGGAAGCCCTG	0.552											OREG0021092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ogt.2		NA																	0				ovary(2)	2						c.(1309-1311)CGG>CAG		sperm-associated cation channel 1							108.0	108.0	108.0					11																	65790439		2201	4296	6497	SO:0001583	missense	117144				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	protein binding	g.chr11:65790439C>T	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1310G>A	11.37:g.65790439C>T	ENSP00000309052:p.Arg437Gln		OREG0021092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1086		p.R437Q	NM_053054	NP_444282	Q8NEC5	CTSR1_HUMAN			2	1448	-			437			Cytoplasmic (Potential).		Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	c.1310G>A	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030308	0.54790	.	.	ENSG00000175294	ENST00000312106	D	0.97553	-4.43	5.1	0.841	0.18918	.	0.650151	0.11787	N	0.529615	D	0.89336	0.6686	N	0.20986	0.625	0.09310	N	1	P	0.42692	0.787	B	0.25506	0.061	T	0.82408	-0.0472	10	0.20519	T	0.43	-10.5498	7.1613	0.25664	0.0:0.588:0.0:0.412	.	437	Q8NEC5	CTSR1_HUMAN	Q	437	ENSP00000309052:R437Q	ENSP00000309052:R437Q	R	-	2	0	CATSPER1	65547015	0.000000	0.05858	0.003000	0.11579	0.049000	0.14656	-0.590000	0.05760	0.263000	0.21812	0.563000	0.77884	CGG		0.552	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		24	79	0	0	0	0.00278	0	24	79				
KRTAP5-7	440050	broad.mit.edu	37	11	71238423	71238423	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:71238423C>T	ENST00000398536.4	+	1	111	c.77C>T	c.(76-78)tCt>tTt	p.S26F		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	26						keratin filament (GO:0045095)				breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						GGCTGTGGCTCTGGCTGTGGG	0.667																																							uc001oqq.1		NA																	0					0						c.(76-78)TCT>TTT		keratin associated protein 5-7							61.0	80.0	74.0					11																	71238423		2195	4285	6480	SO:0001583	missense	440050					keratin filament		g.chr11:71238423C>T	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.77C>T	11.37:g.71238423C>T	ENSP00000417330:p.Ser26Phe						p.S26F	NM_001012503	NP_001012521	Q6L8G8	KRA57_HUMAN			1	111	+			26					B2RNM3|Q701N5	Missense_Mutation	SNP	ENST00000398536.4	37	c.77C>T	CCDS41682.1	.	.	.	.	.	.	.	.	.	.	N	10.35	1.327287	0.24080	.	.	ENSG00000244411	ENST00000398536	T	0.01902	4.57	1.23	1.23	0.21249	.	.	.	.	.	T	0.11024	0.0269	M	0.85041	2.73	0.24507	N	0.99423	D	0.62365	0.991	D	0.68039	0.955	T	0.03619	-1.1019	9	0.66056	D	0.02	.	8.3288	0.32173	0.0:1.0:0.0:0.0	.	26	Q6L8G8	KRA57_HUMAN	F	26	ENSP00000417330:S26F	ENSP00000417330:S26F	S	+	2	0	KRTAP5-7	70916071	0.930000	0.31532	0.987000	0.45799	0.660000	0.38997	0.897000	0.28390	1.008000	0.39264	0.289000	0.19496	TCT		0.667	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1			10	294	0	0	0	0.000978	0	10	294				
INTS4	92105	broad.mit.edu	37	11	77705651	77705651	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:77705651G>A	ENST00000534064.1	-	1	73	c.39C>T	c.(37-39)ttC>ttT	p.F13F	INTS4_ENST00000527522.1_Silent_p.F13F|INTS4_ENST00000529807.1_Silent_p.F13F	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	13					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			CCACTTTCGTGAATTCCTCAT	0.582																																							uc001oys.2		NA																	0				ovary(2)	2						c.(37-39)TTC>TTT		integrator complex subunit 4							94.0	87.0	90.0					11																	77705651		2200	4292	6492	SO:0001819	synonymous_variant	92105				snRNA processing	integrator complex	protein binding	g.chr11:77705651G>A	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.39C>T	11.37:g.77705651G>A						INTS4_uc001oyt.2_RNA|INTS4_uc001oyu.1_Silent_p.F13F|INTS4_uc001oyv.1_RNA	p.F13F	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)		1	67	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		13					Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	ENST00000534064.1	37	c.39C>T	CCDS31644.1																																																																																				0.582	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547		21	98	0	0	0	0.00278	0	21	98				
FAT3	120114	broad.mit.edu	37	11	92087428	92087428	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:92087428C>G	ENST00000298047.6	+	1	2167	c.2150C>G	c.(2149-2151)tCa>tGa	p.S717*	FAT3_ENST00000541502.1_Nonsense_Mutation_p.S717*|FAT3_ENST00000525166.1_Nonsense_Mutation_p.S567*|FAT3_ENST00000409404.2_Nonsense_Mutation_p.S717*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	717					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GACTTTTATTCAATTAATAGA	0.398										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(2149-2151)TCA>TGA		FAT tumor suppressor homolog 3							157.0	160.0	159.0					11																	92087428		1838	4107	5945	SO:0001587	stop_gained	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92087428C>G	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2150C>G	11.37:g.92087428C>G	ENSP00000298047:p.Ser717*	TCGA Ovarian(4;0.039)					p.S717*	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			1	2167	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	717			Extracellular (Potential).		B5MDB0|Q96AU6	Nonsense_Mutation	SNP	ENST00000298047.6	37	c.2150C>G		.	.	.	.	.	.	.	.	.	.	C	39	7.372704	0.98241	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	11.7499	0.51843	0.0:0.9196:0.0:0.0804	.	.	.	.	X	717;717;717;567	.	ENSP00000298047:S717X	S	+	2	0	FAT3	91727076	1.000000	0.71417	0.952000	0.39060	0.982000	0.71751	4.841000	0.62824	2.567000	0.86603	0.467000	0.42956	TCA		0.398	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		8	162	0	0	0	0.004482	0	8	162				
FAT3	120114	broad.mit.edu	37	11	92531712	92531712	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:92531712G>T	ENST00000298047.6	+	9	5550	c.5533G>T	c.(5533-5535)Gcc>Tcc	p.A1845S	FAT3_ENST00000525166.1_Missense_Mutation_p.A1695S|FAT3_ENST00000409404.2_Missense_Mutation_p.A1845S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1845	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGAAACCATTGCCCATTTCCA	0.458										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(5533-5535)GCC>TCC		FAT tumor suppressor homolog 3							75.0	69.0	71.0					11																	92531712		1984	4170	6154	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92531712G>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5533G>T	11.37:g.92531712G>T	ENSP00000298047:p.Ala1845Ser	TCGA Ovarian(4;0.039)					p.A1845S	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			9	5550	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1845			Cadherin 16.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.5533G>T		.	.	.	.	.	.	.	.	.	.	G	0.010	-1.784326	0.00628	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.03580	3.88;3.88;3.88	5.82	2.75	0.32379	.	.	.	.	.	T	0.02230	0.0069	N	0.11131	0.1	0.80722	D	1	B	0.30824	0.296	B	0.26416	0.069	T	0.51779	-0.8662	9	0.09843	T	0.71	.	14.7961	0.69878	0.0:0.0:0.4242:0.5758	.	1845	Q8TDW7-3	.	S	1845;1845;1695	ENSP00000298047:A1845S;ENSP00000387040:A1845S;ENSP00000432586:A1695S	ENSP00000298047:A1845S	A	+	1	0	FAT3	92171360	0.367000	0.25023	0.375000	0.26029	0.911000	0.54048	0.753000	0.26376	0.266000	0.21894	0.591000	0.81541	GCC		0.458	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		17	24	1	0	3.41278e-10	0.00499	3.90979e-10	17	24				
OR10G8	219869	broad.mit.edu	37	11	123901033	123901033	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:123901033G>C	ENST00000431524.1	+	1	737	c.704G>C	c.(703-705)aGa>aCa	p.R235T		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGGAAGCACAGAGCCTTTCAG	0.547																																							uc001pzp.1		NA																	0				ovary(1)|skin(1)	2						c.(703-705)AGA>ACA		olfactory receptor, family 10, subfamily G,							178.0	150.0	159.0					11																	123901033		2201	4299	6500	SO:0001583	missense	219869				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123901033G>C	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.704G>C	11.37:g.123901033G>C	ENSP00000389072:p.Arg235Thr						p.R235T	NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	704	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	235			Cytoplasmic (Potential).		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	c.704G>C	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789050	0.31685	.	.	ENSG00000234560	ENST00000431524	T	0.00183	8.6	2.91	1.98	0.26296	GPCR, rhodopsin-like superfamily (1);	0.134965	0.32343	N	0.006236	T	0.00356	0.0011	M	0.75777	2.31	0.30605	N	0.760069	P	0.46578	0.88	P	0.60886	0.88	T	0.25398	-1.0133	10	0.87932	D	0	.	3.3875	0.07277	0.4597:0.0:0.5403:0.0	.	235	Q8NGN5	O10G8_HUMAN	T	235	ENSP00000389072:R235T	ENSP00000389072:R235T	R	+	2	0	OR10G8	123406243	0.982000	0.34865	0.862000	0.33874	0.300000	0.27592	1.844000	0.39269	1.611000	0.50210	0.557000	0.71058	AGA		0.547	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		28	85	0	0	0	0.008361	0	28	85				
CDON	50937	broad.mit.edu	37	11	125887079	125887079	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:125887079C>T	ENST00000392693.3	-	6	959	c.832G>A	c.(832-834)Gat>Aat	p.D278N	CDON_ENST00000263577.7_Missense_Mutation_p.D278N	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	278	Ig-like C2-type 3.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TCAACGCTATCAGTGGCAAGA	0.498																																							uc009zbw.2		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(832-834)GAT>AAT		surface glycoprotein, Ig superfamily member							101.0	93.0	96.0					11																	125887079		2201	4299	6500	SO:0001583	missense	50937				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding	g.chr11:125887079C>T	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.832G>A	11.37:g.125887079C>T	ENSP00000376458:p.Asp278Asn					CDON_uc001qdc.3_Missense_Mutation_p.D278N|CDON_uc001qdd.3_RNA|CDON_uc009zbx.2_Missense_Mutation_p.D278N	p.D278N	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)	6	960	-	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	278			Extracellular (Potential).|Ig-like C2-type 3.		O14631	Missense_Mutation	SNP	ENST00000392693.3	37	c.832G>A	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	C	9.828	1.187733	0.21954	.	.	ENSG00000064309	ENST00000392693;ENST00000263577	T;T	0.67171	-0.25;-0.25	5.06	5.06	0.68205	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.110781	0.39407	N	0.001378	T	0.51736	0.1692	N	0.12443	0.215	0.19300	N	0.999974	B;B	0.29136	0.234;0.121	B;B	0.27170	0.077;0.046	T	0.50372	-0.8836	10	0.45353	T	0.12	-7.8067	18.8156	0.92076	0.0:1.0:0.0:0.0	.	278;278	Q4KMG0;Q4KMG0-2	CDON_HUMAN;.	N	278	ENSP00000376458:D278N;ENSP00000263577:D278N	ENSP00000263577:D278N	D	-	1	0	CDON	125392289	0.978000	0.34361	0.023000	0.16930	0.018000	0.09664	4.011000	0.57124	2.496000	0.84212	0.563000	0.77884	GAT		0.498	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952		29	51	0	0	0	0.00632	0	29	51				
WNK1	65125	broad.mit.edu	37	12	968524	968524	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:968524G>T	ENST00000315939.6	+	6	2157	c.1514G>T	c.(1513-1515)cGt>cTt	p.R505L	WNK1_ENST00000340908.4_Missense_Mutation_p.R98L|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000537687.1_Missense_Mutation_p.R505L|WNK1_ENST00000535572.1_Missense_Mutation_p.R505L|WNK1_ENST00000530271.2_Missense_Mutation_p.R505L	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	505					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.R505H(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTATGGCTACGTATTGAAGAT	0.348																																					Colon(19;451 567 6672 12618 28860)	Colon(19;451 567 6672 12618 28860)	uc001qio.3		NA																	1	Substitution - Missense(1)		large_intestine(1)	stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23						c.(1513-1515)CGT>CTT		WNK lysine deficient protein kinase 1							66.0	75.0	72.0					12																	968524		2202	4298	6500	SO:0001583	missense	65125				intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity	g.chr12:968524G>T	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1514G>T	12.37:g.968524G>T	ENSP00000313059:p.Arg505Leu					WNK1_uc001qip.3_Missense_Mutation_p.R505L|WNK1_uc001qir.3_5'Flank	p.R505L	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)		6	2021	+	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		505					A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	c.1514G>T	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523586	0.85600	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000530271;ENST00000340908	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	5.7	5.7	0.88788	Serine/threonine-protein kinase OSR1/WNK, CCT domain (1);	0.000000	0.64402	D	0.000006	T	0.76407	0.3983	L	0.59436	1.845	0.50632	D	0.999883	D;D	0.76494	0.999;0.999	D;D	0.81914	0.991;0.995	T	0.70468	-0.4863	10	0.24483	T	0.36	-11.035	19.82	0.96590	0.0:0.0:1.0:0.0	.	505;505	F5GWT4;Q9H4A3	.;WNK1_HUMAN	L	505;505;505;505;98	ENSP00000441972:R505L;ENSP00000313059:R505L;ENSP00000444465:R505L;ENSP00000433548:R505L;ENSP00000341292:R98L	ENSP00000313059:R505L	R	+	2	0	WNK1	838785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.809000	0.99208	2.660000	0.90430	0.591000	0.81541	CGT		0.348	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		14	83	1	0	1.3612e-06	0.003163	1.48039e-06	14	83				
LRRC23	10233	broad.mit.edu	37	12	7014909	7014909	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:7014909G>C	ENST00000007969.8	+	2	332	c.112G>C	c.(112-114)Gag>Cag	p.E38Q	LRRC23_ENST00000443597.2_Missense_Mutation_p.E38Q|LRRC23_ENST00000429740.1_Missense_Mutation_p.E38Q|LRRC23_ENST00000436789.1_Missense_Mutation_p.E38Q|LRRC23_ENST00000449039.1_3'UTR|LRRC23_ENST00000323702.5_Missense_Mutation_p.E38Q|LRRC23_ENST00000433346.1_Missense_Mutation_p.E38Q	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	38										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						agagggggaagagTTCCCTGA	0.547																																							uc001qrt.3		NA																	0				ovary(1)	1						c.(112-114)GAG>CAG		leucine rich repeat containing 23 isoform a							56.0	61.0	59.0					12																	7014909		2203	4300	6503	SO:0001583	missense	10233							g.chr12:7014909G>C	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.112G>C	12.37:g.7014909G>C	ENSP00000007969:p.Glu38Gln					LRRC23_uc001qrn.1_Missense_Mutation_p.E38Q|LRRC23_uc009zfg.2_Intron|LRRC23_uc001qrp.2_Missense_Mutation_p.E38Q|LRRC23_uc001qrq.2_Missense_Mutation_p.E38Q|LRRC23_uc001qrr.2_Missense_Mutation_p.K23N|LRRC23_uc001qrs.2_Missense_Mutation_p.K23N|LRRC23_uc009zfh.2_Missense_Mutation_p.E38Q	p.E38Q	NM_001135217	NP_001128689	Q53EV4	LRC23_HUMAN			2	504	+			38					A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	37	c.112G>C	CCDS8569.1	.	.	.	.	.	.	.	.	.	.	G	8.009	0.757183	0.15846	.	.	ENSG00000010626	ENST00000433346;ENST00000007969;ENST00000323702;ENST00000443597;ENST00000415834;ENST00000436789;ENST00000429740	T;T;T;T;T;T;T	0.68331	1.78;-0.03;-0.32;-0.03;0.79;1.8;1.35	4.64	3.66	0.41972	.	.	.	.	.	T	0.56863	0.2014	L	0.54323	1.7	0.09310	N	0.999998	B;B;B;B	0.33238	0.403;0.403;0.18;0.18	B;B;B;B	0.33042	0.157;0.12;0.056;0.035	T	0.43637	-0.9379	9	0.22109	T	0.4	-0.3799	6.8547	0.24034	0.1278:0.0:0.8722:0.0	.	38;38;38;38	E9PDZ4;Q53EV4-2;Q53EV4;C9JKE8	.;.;LRC23_HUMAN;.	Q	38	ENSP00000402554:E38Q;ENSP00000007969:E38Q;ENSP00000317464:E38Q;ENSP00000390932:E38Q;ENSP00000408066:E38Q;ENSP00000396049:E38Q;ENSP00000397192:E38Q	ENSP00000007969:E38Q	E	+	1	0	LRRC23	6885170	1.000000	0.71417	0.384000	0.26145	0.422000	0.31414	6.411000	0.73298	2.395000	0.81488	0.561000	0.74099	GAG		0.547	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992		15	59	0	0	0	0.004007	0	15	59				
FOXJ2	55810	broad.mit.edu	37	12	8192436	8192436	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:8192436C>T	ENST00000162391.3	+	2	1153	c.8C>T	c.(7-9)tCt>tTt	p.S3F	FOXJ2_ENST00000428177.2_Missense_Mutation_p.S3F	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	3					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		ACCATGGCTTCTGACCTAGAG	0.522																																							uc001qtu.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5						c.(7-9)TCT>TTT		forkhead box J2							81.0	85.0	84.0					12																	8192436		2203	4300	6503	SO:0001583	missense	55810				embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	nucleolus|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding	g.chr12:8192436C>T	AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.8C>T	12.37:g.8192436C>T	ENSP00000162391:p.Ser3Phe					FOXJ2_uc001qtt.1_Missense_Mutation_p.S3F	p.S3F	NM_018416	NP_060886	Q9P0K8	FOXJ2_HUMAN		Kidney(36;0.0944)	2	1093	+			3					A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	ENST00000162391.3	37	c.8C>T	CCDS8587.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485460	0.84854	.	.	ENSG00000065970	ENST00000162391;ENST00000428177	D;D	0.96041	-3.67;-3.89	5.05	5.05	0.67936	.	0.091123	0.47852	D	0.000206	D	0.95906	0.8667	L	0.29908	0.895	0.54753	D	0.999987	D;D	0.76494	0.995;0.999	D;D	0.83275	0.986;0.996	D	0.96788	0.9580	10	0.87932	D	0	.	15.9747	0.80054	0.0:1.0:0.0:0.0	.	3;3	Q9P0K8;Q9P0K8-2	FOXJ2_HUMAN;.	F	3	ENSP00000162391:S3F;ENSP00000403411:S3F	ENSP00000162391:S3F	S	+	2	0	FOXJ2	8083703	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.871000	0.69628	2.363000	0.80096	0.555000	0.69702	TCT		0.522	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400088.1	NM_018416		12	121	0	0	0	0.000978	0	12	121				
GUCY2C	2984	broad.mit.edu	37	12	14774061	14774061	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:14774061G>A	ENST00000261170.3	-	23	2827	c.2691C>T	c.(2689-2691)gcC>gcT	p.A897A	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	897	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GGATTTCCAAGGCCATCTTGG	0.498																																							uc001rcd.2		NA																	0				ovary(4)|skin(2)	6						c.(2689-2691)GCC>GCT		guanylate cyclase 2C precursor							188.0	149.0	162.0					12																	14774061		2203	4300	6503	SO:0001819	synonymous_variant	2984				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity	g.chr12:14774061G>A		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2691C>T	12.37:g.14774061G>A							p.A897A	NM_004963	NP_004954	P25092	GUC2C_HUMAN			23	2828	-			897			Cytoplasmic (Potential).|Guanylate cyclase.		B2RMY6	Silent	SNP	ENST00000261170.3	37	c.2691C>T	CCDS8664.1																																																																																				0.498	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1			21	69	0	0	0	0.001882	0	21	69				
HOXC5	3222	broad.mit.edu	37	12	54428155	54428155	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:54428155G>A	ENST00000312492.2	+	2	818	c.548G>A	c.(547-549)cGc>cAc	p.R183H	MIR615_ENST00000384839.1_RNA|HOXC4_ENST00000303406.4_Intron|RP11-834C11.14_ENST00000512206.1_RNA|RP11-834C11.12_ENST00000513209.1_Missense_Mutation_p.R87H	NM_018953.2	NP_061826.1	Q00444	HXC5_HUMAN	homeobox C5	183					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(2)|urinary_tract(1)	12						CTCACTCGCCGCAGGCGCATA	0.512																																							uc001sew.2		NA																	0					0						c.(547-549)CGC>CAC		homeobox C5							77.0	84.0	82.0					12																	54428155		2203	4300	6503	SO:0001583	missense	3222				regulation of transcription from RNA polymerase II promoter	cell junction|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54428155G>A		CCDS8872.1	12q13.13	2011-06-20	2005-12-22		ENSG00000172789	ENSG00000172789		"""Homeoboxes / ANTP class : HOXL subclass"""	5127	protein-coding gene	gene with protein product		142973	"""homeo box C5"""	HOX3D, HOX3		1973146, 1358459	Standard	NM_018953		Approved		uc001sew.3	Q00444	OTTHUMG00000160028	ENST00000312492.2:c.548G>A	12.37:g.54428155G>A	ENSP00000309336:p.Arg183His					HOXC5_uc001set.2_RNA|HOXC4_uc001seu.2_Intron	p.R183H	NM_018953	NP_061826	Q00444	HXC5_HUMAN			2	623	+			183			Homeobox.			Missense_Mutation	SNP	ENST00000312492.2	37	c.548G>A	CCDS8872.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174583	0.78452	.	.	ENSG00000172789	ENST00000312492	D	0.96168	-3.93	4.26	4.26	0.50523	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.43110	D	0.000615	D	0.95146	0.8427	N	0.17312	0.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96257	0.9188	10	0.87932	D	0	.	16.0193	0.80468	0.0:0.0:1.0:0.0	.	183	Q00444	HXC5_HUMAN	H	183	ENSP00000309336:R183H	ENSP00000309336:R183H	R	+	2	0	HOXC5	52714422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.747000	0.85070	2.371000	0.80710	0.555000	0.69702	CGC		0.512	HOXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358947.1			16	77	0	0	0	0.003163	0	16	77				
SMARCC2	6601	broad.mit.edu	37	12	56563471	56563471	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:56563471C>G	ENST00000267064.4	-	24	2550	c.2464G>C	c.(2464-2466)Gag>Cag	p.E822Q	SMARCC2_ENST00000394023.3_Missense_Mutation_p.E853Q|SMARCC2_ENST00000347471.4_Missense_Mutation_p.E853Q|SMARCC2_ENST00000550164.1_Missense_Mutation_p.E853Q|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	822	Glu-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ttctccttctcAGGATCGACT	0.582																																							uc001skb.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6						c.(2464-2466)GAG>CAG		SWI/SNF-related matrix-associated							154.0	112.0	126.0					12																	56563471		2203	4300	6503	SO:0001583	missense	6601				chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity	g.chr12:56563471C>G	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.2464G>C	12.37:g.56563471C>G	ENSP00000267064:p.Glu822Gln					SMARCC2_uc001skd.2_Missense_Mutation_p.E853Q|SMARCC2_uc001ska.2_Missense_Mutation_p.E853Q|SMARCC2_uc001skc.2_Missense_Mutation_p.E852Q|SMARCC2_uc010sqf.1_Missense_Mutation_p.E742Q	p.E822Q	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.123)		24	2570	-			822			Glu-rich.		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	c.2464G>C	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608532	0.46527	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.49432	1.11;0.78;0.79;0.79	4.9	4.9	0.64082	.	0.495836	0.19570	N	0.111116	T	0.41166	0.1147	L	0.43152	1.355	0.33101	D	0.539236	B;B;B;B;B	0.31274	0.212;0.317;0.212;0.212;0.317	B;B;B;B;B	0.33121	0.076;0.158;0.076;0.076;0.158	T	0.50659	-0.8802	10	0.22109	T	0.4	-11.6978	14.0478	0.64714	0.0:1.0:0.0:0.0	.	742;853;857;822;853	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	Q	853;853;853;822	ENSP00000377591:E853Q;ENSP00000449396:E853Q;ENSP00000302919:E853Q;ENSP00000267064:E822Q	ENSP00000267064:E822Q	E	-	1	0	SMARCC2	54849738	0.394000	0.25246	0.968000	0.41197	0.881000	0.50899	2.319000	0.43788	2.463000	0.83235	0.456000	0.33151	GAG		0.582	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1			5	61	0	0	0	0.000602	0	5	61				
CCER1	196477	broad.mit.edu	37	12	91347524	91347524	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:91347524C>G	ENST00000358859.2	-	1	1429	c.996G>C	c.(994-996)gaG>gaC	p.E332D	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	332	Glu-rich.																ccagctcctcctctccctcct	0.537																																							uc001tbj.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(994-996)GAG>GAC		hypothetical protein LOC196477							167.0	139.0	149.0					12																	91347524		2203	4300	6503	SO:0001583	missense	196477							g.chr12:91347524C>G	BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.996G>C	12.37:g.91347524C>G	ENSP00000351727:p.Glu332Asp						p.E332D	NM_152638	NP_689851	Q8TC90	CL012_HUMAN			1	1430	-			332			Potential.|Glu-rich.		Q8TC47	Missense_Mutation	SNP	ENST00000358859.2	37	c.996G>C	CCDS9036.1	.	.	.	.	.	.	.	.	.	.	C	0.658	-0.806953	0.02819	.	.	ENSG00000197651	ENST00000358859	T	0.21932	1.98	5.04	-0.842	0.10748	.	0.749563	0.10912	N	0.620439	T	0.10508	0.0257	N	0.24115	0.695	0.09310	N	1	P	0.36144	0.539	B	0.33799	0.17	T	0.25363	-1.0134	10	0.28530	T	0.3	-1.8986	3.9404	0.09325	0.1622:0.3792:0.0:0.4586	.	332	Q8TC90	CL012_HUMAN	D	332	ENSP00000351727:E332D	ENSP00000351727:E332D	E	-	3	2	C12orf12	89871655	0.001000	0.12720	0.041000	0.18516	0.039000	0.13416	-1.259000	0.02861	-0.301000	0.08882	-0.361000	0.07541	GAG		0.537	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638		22	30	0	0	0	0.001882	0	22	30				
CKAP4	10970	broad.mit.edu	37	12	106632898	106632898	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:106632898C>T	ENST00000378026.4	-	2	1849	c.1713G>A	c.(1711-1713)gaG>gaA	p.E571E	CKAP4_ENST00000552828.1_5'Flank	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	571						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						CCAGATTGTTCTCGTTGGTTT	0.448																																							uc001tlk.2		NA																	0					0						c.(1711-1713)GAG>GAA		cytoskeleton-associated protein 4							161.0	153.0	156.0					12																	106632898		2203	4300	6503	SO:0001819	synonymous_variant	10970					ER-Golgi intermediate compartment membrane|integral to membrane|membrane fraction		g.chr12:106632898C>T	X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.1713G>A	12.37:g.106632898C>T							p.E571E	NM_006825	NP_006816	Q07065	CKAP4_HUMAN			2	1797	-			571			Potential.		Q504S5|Q53ES6	Silent	SNP	ENST00000378026.4	37	c.1713G>A	CCDS9103.1																																																																																				0.448	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407196.1			7	184	0	0	0	0.001984	0	7	184				
ATP2A2	488	broad.mit.edu	37	12	110777138	110777138	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:110777138G>A	ENST00000539276.2	+	12	1581	c.1472G>A	c.(1471-1473)aGa>aAa	p.R491K	ATP2A2_ENST00000308664.6_Missense_Mutation_p.R491K|ATP2A2_ENST00000395494.2_Missense_Mutation_p.R464K			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	491					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.R491K(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TCACGTGACAGAAAGTCAATG	0.388																																							uc001tqk.3		NA																	1	Substitution - Missense(1)		skin(1)	ovary(3)|skin(1)	4						c.(1471-1473)AGA>AAA		ATPase, Ca++ transporting, slow twitch 2 isoform							116.0	109.0	111.0					12																	110777138		2203	4300	6503	SO:0001583	missense	488				ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding	g.chr12:110777138G>A		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1472G>A	12.37:g.110777138G>A	ENSP00000440045:p.Arg491Lys					ATP2A2_uc001tql.3_Missense_Mutation_p.R491K|ATP2A2_uc010sxy.1_Missense_Mutation_p.R464K	p.R491K	NM_170665	NP_733765	P16615	AT2A2_HUMAN			12	2035	+			491			Cytoplasmic (By similarity).		A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	37	c.1472G>A	CCDS9144.1	.	.	.	.	.	.	.	.	.	.	G	36	5.619457	0.96649	.	.	ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276	D;D;D	0.93426	-3.22;-3.22;-3.22	5.85	5.85	0.93711	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.96987	0.9016	M	0.81179	2.53	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.87578	0.966;0.995;0.998	D	0.96984	0.9717	10	0.87932	D	0	.	20.1588	0.98128	0.0:0.0:1.0:0.0	.	464;491;491	P16615-4;P16615-2;P16615	.;.;AT2A2_HUMAN	K	491;464;491	ENSP00000311186:R491K;ENSP00000378872:R464K;ENSP00000440045:R491K	ENSP00000311186:R491K	R	+	2	0	ATP2A2	109261521	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	9.807000	0.99171	2.770000	0.95276	0.563000	0.77884	AGA		0.388	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681		8	39	0	0	0	0.00308	0	8	39				
CIT	11113	broad.mit.edu	37	12	120128116	120128116	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:120128116C>A	ENST00000261833.7	-	46	5952	c.5900G>T	c.(5899-5901)cGc>cTc	p.R1967L	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.R2009L	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1967					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CTTGTCCCTGCGCAGCTCGGT	0.726																																							uc001txi.1		NA																	0				ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10						c.(5899-5901)CGC>CTC		citron							12.0	15.0	14.0					12																	120128116		2188	4285	6473	SO:0001583	missense	11113				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity	g.chr12:120128116C>A	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.5900G>T	12.37:g.120128116C>A	ENSP00000261833:p.Arg1967Leu					CIT_uc001txh.1_Missense_Mutation_p.R1485L|CIT_uc001txj.1_Missense_Mutation_p.R2009L	p.R1967L	NM_007174	NP_009105	O14578	CTRO_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.211)	46	5953	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)	1967					Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	c.5900G>T	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.837933|5.837933	0.97009|0.97009	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392520|ENST00000392521;ENST00000261833	.|T;T	.|0.72505	.|-0.58;-0.66	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.82793|0.82793	0.5114|0.5114	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.69078	.|0.997;0.997;0.996	.|D;D;D	.|0.79108	.|0.987;0.987;0.992	D|D	0.83697|0.83697	0.0180|0.0180	5|10	.|0.87932	.|D	.|0	.|.	19.7507|19.7507	0.96267|0.96267	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2009;1967;1484	.|Q2M5E1;O14578;O14578-3	.|.;CTRO_HUMAN;.	S|L	1580|2009;1967	.|ENSP00000376306:R2009L;ENSP00000261833:R1967L	.|ENSP00000261833:R1967L	A|R	-|-	1|2	0|0	CIT|CIT	118612499|118612499	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.665000|7.665000	0.83852|0.83852	2.722000|2.722000	0.93159|0.93159	0.655000|0.655000	0.94253|0.94253	GCA|CGC		0.726	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		4	30	1	0	0.00909568	0.009096	0.0094563	4	30				
EP400	57634	broad.mit.edu	37	12	132547172	132547172	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:132547172C>T	ENST00000333577.4	+	48	8477	c.8368C>T	c.(8368-8370)Cag>Tag	p.Q2790*	EP400_ENST00000330386.6_Nonsense_Mutation_p.Q2673*|EP400_ENST00000332482.4_Nonsense_Mutation_p.Q2717*|EP400_ENST00000389562.2_Nonsense_Mutation_p.Q2753*|EP400_ENST00000389561.2_Nonsense_Mutation_p.Q2754*			Q96L91	EP400_HUMAN	E1A binding protein p400	2790					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GACGACCTCTCAGGTGCAAGT	0.607																																							uc001ujn.2		NA																	0				central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12						c.(8260-8262)CAG>TAG		E1A binding protein p400							87.0	68.0	75.0					12																	132547172		2203	4300	6503	SO:0001587	stop_gained	57634				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity	g.chr12:132547172C>T	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8368C>T	12.37:g.132547172C>T	ENSP00000333602:p.Gln2790*					EP400_uc001ujl.2_Nonsense_Mutation_p.Q2753*|EP400_uc001ujm.2_Nonsense_Mutation_p.Q2673*|EP400_uc001ujp.2_5'UTR	p.Q2754*	NM_015409	NP_056224	Q96L91	EP400_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	46	8295	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)	2790					O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Nonsense_Mutation	SNP	ENST00000333577.4	37	c.8260C>T		.	.	.	.	.	.	.	.	.	.	C	48	13.935905	0.99771	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	.	.	.	4.74	4.74	0.60224	.	0.075694	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	16.7211	0.85410	0.0:1.0:0.0:0.0	.	.	.	.	X	2790;2754;2753;2717;2673;2754	.	ENSP00000330620:Q2673X	Q	+	1	0	EP400	131113125	0.998000	0.40836	0.913000	0.36048	0.064000	0.16182	4.894000	0.63206	2.143000	0.66587	0.561000	0.74099	CAG		0.607	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409		14	60	0	0	0	0.00245	0	14	60				
COG3	83548	broad.mit.edu	37	13	46054293	46054293	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr13:46054293G>A	ENST00000349995.5	+	4	529	c.417G>A	c.(415-417)gaG>gaA	p.E139E		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	139					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GGTTTCAGGAGCAGTGTGATG	0.398																																					Ovarian(150;1048 1859 18083 21577 42700)	Ovarian(150;1048 1859 18083 21577 42700)	uc001vak.2		NA																	0				breast(1)|skin(1)	2						c.(415-417)GAG>GAA		component of golgi transport complex 3							145.0	144.0	144.0					13																	46054293		2203	4300	6503	SO:0001819	synonymous_variant	83548				ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity	g.chr13:46054293G>A	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.417G>A	13.37:g.46054293G>A						COG3_uc010tfu.1_RNA|COG3_uc001vai.2_Silent_p.E139E|COG3_uc001vaj.1_Silent_p.E139E|COG3_uc010tfv.1_Intron|COG3_uc010aci.2_Intron	p.E139E	NM_031431	NP_113619	Q96JB2	COG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)	4	518	+		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	139					B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Silent	SNP	ENST00000349995.5	37	c.417G>A	CCDS9398.1																																																																																				0.398	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2			14	37	0	0	0	0.004007	0	14	37				
