#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PGD	5226	broad.mit.edu	37	1	10468178	10468178	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:10468178G>C	ENST00000270776.8	+	6	538	c.500G>C	c.(499-501)gGa>gCa	p.G167A	PGD_ENST00000538557.1_Missense_Mutation_p.G154A|PGD_ENST00000541529.1_Missense_Mutation_p.G145A	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	167					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	GTGGGAACTGGAGAACCCTGC	0.502																																							uc001arc.2		NA																	0				ovary(1)	1						c.(499-501)GGA>GCA		phosphogluconate dehydrogenase							176.0	174.0	174.0					1																	10468178		2203	4300	6503	SO:0001583	missense	5226				pentose-phosphate shunt, oxidative branch	cytosol	NADP binding|phosphogluconate dehydrogenase (decarboxylating) activity|protein binding	g.chr1:10468178G>C	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.500G>C	1.37:g.10468178G>C	ENSP00000270776:p.Gly167Ala					PGD_uc001ard.2_Missense_Mutation_p.E86Q|PGD_uc010oak.1_Missense_Mutation_p.G145A|PGD_uc010oal.1_Missense_Mutation_p.G154A	p.G167A	NM_002631	NP_002622	P52209	6PGD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	6	590	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	167					A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	ENST00000270776.8	37	c.500G>C	CCDS113.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374778	0.61735	.	.	ENSG00000142657	ENST00000541529;ENST00000543846;ENST00000270776;ENST00000538557	T;T;T	0.50548	0.75;0.74;0.75	5.06	5.06	0.68205	6-phosphogluconate dehydrogenase, NADP-binding (1);NAD(P)-binding domain (1);	0.107759	0.64402	D	0.000004	T	0.64864	0.2637	H	0.95470	3.675	0.80722	D	1	B;B	0.28233	0.204;0.047	B;B	0.31101	0.124;0.047	T	0.72818	-0.4178	10	0.87932	D	0	-10.6847	17.0083	0.86399	0.0:0.0:1.0:0.0	.	145;167	F5H7U0;P52209	.;6PGD_HUMAN	A	145;113;167;154	ENSP00000442285:G145A;ENSP00000270776:G167A;ENSP00000437822:G154A	ENSP00000270776:G167A	G	+	2	0	PGD	10390765	1.000000	0.71417	0.997000	0.53966	0.871000	0.50021	9.158000	0.94723	2.514000	0.84764	0.462000	0.41574	GGA		0.502	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005398.1	NM_002631		23	113	0	0	0	0.00278	0	23	113				
VPS13D	55187	broad.mit.edu	37	1	12383832	12383832	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:12383832G>C	ENST00000358136.3	+	35	8115	c.7985G>C	c.(7984-7986)tGt>tCt	p.C2662S	VPS13D_ENST00000356315.4_Missense_Mutation_p.C2662S	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTTTTGGCGTGTCAAGGTAAT	0.423																																							uc001atv.2		NA																	0				ovary(4)|pancreas(1)	5						c.(7984-7986)TGT>TCT		vacuolar protein sorting 13D isoform 1							123.0	112.0	115.0					1																	12383832		2203	4300	6503	SO:0001583	missense	55187				protein localization			g.chr1:12383832G>C	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7985G>C	1.37:g.12383832G>C	ENSP00000350854:p.Cys2662Ser					VPS13D_uc001atw.2_Missense_Mutation_p.C2662S|VPS13D_uc001atx.2_Missense_Mutation_p.C1850S|VPS13D_uc001aty.1_Missense_Mutation_p.C400S	p.C2662S	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	35	8126	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	2662			UBA.			Missense_Mutation	SNP	ENST00000358136.3	37	c.7985G>C	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.21|14.21	2.468394|2.468394	0.43839|0.43839	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000356315;ENST00000358136|ENST00000011700	T;T|.	0.22134|.	1.97;1.97|.	