LMO7	4008	broad.mit.edu	37	13	76287343	76287343	+	Missense_Mutation	SNP	C	C	A	rs75385907		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr13:76287343C>A	ENST00000341547.4	+	3	1511	c.251C>A	c.(250-252)aCa>aAa	p.T84K	LMO7_ENST00000357063.3_Missense_Mutation_p.T84K|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000377534.3_Missense_Mutation_p.T84K	NM_005358.5	NP_005349.3	Q8WWI1	LMO7_HUMAN	LIM domain 7	84	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AATTTTGAAACAAAAGATTTT	0.318																																							uc010thv.1		NA																	0				large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5						c.(250-252)ACA>AAA		LIM domain only 7 isoform 1							49.0	53.0	51.0					13																	76287343		2202	4300	6502	SO:0001583	missense	4008					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding	g.chr13:76287343C>A	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000341547.4:c.251C>A	13.37:g.76287343C>A	ENSP00000342112:p.Thr84Lys					LMO7_uc001vjt.1_Missense_Mutation_p.T32K	p.T84K	NM_005358	NP_005349	Q8WWI1	LMO7_HUMAN		GBM - Glioblastoma multiforme(99;0.0109)	3	1511	+		Breast(118;0.0992)	84			CH.		E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000341547.4	37	c.251C>A	CCDS9454.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704618	0.68615	.	.	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499	D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64	5.59	3.73	0.42828	.	1.313350	0.05340	N	0.529904	D	0.89497	0.6732	N	0.11870	0.19	0.28065	N	0.932812	P;P	0.44627	0.839;0.705	B;B	0.41510	0.322;0.359	T	0.83259	-0.0049	10	0.62326	D	0.03	.	9.5196	0.39126	0.159:0.6868:0.1542:0.0	.	84;32	Q8WWI1-3;F8J2B5	.;.	K	84;84;84;32	ENSP00000342112:T84K;ENSP00000349571:T84K;ENSP00000366757:T84K;ENSP00000366719:T32K	ENSP00000342112:T84K	T	+	2	0	LMO7	75185344	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	1.540000	0.36115	1.458000	0.47871	0.561000	0.74099	ACA		0.318	LMO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045297.1	NM_005358		6	31	1	0	1.26484e-09	0.00308	1.44205e-09	6	31				
LAMP1	3916	broad.mit.edu	37	13	113975949	113975949	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr13:113975949G>T	ENST00000332556.4	+	8	1215	c.1021G>T	c.(1021-1023)Gag>Tag	p.E341*	LAMP1_ENST00000397181.3_Nonsense_Mutation_p.E288*	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	341	Second lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			GTGCAACGCGGAGGAGCACGT	0.557																																							uc001vtm.1		NA																	0				central_nervous_system(2)	2						c.(1021-1023)GAG>TAG		lysosomal-associated membrane protein 1							104.0	113.0	110.0					13																	113975949		2081	4199	6280	SO:0001587	stop_gained	3916					endosome membrane|integral to plasma membrane|lysosomal membrane|membrane fraction		g.chr13:113975949G>T	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.1021G>T	13.37:g.113975949G>T	ENSP00000333298:p.Glu341*					LAMP1_uc010tka.1_Nonsense_Mutation_p.E288*	p.E341*	NM_005561	NP_005552	P11279	LAMP1_HUMAN	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)		8	1302	+	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	341			Lumenal (Potential).|Second lumenal domain.		B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Nonsense_Mutation	SNP	ENST00000332556.4	37	c.1021G>T	CCDS41909.1	.	.	.	.	.	.	.	.	.	.	G	35	5.551583	0.96501	.	.	ENSG00000185896	ENST00000332556;ENST00000397181	.	.	.	5.27	4.42	0.53409	.	0.146062	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-31.7642	9.4955	0.38986	0.0747:0.1442:0.7811:0.0	.	.	.	.	X	341;288	.	ENSP00000333298:E341X	E	+	1	0	LAMP1	113023950	1.000000	0.71417	0.227000	0.23927	0.135000	0.20990	3.798000	0.55522	1.217000	0.43442	-0.326000	0.08463	GAG		0.557	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2			18	95	1	0	2.35188e-11	0.006122	2.7208e-11	18	95				
PPP2R5E	5529	broad.mit.edu	37	14	64006338	64006338	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr14:64006338G>A	ENST00000337537.3	-	2	668	c.66C>T	c.(64-66)gtC>gtT	p.V22V	PPP2R5E_ENST00000553266.1_5'UTR|PPP2R5E_ENST00000555899.1_Silent_p.V22V	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	22					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		TGGCTTTTCTGACGGACTTCC	0.463																																							uc001xgd.1		NA																	0				ovary(1)	1						c.(64-66)GTC>GTT		epsilon isoform of regulatory subunit B56,							152.0	130.0	138.0					14																	64006338		2203	4300	6503	SO:0001819	synonymous_variant	5529				signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr14:64006338G>A	L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.66C>T	14.37:g.64006338G>A						PPP2R5E_uc001xge.2_Silent_p.V22V|PPP2R5E_uc010tsh.1_Silent_p.V22V|PPP2R5E_uc001xgf.1_RNA|PPP2R5E_uc001xgg.3_Silent_p.V22V	p.V22V	NM_006246	NP_006237	Q16537	2A5E_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)	2	656	-			22					A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Silent	SNP	ENST00000337537.3	37	c.66C>T	CCDS9758.1																																																																																				0.463	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276973.1	NM_006246		23	43	0	0	0	0.002299	0	23	43				
AHNAK2	113146	broad.mit.edu	37	14	105411807	105411807	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr14:105411807G>C	ENST00000333244.5	-	7	10100	c.9981C>G	c.(9979-9981)atC>atG	p.I3327M	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3327						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCGAGGCCTGGATGGACTTGC	0.602																																							uc010axc.1		NA																	0				ovary(1)	1						c.(9979-9981)ATC>ATG		AHNAK nucleoprotein 2							167.0	170.0	169.0					14																	105411807		1998	4159	6157	SO:0001583	missense	113146					nucleus		g.chr14:105411807G>C	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9981C>G	14.37:g.105411807G>C	ENSP00000353114:p.Ile3327Met					AHNAK2_uc001ypx.2_Missense_Mutation_p.I3227M	p.I3327M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	10101	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3327					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.9981C>G	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	2.887	-0.230599	0.05983	.	.	ENSG00000185567	ENST00000333244	T	0.00678	5.87	3.74	-7.48	0.01360	.	.	.	.	.	T	0.00468	0.0015	N	0.12637	0.245	0.09310	N	1	P	0.38827	0.649	B	0.37888	0.26	T	0.41431	-0.9509	9	0.38643	T	0.18	.	4.5602	0.12156	0.1439:0.4664:0.214:0.1757	.	3327	Q8IVF2	AHNK2_HUMAN	M	3327	ENSP00000353114:I3327M	ENSP00000353114:I3327M	I	-	3	3	AHNAK2	104482852	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-4.223000	0.00271	-1.936000	0.01048	-1.161000	0.01788	ATC		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		31	294	0	0	0	0.00361	0	31	294				
AHNAK2	113146	broad.mit.edu	37	14	105415472	105415472	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr14:105415472C>A	ENST00000333244.5	-	7	6435	c.6316G>T	c.(6316-6318)Gaa>Taa	p.E2106*	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2106						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACTCTCATTTCCACCTTGGGG	0.592																																							uc010axc.1		NA																	0				ovary(1)	1						c.(6316-6318)GAA>TAA		AHNAK nucleoprotein 2							137.0	93.0	110.0					14																	105415472		1871	2867	4738	SO:0001587	stop_gained	113146					nucleus		g.chr14:105415472C>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6316G>T	14.37:g.105415472C>A	ENSP00000353114:p.Glu2106*					AHNAK2_uc001ypx.2_Nonsense_Mutation_p.E2006*	p.E2106*	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	6436	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	2106					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Nonsense_Mutation	SNP	ENST00000333244.5	37	c.6316G>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	46	12.681834	0.99688	.	.	ENSG00000185567	ENST00000333244	.	.	.	3.75	3.75	0.43078	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	7.8991	0.29723	0.0:0.8801:0.0:0.1199	.	.	.	.	X	2106	.	ENSP00000353114:E2106X	E	-	1	0	AHNAK2	104486517	0.001000	0.12720	0.163000	0.22734	0.015000	0.08874	0.575000	0.23729	2.058000	0.61347	0.306000	0.20318	GAA		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		122	48	1	0	1.64933e-60	0.00361	2.04865e-60	122	48				
APBA2	321	broad.mit.edu	37	15	29346847	29346847	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:29346847C>A	ENST00000558402.1	+	5	1359	c.760C>A	c.(760-762)Cct>Act	p.P254T	APBA2_ENST00000411764.1_Missense_Mutation_p.P254T|APBA2_ENST00000561069.1_Missense_Mutation_p.P254T|APBA2_ENST00000558259.1_Missense_Mutation_p.P254T|APBA2_ENST00000558330.1_Missense_Mutation_p.P254T			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	254	STXBP1-binding.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CGAGCATGGGCCTGAGCCAGG	0.637																																							uc001zck.2		NA																	0					0						c.(760-762)CCT>ACT		amyloid beta A4 precursor protein-binding,							42.0	39.0	40.0					15																	29346847		2203	4300	6503	SO:0001583	missense	321				nervous system development|protein transport		protein binding	g.chr15:29346847C>A	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.760C>A	15.37:g.29346847C>A	ENSP00000453293:p.Pro254Thr					APBA2_uc010azj.2_Missense_Mutation_p.P254T|APBA2_uc010uat.1_Missense_Mutation_p.P254T|APBA2_uc001zcl.2_Missense_Mutation_p.P254T|APBA2_uc010uas.1_Missense_Mutation_p.P254T	p.P254T	NM_005503	NP_005494	Q99767	APBA2_HUMAN		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)	3	967	+		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)	254			STXBP1-binding.		E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	37	c.760C>A	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.791787	0.00623	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.04551	3.6	4.96	2.9	0.33743	.	0.360750	0.28114	N	0.016548	T	0.03608	0.0103	L	0.38175	1.15	0.09310	N	1	B;B;B	0.14438	0.01;0.001;0.001	B;B;B	0.12837	0.008;0.003;0.003	T	0.44345	-0.9334	10	0.13853	T	0.58	.	5.8289	0.18568	0.3727:0.5242:0.0:0.103	.	254;254;254	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	T	254	ENSP00000409312:P254T	ENSP00000219865:P254T	P	+	1	0	APBA2	27134139	0.843000	0.29541	0.016000	0.15963	0.312000	0.27988	1.308000	0.33528	1.085000	0.41206	-0.127000	0.14921	CCT		0.637	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503		30	58	1	0	4.34311e-12	0.003271	5.07412e-12	30	58				
RPAP1	26015	broad.mit.edu	37	15	41812941	41812941	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:41812941C>A	ENST00000304330.4	-	22	3559	c.3443G>T	c.(3442-3444)tGg>tTg	p.W1148L	RPAP1_ENST00000561603.1_Intron	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1148	Leu-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGGCACAGCCCAGAGAGCCTG	0.657																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(3442-3444)TGG>TTG		RNA polymerase II associated protein 1							37.0	42.0	40.0					15																	41812941		2203	4300	6503	SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41812941C>A	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.3443G>T	15.37:g.41812941C>A	ENSP00000306123:p.Trp1148Leu					RPAP1_uc001zoc.2_Missense_Mutation_p.W167L	p.W1148L	NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	22	3567	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	1148			Leu-rich.		Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	c.3443G>T	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	C	9.612	1.131482	0.21041	.	.	ENSG00000103932	ENST00000304330	T	0.75367	-0.93	5.31	0.16	0.14972	.	0.577849	0.18961	N	0.126420	T	0.60599	0.2281	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.53351	-0.8451	10	0.87932	D	0	-0.9424	4.8087	0.13333	0.1523:0.3284:0.0:0.5193	.	1148	Q9BWH6	RPAP1_HUMAN	L	1148	ENSP00000306123:W1148L	ENSP00000306123:W1148L	W	-	2	0	RPAP1	39600233	0.010000	0.17322	0.503000	0.27626	0.997000	0.91878	0.584000	0.23864	-0.105000	0.12132	0.563000	0.77884	TGG		0.657	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		36	63	1	0	2.04263e-09	0.004289	2.30651e-09	36	63				
LRRC57	255252	broad.mit.edu	37	15	42840407	42840407	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:42840407G>A	ENST00000323443.2	-	2	487	c.120C>T	c.(118-120)ctC>ctT	p.L40L	HAUS2_ENST00000260372.3_5'Flank|HAUS2_ENST00000568846.2_5'Flank|LRRC57_ENST00000563454.1_Silent_p.L40L|LRRC57_ENST00000397130.3_Silent_p.L40L|HAUS2_ENST00000568876.1_5'Flank			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	40						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		CGATGGTCCTGAGATTGCTCG	0.552																																							uc001zqd.1		NA																	0					0						c.(118-120)CTC>CTT		leucine rich repeat containing 57							139.0	139.0	139.0					15																	42840407		2203	4299	6502	SO:0001819	synonymous_variant	255252							g.chr15:42840407G>A	AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.120C>T	15.37:g.42840407G>A						HAUS2_uc001zqe.2_5'Flank|HAUS2_uc010udi.1_5'Flank|HAUS2_uc001zqf.2_5'Flank|LRRC57_uc001zqc.2_Silent_p.L40L	p.L40L	NM_153260	NP_694992	Q8N9N7	LRC57_HUMAN		GBM - Glioblastoma multiforme(94;6.87e-07)	2	488	-		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)	40			LRR 1.		Q7Z2Z6|Q8N1T6	Silent	SNP	ENST00000323443.2	37	c.120C>T	CCDS10089.1																																																																																				0.552	LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253174.1	NM_153260		5	163	0	0	0	0.001168	0	5	163				
NEDD4	4734	broad.mit.edu	37	15	56126273	56126273	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:56126273T>C	ENST00000508342.1	-	22	3949	c.3650A>G	c.(3649-3651)tAc>tGc	p.Y1217C	NEDD4_ENST00000338963.2_Missense_Mutation_p.Y1145C|NEDD4_ENST00000435532.3_Missense_Mutation_p.Y798C|NEDD4_ENST00000506154.1_Missense_Mutation_p.Y1201C	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	1217	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		ATTTGCACTGTAGCCATTTTT	0.318																																							uc002adj.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(3649-3651)TAC>TGC		neural precursor cell expressed, developmentally							159.0	144.0	149.0					15																	56126273		2193	4292	6485	SO:0001583	missense	4734				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity	g.chr15:56126273T>C	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.3650A>G	15.37:g.56126273T>C	ENSP00000424827:p.Tyr1217Cys					NEDD4_uc002adl.2_Missense_Mutation_p.Y798C|NEDD4_uc002adi.2_Missense_Mutation_p.Y1145C|NEDD4_uc010ugj.1_Missense_Mutation_p.Y1201C|NEDD4_uc010bfm.2_Missense_Mutation_p.Y1200C|NEDD4_uc002adk.2_RNA	p.Y1217C	NM_198400	NP_006145	P46934	NEDD4_HUMAN		all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)	22	3950	-			1217			HECT.		A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000508342.1	37	c.3650A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.5|22.5	4.303921|4.303921	0.81136|0.81136	.|.	.|.	ENSG00000069869|ENSG00000069869	ENST00000508871|ENST00000508342;ENST00000435532;ENST00000338963;ENST00000506154	.|T;T;T;T	.|0.63913	.|-0.07;-0.07;-0.07;-0.07	5.54|5.54	5.54|5.54	0.83059|0.83059	.|HECT (4);	.|0.117523	.|0.64402	.|D	.|0.000012	D|D	0.82604|0.82604	0.5073|0.5073	M|M	0.90542|0.90542	3.125|3.125	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0	D|D	0.86484|0.86484	0.1793|0.1793	5|10	.|0.87932	.|D	.|0	.|.	14.864|14.864	0.70401|0.70401	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1201;798;1217;1145	.|P46934-2;P46934-4;P46934;P46934-3	.|.;.;NEDD4_HUMAN;.	A|C	808|1217;798;1145;1201	.|ENSP00000424827:Y1217C;ENSP00000410613:Y798C;ENSP00000345530:Y1145C;ENSP00000422705:Y1201C	.|ENSP00000345530:Y1145C	T|Y	-|-	1|2	0|0	NEDD4|NEDD4	53913565|53913565	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.975000|0.975000	0.68041|0.68041	8.036000|8.036000	0.88901|0.88901	2.094000|2.094000	0.63399|0.63399	0.528000|0.528000	0.53228|0.53228	ACA|TAC		0.318	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400		35	64	0	0	0	0.003755	0	35	64				
VPS13C	54832	broad.mit.edu	37	15	62211643	62211643	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:62211643G>C	ENST00000261517.5	-	58	7556	c.7483C>G	c.(7483-7485)Cat>Gat	p.H2495D	VPS13C_ENST00000395898.3_Missense_Mutation_p.H2452D|VPS13C_ENST00000249837.3_Missense_Mutation_p.H2452D|VPS13C_ENST00000395896.4_Missense_Mutation_p.H2495D	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GTATATCCATGAGGTACTAAG	0.378																																							uc002agz.2		NA																	0				ovary(2)	2						c.(7483-7485)CAT>GAT		vacuolar protein sorting 13C protein isoform 2A							115.0	115.0	115.0					15																	62211643		2203	4299	6502	SO:0001583	missense	54832				protein localization			g.chr15:62211643G>C	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.7483C>G	15.37:g.62211643G>C	ENSP00000261517:p.His2495Asp					VPS13C_uc002aha.2_Missense_Mutation_p.H2452D|VPS13C_uc002ahb.1_Missense_Mutation_p.H2495D|VPS13C_uc002ahc.1_Missense_Mutation_p.H2452D|VPS13C_uc002ahd.1_5'Flank	p.H2495D	NM_020821	NP_065872	Q709C8	VP13C_HUMAN			58	7557	-			2495						Missense_Mutation	SNP	ENST00000261517.5	37	c.7483C>G	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382773	0.25031	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.40476	1.03;1.03;1.2	5.08	4.15	0.48705	.	0.444031	0.26377	N	0.024739	T	0.29288	0.0729	L	0.38175	1.15	0.26212	N	0.979283	B;B;B;B	0.22983	0.001;0.002;0.001;0.078	B;B;B;B	0.18263	0.004;0.004;0.007;0.021	T	0.15983	-1.0418	10	0.13853	T	0.58	.	10.3742	0.44073	0.0794:0.1712:0.7493:0.0	.	2452;2495;2452;2495	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	D	2452;2495;2495;2495	ENSP00000249837:H2452D;ENSP00000261517:H2495D;ENSP00000379233:H2495D	ENSP00000249837:H2452D	H	-	1	0	VPS13C	59998935	0.991000	0.36638	1.000000	0.80357	0.971000	0.66376	0.588000	0.23924	1.220000	0.43490	0.655000	0.94253	CAT		0.378	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		23	112	0	0	0	0.00278	0	23	112				
UACA	55075	broad.mit.edu	37	15	70968880	70968880	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:70968880T>A	ENST00000322954.6	-	13	1268	c.1083A>T	c.(1081-1083)gaA>gaT	p.E361D	UACA_ENST00000379983.2_Missense_Mutation_p.E348D|UACA_ENST00000560441.1_Missense_Mutation_p.E348D|UACA_ENST00000539319.1_Missense_Mutation_p.E252D	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	361					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TCCTTAAGCTTTCTTCATGTT	0.333																																							uc002asr.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1081-1083)GAA>GAT		uveal autoantigen with coiled-coil domains and							79.0	81.0	80.0					15																	70968880		2199	4295	6494	SO:0001583	missense	55075					cytoskeleton|extracellular region		g.chr15:70968880T>A	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.1083A>T	15.37:g.70968880T>A	ENSP00000314556:p.Glu361Asp					UACA_uc010uke.1_Missense_Mutation_p.E252D|UACA_uc002asq.2_Missense_Mutation_p.E348D|UACA_uc010bin.1_Missense_Mutation_p.E336D	p.E361D	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN			13	1187	-			361			Potential.		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	c.1083A>T	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.092634	0.76756	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362;ENST00000539319	T;T;T	0.39406	1.08;1.09;1.56	5.4	4.26	0.50523	.	0.000000	0.64402	D	0.000007	T	0.54919	0.1888	L	0.48642	1.525	0.52501	D	0.999957	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.74023	0.982;0.942;0.942;0.974	T	0.51585	-0.8687	10	0.40728	T	0.16	-26.0996	12.7761	0.57448	0.0:0.0:0.1371:0.8628	.	252;361;361;348	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	D	361;348;337;252	ENSP00000314556:E361D;ENSP00000369319:E348D;ENSP00000438667:E252D	ENSP00000314556:E361D	E	-	3	2	UACA	68755934	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	1.023000	0.30065	0.975000	0.38392	0.383000	0.25322	GAA		0.333	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			17	27	0	0	0	0.006122	0	17	27				
PSTPIP1	9051	broad.mit.edu	37	15	77329395	77329395	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:77329395G>A	ENST00000558012.1	+	15	1618	c.1129G>A	c.(1129-1131)Gag>Aag	p.E377K	PSTPIP1_ENST00000379595.3_Missense_Mutation_p.E374K|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.E358K|PSTPIP1_ENST00000557995.1_3'UTR|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.E357K	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	377	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GAACCCAGATGAGCTGGACCT	0.637																																							uc002bcf.2		NA																	0				ovary(1)	1						c.(1129-1131)GAG>AAG		proline-serine-threonine phosphatase interacting							78.0	88.0	85.0					15																	77329395		2012	4163	6175	SO:0001583	missense	9051				cell adhesion|signal transduction	cleavage furrow|lamellipodium|perinuclear region of cytoplasm	catalytic activity	g.chr15:77329395G>A	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.1129G>A	15.37:g.77329395G>A	ENSP00000452746:p.Glu377Lys					PSTPIP1_uc010bkt.1_RNA|PSTPIP1_uc010bku.1_Missense_Mutation_p.E368K|PSTPIP1_uc002bcg.2_Missense_Mutation_p.E374K|PSTPIP1_uc010bkw.1_Missense_Mutation_p.E358K|PSTPIP1_uc002bch.1_Missense_Mutation_p.E138K|PSTPIP1_uc002bci.1_RNA	p.E377K	NM_003978	NP_003969	O43586	PPIP1_HUMAN			15	1579	+			377			SH3.		B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	37	c.1129G>A	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	g	16.76	3.211909	0.58452	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T	0.63255	-0.03	4.48	4.48	0.54585	Src homology-3 domain (5);Spectrin alpha chain, SH3 domain (1);	0.054997	0.64402	D	0.000001	D	0.83271	0.5218	M	0.92219	3.285	0.58432	D	0.99999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.79784	0.983;0.991;0.993	D	0.87790	0.2618	10	0.72032	D	0.01	-27.5925	15.8993	0.79359	0.0:0.0:1.0:0.0	.	358;357;377	O43586-2;C9K004;O43586	.;.;PPIP1_HUMAN	K	377;357	ENSP00000267939:E357K	ENSP00000267939:E357K	E	+	1	0	PSTPIP1	75116450	1.000000	0.71417	0.944000	0.38274	0.115000	0.19883	8.686000	0.91250	2.316000	0.78162	0.586000	0.80456	GAG		0.637	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978		4	70	0	0	0	0.001168	0	4	70				
HMG20A	10363	broad.mit.edu	37	15	77769946	77769946	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:77769946C>T	ENST00000381714.3	+	8	1093	c.665C>T	c.(664-666)aCa>aTa	p.T222I	HMG20A_ENST00000336216.4_Missense_Mutation_p.T222I	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	222					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						CCTATATTTACAGAGGAATTC	0.333																																							uc002bcr.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(664-666)ACA>ATA		high-mobility group 20A							86.0	86.0	86.0					15																	77769946		2196	4294	6490	SO:0001583	missense	10363				chromatin modification	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr15:77769946C>T	AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.665C>T	15.37:g.77769946C>T	ENSP00000371133:p.Thr222Ile					HMG20A_uc002bcs.2_Missense_Mutation_p.T222I	p.T222I	NM_018200	NP_060670	Q9NP66	HM20A_HUMAN			8	866	+			222					A6NHY3|D3DW78|Q53G31|Q9NSF6	Missense_Mutation	SNP	ENST00000381714.3	37	c.665C>T	CCDS10295.1	.	.	.	.	.	.	.	.	.	.	C	32	5.141333	0.94560	.	.	ENSG00000140382	ENST00000336216;ENST00000381714	T;T	0.72942	-0.7;-0.7	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.86990	0.6066	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87507	0.2437	10	0.87932	D	0	-17.2863	20.5948	0.99439	0.0:1.0:0.0:0.0	.	222	Q9NP66	HM20A_HUMAN	I	222	ENSP00000336856:T222I;ENSP00000371133:T222I	ENSP00000336856:T222I	T	+	2	0	HMG20A	75557001	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.294000	0.78760	2.873000	0.98535	0.563000	0.77884	ACA		0.333	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200		9	24	0	0	0	0.006214	0	9	24				
AGBL1	123624	broad.mit.edu	37	15	86807741	86807741	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:86807741C>T	ENST00000441037.2	+	10	1296	c.1201C>T	c.(1201-1203)Ctc>Ttc	p.L401F	AGBL1_ENST00000389298.3_Missense_Mutation_p.L132F|AGBL1_ENST00000421325.2_Missense_Mutation_p.L401F	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	401					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						ATCCAATAGTCTCAGGAGAGA	0.483																																							uc002blz.1		NA																	0					0						c.(1201-1203)CTC>TTC		ATP/GTP binding protein-like 1							64.0	67.0	66.0					15																	86807741		1918	4143	6061	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86807741C>T	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1201C>T	15.37:g.86807741C>T	ENSP00000413001:p.Leu401Phe					AGBL1_uc002bma.1_Missense_Mutation_p.L132F|AGBL1_uc002bmb.1_Missense_Mutation_p.L95F	p.L401F	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN			10	1281	+			401					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.1201C>T	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	C	9.247	1.039651	0.19669	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10288	2.9;2.89	5.71	0.345	0.16011	Armadillo-type fold (1);	1.031720	0.07691	N	0.938737	T	0.10252	0.0251	M	0.71036	2.16	0.09310	N	1	P;B;B	0.40398	0.716;0.418;0.005	B;B;B	0.37144	0.242;0.107;0.005	T	0.30475	-0.9977	10	0.19590	T	0.45	-0.0163	1.0863	0.01654	0.1596:0.4219:0.155:0.2635	.	100;132;401	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	F	430;401;132	ENSP00000397173:L401F;ENSP00000373949:L132F	ENSP00000373949:L132F	L	+	1	0	AGBL1	84608745	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.060000	0.14342	0.100000	0.17581	0.650000	0.86243	CTC		0.483	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		16	80	0	0	0	0.004007	0	16	80				
DNM1P47	100216544	broad.mit.edu	37	15	102292797	102292797	+	RNA	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr15:102292797C>G	ENST00000561463.1	+	0	843									DNM1 pseudogene 47									p.P129A(2)									GAGCTGCTGTCCAACCTGCAC	0.597																																							uc010usj.1		NA																	2	Substitution - Missense(2)		urinary_tract(1)|lung(1)		NA						c.(385-387)CCA>GCA		RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																																						0							g.chr15:102292797C>G	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292797C>G						uc002bxo.2_RNA|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank	p.P129A							4	444	+									Missense_Mutation	SNP	ENST00000561463.1	37	c.385C>G																																																																																					0.597	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149		3	48	0	0	0	0.009096	0	3	48				
CHTF18	63922	broad.mit.edu	37	16	840384	840384	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:840384C>G	ENST00000262315.9	+	6	800	c.737C>G	c.(736-738)tCa>tGa	p.S246*	CHTF18_ENST00000455171.2_Nonsense_Mutation_p.S274*|CHTF18_ENST00000491530.1_3'UTR|RPUSD1_ENST00000561734.1_5'Flank|RPUSD1_ENST00000565809.1_5'Flank|RPUSD1_ENST00000567114.1_5'Flank|RPUSD1_ENST00000007264.2_5'Flank|CHTF18_ENST00000317063.6_Nonsense_Mutation_p.S443*	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	246					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CAGAAGCTTTCAGACACCCTG	0.642																																							uc002cke.3		NA																	0				kidney(1)	1						c.(736-738)TCA>TGA		CTF18, chromosome transmission fidelity factor							20.0	24.0	22.0					16																	840384		1933	4124	6057	SO:0001587	stop_gained	63922				cell cycle|DNA replication	nucleus	ATP binding|DNA binding|nucleoside-triphosphatase activity	g.chr16:840384C>G	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.737C>G	16.37:g.840384C>G	ENSP00000262315:p.Ser246*					RPUSD1_uc002cka.2_5'Flank|RPUSD1_uc002ckb.2_5'Flank|RPUSD1_uc002ckc.2_5'Flank|RPUSD1_uc002ckd.2_5'Flank|CHTF18_uc010uus.1_Missense_Mutation_p.F251L|CHTF18_uc010bre.1_RNA|CHTF18_uc002ckf.3_Nonsense_Mutation_p.S274*|CHTF18_uc010brf.2_5'UTR|CHTF18_uc002ckg.3_5'UTR	p.S246*	NM_022092	NP_071375	Q8WVB6	CTF18_HUMAN			6	800	+		Hepatocellular(780;0.00335)	246					B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Nonsense_Mutation	SNP	ENST00000262315.9	37	c.737C>G	CCDS45371.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.32|17.32	3.360709|3.360709	0.61403|0.61403	.|.	.|.	ENSG00000127586|ENSG00000127586	ENST00000426047|ENST00000317063;ENST00000455171;ENST00000262315	.|.	.|.	.|.	4.3|4.3	3.35|3.35	0.38373|0.38373	.|.	.|7.701850	.|0.00447	.|N	.|0.000083	T|.	0.48077|.	0.1480|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.43294|.	-0.9400|.	5|.	.|0.39692	.|T	.|0.17	-9.2668|-9.2668	10.1896|10.1896	0.43019|0.43019	0.0:0.9004:0.0:0.0996|0.0:0.9004:0.0:0.0996	.|.	251|.	B4DEY3|.	.|.	L|X	141|443;274;246	.|.	.|ENSP00000262315:S246X	F|S	+|+	3|2	2|0	CHTF18|CHTF18	780385|780385	0.004000|0.004000	0.15560|0.15560	0.401000|0.401000	0.26359|0.26359	0.036000|0.036000	0.12997|0.12997	1.894000|1.894000	0.39768|0.39768	1.173000|1.173000	0.42796|0.42796	0.423000|0.423000	0.28283|0.28283	TTC|TCA		0.642	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092		3	25	0	0	0	0.004672	0	3	25				
PKD1	5310	broad.mit.edu	37	16	2159023	2159023	+	Missense_Mutation	SNP	C	C	T	rs369880118		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:2159023C>T	ENST00000262304.4	-	15	6353	c.6145G>A	c.(6145-6147)Gag>Aag	p.E2049K	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Missense_Mutation_p.E2049K	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2049	PKD 16. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTGCGGTTCTCACTGCCCAGG	0.687																																							uc002cos.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(6145-6147)GAG>AAG		polycystin 1 isoform 1 precursor							22.0	24.0	23.0					16																	2159023		2186	4283	6469	SO:0001583	missense	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2159023C>T	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.6145G>A	16.37:g.2159023C>T	ENSP00000262304:p.Glu2049Lys					PKD1_uc002cot.1_Missense_Mutation_p.E2049K	p.E2049K	NM_001009944	NP_001009944	P98161	PKD1_HUMAN			15	6354	-			2049			PKD 16.|Extracellular (Potential).		Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	c.6145G>A	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	c	7.125	0.578662	0.13686	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000382481	T;T	0.60548	0.18;0.18	5.49	4.54	0.55810	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (2);	0.522517	0.20143	N	0.098322	T	0.36468	0.0968	N	0.08118	0	0.09310	N	0.999994	B;B	0.32010	0.351;0.07	B;B	0.37346	0.089;0.247	T	0.23762	-1.0179	10	0.23302	T	0.38	.	7.645	0.28315	0.0:0.6163:0.2408:0.1429	.	2049;2049	P98161-3;P98161	.;PKD1_HUMAN	K	2049;2049;328	ENSP00000262304:E2049K;ENSP00000399501:E2049K	ENSP00000262304:E2049K	E	-	1	0	PKD1	2099024	0.005000	0.15991	0.586000	0.28679	0.069000	0.16628	0.255000	0.18333	1.333000	0.45449	0.544000	0.68410	GAG		0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			6	40	0	0	0	0.001168	0	6	40				
XYLT1	64131	broad.mit.edu	37	16	17235050	17235050	+	Missense_Mutation	SNP	T	T	C	rs200026293		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:17235050T>C	ENST00000261381.6	-	7	1631	c.1547A>G	c.(1546-1548)aAg>aGg	p.K516R	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	516					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTGTTTCATCTTGGTCACCAG	0.502																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(1546-1548)AAG>AGG		xylosyltransferase I							246.0	249.0	248.0					16																	17235050		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17235050T>C	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1547A>G	16.37:g.17235050T>C	ENSP00000261381:p.Lys516Arg						p.K516R	NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN			7	1632	-			516			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.1547A>G	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	T	13.07	2.126699	0.37533	.	.	ENSG00000103489	ENST00000261381	T	0.12039	2.72	5.68	5.68	0.88126	.	0.090575	0.85682	D	0.000000	T	0.19406	0.0466	L	0.34521	1.04	0.48288	D	0.999625	D	0.55172	0.97	P	0.53401	0.725	T	0.01697	-1.1293	10	0.29301	T	0.29	-36.0269	15.1066	0.72326	0.0:0.0:0.0:1.0	.	516	Q86Y38	XYLT1_HUMAN	R	516	ENSP00000261381:K516R	ENSP00000261381:K516R	K	-	2	0	XYLT1	17142551	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	2.768000	0.47645	2.167000	0.68274	0.454000	0.30748	AAG		0.502	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		49	309	0	0	0	0.00361	0	49	309				
UMOD	7369	broad.mit.edu	37	16	20355378	20355378	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:20355378G>A	ENST00000570689.1	-	6	1445	c.1299C>T	c.(1297-1299)gtC>gtT	p.V433V	UMOD_ENST00000570331.1_5'Flank|UMOD_ENST00000396142.2_Silent_p.V433V|UMOD_ENST00000302509.4_Silent_p.V433V|UMOD_ENST00000396138.4_Silent_p.V482V|UMOD_ENST00000424589.1_Silent_p.V466V|UMOD_ENST00000396134.2_Silent_p.V466V			P07911	UROM_HUMAN	uromodulin	433	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)			endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TCTTCAGGCTGACTTTCATGT	0.532																																							uc002dgz.2		NA																	0				ovary(1)|skin(1)	2						c.(1297-1299)GTC>GTT		uromodulin precursor							129.0	109.0	116.0					16																	20355378		2203	4300	6503	SO:0001819	synonymous_variant	7369				cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding	g.chr16:20355378G>A	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1299C>T	16.37:g.20355378G>A						UMOD_uc002dha.2_Silent_p.V433V|UMOD_uc002dhb.2_Silent_p.V466V	p.V433V	NM_003361	NP_003352	P07911	UROM_HUMAN			6	1428	-			433			ZP.		B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Silent	SNP	ENST00000570689.1	37	c.1299C>T	CCDS10583.1																																																																																				0.532	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1			4	64	0	0	0	0.001168	0	4	64				
Unknown	0	broad.mit.edu	37	16	21531273	21531273	+	IGR	SNP	G	G	A	rs200926196	byFrequency	TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:21531273G>A								MIR3680-1 (13817 upstream) : SCARNA6 (67674 downstream)																							GCCGGATGATGAGCAGCTCGA	0.642													g|||	36	0.0071885	0.0	0.0072	5008	,	,		28654	0.0		0.0149	False		,,,				2504	0.0164						uc002djd.2		NA																	0					0						c.(412-414)CTC>CTT		RecName: Full=Putative L-type amino acid transporter 1-like protein MLAS; AltName: Full=hLAT1 3-transmembrane protein MLAS;          Short=hLAT1 3TM MLAS;																																				SO:0001628	intergenic_variant	387254							g.chr16:21531273G>A																													16.37:g.21531273G>A						uc002diq.3_Intron|LOC100271836_uc002dja.2_RNA|LOC100271836_uc002djb.2_RNA	p.L138L	NR_002594						1	493	-									Silent	SNP		37	c.414C>T																																																																																				0	0.642									5	68	0	0	0	0.004482	0	5	68				
SRCAP	10847	broad.mit.edu	37	16	30749478	30749478	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:30749478C>A	ENST00000262518.4	+	34	8502	c.8117C>A	c.(8116-8118)tCa>tAa	p.S2706*	RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Nonsense_Mutation_p.S2644*|SRCAP_ENST00000344771.4_Nonsense_Mutation_p.S2548*	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2706	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ACCTCATCTTCAGCCACTTCC	0.602																																							uc002dze.1		NA																	0				ovary(3)|skin(1)	4						c.(8116-8118)TCA>TAA		Snf2-related CBP activator protein							81.0	69.0	73.0					16																	30749478		2197	4300	6497	SO:0001587	stop_gained	10847				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity	g.chr16:30749478C>A	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.8117C>A	16.37:g.30749478C>A	ENSP00000262518:p.Ser2706*					SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Nonsense_Mutation_p.S2501*	p.S2706*	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Colorectal(24;0.198)		34	8502	+			2706			Pro-rich.		B0JZA6|O15026|Q7Z744|Q9Y5L9	Nonsense_Mutation	SNP	ENST00000262518.4	37	c.8117C>A	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	43	10.391616	0.99396	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	.	.	.	5.04	4.08	0.47627	.	0.168916	0.28510	N	0.015100	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3614	8.3368	0.32219	0.1776:0.6509:0.1714:0.0	.	.	.	.	X	2706;2644;2548	.	ENSP00000262518:S2706X	S	+	2	0	SRCAP	30656979	0.990000	0.36364	0.931000	0.37212	0.052000	0.14988	2.704000	0.47118	1.331000	0.45412	-0.293000	0.09583	TCA		0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		12	117	1	0	1.08611e-07	0.000978	1.19776e-07	12	117				
ZNF319	57567	broad.mit.edu	37	16	58031380	58031380	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:58031380C>T	ENST00000299237.2	-	2	1412	c.790G>A	c.(790-792)Gag>Aag	p.E264K	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						AAGGTCTTCTCGCAGACTGCG	0.607																																							uc002emx.1		NA																	0					0						c.(790-792)GAG>AAG		zinc finger protein 319							80.0	76.0	77.0					16																	58031380		2198	4300	6498	SO:0001583	missense	57567				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:58031380C>T	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.790G>A	16.37:g.58031380C>T	ENSP00000299237:p.Glu264Lys						p.E264K	NM_020807	NP_065858	Q9P2F9	ZN319_HUMAN			2	1413	-			264			C2H2-type 6.		Q52LH8	Missense_Mutation	SNP	ENST00000299237.2	37	c.790G>A	CCDS32462.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370262	0.61624	.	.	ENSG00000166188	ENST00000299237	T	0.01005	5.45	5.13	5.13	0.70059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.057191	0.64402	U	0.000002	T	0.02267	0.0070	L	0.37466	1.105	0.58432	D	0.999999	D	0.58970	0.984	P	0.52823	0.71	T	0.65611	-0.6126	10	0.72032	D	0.01	-23.346	17.579	0.87960	0.0:1.0:0.0:0.0	.	264	Q9P2F9	ZN319_HUMAN	K	264	ENSP00000299237:E264K	ENSP00000299237:E264K	E	-	1	0	ZNF319	56588881	1.000000	0.71417	1.000000	0.80357	0.138000	0.21146	7.811000	0.86092	2.399000	0.81585	0.655000	0.94253	GAG		0.607	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1			19	64	0	0	0	0.007413	0	19	64				
SLC9A5	6553	broad.mit.edu	37	16	67304692	67304692	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:67304692G>A	ENST00000299798.11	+	16	2335	c.2270G>A	c.(2269-2271)tGt>tAt	p.C757Y		NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	757					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		TCCCCAACCTGTGCAGAAAAG	0.557																																							uc002esm.2		NA																	0				ovary(1)|pancreas(1)	2						c.(2269-2271)TGT>TAT		solute carrier family 9 (sodium/hydrogen							42.0	45.0	44.0					16																	67304692		1979	4153	6132	SO:0001583	missense	6553				regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr16:67304692G>A		CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.2270G>A	16.37:g.67304692G>A	ENSP00000299798:p.Cys757Tyr					SLC9A5_uc010cee.2_Missense_Mutation_p.C462Y|SLC9A5_uc010vji.1_Missense_Mutation_p.C261Y	p.C757Y	NM_004594	NP_004585	Q14940	SL9A5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)	16	2333	+		Ovarian(137;0.0563)	757					A5PKY7|Q9Y626	Missense_Mutation	SNP	ENST00000299798.11	37	c.2270G>A	CCDS42178.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.440187	0.25900	.	.	ENSG00000135740	ENST00000299798;ENST00000360183	T	0.56103	0.48	5.29	5.29	0.74685	.	0.461649	0.23828	N	0.044165	T	0.58395	0.2119	L	0.29908	0.895	0.34569	D	0.713185	D;P	0.76494	0.999;0.697	D;B	0.67548	0.952;0.135	T	0.68693	-0.5341	10	0.59425	D	0.04	.	11.7325	0.51746	0.0:0.0:0.7191:0.2809	.	270;757	F8WDV9;Q14940	.;SL9A5_HUMAN	Y	757;270	ENSP00000299798:C757Y	ENSP00000299798:C757Y	C	+	2	0	SLC9A5	65862193	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.968000	0.49224	2.480000	0.83734	0.561000	0.74099	TGT		0.557	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421386.1			13	15	0	0	0	0.001855	0	13	15				
PHLPP2	23035	broad.mit.edu	37	16	71683003	71683003	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:71683003G>A	ENST00000568954.1	-	19	4140	c.3762C>T	c.(3760-3762)ctC>ctT	p.L1254L	PHLPP2_ENST00000540628.1_Intron|PHLPP2_ENST00000360429.3_Intron|PHLPP2_ENST00000356272.3_Silent_p.L1254L|PHLPP2_ENST00000567016.1_Silent_p.L1289L|PHLPP2_ENST00000393524.2_Silent_p.L1187L			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	1254					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						CCACTTCAATGAGGTTCAGGC	0.527																																							uc002fax.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(3760-3762)CTC>CTT		PH domain and leucine rich repeat protein							106.0	102.0	104.0					16																	71683003		2198	4300	6498	SO:0001819	synonymous_variant	23035					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity	g.chr16:71683003G>A	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.3762C>T	16.37:g.71683003G>A						PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Silent_p.L1187L	p.L1254L	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN			18	3768	-			1254					A1L374|Q9NV17|Q9Y2E3	Silent	SNP	ENST00000568954.1	37	c.3762C>T	CCDS32479.1																																																																																				0.527	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020		50	73	0	0	0	0.00361	0	50	73				
PHLPP2	23035	broad.mit.edu	37	16	71683851	71683851	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:71683851G>A	ENST00000568954.1	-	19	3292	c.2914C>T	c.(2914-2916)Ccg>Tcg	p.P972S	PHLPP2_ENST00000540628.1_Intron|PHLPP2_ENST00000360429.3_Intron|PHLPP2_ENST00000356272.3_Missense_Mutation_p.P972S|PHLPP2_ENST00000567016.1_Missense_Mutation_p.P1007S|PHLPP2_ENST00000393524.2_Missense_Mutation_p.P905S			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	972	PP2C-like.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						ATGGTCAGCGGAGTGGAAGAT	0.498																																							uc002fax.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2914-2916)CCG>TCG		PH domain and leucine rich repeat protein							113.0	99.0	104.0					16																	71683851		2198	4300	6498	SO:0001583	missense	23035					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity	g.chr16:71683851G>A	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.2914C>T	16.37:g.71683851G>A	ENSP00000457991:p.Pro972Ser					PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Missense_Mutation_p.P905S	p.P972S	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN			18	2920	-			972			PP2C-like.		A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	ENST00000568954.1	37	c.2914C>T	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	G	5.196	0.221737	0.09863	.	.	ENSG00000040199	ENST00000356272;ENST00000393524	T;T	0.16324	2.35;2.35	5.62	2.57	0.30868	Protein phosphatase 2C-like (4);	0.344220	0.33753	N	0.004589	T	0.08447	0.0210	N	0.20881	0.62	0.36216	D	0.851693	B;B	0.02656	0.0;0.0	B;B	0.08055	0.002;0.003	T	0.29150	-1.0021	10	0.09843	T	0.71	-1.7254	5.323	0.15891	0.1485:0.0:0.5379:0.3136	.	905;972	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	S	972;905	ENSP00000348611:P972S;ENSP00000377159:P905S	ENSP00000348611:P972S	P	-	1	0	PHLPP2	70241352	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.800000	0.38833	0.285000	0.22329	0.650000	0.86243	CCG		0.498	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020		42	61	0	0	0	0.006999	0	42	61				
ADAMTS18	170692	broad.mit.edu	37	16	77465424	77465424	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr16:77465424C>A	ENST00000282849.5	-	3	681	c.263G>T	c.(262-264)cGa>cTa	p.R88L	ADAMTS18_ENST00000567121.1_5'UTR|RP11-449J10.1_ENST00000564358.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	88					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CTGCGCCGATCGCTTTTTCCT	0.483																																							uc002ffc.3		NA																	0				large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(262-264)CGA>CTA		ADAM metallopeptidase with thrombospondin type 1							188.0	193.0	191.0					16																	77465424		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77465424C>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.263G>T	16.37:g.77465424C>A	ENSP00000282849:p.Arg88Leu					ADAMTS18_uc002ffe.1_5'UTR|ADAMTS18_uc010vni.1_RNA	p.R88L	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN			3	682	-			88					Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.263G>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103111	0.76983	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.06608	3.28;3.28	5.66	5.66	0.87406	Peptidase M12B, propeptide (1);	0.065863	0.56097	D	0.000031	T	0.31451	0.0797	M	0.86097	2.795	0.48395	D	0.999645	D	0.89917	1.0	D	0.87578	0.998	T	0.04065	-1.0980	10	0.87932	D	0	.	18.8013	0.92018	0.0:1.0:0.0:0.0	.	88	Q8TE60	ATS18_HUMAN	L	88	ENSP00000282849:R88L;ENSP00000392540:R88L	ENSP00000282849:R88L	R	-	2	0	ADAMTS18	76022925	1.000000	0.71417	0.970000	0.41538	0.922000	0.55478	4.002000	0.57053	2.682000	0.91365	0.586000	0.80456	CGA		0.483	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			111	172	1	0	1.93806e-58	0.00361	2.39467e-58	111	172				
OR1D2	4991	broad.mit.edu	37	17	2995820	2995820	+	Silent	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:2995820G>C	ENST00000331459.1	-	1	470	c.471C>G	c.(469-471)ctC>ctG	p.L157L		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	157					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						GGGTGTGTATGAGGCCATAGA	0.507																																							uc010vrb.1		NA																	0				ovary(1)	1						c.(469-471)CTC>CTG		olfactory receptor, family 1, subfamily D,							86.0	86.0	86.0					17																	2995820		2203	4300	6503	SO:0001819	synonymous_variant	4991				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity	g.chr17:2995820G>C	U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.471C>G	17.37:g.2995820G>C							p.L157L	NM_002548	NP_002539	P34982	OR1D2_HUMAN			1	471	-			157			Helical; Name=4; (Potential).		Q6IFL8|Q96RA4|Q9UM78	Silent	SNP	ENST00000331459.1	37	c.471C>G	CCDS11019.1																																																																																				0.507	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207207.1	NM_002548		3	87	0	0	0	0.004672	0	3	87				
NLRP1	22861	broad.mit.edu	37	17	5436173	5436173	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:5436173C>T	ENST00000572272.1	-	11	3264	c.3265G>A	c.(3265-3267)Gag>Aag	p.E1089K	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000269280.4_Missense_Mutation_p.E1089K|NLRP1_ENST00000577119.1_Missense_Mutation_p.E1059K|NLRP1_ENST00000354411.3_Missense_Mutation_p.E1059K|NLRP1_ENST00000345221.3_Missense_Mutation_p.E1089K|NLRP1_ENST00000262467.5_Missense_Mutation_p.E1093K			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1089					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TCAACTACCTCAGTAGCCACA	0.612																																							uc002gci.2		NA																	0				lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9						c.(3265-3267)GAG>AAG		NLR family, pyrin domain containing 1 isoform 1							63.0	60.0	61.0					17																	5436173		2203	4300	6503	SO:0001583	missense	22861				defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding	g.chr17:5436173C>T	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3265G>A	17.37:g.5436173C>T	ENSP00000460475:p.Glu1089Lys					NLRP1_uc002gcg.1_Missense_Mutation_p.E1093K|NLRP1_uc002gck.2_Missense_Mutation_p.E1089K|NLRP1_uc002gcj.2_Missense_Mutation_p.E1059K|NLRP1_uc002gcl.2_Missense_Mutation_p.E1059K|NLRP1_uc002gch.3_Missense_Mutation_p.E1089K|NLRP1_uc010clh.2_Missense_Mutation_p.E1089K	p.E1089K	NM_033004	NP_127497	Q9C000	NALP1_HUMAN			11	3820	-		Colorectal(1115;3.48e-05)	1089					E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	c.3265G>A	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951819	0.53186	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.74106	-0.81;-0.81;-0.66;-0.63;-0.66	3.93	-0.399	0.12415	.	0.196767	0.25178	N	0.032548	T	0.79094	0.4388	M	0.69358	2.11	0.09310	N	1	D;D;D;D;D;D	0.76494	0.998;0.998;0.998;0.998;0.999;0.998	D;D;D;D;D;D	0.75484	0.981;0.981;0.981;0.969;0.986;0.958	T	0.66913	-0.5803	10	0.72032	D	0.01	.	3.8751	0.09053	0.0:0.4801:0.1972:0.3227	.	355;1059;1059;1089;1089;1093	F5H042;Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;.;NALP1_HUMAN;.;.	K	1093;1093;1089;1059;1089;355	ENSP00000442029:E1093K;ENSP00000262467:E1093K;ENSP00000269280:E1089K;ENSP00000346390:E1059K;ENSP00000324366:E1089K	ENSP00000262467:E1093K	E	-	1	0	NLRP1	5376897	0.000000	0.05858	0.001000	0.08648	0.659000	0.38960	-0.243000	0.08915	0.001000	0.14605	0.549000	0.68633	GAG		0.612	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004		9	45	0	0	0	0.004482	0	9	45				
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	A	rs11540652		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:7577538C>A	ENST00000269305.4	-	7	932	c.743G>T	c.(742-744)cGg>cTg	p.R248L	TP53_ENST00000455263.2_Missense_Mutation_p.R248L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R248L|TP53_ENST00000445888.2_Missense_Mutation_p.R248L|TP53_ENST00000413465.2_Missense_Mutation_p.R248L|TP53_ENST00000359597.4_Missense_Mutation_p.R248L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM920675	TP53	M	rs11540652	c.(742-744)CGG>CTG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							152.0	112.0	126.0					17																	7577538		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577538C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>T	17.37:g.7577538C>A	ENSP00000269305:p.Arg248Leu	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.R248L|TP53_uc002gih.2_Missense_Mutation_p.R248L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116L|TP53_uc010cng.1_Missense_Mutation_p.R116L|TP53_uc002gii.1_Missense_Mutation_p.R116L|TP53_uc010cnh.1_Missense_Mutation_p.R248L|TP53_uc010cni.1_Missense_Mutation_p.R248L|TP53_uc002gij.2_Missense_Mutation_p.R248L|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155L|TP53_uc002gio.2_Missense_Mutation_p.R116L	p.R248L	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	937	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	248		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.743G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488044	0.84854	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99866	-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	M	0.92507	3.315	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.91635	0.996;0.996;0.999;0.996;0.996;0.997	D	0.96931	0.9681	10	0.87932	D	0	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	L	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248L;ENSP00000352610:R248L;ENSP00000269305:R248L;ENSP00000398846:R248L;ENSP00000391127:R248L;ENSP00000391478:R248L;ENSP00000425104:R116L;ENSP00000423862:R155L	ENSP00000269305:R248L	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		7	77	1	0	1.12685e-05	0.004482	1.20333e-05	7	77				
DNAH9	1770	broad.mit.edu	37	17	11532805	11532805	+	Silent	SNP	T	T	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:11532805T>C	ENST00000262442.4	+	7	1490	c.1422T>C	c.(1420-1422)gcT>gcC	p.A474A	DNAH9_ENST00000454412.2_Silent_p.A474A	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	474	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAGGGAATGCTCTGAGTCAGC	0.498																																							uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(1420-1422)GCT>GCC		dynein, axonemal, heavy chain 9 isoform 2							114.0	109.0	111.0					17																	11532805		2203	4300	6503	SO:0001819	synonymous_variant	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11532805T>C	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1422T>C	17.37:g.11532805T>C							p.A474A	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	7	1490	+		Breast(5;0.0122)|all_epithelial(5;0.131)	474			Stem (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	c.1422T>C	CCDS11160.1																																																																																				0.498	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		42	79	0	0	0	0.002852	0	42	79				
SUPT6H	6830	broad.mit.edu	37	17	27031336	27031336	+	IGR	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:27031336G>C	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'UTR|PROCA1_ENST00000439862.3_Missense_Mutation_p.F117L|PROCA1_ENST00000581289.1_Intron|PROCA1_ENST00000301039.2_Missense_Mutation_p.F115L	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AGCCATACCGGAATCGCTCCA	0.637																																							uc002hcb.3		NA																	0				ovary(1)	1						c.(349-351)TTC>TTG		protein interacting with cyclin A1							96.0	103.0	101.0					17																	27031336		2203	4300	6503	SO:0001628	intergenic_variant	147011				lipid catabolic process		calcium ion binding|phospholipase A2 activity	g.chr17:27031336G>C	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27031336G>C						PROCA1_uc010crv.2_Missense_Mutation_p.F43L|PROCA1_uc002hca.1_Missense_Mutation_p.F115L	p.F117L	NM_152465	NP_689678	Q8NCQ7	PRCA1_HUMAN			4	554	-	Lung NSC(42;0.00431)		143					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	c.351C>G	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649712	0.29336	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329;ENST00000422880	T;T	0.04706	3.57;3.57	5.29	4.32	0.51571	Phospholipase A2 (2);	0.205348	0.42964	D	0.000635	T	0.04182	0.0116	L	0.44542	1.39	0.25390	N	0.988539	P;B;B	0.34977	0.478;0.004;0.004	B;B;B	0.27608	0.081;0.004;0.004	T	0.40270	-0.9572	10	0.25751	T	0.34	-9.3176	8.3028	0.32025	0.1801:0.0:0.8199:0.0	.	143;117;115	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	L	115;117;143;117	ENSP00000301039:F115L;ENSP00000411400:F117L	ENSP00000301039:F115L	F	-	3	2	PROCA1	24055463	1.000000	0.71417	0.941000	0.38009	0.010000	0.07245	1.446000	0.35090	1.202000	0.43218	-0.150000	0.13652	TTC		0.637	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		55	142	0	0	0	0.00361	0	55	142				
EFCAB5	374786	broad.mit.edu	37	17	28435021	28435021	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:28435021G>A	ENST00000394835.3	+	23	4683	c.4491G>A	c.(4489-4491)ggG>ggA	p.G1497G	RP11-1148O4.2_ENST00000582938.1_RNA|EFCAB5_ENST00000394832.2_Silent_p.G969G|EFCAB5_ENST00000320856.5_Silent_p.G1373G	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	1497							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						AAATGCCAGGGGAAGGTTTGC	0.343																																							uc002het.2		NA																	0				ovary(1)|skin(1)	2						c.(4489-4491)GGG>GGA		EF-hand calcium binding domain 5 isoform a							149.0	139.0	142.0					17																	28435021		1856	4098	5954	SO:0001819	synonymous_variant	374786						calcium ion binding	g.chr17:28435021G>A	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.4491G>A	17.37:g.28435021G>A						EFCAB5_uc010cse.2_Silent_p.G1252G|EFCAB5_uc010csf.2_Silent_p.G848G	p.G1497G	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN			23	4683	+			1497					B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	ENST00000394835.3	37	c.4491G>A	CCDS11254.2																																																																																				0.343	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529		45	86	0	0	0	0.00361	0	45	86				
JUP	3728	broad.mit.edu	37	17	39912446	39912446	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:39912446G>A	ENST00000393931.3	-	13	2185	c.2067C>T	c.(2065-2067)atC>atT	p.I689I	JUP_ENST00000540235.1_Intron|JUP_ENST00000393930.1_Silent_p.I689I|JUP_ENST00000310706.5_Silent_p.I689I	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	689					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		AGGGCTCATTGATGGGAATCA	0.547																																					Colon(16;42 520 6044 17852 28530)	Colon(16;42 520 6044 17852 28530)	uc002hxq.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(2065-2067)ATC>ATT		junction plakoglobin							70.0	62.0	65.0					17																	39912446		2203	4300	6503	SO:0001819	synonymous_variant	3728				adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity	g.chr17:39912446G>A	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.2067C>T	17.37:g.39912446G>A						JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Silent_p.I689I|JUP_uc002hxs.2_Silent_p.I689I	p.I689I	NM_021991	NP_068831	P14923	PLAK_HUMAN	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)	13	2344	-		Breast(137;0.000162)	689					Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Silent	SNP	ENST00000393931.3	37	c.2067C>T	CCDS11407.1																																																																																				0.547	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257406.1			4	48	0	0	0	0.009096	0	4	48				
ABCA10	10349	broad.mit.edu	37	17	67148250	67148250	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:67148250G>A	ENST00000269081.4	-	37	5240	c.4331C>T	c.(4330-4332)cCt>cTt	p.P1444L	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1444					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					CACCTGGGTAGGTTCTTTCAT	0.383																																							uc010dfa.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(4330-4332)CCT>CTT		ATP-binding cassette, sub-family A, member 10							104.0	107.0	106.0					17																	67148250		2203	4300	6503	SO:0001583	missense	10349				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67148250G>A	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.4331C>T	17.37:g.67148250G>A	ENSP00000269081:p.Pro1444Leu					ABCA10_uc002jhz.2_5'Flank|ABCA10_uc010wqs.1_Missense_Mutation_p.P436L|ABCA10_uc010wqt.1_RNA	p.P1444L	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN			37	5210	-	Breast(10;6.95e-12)		1444					C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	c.4331C>T	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	0.044	-1.274932	0.01410	.	.	ENSG00000154263	ENST00000269081	D	0.96716	-4.1	2.94	0.852	0.18995	.	.	.	.	.	D	0.89336	0.6686	N	0.12663	0.25	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.10450	0.001;0.005	T	0.78979	-0.1990	9	0.25751	T	0.34	.	7.4661	0.27322	0.3044:0.0:0.6956:0.0	.	436;1444	B4DPV2;Q8WWZ4	.;ABCAA_HUMAN	L	1444	ENSP00000269081:P1444L	ENSP00000269081:P1444L	P	-	2	0	ABCA10	64659845	0.000000	0.05858	0.001000	0.08648	0.077000	0.17291	0.529000	0.23019	0.114000	0.18032	0.563000	0.77884	CCT		0.383	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282		4	96	0	0	0	0.009096	0	4	96				
MGAT5B	146664	broad.mit.edu	37	17	74901366	74901366	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:74901366C>T	ENST00000569840.2	+	7	1380	c.806C>T	c.(805-807)gCc>gTc	p.A269V	MGAT5B_ENST00000301618.4_Missense_Mutation_p.A269V|MGAT5B_ENST00000374998.3_3'UTR|MGAT5B_ENST00000428789.2_Missense_Mutation_p.A280V	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	269					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCGCTGGCTGCCCAGCGCCTG	0.652																																							uc002jti.2		NA																	0				ovary(2)|skin(1)	3						c.(838-840)GCC>GTC		N-acetylglucosaminyltranferase VB isoform 2							23.0	28.0	26.0					17																	74901366		2203	4298	6501	SO:0001583	missense	146664					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr17:74901366C>T	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.806C>T	17.37:g.74901366C>T	ENSP00000456037:p.Ala269Val					MGAT5B_uc002jth.2_Missense_Mutation_p.A269V	p.A280V	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN			6	942	+			269			Lumenal (Potential).		Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	ENST00000569840.2	37	c.839C>T	CCDS59299.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.240146	0.22711	.	.	ENSG00000167889	ENST00000374998;ENST00000301618;ENST00000428789	T;T	0.48522	0.81;0.81	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.35364	0.0929	L	0.45051	1.395	0.58432	D	0.999998	P;P	0.51351	0.944;0.944	B;B	0.40825	0.341;0.341	T	0.27971	-1.0058	10	0.05959	T	0.93	-34.5949	13.1552	0.59514	0.0:0.9202:0.0:0.0797	.	280;269	Q3V5L5-2;Q3V5L5-5	.;.	V	269;269;280	ENSP00000301618:A269V;ENSP00000391227:A280V	ENSP00000301618:A269V	A	+	2	0	MGAT5B	72412961	1.000000	0.71417	0.993000	0.49108	0.202000	0.24057	5.377000	0.66184	2.416000	0.81992	0.514000	0.50259	GCC		0.652	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677		25	53	0	0	0	0.00632	0	25	53				
RPTOR	57521	broad.mit.edu	37	17	78599561	78599561	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr17:78599561C>A	ENST00000306801.3	+	2	595	c.233C>A	c.(232-234)aCc>aAc	p.T78N	RPTOR_ENST00000537330.1_5'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.T78N|RPTOR_ENST00000570891.1_Missense_Mutation_p.T78N	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	78					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GTGGTGAAGACCACGCCCTGT	0.547																																							uc002jyt.1		NA																	0				lung(4)|urinary_tract(1)|ovary(1)	6						c.(232-234)ACC>AAC		raptor isoform 1							212.0	162.0	179.0					17																	78599561		2203	4300	6503	SO:0001583	missense	57521				cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding	g.chr17:78599561C>A		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.233C>A	17.37:g.78599561C>A	ENSP00000307272:p.Thr78Asn					RPTOR_uc002jys.2_Missense_Mutation_p.T78N|RPTOR_uc010wuf.1_5'UTR|RPTOR_uc010wug.1_Missense_Mutation_p.T78N	p.T78N	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN			2	1038	+			78					B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	c.233C>A	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	C	31	5.064952	0.93898	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.51817	0.7;0.69	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000001	T	0.74283	0.3696	M	0.89904	3.07	0.80722	D	1	D;D	0.61080	0.989;0.967	D;B	0.75020	0.985;0.425	T	0.79487	-0.1783	10	0.52906	T	0.07	.	17.1491	0.86773	0.0:1.0:0.0:0.0	.	78;78	F5H7J5;Q8N122	.;RPTOR_HUMAN	N	78	ENSP00000307272:T78N;ENSP00000442479:T78N	ENSP00000307272:T78N	T	+	2	0	RPTOR	76214156	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.447000	0.80620	2.336000	0.79503	0.655000	0.94253	ACC		0.547	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761		26	81	1	0	3.73988e-18	0.00632	4.43524e-18	26	81				
DLGAP1	9229	broad.mit.edu	37	18	3879390	3879390	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr18:3879390A>T	ENST00000315677.3	-	4	1274	c.679T>A	c.(679-681)Tgc>Agc	p.C227S	DLGAP1_ENST00000581527.1_Missense_Mutation_p.C227S|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000515196.2_Missense_Mutation_p.C227S|DLGAP1_ENST00000584874.1_Missense_Mutation_p.C227S	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	227					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CGGTCGGGGCACCTGCCCATG	0.657																																							uc002kmf.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(679-681)TGC>AGC		discs large homolog-associated protein 1 isoform							72.0	77.0	75.0					18																	3879390		2203	4300	6503	SO:0001583	missense	9229				synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane		g.chr18:3879390A>T	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.679T>A	18.37:g.3879390A>T	ENSP00000316377:p.Cys227Ser					DLGAP1_uc010wyz.1_Missense_Mutation_p.C227S|DLGAP1_uc002kmk.2_Missense_Mutation_p.C227S|uc002kml.1_Intron	p.C227S	NM_004746	NP_004737	O14490	DLGP1_HUMAN			1	746	-		Colorectal(8;0.0257)	227					A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	c.679T>A	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	A	11.65	1.703135	0.30232	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.10573	2.86;2.86	5.51	5.51	0.81932	.	0.099978	0.64402	D	0.000001	T	0.09202	0.0227	L	0.29908	0.895	0.46279	D	0.998965	B;B;B	0.32467	0.167;0.372;0.123	B;B;B	0.32677	0.045;0.15;0.052	T	0.26538	-1.0100	10	0.12430	T	0.62	-22.8222	15.6239	0.76833	1.0:0.0:0.0:0.0	.	227;227;227	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	S	227	ENSP00000316377:C227S;ENSP00000445973:C227S	ENSP00000316377:C227S	C	-	1	0	DLGAP1	3869390	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.824000	0.75288	2.105000	0.64084	0.533000	0.62120	TGC		0.657	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			28	112	0	0	0	0.00632	0	28	112				
ASXL3	80816	broad.mit.edu	37	18	31323142	31323142	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr18:31323142C>T	ENST00000269197.5	+	12	3330	c.3330C>T	c.(3328-3330)ctC>ctT	p.L1110L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1110					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGGCTAAGCTCTTTGCAAAGC	0.537																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(3328-3330)CTC>CTT		additional sex combs like 3							43.0	44.0	44.0					18																	31323142		1946	4136	6082	SO:0001819	synonymous_variant	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323142C>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3330C>T	18.37:g.31323142C>T						ASXL3_uc002kxq.2_Silent_p.L817L	p.L1110L	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			12	3385	+			1110					Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	c.3330C>T	CCDS45847.1																																																																																				0.537	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			15	43	0	0	0	0.00245	0	15	43				
SETBP1	26040	broad.mit.edu	37	18	42643107	42643107	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr18:42643107G>A	ENST00000282030.5	+	6	4531	c.4235G>A	c.(4234-4236)cGg>cAg	p.R1412Q		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1412						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGCGAAGTGCGGAAGATGTGC	0.532									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(4234-4236)CGG>CAG		SET binding protein 1 isoform a							58.0	54.0	55.0					18																	42643107		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42643107G>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4235G>A	18.37:g.42643107G>A	ENSP00000282030:p.Arg1412Gln						p.R1412Q	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	6	4531	+			1412					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.4235G>A	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	35	5.502006	0.96371	.	.	ENSG00000152217	ENST00000282030	D	0.83335	-1.71	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	D	0.87366	0.6159	L	0.32530	0.975	0.41520	D	0.988397	D	0.89917	1.0	D	0.81914	0.995	D	0.88725	0.3232	10	0.72032	D	0.01	.	18.8667	0.92294	0.0:0.0:1.0:0.0	.	1412	Q9Y6X0	SETBP_HUMAN	Q	1412	ENSP00000282030:R1412Q	ENSP00000282030:R1412Q	R	+	2	0	SETBP1	40897105	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.044000	0.93805	2.615000	0.88500	0.563000	0.77884	CGG		0.532	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		7	28	0	0	0	0.001984	0	7	28				
PHLPP1	23239	broad.mit.edu	37	18	60645807	60645807	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr18:60645807G>A	ENST00000262719.5	+	17	4531	c.4297G>A	c.(4297-4299)Gag>Aag	p.E1433K	PHLPP1_ENST00000400316.4_Missense_Mutation_p.E921K			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1433					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CTGCTGCTGCGAGCTCAGCGC	0.622																																							uc002lis.2		NA																	0					0						c.(2761-2763)GAG>AAG		PH domain and leucine rich repeat protein							23.0	27.0	26.0					18																	60645807		2114	4230	6344	SO:0001583	missense	23239				apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity	g.chr18:60645807G>A	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4297G>A	18.37:g.60645807G>A	ENSP00000262719:p.Glu1433Lys						p.E921K	NM_194449	NP_919431	O60346	PHLP1_HUMAN			18	2939	+			1433					A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	37	c.2761G>A	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824840	0.71143	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.28069	1.81;1.63	4.61	4.61	0.57282	.	.	.	.	.	T	0.36413	0.0966	L	0.47190	1.495	0.35927	D	0.832202	D	0.62365	0.991	P	0.48089	0.566	T	0.44498	-0.9324	9	0.37606	T	0.19	-10.8221	17.6551	0.88175	0.0:0.0:1.0:0.0	.	1433	O60346	PHLP1_HUMAN	K	921;1433	ENSP00000383170:E921K;ENSP00000262719:E1433K	ENSP00000262719:E1433K	E	+	1	0	PHLPP1	58796787	1.000000	0.71417	0.998000	0.56505	0.830000	0.47004	4.837000	0.62796	2.392000	0.81423	0.655000	0.94253	GAG		0.622	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449		6	25	0	0	0	0.001984	0	6	25				