5.61|5.61	5.61|5.61	0.85477|0.85477	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);|.	0.442246|.	0.26241|.	N|.	0.025516|.	T|T	0.58509|0.58509	0.2127|0.2127	L|L	0.38838|0.38838	1.175|1.175	0.80722|0.80722	D|D	1|1	B;B;B|.	0.24426|.	0.103;0.063;0.078|.	B;B;B|.	0.27262|.	0.076;0.046;0.078|.	T|T	0.53436|0.53436	-0.8439|-0.8439	10|5	0.06625|.	T|.	0.88|.	.|.	15.1539|15.1539	0.72723|0.72723	0.0:0.1407:0.8593:0.0|0.0:0.1407:0.8593:0.0	.|.	569;2662;2662|.	B1AJZ2;Q5THJ4-2;Q5THJ4|.	.;.;VP13D_HUMAN|.	S|L	2662|1485	ENSP00000348666:C2662S;ENSP00000350854:C2662S|.	ENSP00000348666:C2662S|.	C|V	+|+	2|1	0|0	VPS13D|VPS13D	12306419|12306419	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.509000|0.509000	0.34042|0.34042	6.480000|6.480000	0.73604|0.73604	2.646000|2.646000	0.89796|0.89796	0.637000|0.637000	0.83480|0.83480	TGT|GTC		0.423	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		19	47	0	0	0	0.010504	0	19	47				
EIF4G3	8672	broad.mit.edu	37	1	21268017	21268017	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:21268017G>C	ENST00000264211.8	-	8	1656	c.1462C>G	c.(1462-1464)Caa>Gaa	p.Q488E	EIF4G3_ENST00000544689.1_5'UTR|EIF4G3_ENST00000374935.3_Intron|EIF4G3_ENST00000536266.1_Missense_Mutation_p.Q92E|EIF4G3_ENST00000374927.4_Missense_Mutation_p.Q488E|EIF4G3_ENST00000374933.3_5'Flank|EIF4G3_ENST00000356916.3_Missense_Mutation_p.Q499E|EIF4G3_ENST00000374937.3_Missense_Mutation_p.Q494E|EIF4G3_ENST00000602326.1_Missense_Mutation_p.Q494E|EIF4G3_ENST00000400422.1_Missense_Mutation_p.Q488E	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	488					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.Q494E(1)|p.Q488E(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TTTAAGTTTTGAGAATCCAAA	0.408																																							uc001bec.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1462-1464)CAA>GAA		eukaryotic translation initiation factor 4							197.0	202.0	200.0					1																	21268017		2203	4300	6503	SO:0001583	missense	8672				interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity	g.chr1:21268017G>C	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1462C>G	1.37:g.21268017G>C	ENSP00000264211:p.Gln488Glu					EIF4G3_uc010odi.1_Missense_Mutation_p.Q92E|EIF4G3_uc010odj.1_Missense_Mutation_p.Q487E|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Missense_Mutation_p.Q488E|EIF4G3_uc001bef.2_Missense_Mutation_p.Q487E|EIF4G3_uc001bee.2_Missense_Mutation_p.Q494E|EIF4G3_uc001beg.2_Missense_Mutation_p.Q487E|EIF4G3_uc010odk.1_Missense_Mutation_p.Q488E|EIF4G3_uc001beh.2_Missense_Mutation_p.Q499E	p.Q488E	NM_003760	NP_003751	O43432	IF4G3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)	9	1718	-		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)	488					B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	c.1462C>G	CCDS214.1	.	.	.	.	.	.	.	.	.	.	G	3.521	-0.097787	0.07010	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374937;ENST00000536266;ENST00000356916;ENST00000374927;ENST00000537059	T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07	6.02	4.16	0.48862	.	0.272597	0.36268	N	0.002699	T	0.10852	0.0265	N	0.19112	0.55	0.23287	N	0.99797	B;B;B;B;B;B	0.29481	0.149;0.245;0.149;0.003;0.005;0.025	B;B;B;B;B;B	0.24541	0.033;0.05;0.054;0.004;0.009;0.015	T	0.29088	-1.0023	10	0.06757	T	0.87	-2.9709	10.808	0.46529	0.1461:0.0:0.8539:0.0	.	488;683;614;92;494;488	B4DXR2;Q59GJ0;B1AN89;F5H564;B9EGQ7;O43432	.;.;.;.;.;IF4G3_HUMAN	E	488;684;488;494;92;614;488;499	ENSP00000264211:Q488E;ENSP00000383274:Q488E;ENSP00000364073:Q494E;ENSP00000444693:Q92E;ENSP00000364062:Q488E	ENSP00000264211:Q488E	Q	-	1	0	EIF4G3	21140604	1.000000	0.71417	0.461000	0.27105	0.013000	0.08279	5.040000	0.64191	0.879000	0.35944	-0.157000	0.13467	CAA		0.408	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760		21	112	0	0	0	0.008871	0	21	112				