FDX1L	112812	broad.mit.edu	37	19	10421236	10421236	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr19:10421236C>T	ENST00000393708.3	-	5	496	c.478G>A	c.(478-480)Gaa>Aaa	p.E160K	ZGLP1_ENST00000403903.3_5'Flank|ZGLP1_ENST00000403352.1_5'Flank|FDX1L_ENST00000494368.1_Missense_Mutation_p.E25K|FDX1L_ENST00000492239.1_5'UTR|FDX1L_ENST00000541276.1_3'UTR|CTD-2369P2.10_ENST00000452032.2_3'UTR	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like	160	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			TCCGCTCCTTCCAGCTCCGGT	0.592																																							uc002mny.1		NA																	0				skin(1)	1						c.(478-480)GAA>AAA		ferredoxin 1-like precursor							121.0	98.0	106.0					19																	10421236		2203	4300	6503	SO:0001583	missense	112812				electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding	g.chr19:10421236C>T	AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299	ENST00000393708.3:c.478G>A	19.37:g.10421236C>T	ENSP00000377311:p.Glu160Lys					ZGLP1_uc002mnw.3_5'Flank|FDX1L_uc002mnx.1_RNA	p.E160K	NM_001031734	NP_001026904	Q6P4F2	ADXL_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)		5	497	-			160			2Fe-2S ferredoxin-type.		Q8N8B8	Missense_Mutation	SNP	ENST00000393708.3	37	c.478G>A	CCDS32905.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697072	0.88830	.	.	ENSG00000167807	ENST00000393708	.	.	.	4.16	4.16	0.48862	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (2);	0.263710	0.36778	N	0.002420	T	0.61110	0.2321	M	0.88181	2.935	0.44927	D	0.99794	P	0.42785	0.79	B	0.40066	0.318	T	0.68580	-0.5371	9	0.66056	D	0.02	-1.3937	7.9273	0.29883	0.0:0.8849:0.0:0.1151	.	160	Q6P4F2	ADXL_HUMAN	K	160	.	ENSP00000377311:E160K	E	-	1	0	FDX1L	10282236	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	5.141000	0.64814	1.848000	0.53677	0.462000	0.41574	GAA		0.592	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280567.2			11	26	0	0	0	0.000978	0	11	26				
TYK2	7297	broad.mit.edu	37	19	10476195	10476195	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr19:10476195C>T	ENST00000525621.1	-	7	1490	c.1009G>A	c.(1009-1011)Gag>Aag	p.E337K	TYK2_ENST00000264818.6_Missense_Mutation_p.E337K|TYK2_ENST00000524462.1_Missense_Mutation_p.E152K|TYK2_ENST00000529370.1_Missense_Mutation_p.E337K	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	337	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TTGCTCACCTCCTCCTTGTTC	0.637																																							uc002moc.3		NA																	0				lung(5)|large_intestine(2)|ovary(1)|breast(1)	9						c.(1009-1011)GAG>AAG		tyrosine kinase 2							76.0	95.0	88.0					19																	10476195		2203	4299	6502	SO:0001583	missense	7297				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity	g.chr19:10476195C>T		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1009G>A	19.37:g.10476195C>T	ENSP00000431885:p.Glu337Lys					TYK2_uc010dxe.2_Missense_Mutation_p.E152K|TYK2_uc002mod.2_Missense_Mutation_p.E337K	p.E337K	NM_003331	NP_003322	P29597	TYK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)		7	1387	-			337			FERM.		Q6QB10|Q96CH0	Missense_Mutation	SNP	ENST00000525621.1	37	c.1009G>A	CCDS12236.1	.	.	.	.	.	.	.	.	.	.	C	1.158	-0.644602	0.03531	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370	T;T;T;T	0.80653	-0.89;-0.88;-0.88;-1.4	0.225	0.225	0.15325	FERM domain (1);	1.817510	0.03154	N	0.168417	T	0.59878	0.2226	N	0.08118	0	0.29457	N	0.858038	B;B	0.11235	0.003;0.004	B;B	0.12156	0.002;0.007	T	0.56396	-0.7986	9	0.05959	T	0.93	.	.	.	.	.	337;337	E9PPF2;P29597	.;TYK2_HUMAN	K	152;337;337;84;337	ENSP00000433203:E152K;ENSP00000431885:E337K;ENSP00000264818:E337K;ENSP00000432728:E337K	ENSP00000264818:E337K	E	-	1	0	TYK2	10337195	0.063000	0.20901	0.953000	0.39169	0.333000	0.28666	-0.717000	0.04986	0.300000	0.22699	0.305000	0.20034	GAG		0.637	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1			5	104	0	0	0	0.000602	0	5	104				
KEAP1	9817	broad.mit.edu	37	19	10600365	10600365	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr19:10600365C>A	ENST00000171111.5	-	4	2037	c.1490G>T	c.(1489-1491)tGg>tTg	p.W497L	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.W497L	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	497					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GATCATTCGCCACTCGTTCCT	0.592																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1489-1491)TGG>TTG		kelch-like ECH-associated protein 1							104.0	84.0	91.0					19																	10600365		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600365C>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1490G>T	19.37:g.10600365C>A	ENSP00000171111:p.Trp497Leu					KEAP1_uc002mop.1_Missense_Mutation_p.W215L|KEAP1_uc002mor.1_Missense_Mutation_p.W497L	p.W497L	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1646	-			497			Kelch 4.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1490G>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	32	5.186618	0.94885	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.96940	-4.18;-4.18	5.79	5.79	0.91817	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99111	0.9694	H	0.99565	4.63	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.98897	1.0775	10	0.87932	D	0	.	17.5827	0.87973	0.0:1.0:0.0:0.0	.	497	Q14145	KEAP1_HUMAN	L	497	ENSP00000171111:W497L;ENSP00000377245:W497L	ENSP00000171111:W497L	W	-	2	0	KEAP1	10461365	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.386000	0.66238	2.752000	0.94435	0.558000	0.71614	TGG		0.592	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		44	26	1	0	3.21987e-24	0.00361	3.87699e-24	44	26				
SLC7A10	56301	broad.mit.edu	37	19	33703454	33703454	+	Silent	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr19:33703454G>T	ENST00000253188.4	-	4	746	c.600C>A	c.(598-600)ctC>ctA	p.L200L		NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	200					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					CGCCGATGATGAGGGACAAGG	0.652																																							uc002num.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(598-600)CTC>CTA		solute carrier family 7, member 10							55.0	58.0	57.0					19																	33703454		2203	4300	6503	SO:0001819	synonymous_variant	56301				blood coagulation|cellular nitrogen compound metabolic process|ion transport|leukocyte migration	integral to plasma membrane	L-serine transmembrane transporter activity	g.chr19:33703454G>T	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.600C>A	19.37:g.33703454G>T						SLC7A10_uc002nul.2_5'Flank|SLC7A10_uc010xrq.1_Silent_p.L173L	p.L200L	NM_019849	NP_062823	Q9NS82	AAA1_HUMAN			4	747	-	Esophageal squamous(110;0.137)		200					B2RE84	Silent	SNP	ENST00000253188.4	37	c.600C>A	CCDS12431.1																																																																																				0.652	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849		8	39	1	0	1.06961e-07	0.00308	1.18511e-07	8	39				
ZFP36	7538	broad.mit.edu	37	19	39898488	39898488	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr19:39898488G>T	ENST00000248673.3	+	2	188	c.130G>T	c.(130-132)Gac>Tac	p.D44Y	ZFP36_ENST00000594045.1_3'UTR|MIR4530_ENST00000581459.1_RNA|ZFP36_ENST00000597629.1_Missense_Mutation_p.D50Y	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	44					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GAGCCCCTCCGACTCCAGCCC	0.726																																					NSCLC(67;1164 1324 12056 21056 30097)	NSCLC(67;1164 1324 12056 21056 30097)	uc002olh.1		NA																	0				pancreas(1)	1						c.(130-132)GAC>TAC		zinc finger protein 36, C3H type, homolog							26.0	31.0	29.0					19																	39898488		2199	4292	6491	SO:0001583	missense	7538				positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	AU-rich element binding|DNA binding|mRNA binding|protein binding|single-stranded RNA binding|zinc ion binding	g.chr19:39898488G>T	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.130G>T	19.37:g.39898488G>T	ENSP00000248673:p.Asp44Tyr					ZFP36_uc010egn.1_5'UTR	p.D44Y	NM_003407	NP_003398	P26651	TTP_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)		2	188	+	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		44					B2RA54	Missense_Mutation	SNP	ENST00000248673.3	37	c.130G>T		.	.	.	.	.	.	.	.	.	.	G	11.60	1.687000	0.29962	.	.	ENSG00000128016	ENST00000248673	T	0.17854	2.25	3.7	3.7	0.42460	.	1.488430	0.04559	N	0.391360	T	0.12050	0.0293	N	0.19112	0.55	0.09310	N	1	P	0.44776	0.843	B	0.36989	0.238	T	0.14924	-1.0455	10	0.62326	D	0.03	-6.5965	6.9533	0.24558	0.1255:0.0:0.8745:0.0	.	44	P26651	TTP_HUMAN	Y	44	ENSP00000248673:D44Y	ENSP00000248673:D44Y	D	+	1	0	ZFP36	44590328	0.001000	0.12720	0.030000	0.17652	0.214000	0.24535	0.981000	0.29526	1.914000	0.55421	0.549000	0.68633	GAC		0.726	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				26	54	1	0	1.42536e-11	0.004656	1.65706e-11	26	54				
ACPT	93650	broad.mit.edu	37	19	51298186	51298186	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr19:51298186C>G	ENST00000270593.1	+	10	1130	c.1130C>G	c.(1129-1131)tCc>tGc	p.S377C	ACPT_ENST00000270594.3_Missense_Mutation_p.S284C|CTD-2568A17.8_ENST00000594114.1_RNA	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	377						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CATGGGGTCTCCTGCCATGGC	0.706																																							uc002pta.1		NA																	0					0						c.(1129-1131)TCC>TGC		testicular acid phosphatase precursor							42.0	53.0	49.0					19																	51298186		2203	4299	6502	SO:0001583	missense	93650					integral to membrane	acid phosphatase activity	g.chr19:51298186C>G	AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.1130C>G	19.37:g.51298186C>G	ENSP00000270593:p.Ser377Cys						p.S377C	NM_033068	NP_149059	Q9BZG2	PPAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)	10	1130	+		all_neural(266;0.057)	377			Extracellular (Potential).		C0H3P7|Q9BZG3|Q9BZG4	Missense_Mutation	SNP	ENST00000270593.1	37	c.1130C>G	CCDS12802.1	.	.	.	.	.	.	.	.	.	.	c	16.39	3.111232	0.56398	.	.	ENSG00000142513	ENST00000270593;ENST00000270594	T;T	0.76709	2.28;-1.04	4.56	2.34	0.29019	.	0.324515	0.25055	N	0.033497	T	0.52141	0.1716	N	0.08118	0	0.22866	N	0.998631	P	0.36438	0.553	B	0.30251	0.113	T	0.50233	-0.8852	10	0.87932	D	0	-11.1588	6.3406	0.21321	0.0:0.7093:0.1869:0.1038	.	377	Q9BZG2	PPAT_HUMAN	C	377;284	ENSP00000270593:S377C;ENSP00000270594:S284C	ENSP00000270593:S377C	S	+	2	0	ACPT	55989998	0.708000	0.27876	0.998000	0.56505	0.735000	0.41995	1.049000	0.30392	0.449000	0.26747	0.561000	0.74099	TCC		0.706	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464434.1	NM_033068		8	115	0	0	0	0.006214	0	8	115				
CRIM1	51232	broad.mit.edu	37	2	36764555	36764555	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:36764555A>G	ENST00000280527.2	+	14	2856	c.2489A>G	c.(2488-2490)gAg>gGg	p.E830G	AC007401.2_ENST00000406220.1_Intron	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	830	VWFC 6. {ECO:0000255|PROSITE- ProRule:PRU00220}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GCCGACGAGGAGCGGTGGGAC	0.582																																							uc002rpd.2		NA																	0				ovary(2)|skin(1)	3						c.(2488-2490)GAG>GGG		cysteine-rich motor neuron 1 precursor							102.0	93.0	96.0					2																	36764555		2203	4300	6503	SO:0001583	missense	51232				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity	g.chr2:36764555A>G	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.2489A>G	2.37:g.36764555A>G	ENSP00000280527:p.Glu830Gly						p.E830G	NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN			14	2528	+		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)	830			Extracellular (Potential).|VWFC 6.		Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	c.2489A>G	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	a	25.9	4.683889	0.88639	.	.	ENSG00000150938	ENST00000280527	T	0.69306	-0.39	5.12	5.12	0.69794	von Willebrand factor, type C (3);	0.055999	0.64402	D	0.000002	T	0.81527	0.4841	M	0.78637	2.42	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.84281	0.0494	10	0.87932	D	0	-21.0495	14.2058	0.65732	1.0:0.0:0.0:0.0	.	830	Q9NZV1	CRIM1_HUMAN	G	830	ENSP00000280527:E830G	ENSP00000280527:E830G	E	+	2	0	CRIM1	36618059	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.030000	0.88816	1.940000	0.56252	0.510000	0.49958	GAG		0.582	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441		3	77	0	0	0	0.004672	0	3	77				
RGPD4	285190	broad.mit.edu	37	2	108496510	108496510	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:108496510G>A	ENST00000408999.3	+	21	5088	c.5011G>A	c.(5011-5013)Ggc>Agc	p.G1671S	RGPD4_ENST00000354986.4_Missense_Mutation_p.G1671S	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1671					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TCACTTAAACGGCCTGCTTCG	0.448																																							uc010ywk.1		NA																	0				skin(2)	2						c.(5011-5013)GGC>AGC		RANBP2-like and GRIP domain containing 4							175.0	145.0	154.0					2																	108496510		692	1591	2283	SO:0001583	missense	285190				intracellular transport		binding	g.chr2:108496510G>A	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.5011G>A	2.37:g.108496510G>A	ENSP00000386810:p.Gly1671Ser					RGPD4_uc002tdu.2_Missense_Mutation_p.G858S|RGPD4_uc010ywl.1_RNA	p.G1671S	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN			21	5093	+			1671					B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	c.5011G>A	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	g	12.35	1.911654	0.33721	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.37235	1.21;1.22	0.854	0.854	0.19007	.	.	.	.	.	T	0.17195	0.0413	N	0.04508	-0.205	0.23886	N	0.996569	B	0.20550	0.046	B	0.06405	0.002	T	0.23190	-1.0195	9	0.87932	D	0	-11.6551	9.0795	0.36542	0.0:0.0:1.0:0.0	.	1671	Q7Z3J3	RGPD4_HUMAN	S	1671;1671;1038	ENSP00000347081:G1671S;ENSP00000386810:G1671S	ENSP00000347081:G1671S	G	+	1	0	RGPD4	107862942	1.000000	0.71417	0.974000	0.42286	0.780000	0.44128	1.969000	0.40510	0.767000	0.33267	0.398000	0.26397	GGC		0.448	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		26	187	0	0	0	0.007291	0	26	187				
SULT1C3	442038	broad.mit.edu	37	2	108863691	108863691	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:108863691A>G	ENST00000329106.2	+	1	41	c.41A>G	c.(40-42)aAg>aGg	p.K14R	SULT1C3_ENST00000376700.1_Missense_Mutation_p.K14R	NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	14					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						ATGGAAAAAAAGCCAGAACTG	0.358																																							uc010ywo.1		NA																	0				skin(1)	1						c.(40-42)AAG>AGG		sulfotransferase family, cytosolic, 1C, member							94.0	101.0	98.0					2																	108863691		2203	4300	6503	SO:0001583	missense	442038					cytoplasm	alcohol sulfotransferase activity	g.chr2:108863691A>G	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.41A>G	2.37:g.108863691A>G	ENSP00000333310:p.Lys14Arg						p.K14R	NM_001008743	NP_001008743	Q6IMI6	ST1C3_HUMAN			1	41	+			14					Q6IMI5	Missense_Mutation	SNP	ENST00000329106.2	37	c.41A>G	CCDS33267.1	.	.	.	.	.	.	.	.	.	.	A	1.348	-0.592087	0.03799	.	.	ENSG00000196228	ENST00000329106;ENST00000376700	T;T	0.01474	4.85;4.85	3.87	1.4	0.22301	.	2.738930	0.01754	N	0.030086	T	0.01320	0.0043	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46091	-0.9216	10	0.15952	T	0.53	.	5.8055	0.18438	0.7737:0.0:0.2263:0.0	.	14	Q6IMI6	ST1C3_HUMAN	R	14	ENSP00000333310:K14R;ENSP00000365890:K14R	ENSP00000333310:K14R	K	+	2	0	SULT1C3	108230123	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	1.546000	0.36179	0.168000	0.19655	-1.080000	0.02220	AAG		0.358	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743		3	77	0	0	0	0.004672	0	3	77				
RGPD8	727851	broad.mit.edu	37	2	113190969	113190969	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:113190969G>A	ENST00000302558.3	-	1	253	c.62C>T	c.(61-63)tCg>tTg	p.S21L	RGPD8_ENST00000330575.5_Missense_Mutation_p.S21L|RGPD8_ENST00000409750.1_Intron	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	21					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						CTGTCGAGGCGACGGGGTGAG	0.751																																							uc002ths.1		NA																	0					0						c.(61-63)TCG>TTG		RANBP2-like and GRIP domain containing 5 isoform							27.0	44.0	39.0					2																	113190969		692	1591	2283	SO:0001583	missense	84220				intracellular transport	cytoplasm	binding	g.chr2:113190969G>A	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.62C>T	2.37:g.113190969G>A	ENSP00000306637:p.Ser21Leu					RGPD8_uc010fkk.1_Intron|RGPD5_uc010yxm.1_Missense_Mutation_p.S21L	p.S21L	NM_005054	NP_005045	Q99666	RGPD5_HUMAN			1	139	-			21					Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	c.62C>T	CCDS46394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.83|12.83	2.054763|2.054763	0.36277|0.36277	.|.	.|.	ENSG00000169629|ENSG00000169629	ENST00000496537|ENST00000302558;ENST00000330575	.|T;T	.|0.58358	.|0.94;0.34	1.79|1.79	1.79|1.79	0.24919|0.24919	.|Tetratricopeptide-like helical (1);	.|.	.|.	.|.	.|.	T|T	0.40322|0.40322	0.1112|0.1112	L|L	0.57536|0.57536	1.79|1.79	0.29743|0.29743	N|N	0.836923|0.836923	.|P;P	.|0.51147	.|0.733;0.942	.|B;B	.|0.31495	.|0.131;0.102	T|T	0.48768|0.48768	-0.9006|-0.9006	6|9	0.87932|0.87932	D|D	0|0	-6.2806|-6.2806	9.1699|9.1699	0.37074|0.37074	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|21;21	.|F8W705;O14715	.|.;RGPD8_HUMAN	C|L	15|21	.|ENSP00000306637:S21L;ENSP00000327486:S21L	ENSP00000430052:R15C|ENSP00000306637:S21L	R|S	-|-	1|2	0|0	RGPD8|RGPD8	112907440|112907440	0.998000|0.998000	0.40836|0.40836	0.301000|0.301000	0.25044|0.25044	0.045000|0.045000	0.14185|0.14185	5.035000|5.035000	0.64158|0.64158	0.973000|0.973000	0.38340|0.38340	0.162000|0.162000	0.16502|0.16502	CGC|TCG		0.751	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279		12	46	0	0	0	0.00245	0	12	46				
DPP10	57628	broad.mit.edu	37	2	116594317	116594317	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:116594317C>A	ENST00000410059.1	+	24	2657	c.2177C>A	c.(2176-2178)gCt>gAt	p.A726D	DPP10_ENST00000310323.8_Missense_Mutation_p.A719D|DPP10_ENST00000393147.2_Missense_Mutation_p.A730D|DPP10_ENST00000409163.1_Missense_Mutation_p.A676D	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	726						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CATGGAACTGCTGACAGTAAG	0.358																																							uc002tla.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(2176-2178)GCT>GAT		dipeptidyl peptidase 10 isoform long							93.0	111.0	105.0					2																	116594317		2203	4300	6503	SO:0001583	missense	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116594317C>A	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2177C>A	2.37:g.116594317C>A	ENSP00000386565:p.Ala726Asp					DPP10_uc002tlb.1_Missense_Mutation_p.A676D|DPP10_uc002tlc.1_Missense_Mutation_p.A722D|DPP10_uc002tle.2_Missense_Mutation_p.A730D|DPP10_uc002tlf.1_Missense_Mutation_p.A719D	p.A726D	NM_020868	NP_065919	Q8N608	DPP10_HUMAN			24	2634	+			726			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	c.2177C>A	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160420	0.78226	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.08	5.08	0.68730	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.114036	0.56097	D	0.000021	T	0.63438	0.2511	M	0.88241	2.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	T	0.70981	-0.4724	10	0.87932	D	0	-12.0806	17.6447	0.88145	0.0:1.0:0.0:0.0	.	719;730;722;726	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	D	726;676;730;719	ENSP00000386565:A726D;ENSP00000387038:A676D;ENSP00000376855:A730D;ENSP00000309066:A719D	ENSP00000309066:A719D	A	+	2	0	DPP10	116310787	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	6.323000	0.72891	2.633000	0.89246	0.561000	0.74099	GCT		0.358	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		10	113	1	0	1.76689e-08	0.006214	1.97624e-08	10	113				
UGGT1	56886	broad.mit.edu	37	2	128873862	128873862	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:128873862A>T	ENST00000259253.6	+	8	864	c.817A>T	c.(817-819)Att>Ttt	p.I273F	UGGT1_ENST00000375990.3_Missense_Mutation_p.I249F	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	273					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CACCACAGTGATTGGTGAAAA	0.328																																							uc002tps.2		NA																	0				ovary(1)	1						c.(817-819)ATT>TTT		UDP-glucose ceramide glucosyltransferase-like 1							155.0	151.0	152.0					2																	128873862		2203	4300	6503	SO:0001583	missense	56886				'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding	g.chr2:128873862A>T	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.817A>T	2.37:g.128873862A>T	ENSP00000259253:p.Ile273Phe					UGGT1_uc010fme.1_Missense_Mutation_p.I148F|UGGT1_uc002tpr.2_Missense_Mutation_p.I249F	p.I273F	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN			8	995	+			273					Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	c.817A>T	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	A	16.04	3.009711	0.54361	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.28454	1.61;1.61	5.18	5.18	0.71444	.	0.093881	0.64402	D	0.000001	T	0.31420	0.0796	L	0.49640	1.575	0.80722	D	1	P;B	0.44044	0.825;0.432	B;B	0.44163	0.443;0.137	T	0.07009	-1.0795	10	0.49607	T	0.09	.	9.5516	0.39313	0.9208:0.0:0.0792:0.0	.	249;273	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	F	249;273	ENSP00000365158:I249F;ENSP00000259253:I273F	ENSP00000259253:I273F	I	+	1	0	UGGT1	128590332	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.581000	0.74045	1.944000	0.56390	0.533000	0.62120	ATT		0.328	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120		4	70	0	0	0	0.009096	0	4	70				
POTEF	728378	broad.mit.edu	37	2	130831864	130831864	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:130831864C>A	ENST00000409914.2	-	17	3580	c.3181G>T	c.(3181-3183)Gag>Tag	p.E1061*	POTEF_ENST00000357462.5_Nonsense_Mutation_p.E1061*	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	1061	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						TCATCATACTCCTGCTTGCTG	0.537																																							uc010fmh.2		NA																	0				skin(3)|ovary(2)	5						c.(3181-3183)GAG>TAG		prostate, ovary, testis expressed protein on							22.0	23.0	23.0					2																	130831864		2133	4231	6364	SO:0001587	stop_gained	728378					cell cortex	ATP binding	g.chr2:130831864C>A	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.3181G>T	2.37:g.130831864C>A	ENSP00000386786:p.Glu1061*						p.E1061*	NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN			17	3581	-			1061			Actin-like.		A6NC34	Nonsense_Mutation	SNP	ENST00000409914.2	37	c.3181G>T	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	38	6.971577	0.97971	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	.	.	.	X	1061	.	ENSP00000350052:E1061X	E	-	1	0	POTEF	130548334	1.000000	0.71417	0.613000	0.29037	0.617000	0.37484	5.286000	0.65639	0.119000	0.18210	0.121000	0.15741	GAG		0.537	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		96	70	1	0	6.29576e-42	0.00361	7.73854e-42	96	70				
TUBA3E	112714	broad.mit.edu	37	2	130951410	130951410	+	Missense_Mutation	SNP	G	G	C	rs201715610		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:130951410G>C	ENST00000312988.7	-	4	1105	c.1005C>G	c.(1003-1005)atC>atG	p.I335M		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	335					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					GCTTGGTCTTGATGGTGGCGA	0.547																																							uc002tqv.2		NA																	0				skin(1)	1						c.(1003-1005)ATC>ATG		tubulin, alpha 3e							143.0	120.0	128.0					2																	130951410		2203	4300	6503	SO:0001583	missense	112714				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr2:130951410G>C	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.1005C>G	2.37:g.130951410G>C	ENSP00000318197:p.Ile335Met						p.I335M	NM_207312	NP_997195	Q6PEY2	TBA3E_HUMAN			4	1106	-	Colorectal(110;0.1)		335						Missense_Mutation	SNP	ENST00000312988.7	37	c.1005C>G	CCDS2158.1	.	.	.	.	.	.	.	.	.	.	g	11.05	1.525522	0.27299	.	.	ENSG00000152086	ENST00000312988	D	0.83992	-1.79	2.96	2.07	0.26955	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.50627	U	0.000115	D	0.86797	0.6019	L	0.59436	1.845	0.38372	D	0.944907	P	0.41232	0.743	D	0.67231	0.95	D	0.85391	0.1125	10	0.87932	D	0	.	5.1648	0.15079	0.283:0.0:0.717:0.0	.	335	Q6PEY2	TBA3E_HUMAN	M	335	ENSP00000318197:I335M	ENSP00000318197:I335M	I	-	3	3	TUBA3E	130667880	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.474000	0.60203	0.588000	0.29660	0.455000	0.32223	ATC		0.547	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312		22	127	0	0	0	0.001882	0	22	127				
RIF1	55183	broad.mit.edu	37	2	152331516	152331516	+	Silent	SNP	T	T	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:152331516T>C	ENST00000243326.5	+	35	7833	c.7350T>C	c.(7348-7350)tgT>tgC	p.C2450C	RIF1_ENST00000430328.2_Silent_p.C2424C|RIF1_ENST00000428287.2_Silent_p.C2424C|RIF1_ENST00000444746.2_Silent_p.C2450C|RIF1_ENST00000453091.2_Silent_p.C2424C			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AACTAAGTTGTATGGCAAACT	0.343																																							uc002txm.2		NA																	0				ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15						c.(7348-7350)TGT>TGC		RAP1 interacting factor 1							63.0	64.0	63.0					2																	152331516		2203	4300	6503	SO:0001819	synonymous_variant	55183				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding	g.chr2:152331516T>C	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.7350T>C	2.37:g.152331516T>C						RIF1_uc002txl.2_Silent_p.C2424C|RIF1_uc002txn.2_Silent_p.C2424C|RIF1_uc002txo.2_Silent_p.C2424C|RIF1_uc002txp.2_RNA|uc010fnw.1_5'Flank	p.C2450C	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0429)	36	7480	+			2450			Interaction with condensed chromosomes in telophase.		A0AVS0|Q9NS16	Silent	SNP	ENST00000243326.5	37	c.7350T>C	CCDS2194.1																																																																																				0.343	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			19	22	0	0	0	0.008871	0	19	22				
BAZ2B	29994	broad.mit.edu	37	2	160204009	160204009	+	Silent	SNP	A	A	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:160204009A>G	ENST00000392783.2	-	31	5937	c.5442T>C	c.(5440-5442)agT>agC	p.S1814S	BAZ2B_ENST00000343439.5_Silent_p.S1714S|BAZ2B_ENST00000392782.1_Silent_p.S1778S|BAZ2B_ENST00000355831.2_Silent_p.S1780S	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1814					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TCACTTGCAAACTTGCTGATG	0.343																																							uc002uao.2		NA																	0				ovary(3)|skin(1)	4						c.(5440-5442)AGT>AGC		bromodomain adjacent to zinc finger domain, 2B							189.0	169.0	175.0					2																	160204009		1867	4107	5974	SO:0001819	synonymous_variant	29994				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr2:160204009A>G	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.5442T>C	2.37:g.160204009A>G						BAZ2B_uc002uap.2_Silent_p.S1778S	p.S1814S	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN			31	5794	-			1814					D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Silent	SNP	ENST00000392783.2	37	c.5442T>C	CCDS2209.2																																																																																				0.343	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			13	63	0	0	0	0.001855	0	13	63				
NYAP2	57624	broad.mit.edu	37	2	226273717	226273717	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:226273717G>C	ENST00000272907.6	+	2	534	c.121G>C	c.(121-123)Gat>Cat	p.D41H	NYAP2_ENST00000409269.2_Missense_Mutation_p.D41H	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	41					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GAATGCGTCAGATATTGCTCG	0.418																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(121-123)GAT>CAT		hypothetical protein LOC57624							120.0	108.0	112.0					2																	226273717		1889	4116	6005	SO:0001583	missense	57624							g.chr2:226273717G>C	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.121G>C	2.37:g.226273717G>C	ENSP00000272907:p.Asp41His					KIAA1486_uc010fxa.1_Missense_Mutation_p.D36H	p.D41H	NM_020864	NP_065915	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	2	296	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	41					A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	c.121G>C	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293184	0.80914	.	.	ENSG00000144460	ENST00000272907;ENST00000409269	T	0.52754	0.65	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000004	T	0.70710	0.3255	M	0.71036	2.16	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71474	-0.4582	10	0.87932	D	0	-31.9308	20.3167	0.98654	0.0:0.0:1.0:0.0	.	41;41	Q9P242-2;Q9P242	.;K1486_HUMAN	H	41	ENSP00000272907:D41H	ENSP00000272907:D41H	D	+	1	0	KIAA1486	225981961	1.000000	0.71417	0.996000	0.52242	0.818000	0.46254	8.781000	0.91805	2.809000	0.96659	0.557000	0.71058	GAT		0.418	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		18	82	0	0	0	0.006122	0	18	82				
NYAP2	57624	broad.mit.edu	37	2	226273727	226273727	+	Missense_Mutation	SNP	G	G	A	rs562957302		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:226273727G>A	ENST00000272907.6	+	2	544	c.131G>A	c.(130-132)cGa>cAa	p.R44Q	NYAP2_ENST00000409269.2_Missense_Mutation_p.R44Q	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	44					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GATATTGCTCGAGAGAATGAT	0.408													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19382	0.0		0.0	False		,,,				2504	0.0						uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(130-132)CGA>CAA		hypothetical protein LOC57624							100.0	90.0	93.0					2																	226273727		1881	4109	5990	SO:0001583	missense	57624							g.chr2:226273727G>A	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.131G>A	2.37:g.226273727G>A	ENSP00000272907:p.Arg44Gln					KIAA1486_uc010fxa.1_Missense_Mutation_p.R39Q	p.R44Q	NM_020864	NP_065915	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	2	306	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	44					A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	c.131G>A	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	31	5.081421	0.94050	.	.	ENSG00000144460	ENST00000272907;ENST00000409269	T	0.51071	0.72	5.92	5.92	0.95590	.	0.000000	0.52532	D	0.000079	T	0.70657	0.3249	M	0.71036	2.16	0.46927	D	0.999255	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.99	T	0.71108	-0.4688	10	0.72032	D	0.01	-14.9567	20.3167	0.98654	0.0:0.0:1.0:0.0	.	44;44	Q9P242-2;Q9P242	.;K1486_HUMAN	Q	44	ENSP00000272907:R44Q	ENSP00000272907:R44Q	R	+	2	0	KIAA1486	225981971	1.000000	0.71417	0.996000	0.52242	0.805000	0.45488	8.584000	0.90798	2.809000	0.96659	0.557000	0.71058	CGA		0.408	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		16	70	0	0	0	0.004007	0	16	70				
PAX1	5075	broad.mit.edu	37	20	21687351	21687351	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr20:21687351G>T	ENST00000398485.2	+	2	616	c.562G>T	c.(562-564)Gac>Tac	p.D188Y	PAX1_ENST00000444366.2_Missense_Mutation_p.D164Y|PAX1_ENST00000460221.1_Intron	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	188	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CAAGCAAGGAGACCCTGGCAT	0.637																																							uc002wsj.2		NA																	0				upper_aerodigestive_tract(1)|kidney(1)	2						c.(562-564)GAC>TAC		paired box 1							58.0	61.0	60.0					20																	21687351		2203	4300	6503	SO:0001583	missense	5075				regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding	g.chr20:21687351G>T		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.562G>T	20.37:g.21687351G>T	ENSP00000381499:p.Asp188Tyr					PAX1_uc010zsl.1_Missense_Mutation_p.D188Y|PAX1_uc010zsm.1_Missense_Mutation_p.D164Y	p.D188Y	NM_006192	NP_006183	P15863	PAX1_HUMAN			2	616	+			188			Paired.		B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	c.562G>T	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	G	15.56	2.869493	0.51588	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.99376	-5.79;-5.79	5.63	4.68	0.58851	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99211	0.9726	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	D	0.99461	1.0943	10	0.87932	D	0	.	14.1833	0.65588	0.0724:0.0:0.9276:0.0	.	164;94;188	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	Y	188;164	ENSP00000381499:D188Y;ENSP00000410355:D164Y	ENSP00000381499:D188Y	D	+	1	0	PAX1	21635351	1.000000	0.71417	0.944000	0.38274	0.108000	0.19459	7.779000	0.85648	1.382000	0.46385	-0.136000	0.14681	GAC		0.637	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3			16	79	1	0	0.000308642	0.003163	0.000323731	16	79				
RALGAPB	57148	broad.mit.edu	37	20	37195789	37195789	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr20:37195789G>A	ENST00000262879.6	+	26	4152	c.3868G>A	c.(3868-3870)Gat>Aat	p.D1290N	RALGAPB_ENST00000397040.1_Missense_Mutation_p.D1290N|RALGAPB_ENST00000397042.3_Missense_Mutation_p.D1287N|RALGAPB_ENST00000397038.1_Missense_Mutation_p.D1069N			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1290	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TTCAAATATGGATCTTATGCC	0.378																																							uc002xiw.2		NA																	0				pancreas(1)|skin(1)	2						c.(3868-3870)GAT>AAT		Ral GTPase activating protein, beta subunit							156.0	143.0	148.0					20																	37195789		2203	4300	6503	SO:0001583	missense	57148				activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:37195789G>A	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.3868G>A	20.37:g.37195789G>A	ENSP00000262879:p.Asp1290Asn					RALGAPB_uc002xix.2_Missense_Mutation_p.D1287N|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Missense_Mutation_p.D1069N	p.D1290N	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN			26	4125	+			1290			Rap-GAP.		A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	ENST00000262879.6	37	c.3868G>A	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049444	0.75846	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	.	.	.	5.42	5.42	0.78866	Rap/ran-GAP (1);	0.096195	0.64402	D	0.000001	T	0.57125	0.2032	L	0.43152	1.355	0.80722	D	1	P;P	0.44139	0.827;0.827	P;P	0.46543	0.52;0.52	T	0.49881	-0.8892	9	0.13853	T	0.58	.	19.2299	0.93834	0.0:0.0:1.0:0.0	.	1287;1290	A2A2E9;Q86X10	.;RLGPB_HUMAN	N	1290;1287;1069;1290;1119	.	ENSP00000262879:D1290N	D	+	1	0	RALGAPB	36629203	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.474000	0.97718	2.553000	0.86117	0.591000	0.81541	GAT		0.378	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336		32	50	0	0	0	0.002445	0	32	50				