ZC3H12A	80149	broad.mit.edu	37	1	37947426	37947426	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:37947426G>C	ENST00000373087.6	+	4	924	c.808G>C	c.(808-810)Gtc>Ctc	p.V270L		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GTACTCCTTCGTCAATGACAA	0.607																																							uc001cbb.3		NA																	0				ovary(2)	2						c.(808-810)GTC>CTC		zinc finger CCCH-type containing 12A							78.0	71.0	73.0					1																	37947426		2203	4300	6503	SO:0001583	missense	80149				angiogenesis|apoptosis|cell differentiation	cytoplasm|nucleus|plasma membrane	endonuclease activity|metal ion binding	g.chr1:37947426G>C		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.808G>C	1.37:g.37947426G>C	ENSP00000362179:p.Val270Leu					ZC3H12A_uc001cbc.1_5'UTR	p.V270L	NM_025079	NP_079355	Q5D1E8	ZC12A_HUMAN			4	958	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	270						Missense_Mutation	SNP	ENST00000373087.6	37	c.808G>C	CCDS417.1	.	.	.	.	.	.	.	.	.	.	G	35	5.469602	0.96274	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.47177	0.85	5.8	5.8	0.92144	Ribonuclease Zc3h12a-like (1);	0.055107	0.64402	D	0.000001	T	0.76212	0.3956	M	0.90542	3.125	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.79553	-0.1756	10	0.59425	D	0.04	-46.2049	20.063	0.97692	0.0:0.0:1.0:0.0	.	270	Q5D1E8	ZC12A_HUMAN	L	270	ENSP00000362179:V270L	ENSP00000362174:V270L	V	+	1	0	ZC3H12A	37720013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.735000	0.93741	0.655000	0.94253	GTC		0.607	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079		7	6	0	0	0	0.001984	0	7	6				
HIVEP3	59269	broad.mit.edu	37	1	42041248	42041248	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:42041248C>A	ENST00000372583.1	-	5	6059	c.5174G>T	c.(5173-5175)gGg>gTg	p.G1725V	HIVEP3_ENST00000372584.1_Missense_Mutation_p.G1725V|HIVEP3_ENST00000429157.2_Missense_Mutation_p.G1725V|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000247584.5_Missense_Mutation_p.G1725V	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1725					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CGCCGGCTCCCCTCTCTGGGA	0.547																																							uc001cgz.3		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)	6						c.(5173-5175)GGG>GTG		human immunodeficiency virus type I enhancer							144.0	153.0	150.0					1																	42041248		2203	4300	6503	SO:0001583	missense	59269				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr1:42041248C>A	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5174G>T	1.37:g.42041248C>A	ENSP00000361664:p.Gly1725Val					HIVEP3_uc001cha.3_Missense_Mutation_p.G1725V|HIVEP3_uc001cgy.2_RNA	p.G1725V	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN			5	6387	-	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)	1725					A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	c.5174G>T	CCDS463.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244286	0.59103	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.06371	3.32;3.31;3.31;3.32	5.12	4.19	0.49359	.	0.119337	0.38217	N	0.001778	T	0.06872	0.0175	N	0.25647	0.755	0.58432	D	0.999999	P;P	0.45827	0.867;0.79	B;B	0.44085	0.44;0.255	T	0.44742	-0.9308	10	0.34782	T	0.22	-20.0764	13.7853	0.63105	0.0:0.7067:0.2933:0.0	.	1725;1725	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	V	1725	ENSP00000361665:G1725V;ENSP00000361664:G1725V;ENSP00000247584:G1725V;ENSP00000410828:G1725V	ENSP00000247584:G1725V	G	-	2	0	HIVEP3	41813835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.618000	0.36954	1.362000	0.46000	0.561000	0.74099	GGG		0.547	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503		35	150	1	0	4.65686e-17	0.003755	5.87728e-17	35	150				