KCNB1	3745	broad.mit.edu	37	20	47990416	47990416	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr20:47990416C>G	ENST00000371741.4	-	2	1847	c.1681G>C	c.(1681-1683)Gaa>Caa	p.E561Q		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	561					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	CTCTCCATTTCAAGTTCTTCC	0.493																																							uc002xur.1		NA																	0				pancreas(1)|skin(1)	2						c.(1681-1683)GAA>CAA		potassium voltage-gated channel, Shab-related							128.0	111.0	117.0					20																	47990416		2203	4300	6503	SO:0001583	missense	3745				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr20:47990416C>G	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1681G>C	20.37:g.47990416C>G	ENSP00000360806:p.Glu561Gln					KCNB1_uc002xus.1_Missense_Mutation_p.E561Q	p.E561Q	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		2	1845	-			561			Cytoplasmic (Potential).		Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	c.1681G>C	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878909	0.72294	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.39229	1.09	6.07	6.07	0.98685	.	1.151280	0.06201	N	0.683284	T	0.70193	0.3196	M	0.69823	2.125	0.80722	D	1	D	0.67145	0.996	D	0.71184	0.972	T	0.59085	-0.7520	10	0.52906	T	0.07	.	20.2543	0.98414	0.0:1.0:0.0:0.0	.	561	Q14721	KCNB1_HUMAN	Q	561;516	ENSP00000360806:E561Q	ENSP00000360806:E561Q	E	-	1	0	KCNB1	47423823	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.999000	0.70665	2.884000	0.98904	0.655000	0.94253	GAA		0.493	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975		9	125	0	0	0	0.006214	0	9	125				
DPM1	8813	broad.mit.edu	37	20	49576335	49576335	+	5'Flank	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr20:49576335C>T	ENST00000371588.5	-	0	0				DPM1_ENST00000371582.4_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.S319L|DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000466152.1_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						TGTGGCTCCTCAGCCACTGAT	0.587																																							uc002xvy.1		NA																	0				skin(2)|ovary(1)	3						c.(955-957)TCA>TTA		molybdenum cofactor synthesis 3							79.0	81.0	81.0					20																	49576335		2203	4300	6503	SO:0001631	upstream_gene_variant	27304				enzyme active site formation via L-cysteine persulfide|Mo-molybdopterin cofactor biosynthetic process|tRNA thio-modification|tRNA wobble uridine modification|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|nucleotidyltransferase activity|protein binding|thiosulfate sulfurtransferase activity|URM1 activating enzyme activity	g.chr20:49576335C>T	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49576335C>T	Exception_encountered					DPM1_uc002xvw.1_5'Flank|DPM1_uc002xvx.1_5'Flank	p.S319L	NM_014484	NP_055299	O95396	MOCS3_HUMAN			1	973	+			319					O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	c.956C>T	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.704790	0.48412	.	.	ENSG00000124217	ENST00000244051	T	0.72835	-0.69	4.89	4.89	0.63831	Molybdenum cofactor biosynthesis, MoeB (1);	0.196869	0.44483	D	0.000450	T	0.62405	0.2425	L	0.50333	1.59	0.44309	D	0.997182	P	0.39376	0.67	B	0.36719	0.231	T	0.62310	-0.6881	9	.	.	.	-3.735	11.6932	0.51527	0.0:0.9191:0.0:0.0809	.	319	O95396	MOCS3_HUMAN	L	319	ENSP00000244051:S319L	.	S	+	2	0	MOCS3	49009742	1.000000	0.71417	0.229000	0.23960	0.885000	0.51271	7.188000	0.77739	2.539000	0.85634	0.561000	0.74099	TCA		0.587	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859		18	102	0	0	0	0.007413	0	18	102				
CASS4	57091	broad.mit.edu	37	20	55033749	55033749	+	Silent	SNP	G	G	A	rs374797932		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr20:55033749G>A	ENST00000360314.3	+	7	2532	c.2307G>A	c.(2305-2307)gcG>gcA	p.A769A	AL121914.1_ENST00000390795.2_RNA|CASS4_ENST00000371336.3_Silent_p.A769A|CASS4_ENST00000434344.1_Silent_p.A332A	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	769					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						ACCTCCAGGCGGAGGCTGAGA	0.627																																							uc002xxp.2		NA																	0				ovary(2)|skin(1)	3						c.(2305-2307)GCG>GCA		HEF-like protein isoform a		G	,,,	0,4404		0,0,2202	52.0	39.0	44.0		2145,996,2307,2307	-11.6	0.0	20		44	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CASS4	NM_001164114.1,NM_001164115.1,NM_001164116.1,NM_020356.3	,,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,,	715/733,332/350,769/787,769/787	55033749	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	57091				cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity	g.chr20:55033749G>A	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.2307G>A	20.37:g.55033749G>A						CASS4_uc002xxr.2_Silent_p.A769A|CASS4_uc010zze.1_Silent_p.A715A|CASS4_uc010gio.2_Silent_p.A332A	p.A769A	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN			7	2532	+			769					E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Silent	SNP	ENST00000360314.3	37	c.2307G>A	CCDS33492.1																																																																																				0.627	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		15	16	0	0	0	0.00499	0	15	16				
ZBP1	81030	broad.mit.edu	37	20	56186808	56186808	+	Silent	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr20:56186808G>T	ENST00000371173.3	-	6	1026	c.849C>A	c.(847-849)gcC>gcA	p.A283A	ZBP1_ENST00000340462.4_Silent_p.A260A|ZBP1_ENST00000395822.3_Silent_p.A208A|ZBP1_ENST00000343535.4_Silent_p.A283A	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	283					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			GGGGGATGTGGGCAGGGCCCT	0.642																																							uc002xyo.2		NA																	0				ovary(2)	2						c.(847-849)GCC>GCA		Z-DNA binding protein 1 isoform a							19.0	23.0	22.0					20																	56186808		2203	4300	6503	SO:0001819	synonymous_variant	81030					cytoplasm|nucleus	double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding	g.chr20:56186808G>T	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.849C>A	20.37:g.56186808G>T						ZBP1_uc010gjm.2_Silent_p.A282A|ZBP1_uc002xyp.2_Silent_p.A208A	p.A283A	NM_030776	NP_110403	Q9H171	ZBP1_HUMAN	BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)		6	1130	-	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		283					A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Silent	SNP	ENST00000371173.3	37	c.849C>A	CCDS13461.1																																																																																				0.642	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776		17	15	1	0	5.03518e-11	0.007413	5.7966e-11	17	15				
TMPRSS15	5651	broad.mit.edu	37	21	19770546	19770546	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr21:19770546G>A	ENST00000284885.3	-	2	279	c.246C>T	c.(244-246)ttC>ttT	p.F82F		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	82	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CAAGAACTTTGAAATCCACTG	0.383																																							uc002ykw.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(244-246)TTC>TTT		enterokinase precursor							76.0	79.0	78.0					21																	19770546		2203	4299	6502	SO:0001819	synonymous_variant	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19770546G>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.246C>T	21.37:g.19770546G>A							p.F82F	NM_002772	NP_002763	P98073	ENTK_HUMAN			2	277	-			82			Extracellular (Potential).|SEA.		Q2NKL7	Silent	SNP	ENST00000284885.3	37	c.246C>T	CCDS13571.1																																																																																				0.383	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		23	20	0	0	0	0.002299	0	23	20				
SYNJ1	8867	broad.mit.edu	37	21	34072413	34072413	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr21:34072413C>T	ENST00000322229.7	-	3	213	c.214G>A	c.(214-216)Gat>Aat	p.D72N	SYNJ1_ENST00000382499.2_Missense_Mutation_p.D111N|SYNJ1_ENST00000433931.2_Missense_Mutation_p.D111N|SYNJ1_ENST00000357345.3_Missense_Mutation_p.D72N|SYNJ1_ENST00000382491.3_Missense_Mutation_p.D72N			O43426	SYNJ1_HUMAN	synaptojanin 1	72					cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.D72H(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						AACATAGTATCACCTGCAAAA	0.343																																							uc002yqh.2		NA																	1	Substitution - Missense(1)		cervix(1)	ovary(4)|skin(1)	5						c.(331-333)GAT>AAT		synaptojanin 1 isoform a							62.0	66.0	65.0					21																	34072413		2202	4300	6502	SO:0001583	missense	8867						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding	g.chr21:34072413C>T	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.214G>A	21.37:g.34072413C>T	ENSP00000322234:p.Asp72Asn					SYNJ1_uc011ads.1_Missense_Mutation_p.D72N|SYNJ1_uc002yqf.2_Missense_Mutation_p.D72N|SYNJ1_uc002yqg.2_Missense_Mutation_p.D72N|SYNJ1_uc002yqi.2_Missense_Mutation_p.D111N	p.D111N	NM_003895	NP_003886	O43426	SYNJ1_HUMAN			4	331	-			72					O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	c.331G>A	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.726241	0.89298	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236;ENST00000456084	D;D;D;D;D;D	0.93763	-2.4;-3.27;-3.28;-2.48;-2.46;-2.25	5.6	5.6	0.85130	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94788	0.8317	L	0.37850	1.14	0.80722	D	1	D;P;D;P;D	0.89917	0.999;0.771;1.0;0.877;0.999	D;P;D;P;D	0.74674	0.984;0.449;0.983;0.627;0.964	D	0.93446	0.6798	10	0.31617	T	0.26	.	19.6209	0.95654	0.0:1.0:0.0:0.0	.	72;111;72;72;72	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	N	72;72;111;111;72;72;72	ENSP00000371931:D72N;ENSP00000349903:D72N;ENSP00000371939:D111N;ENSP00000409667:D111N;ENSP00000322234:D72N;ENSP00000413649:D72N	ENSP00000322234:D72N	D	-	1	0	SYNJ1	32994284	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.375000	0.79646	2.646000	0.89796	0.585000	0.79938	GAT		0.343	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				13	41	0	0	0	0.001855	0	13	41				
SON	6651	broad.mit.edu	37	21	34922804	34922804	+	Missense_Mutation	SNP	C	C	T	rs201446136	byFrequency	TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr21:34922804C>T	ENST00000356577.4	+	3	1742	c.1267C>T	c.(1267-1269)Cca>Tca	p.P423S	SON_ENST00000381679.4_Missense_Mutation_p.P423S|SON_ENST00000290239.6_Missense_Mutation_p.P423S|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.P423S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	423					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCTTTCTACCCCAGTGCCTGA	0.652													C|||	2	0.000399361	0.0	0.0	5008	,	,		18430	0.0		0.002	False		,,,				2504	0.0						uc002yse.1		NA																	0				ovary(4)|skin(2)	6						c.(1267-1269)CCA>TCA		SON DNA-binding protein isoform F		C	SER/PRO,SER/PRO	0,4406		0,0,2203	40.0	44.0	43.0		1267,1267	3.6	1.0	21		43	3,8593		0,3,4295	yes	missense,missense	SON	NM_032195.1,NM_138927.1	74,74	0,3,6498	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging,probably-damaging	423/2304,423/2427	34922804	3,12999	2203	4298	6501	SO:0001583	missense	6651				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding	g.chr21:34922804C>T	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1267C>T	21.37:g.34922804C>T	ENSP00000348984:p.Pro423Ser					SON_uc002ysb.1_Missense_Mutation_p.P423S|SON_uc002ysc.2_Missense_Mutation_p.P423S|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	p.P423S	NM_138927	NP_620305	P18583	SON_HUMAN			3	1316	+			423					D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	c.1267C>T	CCDS13629.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.68	2.010597	0.35511	0.0	3.49E-4	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.12147	2.87;2.95;2.94;2.71	5.44	3.6	0.41247	.	0.239020	0.30219	N	0.010126	T	0.11024	0.0269	L	0.29908	0.895	0.27339	N	0.956563	B;P;B	0.34615	0.33;0.459;0.157	B;B;B	0.34824	0.093;0.19;0.069	T	0.13710	-1.0499	10	0.72032	D	0.01	.	10.8006	0.46487	0.0:0.8335:0.0:0.1665	.	423;423;423	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	S	423	ENSP00000348984:P423S;ENSP00000290239:P423S;ENSP00000300278:P423S;ENSP00000371095:P423S	ENSP00000290239:P423S	P	+	1	0	SON	33844674	0.779000	0.28652	1.000000	0.80357	0.997000	0.91878	2.446000	0.44908	1.438000	0.47492	0.491000	0.48974	CCA		0.652	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		16	72	0	0	0	0.003163	0	16	72				
EWSR1	2130	broad.mit.edu	37	22	29695251	29695251	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr22:29695251G>C	ENST00000397938.2	+	15	1927	c.1608G>C	c.(1606-1608)tgG>tgC	p.W536C	EWSR1_ENST00000332050.6_Missense_Mutation_p.W463C|EWSR1_ENST00000332035.6_Missense_Mutation_p.W480C|EWSR1_ENST00000406548.1_Missense_Mutation_p.W535C|EWSR1_ENST00000331029.7_Missense_Mutation_p.W498C|EWSR1_ENST00000414183.2_Missense_Mutation_p.W541C	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	536					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ACTTCGCCTGGAGAACAGAGT	0.517			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																		uc003aet.2		NA		Dom	yes		22	22q12	2130	T	Ewing sarcoma breakpoint region 1 (EWS)			"""L, M"""	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1		Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma	EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	0				bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						c.(1606-1608)TGG>TGC		Ewing sarcoma breakpoint region 1 isoform 2							165.0	156.0	159.0					22																	29695251		2203	4300	6503	SO:0001583	missense	2130				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding	g.chr22:29695251G>C		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1608G>C	22.37:g.29695251G>C	ENSP00000381031:p.Trp536Cys					EWSR1_uc003aev.2_Missense_Mutation_p.W541C|EWSR1_uc003aew.2_Missense_Mutation_p.W480C|EWSR1_uc003aex.2_Missense_Mutation_p.W535C|EWSR1_uc003aey.2_Missense_Mutation_p.W331C|EWSR1_uc003aez.2_Missense_Mutation_p.W197C	p.W536C	NM_005243	NP_005234	Q01844	EWS_HUMAN			15	1936	+			536			RanBP2-type.		B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	37	c.1608G>C	CCDS13851.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.276405|4.276405	0.80580|0.80580	.|.	.|.	ENSG00000182944|ENSG00000182944	ENST00000360091|ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035	.|T;T;T;T;T;T	.|0.58210	.|0.35;0.35;0.35;0.35;0.35;0.35	5.36|5.36	5.36|5.36	0.76844|0.76844	.|Zinc finger, RanBP2-type (4);	.|0.000000	.|0.85682	.|U	.|0.000000	T|T	0.76314|0.76314	0.3970|0.3970	M|M	0.82923|0.82923	2.615|2.615	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.87578	.|0.998;0.998;0.998;0.998;0.998	T|T	0.79962|0.79962	-0.1582|-0.1582	5|10	.|0.87932	.|D	.|0	.|.	19.0744|19.0744	0.93154|0.93154	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|480;535;480;541;536	.|Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844	.|.;.;.;.;EWS_HUMAN	Q|C	205|463;536;535;498;541;480	.|ENSP00000330896:W463C;ENSP00000381031:W536C;ENSP00000385726:W535C;ENSP00000330516:W498C;ENSP00000400142:W541C;ENSP00000331699:W480C	.|ENSP00000330516:W498C	E|W	+|+	1|3	0|0	EWSR1|EWSR1	28025251|28025251	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	9.423000|9.423000	0.97461|0.97461	2.515000|2.515000	0.84797|0.84797	0.462000|0.462000	0.41574|0.41574	GAG|TGG		0.517	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243		19	126	0	0	0	0.001523	0	19	126				
APOL5	80831	broad.mit.edu	37	22	36123141	36123141	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr22:36123141G>A	ENST00000249044.2	+	3	1026	c.1026G>A	c.(1024-1026)cgG>cgA	p.R342R		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	342					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						AGCTGGACCGGCTCACCCAGC	0.627																																							uc003aof.2		NA																	0					0						c.(1024-1026)CGG>CGA		apolipoprotein L5							24.0	26.0	26.0					22																	36123141		2203	4300	6503	SO:0001819	synonymous_variant	80831				lipid metabolic process|lipid transport|lipoprotein metabolic process	cytoplasm|extracellular region	high-density lipoprotein particle binding|lipid binding|protein binding	g.chr22:36123141G>A	AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.1026G>A	22.37:g.36123141G>A							p.R342R	NM_030642	NP_085145	Q9BWW9	APOL5_HUMAN			3	1026	+			342					Q5TFL9|Q9UGW5	Silent	SNP	ENST00000249044.2	37	c.1026G>A	CCDS13920.1																																																																																				0.627	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318979.1	NM_030642		27	33	0	0	0	0.003954	0	27	33				
NPTXR	23467	broad.mit.edu	37	22	39219239	39219239	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr22:39219239T>A	ENST00000333039.2	-	4	1250	c.1127A>T	c.(1126-1128)gAc>gTc	p.D376V		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	376	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					CCAGCCATTGTCCTTCAGGCT	0.657																																					Pancreas(139;2521 3281 36965)	Pancreas(139;2521 3281 36965)	uc003awk.2		NA																	0				central_nervous_system(2)|skin(1)	3						c.(1126-1128)GAC>GTC		neuronal pentraxin receptor							67.0	53.0	58.0					22																	39219239		2203	4300	6503	SO:0001583	missense	23467					integral to membrane	metal ion binding	g.chr22:39219239T>A	AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.1127A>T	22.37:g.39219239T>A	ENSP00000327545:p.Asp376Val						p.D376V	NM_014293	NP_055108	O95502	NPTXR_HUMAN			4	1281	-	Melanoma(58;0.04)		376			Pentaxin.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000333039.2	37	c.1127A>T	CCDS33647.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555789	0.65425	.	.	ENSG00000221890	ENST00000333039	T	0.61392	0.11	4.17	4.17	0.49024	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.399236	0.27491	N	0.019123	T	0.78685	0.4322	M	0.88031	2.925	0.38738	D	0.953823	D	0.89917	1.0	D	0.91635	0.999	D	0.86052	0.1526	9	0.72032	D	0.01	-59.4131	13.6797	0.62476	0.0:0.0:0.0:1.0	.	376	O95502	NPTXR_HUMAN	V	376	ENSP00000327545:D376V	ENSP00000327545:D376V	D	-	2	0	NPTXR	37549185	1.000000	0.71417	0.996000	0.52242	0.775000	0.43874	4.779000	0.62375	1.873000	0.54277	0.460000	0.39030	GAC		0.657	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318194.2	NM_014293		9	42	0	0	0	0.004482	0	9	42				
ZNF620	253639	broad.mit.edu	37	3	40552972	40552972	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr3:40552972C>T	ENST00000314529.6	+	3	185	c.36C>T	c.(34-36)acC>acT	p.T12T	ZNF620_ENST00000418905.1_Intron	NM_175888.3	NP_787084.1	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	12	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(1)|urinary_tract(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		AACCAGTGACCTTTGAGGATG	0.512																																							uc003ckk.2		NA																	0				ovary(1)	1						c.(34-36)ACC>ACT		zinc finger protein 620							215.0	202.0	206.0					3																	40552972		2203	4300	6503	SO:0001819	synonymous_variant	253639				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:40552972C>T	AK093599	CCDS33740.1, CCDS58825.1	3p21.33	2013-01-08			ENSG00000177842	ENSG00000177842		"""Zinc fingers, C2H2-type"", ""-"""	28742	protein-coding gene	gene with protein product						12477932	Standard	NM_175888		Approved	MGC50836	uc003ckk.4	Q6ZNG0	OTTHUMG00000156044	ENST00000314529.6:c.36C>T	3.37:g.40552972C>T						ZNF620_uc003ckl.2_Intron	p.T12T	NM_175888	NP_787084	Q6ZNG0	ZN620_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)	3	185	+			12			KRAB.		Q8N223	Silent	SNP	ENST00000314529.6	37	c.36C>T	CCDS33740.1																																																																																				0.512	ZNF620-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342824.1	XM_171060		5	152	0	0	0	0.000602	0	5	152				
TMF1	7110	broad.mit.edu	37	3	69097684	69097684	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr3:69097684C>G	ENST00000398559.2	-	2	388	c.172G>C	c.(172-174)Gat>Cat	p.D58H	CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.D58H|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000597950.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	58					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		GTTGAAGTATCCCATCCTCCA	0.373																																							uc003dnn.2		NA																	0					0						c.(172-174)GAT>CAT		TATA element modulatory factor 1							71.0	69.0	70.0					3																	69097684		1854	4102	5956	SO:0001583	missense	7110				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity	g.chr3:69097684C>G		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.172G>C	3.37:g.69097684C>G	ENSP00000381567:p.Asp58His					TMF1_uc011bfx.1_Missense_Mutation_p.D58H	p.D58H	NM_007114	NP_009045	P82094	TMF1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)	2	419	-		Lung NSC(201;0.0193)|Prostate(884;0.174)	58					B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	37	c.172G>C	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414867	0.83449	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248;ENST00000438636	T;T	0.21031	2.03;2.03	5.59	5.59	0.84812	.	0.088421	0.85682	D	0.000000	T	0.44932	0.1317	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.76494	0.999;0.974	D;P	0.64144	0.922;0.789	T	0.32161	-0.9917	10	0.72032	D	0.01	-26.7135	19.597	0.95544	0.0:1.0:0.0:0.0	.	58;58	P82094-2;P82094	.;TMF1_HUMAN	H	58	ENSP00000381567:D58H;ENSP00000438706:D58H	ENSP00000348582:D58H	D	-	1	0	TMF1	69180374	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	5.472000	0.66768	2.639000	0.89480	0.655000	0.94253	GAT		0.373	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114		4	94	0	0	0	0.009096	0	4	94				
DPPA2	151871	broad.mit.edu	37	3	109031471	109031471	+	Silent	SNP	G	G	A	rs572153453	byFrequency	TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr3:109031471G>A	ENST00000478945.1	-	3	348	c.102C>T	c.(100-102)gaC>gaT	p.D34D		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	34					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCATATTTGCGTCATCTTTAA	0.413													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18068	0.0		0.0	False		,,,				2504	0.001						uc003dxo.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(100-102)GAC>GAT		developmental pluripotency associated 2							182.0	166.0	171.0					3																	109031471		2203	4300	6503	SO:0001819	synonymous_variant	151871					nucleus	nucleic acid binding	g.chr3:109031471G>A	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.102C>T	3.37:g.109031471G>A							p.D34D	NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN			3	349	-			34					Q8WVF0	Silent	SNP	ENST00000478945.1	37	c.102C>T	CCDS2956.1																																																																																				0.413	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353938.1	NM_138815		5	89	0	0	0	0.000602	0	5	89				
COPG1	22820	broad.mit.edu	37	3	128979633	128979633	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr3:128979633A>G	ENST00000314797.6	+	12	1215	c.1111A>G	c.(1111-1113)Atc>Gtc	p.I371V		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	371					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										CATGTCAGAAATCTCGGATGA	0.602																																							uc003els.2		NA																	0				ovary(3)|breast(1)	4						c.(1111-1113)ATC>GTC		coatomer protein complex, subunit gamma 1							90.0	82.0	84.0					3																	128979633		2203	4300	6503	SO:0001583	missense	22820				COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity	g.chr3:128979633A>G	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.1111A>G	3.37:g.128979633A>G	ENSP00000325002:p.Ile371Val					COPG_uc010htb.2_Missense_Mutation_p.I277V	p.I371V	NM_016128	NP_057212	Q9Y678	COPG_HUMAN			12	1211	+			371			HEAT 4.		A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	37	c.1111A>G	CCDS33851.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035791	0.54896	.	.	ENSG00000181789	ENST00000314797	T	0.25250	1.81	6.01	4.84	0.62591	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.137470	0.49916	D	0.000124	T	0.33381	0.0861	M	0.83953	2.67	0.44899	D	0.997911	B	0.09022	0.002	B	0.16722	0.016	T	0.09662	-1.0664	10	0.36615	T	0.2	-6.3271	11.7487	0.51837	0.8524:0.1476:0.0:0.0	.	371	Q9Y678	COPG_HUMAN	V	371	ENSP00000325002:I371V	ENSP00000325002:I371V	I	+	1	0	COPG	130462323	1.000000	0.71417	0.935000	0.37517	0.217000	0.24651	9.094000	0.94168	1.086000	0.41228	0.456000	0.33151	ATC		0.602	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128		5	55	0	0	0	0.000602	0	5	55				
DVL3	1857	broad.mit.edu	37	3	183885740	183885741	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr3:183885740_183885741GG>TT	ENST00000313143.3	+	13	1633_1634	c.1385_1386GG>TT	c.(1384-1386)aGG>aTT	p.R462I	EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000431765.1_Missense_Mutation_p.R445I	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	462	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			ACGGACCGGAGGGAGGCCCGCA	0.574																																							uc003fms.2		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(1384-1386)AGG>ATT		dishevelled 3																																				SO:0001583	missense	1857				canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity	g.chr3:183885740_183885741GG>TT	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	Exception_encountered	3.37:g.183885740_183885741delinsTT	ENSP00000316054:p.Arg462Ile					DVL3_uc011bqw.1_Missense_Mutation_p.R445I|DVL3_uc003fmt.2_Missense_Mutation_p.R133I|DVL3_uc003fmu.2_Missense_Mutation_p.R294I	p.R462I	NM_004423	NP_004414	Q92997	DVL3_HUMAN	Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)		13	1525_1526	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		462			DEP.		B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	DNP	ENST00000313143.3	37	c.1385_1386GG>TT	CCDS3253.1																																																																																				0.574	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423		21	57	0	0	0	0.004672	0	21	57				
VPS8	23355	broad.mit.edu	37	3	184675167	184675167	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr3:184675167G>A	ENST00000437079.3	+	37	3212	c.3041G>A	c.(3040-3042)gGt>gAt	p.G1014D	VPS8_ENST00000287546.4_Missense_Mutation_p.G1014D|VPS8_ENST00000446204.2_Missense_Mutation_p.G922D|VPS8_ENST00000436792.2_Missense_Mutation_p.G1012D	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1014							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TTTAGGGAAGGTATTCATGTA	0.318																																							uc003fpb.1		NA																	0				ovary(1)	1						c.(3034-3036)GGT>GAT		vacuolar protein sorting 8 homolog isoform b							68.0	62.0	64.0					3																	184675167		1848	4086	5934	SO:0001583	missense	23355						zinc ion binding	g.chr3:184675167G>A	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3041G>A	3.37:g.184675167G>A	ENSP00000397879:p.Gly1014Asp					VPS8_uc010hyd.1_Missense_Mutation_p.G922D|VPS8_uc010hye.1_Missense_Mutation_p.G441D	p.G1012D	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)		36	3206	+	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		1014					A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	c.3035G>A	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166539	0.38217	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.18502	2.21;2.21;2.21;2.22	5.46	5.46	0.80206	Quinonprotein alcohol dehydrogenase-like (1);	0.049125	0.85682	D	0.000000	T	0.20210	0.0486	M	0.65975	2.015	0.80722	D	1	B;P;B	0.40619	0.449;0.724;0.184	B;B;B	0.38880	0.283;0.284;0.227	T	0.04825	-1.0924	10	0.10636	T	0.68	-23.6573	16.2413	0.82409	0.0:0.0:1.0:0.0	.	1014;922;1012	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	D	1014;1014;1012;922	ENSP00000287546:G1014D;ENSP00000397879:G1014D;ENSP00000404704:G1012D;ENSP00000405483:G922D	ENSP00000287546:G1014D	G	+	2	0	VPS8	186157861	1.000000	0.71417	0.986000	0.45419	0.771000	0.43674	5.598000	0.67585	2.549000	0.85964	0.655000	0.94253	GGT		0.318	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303		6	17	0	0	0	0.00308	0	6	17				
ATP13A3	79572	broad.mit.edu	37	3	194180676	194180676	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr3:194180676C>T	ENST00000439040.1	-	5	1041	c.250G>A	c.(250-252)Gca>Aca	p.A84T	ATP13A3_ENST00000256031.4_Missense_Mutation_p.A84T			Q9H7F0	AT133_HUMAN	ATPase type 13A3	84						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		CGAATTTTTGCACAAAACCAC	0.323																																							uc003fty.3		NA																	0				ovary(1)	1						c.(250-252)GCA>ACA		ATPase type 13A3							67.0	62.0	63.0					3																	194180676		1818	4078	5896	SO:0001583	missense	79572				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:194180676C>T	AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.250G>A	3.37:g.194180676C>T	ENSP00000416508:p.Ala84Thr						p.A84T	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)	4	652	-	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	84					Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	37	c.250G>A	CCDS43187.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860370	0.71834	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000457986	T;T;T	0.22743	1.94;1.94;1.94	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.23572	0.0570	L	0.50333	1.59	0.80722	D	1	B	0.21520	0.057	B	0.26310	0.068	T	0.08146	-1.0736	10	0.11794	T	0.64	-0.0707	19.4899	0.95046	0.0:1.0:0.0:0.0	.	84	Q9H7F0	AT133_HUMAN	T	84	ENSP00000416508:A84T;ENSP00000256031:A84T;ENSP00000406234:A84T	ENSP00000256031:A84T	A	-	1	0	ATP13A3	195661965	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	6.585000	0.74062	2.615000	0.88500	0.585000	0.79938	GCA		0.323	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524		14	25	0	0	0	0.003163	0	14	25				
WDR1	9948	broad.mit.edu	37	4	10084647	10084647	+	Splice_Site	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:10084647T>A	ENST00000499869.2	-	10	1388	c.1195A>T	c.(1195-1197)Agc>Tgc	p.S399C	WDR1_ENST00000382452.2_Splice_Site_p.S399C|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000502702.1_Splice_Site_p.S259C|WDR1_ENST00000382451.2_Splice_Site_p.S259C			O75083	WDR1_HUMAN	WD repeat domain 1	399					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		TGCTCTCACCTGTAGTCCCGC	0.627																																							uc003gmf.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1195-1197)AGC>TGC		WD repeat-containing protein 1 isoform 1							47.0	54.0	52.0					4																	10084647		2097	4216	6313	SO:0001630	splice_region_variant	9948				platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding	g.chr4:10084647T>A	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1196+1A>T	4.37:g.10084647T>A						WDR1_uc003gmg.2_Missense_Mutation_p.S259C|WDR1_uc010idm.2_RNA	p.S399C	NM_017491	NP_059830	O75083	WDR1_HUMAN		STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)	10	1478	-			399			WD 7.		A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	ENST00000499869.2	37	c.1195A>T	CCDS54740.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303926	0.81136	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000502702;ENST00000439733	T;T;T;T	0.52295	0.67;0.67;1.02;1.02	5.42	5.42	0.78866	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.65491	0.2696	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.76575	0.988;0.862	T	0.67090	-0.5758	10	0.52906	T	0.07	-13.356	14.6435	0.68742	0.0:0.0:0.0:1.0	.	259;399	O75083-3;O75083	.;WDR1_HUMAN	C	399;399;259;259;234	ENSP00000427687:S399C;ENSP00000371890:S399C;ENSP00000371889:S259C;ENSP00000426725:S259C	ENSP00000371889:S259C	S	-	1	0	WDR1	9693745	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	7.438000	0.80431	2.053000	0.61076	0.379000	0.24179	AGC		0.627	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		Missense_Mutation	11	33	0	0	0	0.000978	0	11	33				
HS3ST1	9957	broad.mit.edu	37	4	11400725	11400725	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:11400725C>G	ENST00000002596.5	-	2	2079	c.905G>C	c.(904-906)aGa>aCa	p.R302T		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	302					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						GTCAAATGTTCTGCCAACAAG	0.418																																							uc003gmq.2		NA																	0				skin(1)	1						c.(904-906)AGA>ACA		heparan sulfate D-glucosaminyl							80.0	83.0	82.0					4																	11400725		2203	4300	6503	SO:0001583	missense	9957					Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity	g.chr4:11400725C>G	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.905G>C	4.37:g.11400725C>G	ENSP00000002596:p.Arg302Thr						p.R302T	NM_005114	NP_005105	O14792	HS3S1_HUMAN			2	1228	-			302					B3KUA6|Q6PEY8	Missense_Mutation	SNP	ENST00000002596.5	37	c.905G>C	CCDS3408.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499635	0.64298	.	.	ENSG00000002587	ENST00000002596	T	0.57273	0.41	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.62672	0.2447	L	0.43646	1.37	0.80722	D	1	D	0.76494	0.999	P	0.57776	0.827	T	0.63646	-0.6590	10	0.56958	D	0.05	.	18.3674	0.90396	0.0:1.0:0.0:0.0	.	302	O14792	HS3S1_HUMAN	T	302	ENSP00000002596:R302T	ENSP00000002596:R302T	R	-	2	0	HS3ST1	11009823	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	6.094000	0.71431	2.571000	0.86741	0.655000	0.94253	AGA		0.418	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114		18	72	0	0	0	0.007413	0	18	72				
CWH43	80157	broad.mit.edu	37	4	49046815	49046815	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:49046815A>G	ENST00000226432.4	+	14	1999	c.1816A>G	c.(1816-1818)Act>Gct	p.T606A	CWH43_ENST00000513409.1_Missense_Mutation_p.T579A	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	606					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						TATCGACAGCACTGATCATGA	0.358																																							uc003gyv.2		NA																	0				skin(2)|ovary(1)	3						c.(1816-1818)ACT>GCT		cell wall biogenesis 43 C-terminal homolog							181.0	167.0	172.0					4																	49046815		2203	4300	6503	SO:0001583	missense	80157				GPI anchor biosynthetic process	integral to membrane		g.chr4:49046815A>G		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1816A>G	4.37:g.49046815A>G	ENSP00000226432:p.Thr606Ala					CWH43_uc011bzl.1_Missense_Mutation_p.T579A	p.T606A	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN			14	1998	+			606					B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	c.1816A>G	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	A	10.97	1.500407	0.26861	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.29655	1.56;1.56	4.56	3.34	0.38264	Endonuclease/exonuclease/phosphatase (1);	0.120506	0.36555	N	0.002536	T	0.28366	0.0701	L	0.59436	1.845	0.31997	N	0.603811	P	0.47841	0.901	B	0.41510	0.359	T	0.37820	-0.9689	9	.	.	.	.	8.6767	0.34183	0.8237:0.0:0.0:0.1763	.	606	Q9H720	PG2IP_HUMAN	A	606;579	ENSP00000226432:T606A;ENSP00000422802:T579A	.	T	+	1	0	CWH43	48741572	1.000000	0.71417	1.000000	0.80357	0.192000	0.23643	1.928000	0.40104	0.749000	0.32854	0.459000	0.35465	ACT		0.358	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087		9	59	0	0	0	0.006214	0	9	59				
KIAA1211	57482	broad.mit.edu	37	4	57189656	57189656	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:57189656C>T	ENST00000504228.1	+	7	3406	c.3301C>T	c.(3301-3303)Cgg>Tgg	p.R1101W	KIAA1211_ENST00000264229.6_Missense_Mutation_p.R1101W|KIAA1211_ENST00000541073.1_Missense_Mutation_p.R1094W			Q6ZU35	K1211_HUMAN	KIAA1211	1101										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					AAAGGGGTTTCGGGAGCAGCA	0.522																																							uc003hbk.2		NA																	0				ovary(1)|skin(1)	2						c.(3301-3303)CGG>TGG		hypothetical protein LOC57482							71.0	80.0	77.0					4																	57189656		1948	4137	6085	SO:0001583	missense	57482							g.chr4:57189656C>T	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3301C>T	4.37:g.57189656C>T	ENSP00000423366:p.Arg1101Trp					KIAA1211_uc010iha.2_Missense_Mutation_p.R1094W	p.R1101W	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN			9	3692	+	Glioma(25;0.08)|all_neural(26;0.101)		1101					Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	c.3301C>T	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.784807	0.70222	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073	T;T;T	0.20598	2.31;2.31;2.06	5.5	3.56	0.40772	.	.	.	.	.	T	0.45074	0.1324	M	0.66939	2.045	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.51826	-0.8656	9	0.87932	D	0	-22.2918	15.9116	0.79477	0.2575:0.7425:0.0:0.0	.	1094;1101	F5H1N7;Q6ZU35	.;K1211_HUMAN	W	1101;1101;1094	ENSP00000264229:R1101W;ENSP00000423366:R1101W;ENSP00000444006:R1094W	ENSP00000264229:R1101W	R	+	1	2	KIAA1211	56884413	1.000000	0.71417	0.963000	0.40424	0.914000	0.54420	3.598000	0.54038	1.294000	0.44707	0.563000	0.77884	CGG		0.522	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722		18	25	0	0	0	0.006122	0	18	25				
HSD17B11	51170	broad.mit.edu	37	4	88312133	88312133	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:88312133C>T	ENST00000358290.4	-	1	405	c.90G>A	c.(88-90)agG>agA	p.R30R	HSD17B11_ENST00000507286.1_Silent_p.R30R	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	30					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		CTGATTTTCTCCTCTTAGGAA	0.463																																							uc003hqp.2		NA																	0				ovary(2)	2						c.(88-90)AGG>AGA		estradiol 17-beta-dehydrogenase 11							78.0	82.0	81.0					4																	88312133		2203	4300	6503	SO:0001819	synonymous_variant	51170				androgen catabolic process|steroid biosynthetic process	cytoplasm|extracellular region	binding|estradiol 17-beta-dehydrogenase activity	g.chr4:88312133C>T	AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.90G>A	4.37:g.88312133C>T							p.R30R	NM_016245	NP_057329	Q8NBQ5	DHB11_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000339)	1	323	-		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	30					Q96HF6|Q9UKU4	Silent	SNP	ENST00000358290.4	37	c.90G>A	CCDS3619.1																																																																																				0.463	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253041.1	NM_016245		3	43	0	0	0	0.004672	0	3	43				
MTTP	4547	broad.mit.edu	37	4	100518350	100518350	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:100518350C>A	ENST00000265517.5	+	8	1239	c.1036C>A	c.(1036-1038)Caa>Aaa	p.Q346K	MTTP_ENST00000457717.1_Missense_Mutation_p.Q346K|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000511045.1_Missense_Mutation_p.Q373K			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	346	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AGAGATCCTTCAAATACTAAA	0.428																																							uc003hvc.3		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1036-1038)CAA>AAA		microsomal triglyceride transfer protein large	Hesperetin(DB01094)						89.0	90.0	90.0					4																	100518350		2203	4300	6503	SO:0001583	missense	4547				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity	g.chr4:100518350C>A		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1036C>A	4.37:g.100518350C>A	ENSP00000265517:p.Gln346Lys					MTTP_uc011cej.1_Missense_Mutation_p.Q373K	p.Q346K	NM_000253	NP_000244	P55157	MTP_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	9	1292	+			346			Vitellogenin.		A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	ENST00000265517.5	37	c.1036C>A	CCDS3651.1	.	.	.	.	.	.	.	.	.	.	C	5.303	0.241309	0.10077	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517;ENST00000538053	T;T;T	0.68624	-0.34;-0.34;-0.34	5.27	4.41	0.53225	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.182497	0.47852	D	0.000209	T	0.49626	0.1568	L	0.38531	1.155	0.32029	N	0.599749	B;B	0.15141	0.007;0.012	B;B	0.15052	0.003;0.012	T	0.47911	-0.9080	10	0.05525	T	0.97	-25.7657	9.9571	0.41673	0.274:0.5926:0.1335:0.0	.	373;346	E9PBP6;P55157	.;MTP_HUMAN	K	373;346;346;346	ENSP00000427679:Q373K;ENSP00000400821:Q346K;ENSP00000265517:Q346K	ENSP00000265517:Q346K	Q	+	1	0	MTTP	100737373	0.991000	0.36638	0.315000	0.25238	0.490000	0.33462	3.699000	0.54778	1.168000	0.42723	0.655000	0.94253	CAA		0.428	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3			8	68	1	0	0.000274275	0.004482	0.000288968	8	68				
ALPK1	80216	broad.mit.edu	37	4	113352234	113352234	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:113352234C>T	ENST00000458497.1	+	11	1810	c.1531C>T	c.(1531-1533)Cat>Tat	p.H511Y	ALPK1_ENST00000504176.2_Missense_Mutation_p.H433Y|ALPK1_ENST00000177648.9_Missense_Mutation_p.H511Y	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	511							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		AGAAAAGCCACATTGTCAAAG	0.403																																							uc003iap.3		NA																	0				ovary(5)	5						c.(1531-1533)CAT>TAT		alpha-kinase 1							56.0	57.0	57.0					4																	113352234		2203	4300	6503	SO:0001583	missense	80216						ATP binding|protein serine/threonine kinase activity	g.chr4:113352234C>T	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.1531C>T	4.37:g.113352234C>T	ENSP00000398048:p.His511Tyr					ALPK1_uc003ian.3_Missense_Mutation_p.H511Y|ALPK1_uc011cfx.1_Missense_Mutation_p.H433Y|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Missense_Mutation_p.H339Y	p.H511Y	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00325)	11	1810	+		Ovarian(17;0.0446)|Hepatocellular(203;0.217)	511					B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	c.1531C>T	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	C	2.357	-0.347483	0.05208	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.02446	4.36;4.36;4.29	5.48	-11.0	0.00169	.	2.655720	0.00799	N	0.001410	T	0.02119	0.0066	L	0.41236	1.265	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.08055	0.003;0.001;0.001	T	0.41875	-0.9484	10	0.19147	T	0.46	4.9731	3.5318	0.07779	0.1523:0.4326:0.1535:0.2616	.	433;433;511	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	Y	511;511;433	ENSP00000398048:H511Y;ENSP00000177648:H511Y;ENSP00000426044:H433Y	ENSP00000177648:H511Y	H	+	1	0	ALPK1	113571683	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.487000	0.02310	-1.863000	0.01150	-0.793000	0.03317	CAT		0.403	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144		19	23	0	0	0	0.001523	0	19	23				
SYNPO2	171024	broad.mit.edu	37	4	119948362	119948362	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:119948362G>T	ENST00000429713.2	+	3	1020	c.838G>T	c.(838-840)Gga>Tga	p.G280*	SYNPO2_ENST00000307142.4_Nonsense_Mutation_p.G280*|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Nonsense_Mutation_p.G280*	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	280						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGGAGATGCGGGACTGCCCCG	0.537																																							uc003icm.3		NA																	0				ovary(2)	2						c.(838-840)GGA>TGA		synaptopodin 2 isoform b							74.0	75.0	74.0					4																	119948362		2203	4300	6503	SO:0001587	stop_gained	171024					nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding	g.chr4:119948362G>T	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.838G>T	4.37:g.119948362G>T	ENSP00000395143:p.Gly280*					SYNPO2_uc010ina.2_Nonsense_Mutation_p.G280*|SYNPO2_uc010inb.2_Nonsense_Mutation_p.G280*|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Nonsense_Mutation_p.G208*	p.G280*	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN			3	1034	+			280					B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Nonsense_Mutation	SNP	ENST00000429713.2	37	c.838G>T	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.92|12.92	2.083611|2.083611	0.36758|0.36758	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	.|.	.|.	.|.	5.11|5.11	0.904|0.904	0.19302|0.19302	.|.	1.079030|1.079030	0.07125|0.07125	N|N	0.844628|0.844628	T|.	0.18509|.	0.0444|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.25502|.	-1.0130|.	5|.	.|0.19590	.|T	.|0.45	-3.8935|-3.8935	2.0935|2.0935	0.03662|0.03662	0.2403:0.1398:0.4755:0.1444|0.2403:0.1398:0.4755:0.1444	.|.	.|.	.|.	.|.	V|X	231|280	.|.	.|ENSP00000306015:G280X	G|G	+|+	2|1	0|0	SYNPO2|SYNPO2	120167810|120167810	0.079000|0.079000	0.21365|0.21365	0.087000|0.087000	0.20705|0.20705	0.022000|0.022000	0.10575|0.10575	0.860000|0.860000	0.27871|0.27871	0.018000|0.018000	0.15052|0.15052	-2.049000|-2.049000	0.00408|0.00408	GGG|GGA		0.537	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			22	26	1	0	5.26018e-13	0.001882	6.17613e-13	22	26				
MYOZ2	51778	broad.mit.edu	37	4	120085430	120085430	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:120085430C>T	ENST00000307128.5	+	5	654	c.441C>T	c.(439-441)taC>taT	p.Y147Y		NM_016599.4	NP_057683.1			myozenin 2											endometrium(1)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						TCCCTAAGTACTATCAATCTC	0.403																																							uc003icp.3		NA																	0					0						c.(439-441)TAC>TAT		myozenin 2							68.0	71.0	70.0					4																	120085430		2203	4300	6503	SO:0001819	synonymous_variant	51778						protein phosphatase 2B binding	g.chr4:120085430C>T	AF249873	CCDS3711.1	4q26-q27	2014-09-17	2002-01-07	2002-01-11	ENSG00000172399	ENSG00000172399			1330	protein-coding gene	gene with protein product		605602	"""chromosome 4 open reading frame 5"""	C4orf5		8619474, 9110174	Standard	NM_016599		Approved	CS-1	uc003icp.4	Q9NPC6	OTTHUMG00000132968	ENST00000307128.5:c.441C>T	4.37:g.120085430C>T							p.Y147Y	NM_016599	NP_057683	Q9NPC6	MYOZ2_HUMAN			5	654	+			147						Silent	SNP	ENST00000307128.5	37	c.441C>T	CCDS3711.1																																																																																				0.403	MYOZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256526.2			8	33	0	0	0	0.00308	0	8	33				
PRIMPOL	201973	broad.mit.edu	37	4	185618908	185618908	+	IGR	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr4:185618908C>G	ENST00000314970.6	+	0	2289				MLF1IP_ENST00000506535.1_5'Flank|MLF1IP_ENST00000281453.5_Missense_Mutation_p.E346Q	NM_152683.2	NP_689896	Q96LW4	PRIPO_HUMAN	primase and polymerase (DNA-directed)						mitochondrial DNA replication (GO:0006264)|replication fork processing (GO:0031297)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA primase activity (GO:0003896)|DNA-directed DNA polymerase activity (GO:0003887)|manganese ion binding (GO:0030145)										GACTTTCTCTCTTTAAGTTCA	0.323																																							uc003iwq.2		NA																	0					0						c.(1036-1038)GAG>CAG		MLF1 interacting protein							79.0	81.0	81.0					4																	185618908		2202	4298	6500	SO:0001628	intergenic_variant	79682				CenH3-containing nucleosome assembly at centromere|interspecies interaction between organisms|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|condensed chromosome kinetochore|cytosol|nucleoplasm		g.chr4:185618908C>G	AK057729	CCDS3837.1, CCDS75211.1, CCDS75212.1	4q35.1	2013-09-27	2013-09-27	2013-09-27	ENSG00000164306	ENSG00000164306			26575	protein-coding gene	gene with protein product		615421	"""coiled-coil domain containing 111"""	CCDC111		12477932	Standard	XM_005262814		Approved	FLJ33167	uc003iwk.2	Q96LW4	OTTHUMG00000160495		4.37:g.185618908C>G						MLF1IP_uc003iwp.2_RNA|MLF1IP_uc003iwr.1_3'UTR	p.E346Q	NM_024629	NP_078905	Q71F23	CENPU_HUMAN		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)	12	1106	-		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)	346			Potential.		D3DP55|D6RDM1|Q5HYJ9	Missense_Mutation	SNP	ENST00000314970.6	37	c.1036G>C	CCDS3837.1	.	.	.	.	.	.	.	.	.	.	C	9.683	1.149950	0.21371	.	.	ENSG00000151725	ENST00000281453	T	0.17213	2.29	5.2	2.4	0.29515	.	0.681105	0.13874	N	0.356815	T	0.17066	0.0410	L	0.52011	1.625	0.80722	D	1	D	0.53619	0.961	P	0.44597	0.454	T	0.04593	-1.0940	10	0.42905	T	0.14	-18.7817	7.3321	0.26588	0.0:0.7102:0.1369:0.1529	.	346	Q71F23	CENPU_HUMAN	Q	346	ENSP00000281453:E346Q	ENSP00000281453:E346Q	E	-	1	0	MLF1IP	185855902	0.990000	0.36364	1.000000	0.80357	0.601000	0.36947	1.911000	0.39937	0.771000	0.33359	-0.142000	0.14014	GAG		0.323	PRIMPOL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360827.1	NM_152683		3	24	0	0	0	0.004672	0	3	24				
CEP72	55722	broad.mit.edu	37	5	634005	634005	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr5:634005C>T	ENST00000264935.5	+	5	724	c.634C>T	c.(634-636)Ccc>Tcc	p.P212S	CEP72_ENST00000444221.1_Intron	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	212					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			CGGCAGGCCTCCCGGGAGCAC	0.657																																							uc003jbf.2		NA																	0				ovary(1)	1						c.(634-636)CCC>TCC		centrosomal protein 72 kDa							73.0	77.0	76.0					5																	634005		2203	4300	6503	SO:0001583	missense	55722				G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol		g.chr5:634005C>T	BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.634C>T	5.37:g.634005C>T	ENSP00000264935:p.Pro212Ser					CEP72_uc011clz.1_Intron	p.P212S	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)		5	706	+			212					B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Missense_Mutation	SNP	ENST00000264935.5	37	c.634C>T	CCDS34126.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850225	0.51270	.	.	ENSG00000112877	ENST00000264935	T	0.11385	2.78	4.97	4.97	0.65823	.	0.171764	0.40818	N	0.001017	T	0.31071	0.0785	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.01416	-1.1360	10	0.59425	D	0.04	-21.6352	15.5203	0.75859	0.0:1.0:0.0:0.0	.	212	Q9P209	CEP72_HUMAN	S	212	ENSP00000264935:P212S	ENSP00000264935:P212S	P	+	1	0	CEP72	687005	0.997000	0.39634	0.630000	0.29268	0.058000	0.15608	1.740000	0.38228	2.443000	0.82685	0.462000	0.41574	CCC		0.657	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365967.3	NM_018140		6	184	0	0	0	0.001168	0	6	184				
ICE1	23379	broad.mit.edu	37	5	5464745	5464745	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr5:5464745C>T	ENST00000296564.7	+	13	5520	c.5298C>T	c.(5296-5298)ctC>ctT	p.L1766L		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1766					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CCCGGACCCTCAACATCCTCA	0.517																																							uc003jdm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(5296-5298)CTC>CTT		hypothetical protein LOC23379							36.0	36.0	36.0					5																	5464745		1908	4114	6022	SO:0001819	synonymous_variant	23379							g.chr5:5464745C>T																												ENST00000296564.7:c.5298C>T	5.37:g.5464745C>T							p.L1766L	NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN			13	5520	+			1766					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	37	c.5298C>T	CCDS47187.1																																																																																				0.517	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			5	32	0	0	0	0.000602	0	5	32				
PCDHB4	56131	broad.mit.edu	37	5	140502747	140502747	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr5:140502747G>A	ENST00000194152.1	+	1	1167	c.1167G>A	c.(1165-1167)ccG>ccA	p.P389P	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	389	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATAATCTACCGTTTATTCTAA	0.433																																							uc003lip.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1165-1167)CCG>CCA		protocadherin beta 4 precursor							71.0	75.0	73.0					5																	140502747		2203	4300	6503	SO:0001819	synonymous_variant	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140502747G>A	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1167G>A	5.37:g.140502747G>A							p.P389P	NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1167	+			389			Cadherin 4.|Extracellular (Potential).		Q4V761	Silent	SNP	ENST00000194152.1	37	c.1167G>A	CCDS4246.1																																																																																				0.433	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		69	42	0	0	0	0.00361	0	69	42				
NUDCD2	134492	broad.mit.edu	37	5	162883952	162883952	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr5:162883952C>G	ENST00000302764.4	-	3	462	c.373G>C	c.(373-375)Gag>Cag	p.E125Q	NUDCD2_ENST00000519395.1_5'Flank|NUDCD2_ENST00000517501.1_Missense_Mutation_p.E100Q	NM_145266.4	NP_660309.1	Q8WVJ2	NUDC2_HUMAN	NudC domain containing 2	125						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)				large_intestine(1)|prostate(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.0207)|all_neural(177;0.0966)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0981)|OV - Ovarian serous cystadenocarcinoma(192;0.183)|Epithelial(171;0.247)		TGGAATCTCTCTAATGTAAGC	0.323																																							uc003lze.2		NA																	0					0						c.(373-375)GAG>CAG		NudC domain containing 2							138.0	132.0	134.0					5																	162883952		2203	4300	6503	SO:0001583	missense	134492					intracellular		g.chr5:162883952C>G	BX538290	CCDS4361.1	5q34	2008-02-05			ENSG00000170584	ENSG00000170584			30535	protein-coding gene	gene with protein product							Standard	NM_145266		Approved	DKFZp686E10109	uc003lze.3	Q8WVJ2	OTTHUMG00000130378	ENST00000302764.4:c.373G>C	5.37:g.162883952C>G	ENSP00000304854:p.Glu125Gln						p.E125Q	NM_145266	NP_660309	Q8WVJ2	NUDC2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0981)|OV - Ovarian serous cystadenocarcinoma(192;0.183)|Epithelial(171;0.247)	3	460	-	Renal(175;0.000281)	Medulloblastoma(196;0.0207)|all_neural(177;0.0966)	125					B2R4V0	Missense_Mutation	SNP	ENST00000302764.4	37	c.373G>C	CCDS4361.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256608	0.80246	.	.	ENSG00000170584	ENST00000302764;ENST00000517501	.	.	.	5.95	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.63954	0.2555	L	0.54908	1.71	0.58432	D	0.999998	D	0.69078	0.997	P	0.51324	0.666	T	0.65442	-0.6167	9	0.44086	T	0.13	-19.3374	16.9826	0.86332	0.0:0.8724:0.1276:0.0	.	125	Q8WVJ2	NUDC2_HUMAN	Q	125;100	.	ENSP00000304854:E125Q	E	-	1	0	NUDCD2	162816530	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.354000	0.79424	1.485000	0.48380	0.655000	0.94253	GAG		0.323	NUDCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252747.3	NM_145266		6	37	0	0	0	0.001984	0	6	37				
BTNL8	79908	broad.mit.edu	37	5	180338435	180338435	+	Missense_Mutation	SNP	C	C	A	rs370167264		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr5:180338435C>A	ENST00000340184.4	+	3	700	c.494C>A	c.(493-495)gCg>gAg	p.A165E	BTNL8_ENST00000231229.4_Missense_Mutation_p.A165E|BTNL8_ENST00000400707.3_Missense_Mutation_p.A40E|BTNL8_ENST00000505126.1_5'UTR|BTNL8_ENST00000511704.1_Missense_Mutation_p.A49E|BTNL8_ENST00000508408.1_Missense_Mutation_p.A165E|BTNL8_ENST00000533815.2_5'UTR|Y_RNA_ENST00000410920.1_RNA	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	165	Ig-like V-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGGCCCACAGCGAAGTGGAAA	0.537																																							uc003mmp.2		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(493-495)GCG>GAG		butyrophilin-like 8 isoform 2 precursor							144.0	155.0	151.0					5																	180338435		2203	4296	6499	SO:0001583	missense	79908					integral to membrane		g.chr5:180338435C>A	AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.494C>A	5.37:g.180338435C>A	ENSP00000342197:p.Ala165Glu					BTNL8_uc003mmq.2_Missense_Mutation_p.A165E|BTNL8_uc011dhg.1_Missense_Mutation_p.A40E|BTNL8_uc010jll.2_Missense_Mutation_p.A165E|BTNL8_uc010jlm.2_Missense_Mutation_p.A49E|BTNL8_uc011dhh.1_5'UTR	p.A165E	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		3	728	+	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	165			Ig-like V-type 2.|Extracellular (Potential).		A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Missense_Mutation	SNP	ENST00000340184.4	37	c.494C>A	CCDS43413.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938939	0.34189	.	.	ENSG00000113303	ENST00000231229;ENST00000340184;ENST00000400707;ENST00000508408;ENST00000511704	T;T;T;T;T	0.06528	3.29;3.29;3.29;3.29;3.29	3.69	-0.256	0.12984	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.12603	0.0306	M	0.62723	1.935	0.21897	N	0.999485	D;D;D;D;P	0.64830	0.986;0.959;0.987;0.994;0.924	P;P;P;P;B	0.54499	0.609;0.609;0.754;0.754;0.345	T	0.13629	-1.0502	9	0.72032	D	0.01	.	6.1513	0.20313	0.0:0.3741:0.0:0.6259	.	40;49;165;165;165	E9PG07;E9PEF6;F2Z2B2;A6NEX6;Q6UX41	.;.;.;.;BTNL8_HUMAN	E	165;165;40;165;49	ENSP00000231229:A165E;ENSP00000342197:A165E;ENSP00000383543:A40E;ENSP00000424585:A165E;ENSP00000425207:A49E	ENSP00000231229:A165E	A	+	2	0	BTNL8	180271041	0.000000	0.05858	0.000000	0.03702	0.197000	0.23852	-0.223000	0.09177	-0.236000	0.09753	0.205000	0.17691	GCG		0.537	BTNL8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368440.1	NM_024850		8	203	1	0	0.000157383	0.00308	0.000166558	8	203				
GMDS	2762	broad.mit.edu	37	6	1742745	1742745	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:1742745C>T	ENST00000380815.4	-	8	1116	c.847G>A	c.(847-849)Gaa>Aaa	p.E283K	GMDS_ENST00000530927.1_Missense_Mutation_p.E253K	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	283					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)		GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		TCGACAAATTCCCGGACACTA	0.458																																							uc003mtq.2		NA																	0				central_nervous_system(1)	1						c.(847-849)GAA>AAA		GDP-mannose 4,6-dehydratase							137.0	122.0	127.0					6																	1742745		2203	4300	6503	SO:0001583	missense	2762				'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity	g.chr6:1742745C>T	AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.847G>A	6.37:g.1742745C>T	ENSP00000370194:p.Glu283Lys						p.E283K	NM_001500	NP_001491	O60547	GMDS_HUMAN		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)	8	1037	-	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)	283					E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Missense_Mutation	SNP	ENST00000380815.4	37	c.847G>A	CCDS4474.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116255	0.56505	.	.	ENSG00000112699	ENST00000530927;ENST00000380815	.	.	.	5.51	5.51	0.81932	.	0.111999	0.64402	D	0.000014	T	0.73418	0.3584	M	0.92219	3.285	0.80722	D	1	B	0.23490	0.086	B	0.21360	0.034	T	0.75994	-0.3121	9	0.72032	D	0.01	-1.4309	19.4328	0.94778	0.0:1.0:0.0:0.0	.	283	O60547	GMDS_HUMAN	K	253;283	.	ENSP00000370194:E283K	E	-	1	0	GMDS	1687744	1.000000	0.71417	0.994000	0.49952	0.163000	0.22366	7.482000	0.81143	2.584000	0.87258	0.563000	0.77884	GAA		0.458	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043380.3			18	81	0	0	0	0.008871	0	18	81				
TRIM27	5987	broad.mit.edu	37	6	28891242	28891242	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:28891242G>C	ENST00000377199.3	-	1	524	c.168C>G	c.(166-168)tgC>tgG	p.C56W	TRIM27_ENST00000498117.1_5'Flank|TRIM27_ENST00000377194.3_Missense_Mutation_p.C56W	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	56					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						AGGTCTCCCGGCACTGCGGGC	0.682			T	RET	papillary thyroid																																		uc003nlr.2		NA		Dom	yes		6	6p22	5987	T	tripartite motif-containing 27			E	RET		papillary thyroid		0				ovary(1)	1						c.(166-168)TGC>TGG		ret finger protein							22.0	20.0	21.0					6																	28891242		2200	4295	6495	SO:0001583	missense	5987				cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding	g.chr6:28891242G>C	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.168C>G	6.37:g.28891242G>C	ENSP00000366404:p.Cys56Trp					TRIM27_uc003nls.2_Missense_Mutation_p.C56W|TRIM27_uc003nlt.1_Missense_Mutation_p.C56W	p.C56W	NM_006510	NP_006501	P14373	TRI27_HUMAN			1	527	-			56			RING-type.		A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	ENST00000377199.3	37	c.168C>G	CCDS4654.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781137	0.70222	.	.	ENSG00000204713	ENST00000377199;ENST00000377194	T;T	0.54866	0.55;0.55	4.31	4.31	0.51392	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.50627	D	0.000106	T	0.82240	0.4994	H	0.99454	4.575	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.89770	0.3953	10	0.87932	D	0	.	15.0597	0.71942	0.0:0.0:1.0:0.0	.	123;56;56	Q59EC6;P14373-2;P14373	.;.;TRI27_HUMAN	W	56	ENSP00000366404:C56W;ENSP00000366399:C56W	ENSP00000366399:C56W	C	-	3	2	TRIM27	28999221	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.630000	0.54273	2.314000	0.78098	0.555000	0.69702	TGC		0.682	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950		6	38	0	0	0	0.001984	0	6	38				
HLA-DMA	3108	broad.mit.edu	37	6	32920762	32920762	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:32920762G>A	ENST00000374843.4	-	1	137	c.52C>T	c.(52-54)Ctg>Ttg	p.L18L	HLA-DMA_ENST00000464392.1_Intron|HLA-DMA_ENST00000395303.3_Silent_p.L18L|HLA-DMA_ENST00000395305.3_Silent_p.L18L|XXbac-BPG181M17.5_ENST00000429234.1_Silent_p.L18L	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha	18					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						AGCAGCCACAGAAGTGGTAAC	0.537																																							uc003ocm.2		NA																	0					0						c.(52-54)CTG>TTG		major histocompatibility complex, class II, DM							228.0	215.0	219.0					6																	32920762		1511	2709	4220	SO:0001819	synonymous_variant	3108					integral to membrane|MHC class II protein complex		g.chr6:32920762G>A		CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.52C>T	6.37:g.32920762G>A						HLA-DMA_uc011dqm.1_Silent_p.L18L	p.L18L	NM_006120	NP_006111	Q31604	Q31604_HUMAN			1	138	-			18					Q29639|Q29640	Silent	SNP	ENST00000374843.4	37	c.52C>T	CCDS4761.1																																																																																				0.537	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076325.2	NM_006120		7	282	0	0	0	0.00308	0	7	282				
CUL9	23113	broad.mit.edu	37	6	43152373	43152373	+	Missense_Mutation	SNP	G	G	A	rs548294417		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:43152373G>A	ENST00000252050.4	+	2	409	c.325G>A	c.(325-327)Gaa>Aaa	p.E109K	CUL9_ENST00000354495.3_Missense_Mutation_p.E109K|CUL9_ENST00000372647.2_Missense_Mutation_p.E109K	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	109					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AGGCCTGGATGAAGTGGCAAT	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		21002	0.0		0.0	False		,,,				2504	0.001						uc003ouk.2		NA																	0				ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(325-327)GAA>AAA		p53-associated parkin-like cytoplasmic protein							89.0	96.0	94.0					6																	43152373		2203	4300	6503	SO:0001583	missense	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43152373G>A	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.325G>A	6.37:g.43152373G>A	ENSP00000252050:p.Glu109Lys					CUL9_uc003ouj.1_Missense_Mutation_p.E109K|CUL9_uc003oul.2_Missense_Mutation_p.E109K|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_5'Flank	p.E109K	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN			2	400	+			109					O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	c.325G>A	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475733	0.26511	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.76839	-1.04;-1.05;-0.94	3.91	3.91	0.45181	.	0.262591	0.35903	N	0.002907	T	0.55768	0.1941	N	0.24115	0.695	0.39804	D	0.972605	B;B;P	0.45768	0.247;0.247;0.866	B;B;B	0.43413	0.057;0.057;0.419	T	0.57734	-0.7760	10	0.19590	T	0.45	-9.7875	16.4531	0.83998	0.0:0.0:1.0:0.0	.	109;109;109	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	K	109	ENSP00000252050:E109K;ENSP00000346490:E109K;ENSP00000361730:E109K	ENSP00000252050:E109K	E	+	1	0	CUL9	43260351	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	7.496000	0.81526	2.174000	0.68829	0.313000	0.20887	GAA		0.612	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		15	245	0	0	0	0.004007	0	15	245				
ZNF318	24149	broad.mit.edu	37	6	43308072	43308072	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:43308072C>G	ENST00000361428.2	-	10	3741	c.3664G>C	c.(3664-3666)Gaa>Caa	p.E1222Q	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1222	Lys-rich.				meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TCCTTTACTTCTTTCACAGCC	0.448																																							uc003oux.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(3664-3666)GAA>CAA		zinc finger protein 318							211.0	212.0	212.0					6																	43308072		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43308072C>G	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.3664G>C	6.37:g.43308072C>G	ENSP00000354964:p.Glu1222Gln					ZNF318_uc003ouw.2_Intron	p.E1222Q	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		10	3742	-			1222			Lys-rich.		O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.3664G>C	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846027	0.32606	.	.	ENSG00000171467	ENST00000361428	T	0.50548	0.74	5.69	5.69	0.88448	.	0.209202	0.38959	N	0.001506	T	0.48943	0.1528	L	0.32530	0.975	0.80722	D	1	D	0.67145	0.996	P	0.59357	0.856	T	0.48091	-0.9065	10	0.54805	T	0.06	-6.0786	19.8165	0.96571	0.0:1.0:0.0:0.0	.	1222	Q5VUA4	ZN318_HUMAN	Q	1222	ENSP00000354964:E1222Q	ENSP00000354964:E1222Q	E	-	1	0	ZNF318	43416050	1.000000	0.71417	0.983000	0.44433	0.401000	0.30781	3.796000	0.55507	2.683000	0.91414	0.655000	0.94253	GAA		0.448	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		37	239	0	0	0	0.004878	0	37	239				
FAM135A	57579	broad.mit.edu	37	6	71235143	71235143	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:71235143G>A	ENST00000418814.2	+	15	2970	c.2356G>A	c.(2356-2358)Gat>Aat	p.D786N	FAM135A_ENST00000370479.3_Missense_Mutation_p.D573N|FAM135A_ENST00000505769.1_Intron|FAM135A_ENST00000361499.3_Missense_Mutation_p.D590N|FAM135A_ENST00000457062.2_Missense_Mutation_p.D573N|FAM135A_ENST00000505868.1_Missense_Mutation_p.D786N	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	786										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						TCCAAACACTGATTTAGTCTT	0.353																																							uc003pfj.2		NA																	0				central_nervous_system(1)	1						c.(2356-2358)GAT>AAT		hypothetical protein LOC57579 isoform c							84.0	82.0	83.0					6																	71235143		2203	4299	6502	SO:0001583	missense	57579							g.chr6:71235143G>A	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.2356G>A	6.37:g.71235143G>A	ENSP00000410768:p.Asp786Asn					FAM135A_uc003pfi.2_Missense_Mutation_p.D590N|FAM135A_uc003pfh.2_Missense_Mutation_p.D573N|FAM135A_uc003pfl.2_Missense_Mutation_p.D453N|FAM135A_uc003pfn.2_Intron|FAM135A_uc003pfo.1_Missense_Mutation_p.D157N|FAM135A_uc010kan.1_5'Flank	p.D786N	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN			13	2489	+			786					A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	ENST00000418814.2	37	c.2356G>A	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555258	0.65425	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04	5.88	5.88	0.94601	.	0.301114	0.41605	D	0.000849	T	0.61850	0.2380	L	0.58101	1.795	0.52501	D	0.99995	P;P;P;P	0.44521	0.597;0.647;0.837;0.561	B;P;P;B	0.49192	0.302;0.51;0.602;0.436	T	0.57225	-0.7848	10	0.32370	T	0.25	.	20.2187	0.98312	0.0:0.0:1.0:0.0	.	786;786;590;573	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	N	786;573;573;590;786	ENSP00000410768:D786N;ENSP00000359510:D573N;ENSP00000409201:D573N;ENSP00000354913:D590N;ENSP00000423307:D786N	ENSP00000354913:D590N	D	+	1	0	FAM135A	71291864	1.000000	0.71417	0.954000	0.39281	0.951000	0.60555	8.019000	0.88732	2.780000	0.95670	0.655000	0.94253	GAT		0.353	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819		12	49	0	0	0	0.003163	0	12	49				