TIE1	7075	broad.mit.edu	37	1	43772829	43772829	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:43772829C>T	ENST00000372476.3	+	5	736	c.657C>T	c.(655-657)cgC>cgT	p.R219R	TIE1_ENST00000441333.2_Silent_p.R219R|TIE1_ENST00000433781.2_5'Flank|TIE1_ENST00000538015.1_Silent_p.R219R	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	219	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGGCTGGGCGCTGGGGGCCAG	0.637																																							uc001ciu.2		NA																	0				lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7						c.(655-657)CGC>CGT		tyrosine kinase with immunoglobulin-like and							58.0	59.0	59.0					1																	43772829		2203	4300	6503	SO:0001819	synonymous_variant	7075				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:43772829C>T	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.657C>T	1.37:g.43772829C>T						TIE1_uc010okd.1_Silent_p.R219R|TIE1_uc010oke.1_Silent_p.R174R|TIE1_uc009vwq.2_Intron|TIE1_uc010okf.1_5'UTR|TIE1_uc010okg.1_5'UTR|TIE1_uc010okc.1_Silent_p.R219R	p.R219R	NM_005424	NP_005415	P35590	TIE1_HUMAN			5	736	+	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	219			Extracellular (Potential).|EGF-like 1.		B5A949|B5A950	Silent	SNP	ENST00000372476.3	37	c.657C>T	CCDS482.1																																																																																				0.637	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424		23	41	0	0	0	0.004656	0	23	41				
SZT2	23334	broad.mit.edu	37	1	43913626	43913626	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:43913626G>C	ENST00000562955.1	+	67	9376	c.9376G>C	c.(9376-9378)Gag>Cag	p.E3126Q	SZT2_ENST00000372442.1_Missense_Mutation_p.E2284Q|SZT2-AS1_ENST00000396885.2_RNA	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	3183					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						AGGAGAGGCTGAGCGGCACGT	0.572																																							uc001cjk.1		NA																	0					0						c.(6850-6852)GAG>CAG		hypothetical protein LOC23334							92.0	88.0	89.0					1																	43913626		2203	4300	6503	SO:0001583	missense	23334					peroxisome		g.chr1:43913626G>C	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.9376G>C	1.37:g.43913626G>C	ENSP00000457168:p.Glu3126Gln					KIAA0467_uc001cjl.1_Missense_Mutation_p.E272Q	p.E2284Q	NM_015284	NP_056099	Q5T011	SZT2_HUMAN			53	7312	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	3183					A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	c.6850G>C	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599762	0.66332	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.69	5.69	0.88448	.	0.046479	0.85682	D	0.000000	T	0.76069	0.3936	L	0.50333	1.59	0.37217	D	0.905066	D;D	0.76494	0.999;0.999	D;D	0.71656	0.957;0.974	T	0.79500	-0.1778	9	0.87932	D	0	.	19.8208	0.96592	0.0:0.0:1.0:0.0	.	3183;3126	Q5T011;Q5T011-5	SZT2_HUMAN;.	Q	2284	.	ENSP00000361519:E2284Q	E	+	1	0	SZT2	43686213	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	9.362000	0.97126	2.688000	0.91661	0.563000	0.77884	GAG		0.572	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284		21	57	0	0	0	0.008871	0	21	57				