RARS2	57038	broad.mit.edu	37	6	88240532	88240532	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:88240532C>G	ENST00000369536.5	-	9	786	c.741G>C	c.(739-741)ttG>ttC	p.L247F		NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	247					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		CTTCAATGCTCAAGTCCCGAA	0.463																																							uc003pme.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(739-741)TTG>TTC		arginyl-tRNA synthetase 2, mitochondrial							178.0	157.0	164.0					6																	88240532		2203	4300	6503	SO:0001583	missense	57038				arginyl-tRNA aminoacylation	mitochondrial matrix	arginine-tRNA ligase activity|ATP binding|protein binding	g.chr6:88240532C>G	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.741G>C	6.37:g.88240532C>G	ENSP00000358549:p.Leu247Phe					RARS2_uc003pmb.2_Missense_Mutation_p.L72F|RARS2_uc003pmc.2_Missense_Mutation_p.L72F|RARS2_uc003pmd.2_5'UTR|RARS2_uc003pmf.2_RNA	p.L247F	NM_020320	NP_064716	Q5T160	SYRM_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0456)	9	801	-		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	247					B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	37	c.741G>C	CCDS5011.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786943	0.31593	.	.	ENSG00000146282	ENST00000369536	T	0.65364	-0.15	6.17	4.39	0.52855	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.133795	0.56097	D	0.000040	T	0.48624	0.1510	M	0.76002	2.32	0.39122	D	0.961678	B	0.21309	0.054	B	0.30105	0.111	T	0.51379	-0.8713	10	0.42905	T	0.14	.	10.7607	0.46264	0.0:0.7278:0.1387:0.1334	.	247	Q5T160	SYRM_HUMAN	F	247	ENSP00000358549:L247F	ENSP00000358549:L247F	L	-	3	2	RARS2	88297251	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	0.691000	0.25467	0.953000	0.37825	-0.797000	0.03246	TTG		0.463	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320		13	52	0	0	0	0.001368	0	13	52				
TNFAIP3	7128	broad.mit.edu	37	6	138200479	138200479	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:138200479G>A	ENST00000237289.4	+	7	1963	c.1897G>A	c.(1897-1899)Gaa>Aaa	p.E633K		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	633	Interaction with TNIP1. {ECO:0000250}.|Required for proteosomal degradation of UBE2N and UBE2D3, TRAF6 deubiquitination, and TAX1BP1 interaction with UBE2N. {ECO:0000250}.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.?(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CGAGTACAGAGAAAACAAACG	0.493			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)	GBM(130;153 1739 22295 28918 47987)	uc003qhr.2		NA		Rec	yes		6	6q23	7128	D|N|F	"""tumor necrosis factor, alpha-induced protein 3"""			L			marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma		26	Whole gene deletion(25)|Unknown(1)	p.0?(22)|p.?(1)	haematopoietic_and_lymphoid_tissue(26)	haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137						c.(1897-1899)GAA>AAA		tumor necrosis factor, alpha-induced protein 3							63.0	69.0	67.0					6																	138200479		2203	4300	6503	SO:0001583	missense	7128				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr6:138200479G>A	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1897G>A	6.37:g.138200479G>A	ENSP00000237289:p.Glu633Lys					TNFAIP3_uc003qhs.2_Missense_Mutation_p.E633K	p.E633K	NM_006290	NP_006281	P21580	TNAP3_HUMAN		GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)	7	1963	+	Breast(32;0.135)|Colorectal(23;0.24)		633			Interaction with NAF1 (By similarity).|A20-type 4.		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	c.1897G>A	CCDS5187.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.0|27.0	4.795506|4.795506	0.90453|0.90453	.|.	.|.	ENSG00000118503|ENSG00000118503	ENST00000237289;ENST00000535574|ENST00000544646	T|.	0.24350|.	1.86|.	5.93|5.93	5.93|5.93	0.95920|0.95920	Zinc finger, A20-type (1);|.	0.099197|.	0.64402|.	D|.	0.000001|.	T|T	0.67608|0.67608	0.2911|0.2911	M|M	0.62723|0.62723	1.935|1.935	0.49915|0.49915	D|D	0.999831|0.999831	D|.	0.60575|.	0.988|.	P|.	0.54759|.	0.76|.	T|T	0.63637|0.63637	-0.6592|-0.6592	10|5	0.44086|.	T|.	0.13|.	-22.785|-22.785	18.5066|18.5066	0.90900|0.90900	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	633|.	P21580|.	TNAP3_HUMAN|.	K|K	633|632	ENSP00000237289:E633K|.	ENSP00000237289:E633K|.	E|R	+|+	1|2	0|0	TNFAIP3|TNFAIP3	138242172|138242172	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	5.782000|5.782000	0.68973|0.68973	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GAA|AGA		0.493	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			7	60	0	0	0	0.001984	0	7	60				
REPS1	85021	broad.mit.edu	37	6	139251135	139251135	+	Silent	SNP	A	A	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr6:139251135A>C	ENST00000450536.2	-	9	1810	c.1236T>G	c.(1234-1236)ccT>ccG	p.P412P	REPS1_ENST00000258062.5_Silent_p.P412P|REPS1_ENST00000409812.2_Silent_p.P412P|REPS1_ENST00000415951.2_Silent_p.P412P|REPS1_ENST00000367663.4_Silent_p.P412P			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	412					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		GATTCAGCTCAGGCCATGTCT	0.448																																							uc003qii.2		NA																	0				lung(1)|breast(1)	2						c.(1234-1236)CCT>CCG		RALBP1 associated Eps domain containing 1							176.0	150.0	159.0					6																	139251135		2203	4300	6503	SO:0001819	synonymous_variant	85021					coated pit|plasma membrane	calcium ion binding|SH3 domain binding	g.chr6:139251135A>C		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1236T>G	6.37:g.139251135A>C						REPS1_uc003qig.3_Silent_p.P412P|REPS1_uc011edr.1_Silent_p.P412P|REPS1_uc003qij.2_Silent_p.P412P|REPS1_uc003qik.2_Silent_p.P45P	p.P412P	NM_031922	NP_114128	Q96D71	REPS1_HUMAN		GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)	9	1815	-			412					B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Silent	SNP	ENST00000450536.2	37	c.1236T>G																																																																																					0.448	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3			4	60	0	0	0	0.009096	0	4	60				
C7orf26	79034	broad.mit.edu	37	7	6641768	6641768	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:6641768A>G	ENST00000344417.5	+	5	1412	c.1145A>G	c.(1144-1146)aAt>aGt	p.N382S	C7orf26_ENST00000359073.5_Missense_Mutation_p.N285S|C7orf26_ENST00000472693.1_3'UTR	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	382										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		CTGCCCCATAATAAGTAAGTA	0.512											OREG0017863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003sqo.1		NA																	0				ovary(1)	1						c.(1144-1146)AAT>AGT		hypothetical protein LOC79034							150.0	136.0	141.0					7																	6641768		2203	4300	6503	SO:0001583	missense	79034							g.chr7:6641768A>G	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.1145A>G	7.37:g.6641768A>G	ENSP00000340220:p.Asn382Ser		OREG0017863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	635	C7orf26_uc003sqp.1_Missense_Mutation_p.N285S|C7orf26_uc003sqq.1_Missense_Mutation_p.N183S	p.N382S	NM_024067	NP_076972	Q96N11	CG026_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)	5	1145	+		Ovarian(82;0.232)	382					Q9BQ43	Missense_Mutation	SNP	ENST00000344417.5	37	c.1145A>G	CCDS5353.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730478	0.89390	.	.	ENSG00000146576	ENST00000344417;ENST00000359073	T;T	0.48201	0.82;0.82	5.39	5.39	0.77823	.	0.080012	0.85682	D	0.000000	T	0.65196	0.2668	L	0.61387	1.9	0.49051	D	0.999748	D;D	0.67145	0.996;0.996	D;D	0.77557	0.971;0.99	T	0.67910	-0.5548	10	0.66056	D	0.02	-10.8839	13.724	0.62748	1.0:0.0:0.0:0.0	.	285;382	Q96N11-2;Q96N11	.;CG026_HUMAN	S	382;285	ENSP00000340220:N382S;ENSP00000351974:N285S	ENSP00000340220:N382S	N	+	2	0	C7orf26	6608293	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.169000	0.89672	2.184000	0.69523	0.524000	0.50904	AAT		0.512	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246844.2	NM_024067		4	112	0	0	0	0.009096	0	4	112				
HNRNPA2B1	3181	broad.mit.edu	37	7	26233309	26233309	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:26233309T>A	ENST00000354667.4	-	9	931	c.763A>T	c.(763-765)Aat>Tat	p.N255Y	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.N243Y|HNRNPA2B1_ENST00000476233.1_5'Flank	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	255	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						CCTCCAAAATTGCCACCTATT	0.443			T	ETV1	prostate																																		uc003sxr.3		NA		Dom	yes		7	7p15	3181	T	heterogeneous nuclear ribonucleoprotein A2/B1			E	ETV1		prostate		0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(763-765)AAT>TAT		heterogeneous nuclear ribonucleoprotein A2/B1							57.0	61.0	60.0					7																	26233309		2203	4300	6503	SO:0001583	missense	3181				RNA transport	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|protein binding|RNA binding|single-stranded telomeric DNA binding	g.chr7:26233309T>A	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.763A>T	7.37:g.26233309T>A	ENSP00000346694:p.Asn255Tyr					HNRNPA2B1_uc003sxs.3_Missense_Mutation_p.N243Y	p.N255Y	NM_031243	NP_112533	P22626	ROA2_HUMAN			9	979	-			255			Gly-rich.		A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	37	c.763A>T	CCDS43557.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.030177	0.35797	.	.	ENSG00000122566	ENST00000354667;ENST00000356674	D;D	0.85955	-2.05;-2.05	6.07	3.7	0.42460	.	0.070787	0.56097	D	0.000022	D	0.83468	0.5261	M	0.69358	2.11	0.29060	N	0.883958	P;P	0.39131	0.661;0.531	B;B	0.43783	0.431;0.352	T	0.74222	-0.3735	10	0.22109	T	0.4	.	8.7602	0.34669	0.0:0.0663:0.129:0.8047	.	243;255	P22626-2;P22626	.;ROA2_HUMAN	Y	255;243	ENSP00000346694:N255Y;ENSP00000349101:N243Y	ENSP00000346694:N255Y	N	-	1	0	HNRNPA2B1	26199834	1.000000	0.71417	1.000000	0.80357	0.487000	0.33371	7.607000	0.82883	0.528000	0.28580	-0.313000	0.08912	AAT		0.443	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137		27	41	0	0	0	0.005443	0	27	41				
BMPER	168667	broad.mit.edu	37	7	34182860	34182860	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:34182860G>T	ENST00000297161.2	+	15	2138	c.1764G>T	c.(1762-1764)atG>atT	p.M588I	BMPER_ENST00000426693.1_Missense_Mutation_p.M588I	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	588					blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TGACAGACATGTGTGAATGTC	0.428																																							uc011kap.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1762-1764)ATG>ATT		BMP-binding endothelial regulator precursor							168.0	169.0	169.0					7																	34182860		2203	4300	6503	SO:0001583	missense	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34182860G>T		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1764G>T	7.37:g.34182860G>T	ENSP00000297161:p.Met588Ile						p.M588I	NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN			14	1878	+			588					A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	c.1764G>T	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	G	33	5.213846	0.95104	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.75704	-0.96;-0.96	5.76	5.76	0.90799	Uncharacterised domain, cysteine-rich (2);	0.000000	0.85682	D	0.000000	T	0.81884	0.4917	M	0.72894	2.215	0.80722	D	1	P	0.51057	0.941	P	0.51615	0.675	T	0.79713	-0.1688	10	0.37606	T	0.19	.	20.3431	0.98773	0.0:0.0:1.0:0.0	.	588	Q8N8U9	BMPER_HUMAN	I	588	ENSP00000297161:M588I;ENSP00000393950:M588I	ENSP00000297161:M588I	M	+	3	0	BMPER	34149385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.154000	0.94694	2.880000	0.98712	0.650000	0.86243	ATG		0.428	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		24	87	1	0	1.85244e-09	0.00333	2.10181e-09	24	87				
YAE1D1	57002	broad.mit.edu	37	7	39610105	39610105	+	Splice_Site	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:39610105G>A	ENST00000223273.2	+	2	173	c.130G>A	c.(130-132)Gaa>Aaa	p.E44K	YAE1D1_ENST00000469737.1_3'UTR|YAE1D1_ENST00000432096.2_Splice_Site_p.E44K|YAE1D1_ENST00000448268.1_Splice_Site_p.E44K	NM_020192.3	NP_064577.1	Q9NRH1	YAED1_HUMAN	Yae1 domain containing 1	44																	TTATTTTTAGGAAGGTTATAG	0.358																																							uc003thc.3		NA																	0					0						c.(130-132)GAA>AAA		hypothetical protein LOC57002							104.0	106.0	105.0					7																	39610105		2203	4300	6503	SO:0001630	splice_region_variant	57002							g.chr7:39610105G>A	AF226046	CCDS5459.1, CCDS64630.1	7p14.1	2011-11-24	2011-11-24	2011-11-24	ENSG00000241127	ENSG00000241127			24857	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 36"""	C7orf36		12477932	Standard	NM_020192		Approved	GK003	uc003thc.4	Q9NRH1	OTTHUMG00000128689	ENST00000223273.2:c.130-1G>A	7.37:g.39610105G>A							p.E44K	NM_020192	NP_064577	Q9NRH1	CG036_HUMAN			2	139	+			44					A4D1W4|B4DE83|Q6IAF7|Q8WVZ5	Missense_Mutation	SNP	ENST00000223273.2	37	c.130G>A	CCDS5459.1	.	.	.	.	.	.	.	.	.	.	G	31	5.094603	0.94149	.	.	ENSG00000241127	ENST00000223273;ENST00000448268;ENST00000432096	T;T;T	0.49720	0.77;0.86;0.81	6.02	6.02	0.97574	.	0.045626	0.85682	D	0.000000	T	0.65176	0.2666	L	0.50333	1.59	0.53005	D	0.999964	D	0.76494	0.999	D	0.80764	0.994	T	0.62011	-0.6944	10	0.51188	T	0.08	-1.7147	18.7178	0.91682	0.0:0.0:1.0:0.0	.	44	Q9NRH1	CG036_HUMAN	K	44	ENSP00000223273:E44K;ENSP00000400511:E44K;ENSP00000395777:E44K	ENSP00000223273:E44K	E	+	1	0	C7orf36	39576630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.780000	0.75063	2.857000	0.98124	0.650000	0.86243	GAA		0.358	YAE1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250586.1	NM_020192	Missense_Mutation	6	59	0	0	0	0.001168	0	6	59				
CCL24	6369	broad.mit.edu	37	7	75441236	75441236	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:75441236C>A	ENST00000416943.1	-	4	331	c.238G>T	c.(238-240)Gag>Tag	p.E80*	CCL24_ENST00000222902.2_Nonsense_Mutation_p.E80*	NM_002991.2	NP_002982.2	O00175	CCL24_HUMAN	chemokine (C-C motif) ligand 24	80					cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of inflammatory response (GO:0050729)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			endometrium(1)|lung(2)	3						TGGACCCACTCCTGCTTGGGG	0.602																																							uc011kga.1		NA																	0					0						c.(238-240)GAG>TAG		small inducible cytokine A24 precursor							97.0	78.0	84.0					7																	75441236		2203	4300	6503	SO:0001587	stop_gained	6369				cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity	g.chr7:75441236C>A	U85768	CCDS34670.1	7q11.23	2013-02-25	2002-08-22	2002-08-23	ENSG00000106178	ENSG00000106178		"""Chemokine ligands"", ""Endogenous ligands"""	10623	protein-coding gene	gene with protein product	"""CK-beta-6"", ""myeloid progenitor inhibitory factor 2"", ""eotaxin-2"""	602495	"""small inducible cytokine subfamily A (Cys-Cys), member 24"""	SCYA24		9104803, 9598329	Standard	NM_002991		Approved	Ckb-6, MPIF-2, eotaxin-2, MPIF2	uc011kga.2	O00175	OTTHUMG00000156635	ENST00000416943.1:c.238G>T	7.37:g.75441236C>A	ENSP00000400533:p.Glu80*						p.E80*	NM_002991	NP_002982	O00175	CCL24_HUMAN			3	238	-			80					B2R5K2	Nonsense_Mutation	SNP	ENST00000416943.1	37	c.238G>T	CCDS34670.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417876	0.25552	.	.	ENSG00000106178	ENST00000222902;ENST00000416943	.	.	.	4.33	2.33	0.28932	.	2.057820	0.02273	N	0.068618	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	10.2255	0.43222	0.0:0.4199:0.5801:0.0	.	.	.	.	X	80	.	ENSP00000222902:E80X	E	-	1	0	CCL24	75279172	0.000000	0.05858	0.004000	0.12327	0.081000	0.17604	-0.218000	0.09240	0.947000	0.37659	-0.321000	0.08615	GAG		0.602	CCL24-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344886.1	NM_002991		34	45	1	0	1.30293e-26	0.003271	1.59323e-26	34	45				
CROT	54677	broad.mit.edu	37	7	86991112	86991112	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:86991112C>G	ENST00000331536.3	+	6	676	c.491C>G	c.(490-492)tCt>tGt	p.S164C	CROT_ENST00000442291.1_Missense_Mutation_p.S164C|CROT_ENST00000419147.2_Missense_Mutation_p.S192C	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	164					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	ATGCTATTTTCTACCTGCAAG	0.323																																							uc003uit.2		NA																	0				ovary(2)|lung(1)	3						c.(490-492)TCT>TGT		peroxisomal carnitine O-octanoyltransferase	L-Carnitine(DB00583)						87.0	99.0	95.0					7																	86991112		2203	4300	6503	SO:0001583	missense	54677				fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity	g.chr7:86991112C>G		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.491C>G	7.37:g.86991112C>G	ENSP00000331981:p.Ser164Cys					CROT_uc003uiu.2_Missense_Mutation_p.S192C	p.S164C	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN			6	736	+	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		164					A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	37	c.491C>G	CCDS5604.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387739	0.25031	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.90620	-2.7;-2.7;-2.7	5.59	5.59	0.84812	.	0.331501	0.36740	N	0.002426	D	0.84602	0.5508	L	0.35341	1.055	0.36146	D	0.847115	B;B	0.14438	0.006;0.01	B;B	0.16722	0.015;0.016	T	0.82240	-0.0555	10	0.49607	T	0.09	-16.4048	9.3909	0.38372	0.2412:0.5634:0.1954:0.0	.	192;164	E7EQF2;Q9UKG9	.;OCTC_HUMAN	C	192;164;164	ENSP00000413575:S192C;ENSP00000331981:S164C;ENSP00000411983:S164C	ENSP00000331981:S164C	S	+	2	0	CROT	86829048	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	3.006000	0.49529	2.783000	0.95769	0.655000	0.94253	TCT		0.323	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151		5	90	0	0	0	0.000602	0	5	90				
MUC17	140453	broad.mit.edu	37	7	100679181	100679181	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:100679181C>T	ENST00000306151.4	+	3	4548	c.4484C>T	c.(4483-4485)tCt>tTt	p.S1495F		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1495	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGTTCATCTCCTACACCT	0.502																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(4483-4485)TCT>TTT		mucin 17 precursor							172.0	170.0	171.0					7																	100679181		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100679181C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4484C>T	7.37:g.100679181C>T	ENSP00000302716:p.Ser1495Phe					MUC17_uc010lho.1_RNA	p.S1495F	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	4537	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1495			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|23.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.4484C>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	0.654	-0.808426	0.02819	.	.	ENSG00000169876	ENST00000306151	T	0.02682	4.2	1.19	-1.12	0.09808	.	.	.	.	.	T	0.01661	0.0053	N	0.17082	0.46	0.09310	N	1	B	0.24186	0.099	B	0.14578	0.011	T	0.46610	-0.9179	9	0.39692	T	0.17	.	1.7736	0.03017	0.3265:0.4317:0.0:0.2418	.	1495	Q685J3	MUC17_HUMAN	F	1495	ENSP00000302716:S1495F	ENSP00000302716:S1495F	S	+	2	0	MUC17	100465901	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.232000	0.17891	-0.339000	0.08401	0.134000	0.15878	TCT		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		58	244	0	0	0	0.00361	0	58	244				
RELN	5649	broad.mit.edu	37	7	103137192	103137192	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:103137192C>T	ENST00000428762.1	-	56	9133	c.8974G>A	c.(8974-8976)Gag>Aag	p.E2992K	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000343529.5_Missense_Mutation_p.E2992K|RELN_ENST00000424685.2_Missense_Mutation_p.E2992K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2992					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TAATCCATCTCATGGAGCAAA	0.408																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(8974-8976)GAG>AAG		reelin isoform a							83.0	80.0	81.0					7																	103137192		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103137192C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.8974G>A	7.37:g.103137192C>T	ENSP00000392423:p.Glu2992Lys					RELN_uc010liz.2_Missense_Mutation_p.E2992K	p.E2992K	NM_005045	NP_005036	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	56	9134	-			2992					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.8974G>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	34	5.400001	0.96030	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.26810	1.71;1.71;1.71	5.74	5.74	0.90152	Neuraminidase (2);	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	M	0.75615	2.305	0.80722	D	1	D;D	0.76494	0.999;0.959	D;D	0.77557	0.99;0.935	T	0.53781	-0.8390	10	0.59425	D	0.04	.	19.9329	0.97127	0.0:1.0:0.0:0.0	.	2992;2992	P78509-2;P78509	.;RELN_HUMAN	K	2992;2992;2992;509;2992	ENSP00000392423:E2992K;ENSP00000345694:E2992K;ENSP00000388446:E2992K	ENSP00000345694:E2992K	E	-	1	0	RELN	102924428	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.714000	0.92807	0.650000	0.86243	GAG		0.408	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		8	49	0	0	0	0.008291	0	8	49				
MET	4233	broad.mit.edu	37	7	116435970	116435970	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:116435970C>A	ENST00000318493.6	+	21	4206	c.4019C>A	c.(4018-4020)cCt>cAt	p.P1340H	MET_ENST00000539704.1_Missense_Mutation_p.P192H|MET_ENST00000397752.3_Missense_Mutation_p.P1322H			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TGCTGGCACCCTAAAGCCGAA	0.438			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		0				upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(3964-3966)CCT>CAT		met proto-oncogene isoform b precursor							118.0	109.0	112.0					7																	116435970		1909	4111	6020	SO:0001583	missense	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116435970C>A	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.4019C>A	7.37:g.116435970C>A	ENSP00000317272:p.Pro1340His					MET_uc010lkh.2_Missense_Mutation_p.P1340H|MET_uc011knj.1_Missense_Mutation_p.P892H	p.P1322H	NM_000245	NP_000236	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		21	4152	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	1322			Protein kinase.|Interaction with MUC20.|Interaction with RANBP9.|Cytoplasmic (Potential).		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	c.3965C>A	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934350	0.92458	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.34859	1.34;1.34;1.34	5.72	5.72	0.89469	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	N	0.04959	-0.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.56745	-0.7928	10	0.87932	D	0	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	1340;1322	P08581-2;P08581	.;MET_HUMAN	H	1322;1340;192	ENSP00000380860:P1322H;ENSP00000317272:P1340H;ENSP00000445020:P192H	ENSP00000317272:P1340H	P	+	2	0	MET	116223206	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.445000	0.80570	2.865000	0.98341	0.655000	0.94253	CCT		0.438	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			4	75	1	0	0.00909568	0.009096	0.0094563	4	75				
RNF133	168433	broad.mit.edu	37	7	122338615	122338615	+	Missense_Mutation	SNP	T	T	C	rs140861967		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:122338615T>C	ENST00000340112.2	-	1	595	c.358A>G	c.(358-360)Act>Gct	p.T120A	CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	120	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						CCCTTCTCAGTTGCCACTTTA	0.458																																					Colon(198;1778 2057 7449 19869 45985)	Colon(198;1778 2057 7449 19869 45985)	uc003vkj.1		NA																	0				skin(1)	1						c.(358-360)ACT>GCT		ring finger protein 133		T	,,,ALA/THR	0,4406		0,0,2203	133.0	132.0	133.0		,,,358	-1.2	0.0	7	dbSNP_134	133	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,intron,missense	CADPS2,RNF133	NM_001009571.3,NM_001167940.1,NM_017954.10,NM_139175.1	,,,58	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,,,benign	,,,120/377	122338615	1,13005	2203	4300	6503	SO:0001583	missense	168433					endoplasmic reticulum membrane|integral to membrane	ligase activity|zinc ion binding	g.chr7:122338615T>C	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.358A>G	7.37:g.122338615T>C	ENSP00000344489:p.Thr120Ala					CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron	p.T120A	NM_139175	NP_631914	Q8WVZ7	RN133_HUMAN			1	594	-			120			PA.		A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	c.358A>G	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	T	0.312	-0.967070	0.02232	0.0	1.16E-4	ENSG00000188050	ENST00000340112	T	0.05382	3.45	5.66	-1.19	0.09585	Protease-associated domain, PA (1);	0.821364	0.10627	N	0.652600	T	0.01287	0.0042	N	0.00190	-1.885	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.46119	-0.9214	10	0.08837	T	0.75	.	7.6246	0.28206	0.105:0.4574:0.0:0.4376	.	120	Q8WVZ7	RN133_HUMAN	A	120	ENSP00000344489:T120A	ENSP00000344489:T120A	T	-	1	0	RNF133	122125851	0.000000	0.05858	0.000000	0.03702	0.820000	0.46376	-0.037000	0.12164	-1.009000	0.03400	-1.447000	0.01057	ACT		0.458	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175		8	155	0	0	0	0.00308	0	8	155				
FLNC	2318	broad.mit.edu	37	7	128493015	128493015	+	Silent	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:128493015C>G	ENST00000325888.8	+	37	6399	c.6138C>G	c.(6136-6138)gtC>gtG	p.V2046V	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.V2013V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2046					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGGTGCGGGTCTGGGGCAAGG	0.617																																							uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(6136-6138)GTC>GTG		gamma filamin isoform a							50.0	57.0	55.0					7																	128493015		2048	4195	6243	SO:0001819	synonymous_variant	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128493015C>G	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6138C>G	7.37:g.128493015C>G						FLNC_uc003voa.3_Silent_p.V2013V	p.V2046V	NM_001458	NP_001449	Q14315	FLNC_HUMAN			37	6347	+			2046			Filamin 19.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	c.6138C>G	CCDS43644.1																																																																																				0.617	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			14	61	0	0	0	0.004007	0	14	61				
EXOC4	60412	broad.mit.edu	37	7	133164812	133164812	+	Missense_Mutation	SNP	C	C	T	rs545066605		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:133164812C>T	ENST00000253861.4	+	9	1366	c.1337C>T	c.(1336-1338)tCg>tTg	p.S446L	EXOC4_ENST00000539845.1_Missense_Mutation_p.S345L|EXOC4_ENST00000393161.2_Missense_Mutation_p.S446L	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	446					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				AGGTTCGAATCGTCCTCCCAT	0.483													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18499	0.0		0.0	False		,,,				2504	0.0						uc003vrk.2		NA																	0				ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.(1336-1338)TCG>TTG		SEC8 protein isoform a							185.0	154.0	165.0					7																	133164812		2203	4300	6503	SO:0001583	missense	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:133164812C>T	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1337C>T	7.37:g.133164812C>T	ENSP00000253861:p.Ser446Leu					EXOC4_uc011kpo.1_Missense_Mutation_p.S345L|EXOC4_uc003vri.2_Missense_Mutation_p.S446L|EXOC4_uc003vrj.2_Missense_Mutation_p.S446L	p.S446L	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN			9	1372	+		Esophageal squamous(399;0.129)	446					E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	c.1337C>T	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984762	0.74474	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000546185;ENST00000539845	.	.	.	5.91	5.91	0.95273	.	0.135532	0.51477	D	0.000083	T	0.50188	0.1601	L	0.50333	1.59	0.80722	D	1	P;P	0.49635	0.926;0.83	B;B	0.33960	0.173;0.077	T	0.53662	-0.8407	9	0.34782	T	0.22	.	19.8934	0.96939	0.0:1.0:0.0:0.0	.	446;446	Q96A65;Q8TAR2	EXOC4_HUMAN;.	L	446;446;65;345	.	ENSP00000253861:S446L	S	+	2	0	EXOC4	132815352	1.000000	0.71417	0.973000	0.42090	0.649000	0.38597	5.760000	0.68793	2.802000	0.96397	0.655000	0.94253	TCG		0.483	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		22	67	0	0	0	0.00278	0	22	67				
KEL	3792	broad.mit.edu	37	7	142641793	142641793	+	Silent	SNP	G	G	A	rs201720053		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:142641793G>A	ENST00000355265.2	-	12	1824	c.1350C>T	c.(1348-1350)ctC>ctT	p.L450L	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	450					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GGCGAGTGATGAGGGCATCCC	0.612																																							uc003wcb.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1348-1350)CTC>CTT		Kell blood group, metallo-endopeptidase							80.0	69.0	73.0					7																	142641793		2203	4300	6503	SO:0001819	synonymous_variant	3792				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr7:142641793G>A	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1350C>T	7.37:g.142641793G>A							p.L450L	NM_000420	NP_000411	P23276	KELL_HUMAN			12	1560	-	Melanoma(164;0.059)		450			Extracellular (Potential).		B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	37	c.1350C>T	CCDS34766.1																																																																																				0.612	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		7	25	0	0	0	0.004482	0	7	25				
OR6B1	135946	broad.mit.edu	37	7	143701741	143701741	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:143701741T>C	ENST00000408922.2	+	1	720	c.652T>C	c.(652-654)Tac>Cac	p.Y218H		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					TGTCCTGTCCTACGGATGCAT	0.463																																							uc003wdt.1		NA																	0				ovary(1)	1						c.(652-654)TAC>CAC		olfactory receptor, family 6, subfamily B,							204.0	194.0	197.0					7																	143701741		2013	4183	6196	SO:0001583	missense	135946				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143701741T>C		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.652T>C	7.37:g.143701741T>C	ENSP00000386151:p.Tyr218His						p.Y218H	NM_001005281	NP_001005281	O95007	OR6B1_HUMAN			1	652	+	Melanoma(164;0.0783)		218			Cytoplasmic (Potential).		A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	ENST00000408922.2	37	c.652T>C	CCDS43667.1	.	.	.	.	.	.	.	.	.	.	T	19.73	3.882190	0.72294	.	.	ENSG00000221813	ENST00000408922	T	0.00515	6.87	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33813	U	0.004539	T	0.03520	0.0101	H	0.97611	4.04	0.38081	D	0.936674	D	0.89917	1.0	D	0.97110	1.0	T	0.01156	-1.1434	10	0.87932	D	0	.	13.0076	0.58715	0.0:0.0:0.0:1.0	.	218	O95007	OR6B1_HUMAN	H	218	ENSP00000386151:Y218H	ENSP00000386151:Y218H	Y	+	1	0	OR6B1	143332674	0.994000	0.37717	0.960000	0.40013	0.798000	0.45092	2.934000	0.48956	2.167000	0.68274	0.533000	0.62120	TAC		0.463	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1			90	108	0	0	0	0.00361	0	90	108				
SLC4A2	6522	broad.mit.edu	37	7	150767303	150767303	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr7:150767303G>T	ENST00000485713.1	+	10	2359	c.1319G>T	c.(1318-1320)cGc>cTc	p.R440L	SLC4A2_ENST00000461735.1_Missense_Mutation_p.R426L|SLC4A2_ENST00000310317.5_Missense_Mutation_p.R358L|SLC4A2_ENST00000413384.2_Missense_Mutation_p.R440L|SLC4A2_ENST00000392826.2_Missense_Mutation_p.R431L	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	440					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCTTCCCCCGCAACATCTCA	0.632																																							uc003wit.3		NA																	0					0						c.(1318-1320)CGC>CTC		solute carrier family 4, anion exchanger, member							88.0	85.0	86.0					7																	150767303		2203	4300	6503	SO:0001583	missense	6522				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity	g.chr7:150767303G>T		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.1319G>T	7.37:g.150767303G>T	ENSP00000419412:p.Arg440Leu					SLC4A2_uc011kve.1_Missense_Mutation_p.R431L|SLC4A2_uc003wiu.3_Missense_Mutation_p.R426L|SLC4A2_uc003wiv.3_5'Flank	p.R440L	NM_003040	NP_003031	P04920	B3A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	10	1575	+			440			Cytoplasmic (Potential).		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	c.1319G>T	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	g	17.08	3.296925	0.60086	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	5.07	5.07	0.68467	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.211286	0.40222	N	0.001148	T	0.74496	0.3724	L	0.49126	1.545	0.80722	D	1	P;P;D	0.67145	0.841;0.847;0.996	B;P;D	0.66602	0.311;0.56;0.945	T	0.68085	-0.5502	10	0.12103	T	0.63	.	17.4395	0.87562	0.0:0.0:1.0:0.0	.	431;426;440	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	L	440;440;358;431;426	ENSP00000419412:R440L;ENSP00000405600:R440L;ENSP00000311402:R358L;ENSP00000376571:R431L;ENSP00000419164:R426L	ENSP00000311402:R358L	R	+	2	0	SLC4A2	150398236	1.000000	0.71417	0.795000	0.32087	0.561000	0.35649	9.308000	0.96247	2.528000	0.85240	0.550000	0.68814	CGC		0.632	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040		11	108	1	0	0.00010058	0.001368	0.000106923	11	108				