SLC5A9	200010	broad.mit.edu	37	1	48713175	48713175	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:48713175T>C	ENST00000438567.2	+	14	2058	c.2006T>C	c.(2005-2007)tTg>tCg	p.L669S	SLC5A9_ENST00000471020.1_3'UTR|SLC5A9_ENST00000236495.5_Missense_Mutation_p.L694S|SLC5A9_ENST00000533824.1_Missense_Mutation_p.L690S	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	669					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						GCTGTCCTTTTGCTGGCCATC	0.522																																							uc001cro.2		NA																	0				ovary(3)	3						c.(2005-2007)TTG>TCG		solute carrier family 5 (sodium/glucose							118.0	109.0	112.0					1																	48713175		2203	4300	6503	SO:0001583	missense	200010					integral to membrane|plasma membrane	low-affinity glucose:sodium symporter activity	g.chr1:48713175T>C	BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.2006T>C	1.37:g.48713175T>C	ENSP00000401730:p.Leu669Ser					SLC5A9_uc001crn.2_Missense_Mutation_p.L694S|SLC5A9_uc010omt.1_Missense_Mutation_p.L683S|SLC5A9_uc001crp.2_Missense_Mutation_p.L336S|SLC5A9_uc010omu.1_Missense_Mutation_p.L336S|SLC5A9_uc009vyt.1_RNA	p.L669S	NM_001011547	NP_001011547	Q2M3M2	SC5A9_HUMAN			14	2058	+			669			Helical; (Potential).		B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	ENST00000438567.2	37	c.2006T>C	CCDS30709.2	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132277	0.77662	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495	D;D;D	0.89196	-2.42;-2.41;-2.48	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000001	D	0.94125	0.8116	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.995;0.995	D	0.94685	0.7869	10	0.66056	D	0.02	.	13.8547	0.63519	0.0:0.0:0.0:1.0	.	690;669;694	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	S	690;669;694	ENSP00000431900:L690S;ENSP00000401730:L669S;ENSP00000236495:L694S	ENSP00000236495:L694S	L	+	2	0	SLC5A9	48485762	0.918000	0.31147	0.934000	0.37439	0.902000	0.53008	5.979000	0.70508	2.059000	0.61396	0.459000	0.35465	TTG		0.522	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174		20	30	0	0	0	0.002299	0	20	30				
MAGOH	4116	broad.mit.edu	37	1	53699287	53699287	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:53699287C>G	ENST00000371470.3	-	3	346	c.185G>C	c.(184-186)aGa>aCa	p.R62T	MAGOH_ENST00000371466.4_Intron|MAGOH_ENST00000462941.1_5'UTR	NM_002370.3	NP_002361.1	P61326	MGN_HUMAN	mago-nashi homolog, proliferation-associated (Drosophila)	62					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	6						GTCAATTATTCTCTTCAGTTC	0.418																																					Colon(150;521 2416 7674 18129)	Colon(150;521 2416 7674 18129)	uc001cvf.1		NA																	0					0						c.(184-186)AGA>ACA		mago-nashi homolog							265.0	232.0	243.0					1																	53699287		2203	4300	6503	SO:0001583	missense	4116				mRNA 3'-end processing|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|exon-exon junction complex|nuclear speck	protein binding|RNA binding	g.chr1:53699287C>G	AF035940	CCDS577.1	1p32.3	2010-04-16	2001-11-28		ENSG00000162385	ENSG00000162385			6815	protein-coding gene	gene with protein product		602603	"""mago-nashi (Drosophila) homolog, proliferation-associated"""			9479507	Standard	NM_002370		Approved	MAGOHA, MAGOH1	uc001cvf.2	P61326	OTTHUMG00000008932	ENST00000371470.3:c.185G>C	1.37:g.53699287C>G	ENSP00000360525:p.Arg62Thr					MAGOH_uc010ont.1_Intron	p.R62T	NM_002370	NP_002361	P61326	MGN_HUMAN			3	273	-			62					B1ARP8|B2R5A2|O35169|P50606|Q5SW69	Missense_Mutation	SNP	ENST00000371470.3	37	c.185G>C	CCDS577.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178103	0.94846	.	.	ENSG00000162385	ENST00000371470	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.83653	0.5301	M	0.92459	3.31	0.80722	D	1	D	0.59767	0.986	P	0.55785	0.784	D	0.87512	0.2440	9	0.62326	D	0.03	-25.5271	19.2175	0.93783	0.0:1.0:0.0:0.0	.	62	P61326	MGN_HUMAN	T	62	.	ENSP00000360525:R62T	R	-	2	0	MAGOH	53471875	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.308000	0.78929	2.556000	0.86216	0.555000	0.69702	AGA		0.418	MAGOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024730.1	NM_002370		19	146	0	0	0	0.007413	0	19	146				
LDLRAD1	388633	broad.mit.edu	37	1	54474683	54474683	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:54474683G>A	ENST00000371360.1	-	6	607	c.590C>T	c.(589-591)tCc>tTc	p.S197F	LDLRAD1_ENST00000420619.1_Missense_Mutation_p.S158F|LDLRAD1_ENST00000371362.3_Missense_Mutation_p.S108F|LDLRAD1_ENST00000545928.1_Missense_Mutation_p.S154F	NM_001010978.2	NP_001010978.2	Q5T700	LRAD1_HUMAN	low density lipoprotein receptor class A domain containing 1	197	LDL-receptor class A 3; atypical. {ECO:0000255|PROSITE-ProRule:PRU00124}.					integral component of membrane (GO:0016021)				large_intestine(3)|prostate(1)|skin(3)	7						ATACTCATCGGACCAGTCGGA	0.572																																							uc001cwm.1		NA																	0				skin(2)|large_intestine(1)	3						c.(589-591)TCC>TTC		low density lipoprotein receptor class A domain							113.0	109.0	110.0					1																	54474683		2203	4300	6503	SO:0001583	missense	388633					integral to membrane	receptor activity	g.chr1:54474683G>A		CCDS30725.1, CCDS60145.1, CCDS60146.1, CCDS60147.1	1p32.3	2008-02-05	2005-10-07		ENSG00000203985	ENSG00000203985			32069	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 1"""				Standard	NM_001010978		Approved		uc001cwm.2	Q5T700	OTTHUMG00000008433	ENST00000371360.1:c.590C>T	1.37:g.54474683G>A	ENSP00000360411:p.Ser197Phe					LDLRAD1_uc010onz.1_3'UTR|LDLRAD1_uc010ooa.1_Missense_Mutation_p.S154F|LDLRAD1_uc009vzn.1_RNA	p.S197F	NM_001010978	NP_001010978	Q5T700	LRAD1_HUMAN			6	608	-			197			LDL-receptor class A 3; atypical.		A0PJY0|B7ZME3|Q5T6Z9	Missense_Mutation	SNP	ENST00000371360.1	37	c.590C>T	CCDS30725.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992585	0.54041	.	.	ENSG00000203985	ENST00000371362;ENST00000371360;ENST00000545928;ENST00000420619	D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63	4.25	4.25	0.50352	.	0.241851	0.29192	N	0.012874	D	0.94555	0.8246	M	0.71581	2.175	0.48087	D	0.999582	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95057	0.8192	10	0.66056	D	0.02	-14.3148	15.612	0.76733	0.0:0.0:1.0:0.0	.	154;197	B7ZME3;Q5T700	.;LRAD1_HUMAN	F	108;197;154;158	ENSP00000360413:S108F;ENSP00000360411:S197F;ENSP00000445871:S154F;ENSP00000411017:S158F	ENSP00000360411:S197F	S	-	2	0	LDLRAD1	54247271	1.000000	0.71417	0.920000	0.36463	0.332000	0.28634	6.382000	0.73167	2.201000	0.70794	0.655000	0.94253	TCC		0.572	LDLRAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023243.1	NM_001010978		20	106	0	0	0	0.010504	0	20	106				
WDR78	79819	broad.mit.edu	37	1	67327902	67327902	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:67327902C>G	ENST00000371026.3	-	7	1079	c.1024G>C	c.(1024-1026)Gag>Cag	p.E342Q	WDR78_ENST00000493572.1_5'UTR|WDR78_ENST00000431318.1_Missense_Mutation_p.E88Q|WDR78_ENST00000371023.3_Missense_Mutation_p.E342Q	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	342					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						CTACTTGACTCAACCACAGAT	0.343																																							uc001dcx.2		NA																	0				ovary(2)	2						c.