DPYSL2	1808	broad.mit.edu	37	8	26492307	26492307	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:26492307A>T	ENST00000311151.5	+	8	1114	c.702A>T	c.(700-702)gaA>gaT	p.E234D	DPYSL2_ENST00000521913.1_Missense_Mutation_p.E198D|DPYSL2_ENST00000523027.1_Missense_Mutation_p.E198D|DPYSL2_ENST00000521983.1_3'UTR	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	234					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)			breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		TCGAGGCCGAAGCCGTGAATC	0.572																																							uc003xfb.1		NA																	0				large_intestine(1)	1						c.(700-702)GAA>GAT		dihydropyrimidinase-like 2							144.0	117.0	126.0					8																	26492307		2203	4300	6503	SO:0001583	missense	1808				axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding	g.chr8:26492307A>T	D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.702A>T	8.37:g.26492307A>T	ENSP00000309539:p.Glu234Asp					DPYSL2_uc003xfa.2_Missense_Mutation_p.E339D|DPYSL2_uc011lag.1_Missense_Mutation_p.E234D|DPYSL2_uc010luk.1_RNA|DPYSL2_uc011lah.1_Missense_Mutation_p.E198D	p.E234D	NM_001386	NP_001377	Q16555	DPYL2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)	8	1052	+		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)	234					A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	37	c.702A>T	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.465402	0.43839	.	.	ENSG00000092964	ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68	5.8	-3.08	0.05347	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.91085	0.7194	M	0.90542	3.125	0.53688	D	0.999976	B;B;B	0.26577	0.153;0.0;0.0	B;B;B	0.30251	0.113;0.002;0.003	D	0.85208	0.1019	10	0.87932	D	0	-23.8506	14.7137	0.69251	0.5183:0.0:0.4817:0.0	.	234;234;290	Q53ET2;Q16555;Q59GB4	.;DPYL2_HUMAN;.	D	198;234;234;198	ENSP00000427985:E198D;ENSP00000309539:E234D;ENSP00000428909:E234D;ENSP00000431117:E198D	ENSP00000309539:E234D	E	+	3	2	DPYSL2	26548224	1.000000	0.71417	0.859000	0.33776	0.166000	0.22503	1.365000	0.34182	-0.389000	0.07786	-0.366000	0.07423	GAA		0.572	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386		18	106	0	0	0	0.001882	0	18	106				
ANK1	286	broad.mit.edu	37	8	41581127	41581127	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:41581127C>T	ENST00000347528.4	-	8	819	c.736G>A	c.(736-738)Gcc>Acc	p.A246T	ANK1_ENST00000352337.4_Missense_Mutation_p.A246T|ANK1_ENST00000265709.8_Missense_Mutation_p.A279T|ANK1_ENST00000289734.7_Missense_Mutation_p.A246T|ANK1_ENST00000396942.1_Missense_Mutation_p.A246T|ANK1_ENST00000396945.1_Missense_Mutation_p.A246T|ANK1_ENST00000379758.2_Missense_Mutation_p.A246T	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	246	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A246T(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTGCGGGAGGCGATGTGCAGT	0.632																																							uc003xok.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(736-738)GCC>ACC		ankyrin 1 isoform 1							105.0	75.0	85.0					8																	41581127		2203	4300	6503	SO:0001583	missense	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41581127C>T	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.736G>A	8.37:g.41581127C>T	ENSP00000339620:p.Ala246Thr					NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Missense_Mutation_p.A246T|ANK1_uc003xoj.2_Missense_Mutation_p.A246T|ANK1_uc003xol.2_Missense_Mutation_p.A246T|ANK1_uc003xom.2_Missense_Mutation_p.A279T	p.A246T	NM_020476	NP_065209	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		8	820	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	246			ANK 7.|89 kDa domain.		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	c.736G>A	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	36	5.725632	0.96847	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	D;D;D;D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56	5.28	5.28	0.74379	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.93913	0.8052	H	0.94345	3.525	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.992;0.986;0.999	D	0.95410	0.8497	10	0.87932	D	0	.	18.9173	0.92510	0.0:1.0:0.0:0.0	.	279;246;246;246;246	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	T	246;246;246;246;246;246;279;246	ENSP00000339620:A246T;ENSP00000289734:A246T;ENSP00000369082:A246T;ENSP00000380149:A246T;ENSP00000380147:A246T;ENSP00000309131:A246T;ENSP00000265709:A279T	ENSP00000265709:A279T	A	-	1	0	ANK1	41700284	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.468000	0.83385	0.561000	0.74099	GCC		0.632	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		13	72	0	0	0	0.00245	0	13	72				
KAT6A	7994	broad.mit.edu	37	8	41791420	41791420	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:41791420C>A	ENST00000396930.3	-	18	4861	c.4318G>T	c.(4318-4320)Gag>Tag	p.E1440*	KAT6A_ENST00000265713.2_Nonsense_Mutation_p.E1440*|KAT6A_ENST00000406337.1_Nonsense_Mutation_p.E1440*	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1440					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TAGGCGCCCTCATGCTCACTG	0.507																																							uc010lxb.2		NA																	0				ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(4318-4320)GAG>TAG		MYST histone acetyltransferase (monocytic							119.0	110.0	113.0					8																	41791420		2203	4300	6503	SO:0001587	stop_gained	7994				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr8:41791420C>A	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4318G>T	8.37:g.41791420C>A	ENSP00000380136:p.Glu1440*					MYST3_uc010lxc.2_Nonsense_Mutation_p.E1440*|MYST3_uc003xon.3_Nonsense_Mutation_p.E1440*	p.E1440*	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)		18	4862	-	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	1440					Q76L81	Nonsense_Mutation	SNP	ENST00000396930.3	37	c.4318G>T	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	46	12.245070	0.99650	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	.	.	.	5.96	5.96	0.96718	.	0.064498	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-23.8842	20.4043	0.99006	0.0:1.0:0.0:0.0	.	.	.	.	X	1440	.	ENSP00000265713:E1440X	E	-	1	0	KAT6A	41910577	1.000000	0.71417	0.953000	0.39169	0.497000	0.33675	5.603000	0.67619	2.823000	0.97156	0.650000	0.86243	GAG		0.507	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		72	111	1	0	5.72124e-26	0.00361	6.95986e-26	72	111				
PDE7A	5150	broad.mit.edu	37	8	66753652	66753652	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:66753652G>C	ENST00000401827.3	-	1	535	c.92C>G	c.(91-93)tCc>tGc	p.S31C	CTD-2532N20.1_ENST00000607622.1_lincRNA|PDE7A_ENST00000396642.3_Missense_Mutation_p.S31C	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	31	Poly-Ser.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	AGCGGAGCTGGAGCTGAAGCT	0.632																																							uc003xvq.2		NA																	0					0						c.(91-93)TCC>TGC		phosphodiesterase 7A isoform b	Dyphylline(DB00651)|Ketotifen(DB00920)						15.0	21.0	19.0					8																	66753652		1952	4152	6104	SO:0001583	missense	5150					cell fraction|cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding	g.chr8:66753652G>C	L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.92C>G	8.37:g.66753652G>C	ENSP00000385632:p.Ser31Cys					PDE7A_uc003xvr.2_Missense_Mutation_p.S31C	p.S31C	NM_002604	NP_002595	Q13946	PDE7A_HUMAN	Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		1	104	-			31			Poly-Ser.		A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Missense_Mutation	SNP	ENST00000401827.3	37	c.92C>G	CCDS56538.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415385	0.83449	.	.	ENSG00000205268	ENST00000401827;ENST00000396642	T;T	0.79033	-1.23;-1.23	4.12	3.24	0.37175	.	.	.	.	.	T	0.77143	0.4087	L	0.50333	1.59	0.33313	D	0.566299	P;P	0.41848	0.763;0.651	P;B	0.46585	0.521;0.221	T	0.82341	-0.0505	9	0.87932	D	0	.	11.7515	0.51852	0.0878:0.0:0.9122:0.0	.	31;31	Q13946-3;Q13946	.;PDE7A_HUMAN	C	31	ENSP00000385632:S31C;ENSP00000379881:S31C	ENSP00000379881:S31C	S	-	2	0	PDE7A	66916206	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	6.053000	0.71089	0.711000	0.32018	0.557000	0.71058	TCC		0.632	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378905.1			7	35	0	0	0	0.001984	0	7	35				
TPD52	7163	broad.mit.edu	37	8	80976821	80976821	+	Silent	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:80976821C>T	ENST00000379097.3	-	2	509	c.147G>A	c.(145-147)ctG>ctA	p.L49L	TPD52_ENST00000537855.1_Silent_p.L49L|TPD52_ENST00000517427.1_Silent_p.L49L|TPD52_ENST00000519303.2_5'UTR|TPD52_ENST00000379096.5_Silent_p.L9L|TPD52_ENST00000520527.1_Silent_p.L49L|TPD52_ENST00000518937.1_Silent_p.L9L|TPD52_ENST00000448733.2_Silent_p.L49L	NM_001025252.1	NP_001020423.1	P55327	TPD52_HUMAN	tumor protein D52	49					anatomical structure morphogenesis (GO:0009653)|B cell differentiation (GO:0030183)|positive regulation of cell proliferation (GO:0008284)|secretion (GO:0046903)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			GGTCTGTTCTCAGCAGACCTG	0.463																																							uc003ybr.1		NA																	0				ovary(1)	1						c.(145-147)CTG>CTA		tumor protein D52 isoform 1							137.0	128.0	131.0					8																	80976821		2203	4300	6503	SO:0001819	synonymous_variant	7163				anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity	g.chr8:80976821C>T	U18914	CCDS34912.1, CCDS47879.1, CCDS55249.1, CCDS75757.1, CCDS75758.1, CCDS75759.1	8q21.13	2014-06-24			ENSG00000076554	ENSG00000076554			12005	protein-coding gene	gene with protein product		604068				7796418	Standard	NM_001287144		Approved	D52, hD52, N8L	uc003ybr.1	P55327	OTTHUMG00000164565	ENST00000379097.3:c.147G>A	8.37:g.80976821C>T						TPD52_uc010lzr.2_RNA|TPD52_uc010lzs.1_RNA|TPD52_uc003ybs.1_Silent_p.L9L|TPD52_uc003ybt.1_Silent_p.L9L|TPD52_uc003ybq.1_RNA|TPD52_uc003ybu.1_RNA	p.L49L	NM_001025252	NP_001020423	P55327	TPD52_HUMAN	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)		2	469	-	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	49					B7Z414|C9J502|D0UFD1|D0UFD2|D0UFD3|D0UFD4|D0UFD5|E5RKB4|Q13056|Q53EK8|Q6FGP3|Q6FGS3|Q86YZ2|Q9UCX8	Silent	SNP	ENST00000379097.3	37	c.147G>A	CCDS34912.1																																																																																				0.463	TPD52-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379539.2	NM_005079		17	90	0	0	0	0.007413	0	17	90				
DCAF4L2	138009	broad.mit.edu	37	8	88885129	88885129	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:88885129G>A	ENST00000319675.3	-	1	1167	c.1071C>T	c.(1069-1071)ccC>ccT	p.P357P		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	357										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TCTCCGAGGCGGGGTATGGGG	0.617																																							uc003ydz.2		NA																	0				ovary(1)	1						c.(1069-1071)CCC>CCT		WD repeat domain 21C							76.0	84.0	81.0					8																	88885129		2203	4300	6503	SO:0001819	synonymous_variant	138009							g.chr8:88885129G>A	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.1071C>T	8.37:g.88885129G>A							p.P357P	NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN			1	1168	-			357						Silent	SNP	ENST00000319675.3	37	c.1071C>T	CCDS6245.1																																																																																				0.617	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		36	50	0	0	0	0.002836	0	36	50				
NBN	4683	broad.mit.edu	37	8	90983437	90983437	+	Silent	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:90983437G>A	ENST00000265433.3	-	6	820	c.666C>T	c.(664-666)ttC>ttT	p.F222F	NBN_ENST00000409330.1_Silent_p.F140F	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	222	Interaction with MTOR, MAPKAP1 and RICTOR.|Mediates interaction with SP100. {ECO:0000250}.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTTTCCCTTTGAAGATTTGTT	0.289								Homologous recombination																															uc003yej.1		NA																	0				central_nervous_system(3)|kidney(3)|lung(1)	7						c.(664-666)TTC>TTT	Direct_reversal_of_damage|Homologous_recombination	nibrin							67.0	67.0	67.0					8																	90983437		2201	4297	6498	SO:0001819	synonymous_variant	4683	Nijmegen_Breakage_syndrome			cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding	g.chr8:90983437G>A	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.666C>T	8.37:g.90983437G>A						NBN_uc003yei.1_Silent_p.F140F|NBN_uc011lgb.1_Silent_p.F222F	p.F222F	NM_002485	NP_002476	O60934	NBN_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0344)		6	776	-			222					B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Silent	SNP	ENST00000265433.3	37	c.666C>T	CCDS6249.1																																																																																				0.289	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3	NM_001024688		5	25	0	0	0	0.000602	0	5	25				
WISP1	8840	broad.mit.edu	37	8	134233066	134233066	+	Missense_Mutation	SNP	C	C	A	rs560735095		TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr8:134233066C>A	ENST00000250160.6	+	3	698	c.592C>A	c.(592-594)Cgt>Agt	p.R198S	WISP1_ENST00000377863.2_Intron|WISP1_ENST00000517423.1_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	198					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GACCGCACCCCGTGACACAGG	0.642																																							uc003yub.2		NA																	0				central_nervous_system(1)|kidney(1)	2						c.(592-594)CGT>AGT		WNT1 inducible signaling pathway protein 1							28.0	26.0	27.0					8																	134233066		2198	4296	6494	SO:0001583	missense	8840				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding	g.chr8:134233066C>A	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.592C>A	8.37:g.134233066C>A	ENSP00000250160:p.Arg198Ser					WISP1_uc003yuc.2_Intron|WISP1_uc010meb.2_Intron|WISP1_uc010mec.2_Intron|WISP1_uc010med.2_Intron|WISP1_uc003yud.2_Intron	p.R198S	NM_003882	NP_003873	O95388	WISP1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0107)		3	668	+	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		198					A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	ENST00000250160.6	37	c.592C>A	CCDS6371.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054519	0.36277	.	.	ENSG00000104415	ENST00000250160	T	0.78816	-1.21	4.76	2.86	0.33363	.	1.534980	0.03979	N	0.293020	T	0.57799	0.2078	N	0.08118	0	0.80722	D	1	P	0.45428	0.858	B	0.32393	0.145	T	0.40942	-0.9536	10	0.48119	T	0.1	-25.8686	9.4061	0.38462	0.0:0.7744:0.144:0.0815	.	198	O95388	WISP1_HUMAN	S	198	ENSP00000250160:R198S	ENSP00000250160:R198S	R	+	1	0	WISP1	134302248	0.962000	0.33011	0.002000	0.10522	0.021000	0.10359	1.689000	0.37700	0.377000	0.24735	0.557000	0.71058	CGT		0.642	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882		17	40	1	0	1.99824e-07	0.00499	2.19341e-07	17	40				
SH3GL2	6456	broad.mit.edu	37	9	17789495	17789495	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr9:17789495G>A	ENST00000380607.4	+	6	691	c.571G>A	c.(571-573)Gat>Aat	p.D191N	SH3GL2_ENST00000537391.1_Missense_Mutation_p.D144N	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	191	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		AGAGAAATTTGATGAGTCTAA	0.408																																							uc003zna.2		NA																	0				skin(1)	1						c.(571-573)GAT>AAT		SH3-domain GRB2-like 2							101.0	101.0	101.0					9																	17789495		2203	4300	6503	SO:0001583	missense	6456				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding	g.chr9:17789495G>A	X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.571G>A	9.37:g.17789495G>A	ENSP00000369981:p.Asp191Asn					SH3GL2_uc011lmx.1_Missense_Mutation_p.D156N|SH3GL2_uc011lmy.1_Missense_Mutation_p.D144N	p.D191N	NM_003026	NP_003017	Q99962	SH3G2_HUMAN		GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)	6	859	+			191			BAR.|Potential.		B2R618|Q9NQK5	Missense_Mutation	SNP	ENST00000380607.4	37	c.571G>A	CCDS6483.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688988	0.88735	.	.	ENSG00000107295	ENST00000397481;ENST00000380607;ENST00000537391	T;T	0.65178	-0.14;-0.14	5.99	5.99	0.97316	BAR (3);	0.051336	0.64402	D	0.000001	T	0.67363	0.2885	M	0.72118	2.19	0.80722	D	1	B;B	0.30281	0.015;0.275	B;B	0.32583	0.028;0.148	T	0.66567	-0.5891	10	0.62326	D	0.03	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	156;191	B7Z7W3;Q99962	.;SH3G2_HUMAN	N	169;191;144	ENSP00000369981:D191N;ENSP00000443365:D144N	ENSP00000369981:D191N	D	+	1	0	SH3GL2	17779495	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.938000	0.87678	2.840000	0.97914	0.655000	0.94253	GAT		0.408	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026		14	18	0	0	0	0.00245	0	14	18				
TAF1L	138474	broad.mit.edu	37	9	32634735	32634735	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr9:32634735C>G	ENST00000242310.4	-	1	932	c.843G>C	c.(841-843)aaG>aaC	p.K281N	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	281					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GCTTCTTCCTCTTTCTCCGAG	0.463																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(841-843)AAG>AAC		TBP-associated factor RNA polymerase 1-like							165.0	150.0	155.0					9																	32634735		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32634735C>G	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.843G>C	9.37:g.32634735C>G	ENSP00000418379:p.Lys281Asn					uc003zrh.1_RNA	p.K281N	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	933	-			281					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.843G>C	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258218	0.39896	.	.	ENSG00000122728	ENST00000242310	T	0.09350	2.99	1.04	-0.0542	0.13815	.	0.000000	0.85682	D	0.000000	T	0.14399	0.0348	M	0.69823	2.125	0.44643	D	0.997624	P	0.46020	0.871	P	0.47470	0.548	T	0.03463	-1.1034	10	0.54805	T	0.06	.	4.9434	0.13976	0.0:0.7269:0.0:0.2731	.	281	Q8IZX4	TAF1L_HUMAN	N	281	ENSP00000418379:K281N	ENSP00000418379:K281N	K	-	3	2	TAF1L	32624735	1.000000	0.71417	0.994000	0.49952	0.791000	0.44710	0.668000	0.25127	0.507000	0.28148	0.195000	0.17529	AAG		0.463	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			4	95	0	0	0	0.009096	0	4	95				
SPATA31C2	645961	broad.mit.edu	37	9	90748512	90748512	+	IGR	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr9:90748512T>A								U6 (135262 upstream) : U3 (240671 downstream)																							GCCTTACCTCTCAGACTGTGG	0.547																																							uc011lti.1		NA																	0					NA						c.(262-264)AGA>TGA		SubName: Full=cDNA FLJ59639;							54.0	60.0	58.0					9																	90748512		692	1591	2283	SO:0001628	intergenic_variant	0							g.chr9:90748512T>A																													9.37:g.90748512T>A							p.R88*							2	291	-									Nonsense_Mutation	SNP		37	c.262A>T																																																																																				0	0.547									34	38	0	0	0	0.00361	0	34	38				
TLR4	7099	broad.mit.edu	37	9	120476775	120476775	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr9:120476775G>A	ENST00000355622.6	+	3	2470	c.2369G>A	c.(2368-2370)aGc>aAc	p.S790N	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.S750N	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	790	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	CGCCTTCTCAGCAGGAACACT	0.547																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(2368-2370)AGC>AAC		toll-like receptor 4 precursor							77.0	77.0	77.0					9																	120476775		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120476775G>A	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2369G>A	9.37:g.120476775G>A	ENSP00000363089:p.Ser790Asn					TLR4_uc004bka.2_Missense_Mutation_p.S750N|TLR4_uc004bkb.2_Missense_Mutation_p.S590N	p.S790N	NM_138554	NP_612564	O00206	TLR4_HUMAN			3	2660	+			790			Cytoplasmic (Potential).|TIR.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.2369G>A	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	9.910	1.209365	0.22289	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.07908	3.15;3.15	5.91	-5.06	0.02946	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.791255	0.12376	N	0.474339	T	0.04137	0.0115	N	0.11756	0.17	0.09310	N	0.999998	B	0.06786	0.001	B	0.13407	0.009	T	0.43686	-0.9376	10	0.15952	T	0.53	.	13.7875	0.63119	0.5934:0.0:0.4066:0.0	.	790	O00206	TLR4_HUMAN	N	750;790	ENSP00000377997:S750N;ENSP00000363089:S790N	ENSP00000363089:S790N	S	+	2	0	TLR4	119516596	0.152000	0.22762	0.833000	0.33012	0.800000	0.45204	0.125000	0.15749	-0.770000	0.04614	-0.345000	0.07892	AGC		0.547	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		5	86	0	0	0	0.000602	0	5	86				
KCNT1	57582	broad.mit.edu	37	9	138683691	138683691	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr9:138683691C>A	ENST00000263604.3	+	30	3536	c.3536C>A	c.(3535-3537)cCt>cAt	p.P1179H	KCNT1_ENST00000487664.1_Missense_Mutation_p.P1160H|KCNT1_ENST00000486577.2_Missense_Mutation_p.P1162H|KCNT1_ENST00000371757.2_Missense_Mutation_p.P1184H|KCNT1_ENST00000298480.5_Missense_Mutation_p.P1205H|KCNT1_ENST00000488444.2_Missense_Mutation_p.P1184H|KCNT1_ENST00000491806.2_Missense_Mutation_p.P1170H|KCNT1_ENST00000490355.2_Missense_Mutation_p.P1183H			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	1179					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CTCATCAACCCTCCGCCCGAC	0.642																																							uc011mdq.1		NA																	0				large_intestine(2)|ovary(1)|pancreas(1)	4						c.(3550-3552)CCT>CAT		potassium channel, subfamily T, member 1							136.0	122.0	127.0					9																	138683691		2203	4300	6503	SO:0001583	missense	57582					membrane	binding|calcium-activated potassium channel activity	g.chr9:138683691C>A	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.3536C>A	9.37:g.138683691C>A	ENSP00000263604:p.Pro1179His					KCNT1_uc011mdr.1_Missense_Mutation_p.P1032H|KCNT1_uc010nbf.2_Missense_Mutation_p.P1160H	p.P1184H	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)	30	3625	+		Myeloproliferative disorder(178;0.0821)	1184					B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37	c.3551C>A		.	.	.	.	.	.	.	.	.	.	C	17.93	3.509342	0.64522	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.74421	-0.59;-0.38;-0.84;-0.61	5.24	5.24	0.73138	.	0.000000	0.85682	U	0.000000	D	0.87358	0.6157	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.88977	0.3405	10	0.87932	D	0	-33.8941	18.8119	0.92061	0.0:1.0:0.0:0.0	.	1172;1184;1160	C9JYL2;B9EGP2;G5E9V0	.;.;.	H	1160;1205;1184;1164;1172;1186;1184;1179	ENSP00000417851:P1160H;ENSP00000298480:P1205H;ENSP00000360822:P1184H;ENSP00000263604:P1179H	ENSP00000263604:P1179H	P	+	2	0	KCNT1	137823512	1.000000	0.71417	0.979000	0.43373	0.079000	0.17450	7.609000	0.82925	2.438000	0.82558	0.655000	0.94253	CCT		0.642	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822		47	32	1	0	1.63038e-21	0.00361	1.95314e-21	47	32				
FAM47C	442444	broad.mit.edu	37	X	37028517	37028517	+	Silent	SNP	C	C	G			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chrX:37028517C>G	ENST00000358047.3	+	1	2086	c.2034C>G	c.(2032-2034)ctC>ctG	p.L678L		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	678										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TGTCCCATCTCTGCCCGGAGC	0.642																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(2032-2034)CTC>CTG		hypothetical protein LOC442444							22.0	21.0	21.0					X																	37028517		2163	4227	6390	SO:0001819	synonymous_variant	442444							g.chrX:37028517C>G	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2034C>G	X.37:g.37028517C>G							p.L678L	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	2048	+			678					Q6ZU46	Silent	SNP	ENST00000358047.3	37	c.2034C>G	CCDS35227.1																																																																																				0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		8	44	0	0	0	0.004482	0	8	44				
DYNLT3	6990	broad.mit.edu	37	X	37700311	37700311	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chrX:37700311T>A	ENST00000378578.4	-	4	370	c.244A>T	c.(244-246)Agc>Tgc	p.S82C	DYNLT3_ENST00000432389.2_Missense_Mutation_p.S88C|TM4SF2_ENST00000465127.1_Intron|DYNLT3_ENST00000378581.3_Missense_Mutation_p.S82C	NM_006520.2	NP_006511.1	P51808	DYLT3_HUMAN	dynein, light chain, Tctex-type 3	82					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)|transport (GO:0006810)	cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	motor activity (GO:0003774)			endometrium(1)|lung(1)|skin(1)	3						AAACAGGAGCTGGCTGTGTGA	0.423																																							uc004dds.2		NA																	0					0						c.(244-246)AGC>TGC		dynein, light chain, Tctex-type 3							91.0	82.0	85.0					X																	37700311		2201	4300	6501	SO:0001583	missense	6990				cell division|mitosis|regulation of mitotic cell cycle|transport	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|nucleus|plasma membrane	motor activity	g.chrX:37700311T>A	U02556	CCDS14243.1	Xp21	2013-01-18	2005-11-25	2005-11-25	ENSG00000165169	ENSG00000165169		"""Cytoplasmic dyneins"""	11694	protein-coding gene	gene with protein product		300302	"""t-complex-associated-testis-expressed 1-like"""	TCTE1L		8004092	Standard	NM_006520		Approved	TCTEX1L	uc004dds.3	P51808	OTTHUMG00000033172	ENST00000378578.4:c.244A>T	X.37:g.37700311T>A	ENSP00000367841:p.Ser82Cys						p.S82C	NM_006520	NP_006511	P51808	DYLT3_HUMAN			4	370	-			82					Q6ICS3	Missense_Mutation	SNP	ENST00000378578.4	37	c.244A>T	CCDS14243.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.329322	0.81690	.	.	ENSG00000165169	ENST00000378581;ENST00000378578;ENST00000432389	T;T;T	0.36340	1.26;1.26;1.26	5.57	5.57	0.84162	.	0.039128	0.85682	D	0.000000	T	0.56485	0.1988	M	0.71920	2.185	0.45899	D	0.998746	D	0.76494	0.999	D	0.66716	0.946	T	0.59010	-0.7534	10	0.52906	T	0.07	-23.3804	12.3476	0.55130	0.0:0.0:0.0:1.0	.	82	P51808	DYLT3_HUMAN	C	82;82;88	ENSP00000367844:S82C;ENSP00000367841:S82C;ENSP00000402695:S88C	ENSP00000367841:S82C	S	-	1	0	DYNLT3	37585255	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.979000	0.76154	1.972000	0.57404	0.481000	0.45027	AGC		0.423	DYNLT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080876.1	NM_006520		9	28	0	0	0	0.000978	0	9	28				
TRO	7216	broad.mit.edu	37	X	54955213	54955213	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chrX:54955213G>A	ENST00000173898.7	+	12	2168	c.2056G>A	c.(2056-2058)Gac>Aac	p.D686N	TRO_ENST00000420798.2_Missense_Mutation_p.D217N|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000319167.8_Intron|TRO_ENST00000375041.2_Missense_Mutation_p.D289N	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	686					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CATGGATATCGACTGCCTAAC	0.542																																							uc004dtq.2		NA																	0				ovary(1)	1						c.(2056-2058)GAC>AAC		trophinin isoform 5							57.0	60.0	59.0					X																	54955213		2094	4226	6320	SO:0001583	missense	7216				embryo implantation|homophilic cell adhesion	integral to plasma membrane		g.chrX:54955213G>A	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.2056G>A	X.37:g.54955213G>A	ENSP00000173898:p.Asp686Asn					TRO_uc004dts.2_Intron|TRO_uc004dtr.2_Intron|TRO_uc004dtt.2_Intron|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Missense_Mutation_p.D217N|TRO_uc004dtw.2_Missense_Mutation_p.D289N|TRO_uc004dtx.2_Missense_Mutation_p.D69N	p.D686N	NM_001039705	NP_001034794	Q12816	TROP_HUMAN			12	2163	+			686					B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	c.2056G>A	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	G	1.211	-0.629740	0.03610	.	.	ENSG00000067445	ENST00000173898;ENST00000420798;ENST00000375041	T;T;T	0.06849	4.02;3.25;3.55	2.95	0.0358	0.14189	.	.	.	.	.	T	0.02193	0.0068	N	0.02011	-0.69	0.19300	N	0.999971	B;B	0.18310	0.027;0.027	B;B	0.08055	0.003;0.003	T	0.45891	-0.9230	9	0.09084	T	0.74	.	2.6259	0.04929	0.4009:0.0:0.3827:0.2164	.	289;686	B1AKE9;Q12816	.;TROP_HUMAN	N	686;217;289	ENSP00000173898:D686N;ENSP00000405126:D217N;ENSP00000364181:D289N	ENSP00000173898:D686N	D	+	1	0	TRO	54971938	0.041000	0.20044	0.322000	0.25334	0.389000	0.30415	2.030000	0.41108	-0.110000	0.12022	-0.330000	0.08379	GAC		0.542	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		14	9	0	0	0	0.001855	0	14	9				
WASH6P	653440	broad.mit.edu	37	X	155254706	155254706	+	RNA	SNP	C	C	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chrX:155254706C>T	ENST00000461007.1	+	0	3622				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.T415M(2)									GTGAGAGCCACGAGCCAAGGT	0.637													c|||	392	0.0782748	0.0121	0.2233	5008	,	,		28320	0.0615		0.1352	False		,,,				2504	0.0235						uc004fnx.3		NA																	2	Substitution - Missense(2)		kidney(2)		NA						c.(601-603)ACG>ATG		WAS protein family homolog 1																																						0							g.chrX:155254706C>T	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254706C>T							p.T201M	NM_182905	NP_878908					8	1056	+								A6NGF1|Q8N305	Missense_Mutation	SNP	ENST00000461007.1	37	c.602C>T		.	.	.	.	.	.	.	.	.	.	c	13.63	2.293922	0.40594	.	.	ENSG00000182484	ENST00000359512;ENST00000285718	.	.	.	0.379	0.379	0.16213	.	0.155800	0.56097	N	0.000022	T	0.38983	0.1061	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28586	-1.0039	6	0.62326	D	0.03	-19.9253	6.473	0.22020	0.0:0.9998:0.0:2.0E-4	.	.	.	.	M	415;384	.	ENSP00000285718:T384M	T	+	2	0	WASH6P	154907900	0.648000	0.27313	0.679000	0.29978	0.260000	0.26232	2.495000	0.45337	0.418000	0.25898	0.171000	0.16805	ACG		0.637	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1	NG_008380		4	7	0	0	0	0.000602	0	4	7				
TECTA	7007	broad.mit.edu	37	11	121000388	121000388	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr11:121000388delG	ENST00000392793.1	+	10	2680	c.2409delG	c.(2407-2409)tcgfs	p.S803fs	TECTA_ENST00000264037.2_Frame_Shift_Del_p.S803fs			O75443	TECTA_HUMAN	tectorin alpha	803	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCCATCCTTCGGGGAAGCTGG	0.438																																							uc010rzo.1		NA																	0				breast(6)|ovary(2)|skin(2)	10						c.(2407-2409)TCGfs		tectorin alpha precursor							153.0	154.0	154.0					11																	121000388		2203	4299	6502	SO:0001589	frameshift_variant	7007				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr11:121000388delG	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2409delG	11.37:g.121000388delG	ENSP00000376543:p.Ser803fs						p.S803fs	NM_005422	NP_005413	O75443	TECTA_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)	9	2409	+	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)	803			VWFD 2.			Frame_Shift_Del	DEL	ENST00000392793.1	37	c.2409delG	CCDS8434.1																																																																																				0.438	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422		50	124	NA	NA	NA	NA	NA	50	124	---	---	---	---
UBC	7316	broad.mit.edu	37	12	125397413	125397414	+	Frame_Shift_Ins	INS	-	-	T			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr12:125397413_125397414insT	ENST00000536769.1	-	1	2480_2481	c.904_905insA	c.(904-906)agafs	p.R302fs	UBC_ENST00000339647.5_Frame_Shift_Ins_p.R302fs|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000538617.1_Intron|UBC_ENST00000546120.1_Frame_Shift_Ins_p.R226fs|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	302	Ubiquitin-like 4. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CATCCCACCTCTGAGACGGAGC	0.53																																							uc001ugs.3		NA																	0				ovary(2)	2						c.(904-906)AGAfs		ubiquitin C																																				SO:0001589	frameshift_variant	7316				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding	g.chr12:125397413_125397414insT		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.905dupA	12.37:g.125397414_125397414dupT	ENSP00000441543:p.Arg302fs					UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Frame_Shift_Ins_p.R302fs|UBC_uc001ugt.2_Frame_Shift_Ins_p.R302fs|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_Frame_Shift_Ins_p.R150fs	p.R302fs	NM_021009	NP_066289	P0CG48	UBC_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)	2	1352_1353	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		302			Ubiquitin-like 4.		P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Frame_Shift_Ins	INS	ENST00000536769.1	37	c.904_905insA	CCDS9260.1																																																																																				0.530	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009		11	233	NA	NA	NA	NA	NA	11	233	---	---	---	---
RIF1	55183	broad.mit.edu	37	2	152330523	152330524	+	Frame_Shift_Ins	INS	-	-	A			TCGA-78-7149-01A-11D-2036-08	TCGA-78-7149-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b4e21232-2edd-413b-aca5-f1db86fbdda9	0fd5c9a4-bf18-487c-8ada-873b032ac3da	g.chr2:152330523_152330524insA	ENST00000243326.5	+	34	7624_7625	c.7141_7142insA	c.(7141-7143)gaafs	p.E2381fs	RIF1_ENST00000430328.2_Frame_Shift_Ins_p.E2355fs|RIF1_ENST00000428287.2_Frame_Shift_Ins_p.E2355fs|RIF1_ENST00000444746.2_Frame_Shift_Ins_p.E2381fs|RIF1_ENST00000453091.2_Frame_Shift_Ins_p.E2355fs			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TGATATTTCTGAAAAAACAGTA	0.317																																							uc002txm.2		NA																	0				ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15						c.(7141-7143)GAAfs		RAP1 interacting factor 1																																				SO:0001589	frameshift_variant	55183				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding	g.chr2:152330523_152330524insA	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.7147dupA	2.37:g.152330529_152330529dupA	ENSP00000243326:p.Glu2381fs					RIF1_uc002txl.2_Frame_Shift_Ins_p.E2355fs|RIF1_uc002txn.2_Frame_Shift_Ins_p.E2355fs|RIF1_uc002txo.2_Frame_Shift_Ins_p.E2355fs|RIF1_uc002txp.2_RNA|uc010fnw.1_5'Flank	p.E2381fs	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0429)	35	7271_7272	+			2381			Interaction with condensed chromosomes in telophase.		A0AVS0|Q9NS16	Frame_Shift_Ins	INS	ENST00000243326.5	37	c.7141_7142insA	CCDS2194.1																																																																																				0.317	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			20	93	NA	NA	NA	NA	NA	20	93	---	---	---	---