(1024-1026)GAG>CAG		WD repeat domain 78 isoform 1							106.0	106.0	106.0					1																	67327902		2203	4300	6503	SO:0001583	missense	79819							g.chr1:67327902C>G	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1024G>C	1.37:g.67327902C>G	ENSP00000360065:p.Glu342Gln					WDR78_uc001dcy.2_Missense_Mutation_p.E342Q|WDR78_uc009waw.2_Missense_Mutation_p.E88Q|WDR78_uc009wax.2_RNA	p.E342Q	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN			7	1080	-			342					A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	ENST00000371026.3	37	c.1024G>C	CCDS635.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.65|12.65	2.002970|2.002970	0.35320|0.35320	.|.	.|.	ENSG00000152763|ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352;ENST00000371023;ENST00000531552|ENST00000469450	T;T;T;T;T|.	0.68765|.	0.27;-0.35;-0.34;2.1;1.5|.	5.53|5.53	-0.546|-0.546	0.11840|0.11840	.|.	1.723980|.	0.03185|.	N|.	0.172544|.	T|.	0.11623|.	0.0283|.	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	B;B;B|.	0.33477|.	0.413;0.036;0.036|.	B;B;B|.	0.28991|.	0.097;0.014;0.014|.	T|.	0.32052|.	-0.9921|.	10|.	0.36615|.	T|.	0.2|.	-1.4906|-1.4906	1.7824|1.7824	0.03035|0.03035	0.14:0.2605:0.3772:0.2223|0.14:0.2605:0.3772:0.2223	.|.	88;342;342|.	Q5VTH9-3;A0AVI9;Q5VTH9|.	.;.;WDR78_HUMAN|.	Q|S	342;88;108;342;29|75	ENSP00000360065:E342Q;ENSP00000393182:E88Q;ENSP00000433682:E108Q;ENSP00000360062:E342Q;ENSP00000433037:E29Q|.	ENSP00000360062:E342Q|.	E|X	-|-	1|2	0|2	WDR78|WDR78	67100490|67100490	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.006000|0.006000	0.05464|0.05464	0.020000|0.020000	0.13466|0.13466	0.232000|0.232000	0.21100|0.21100	0.591000|0.591000	0.81541|0.81541	GAG|TGA		0.343	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	NM_024763		6	30	0	0	0	0.00308	0	6	30				
ERICH3	127254	broad.mit.edu	37	1	75107024	75107024	+	Silent	SNP	C	C	T	rs370906098		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:75107024C>T	ENST00000326665.5	-	5	653	c.435G>A	c.(433-435)ccG>ccA	p.P145P		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		145								p.P145P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCAGTGCTAACGGACTGGAAT	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		19245	0.0		0.0	False		,,,				2504	0.001						uc001dgg.2		NA																	1	Substitution - coding silent(1)		prostate(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(433-435)CCG>CCA		hypothetical protein LOC127254							151.0	133.0	139.0					1																	75107024		2203	4300	6503	SO:0001819	synonymous_variant	127254							g.chr1:75107024C>T																												ENST00000326665.5:c.435G>A	1.37:g.75107024C>T							p.P145P	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			5	654	-			145					Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	37	c.435G>A	CCDS30755.1																																																																																				0.428	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			23	38	0	0	0	0.00632	0	23	38				
GBP4	115361	broad.mit.edu	37	1	89652196	89652196	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:89652196C>T	ENST00000355754.6	-	10	1624	c.1527G>A	c.(1525-1527)atG>atA	p.M509I	GBP4_ENST00000471938.1_5'Flank	NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	509						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		CTGCTTCCTTCATGGCCCGCT	0.483																																							uc001dnb.2		NA																	0					0						c.(1525-1527)ATG>ATA		guanylate binding protein 4							76.0	60.0	65.0					1																	89652196		2203	4300	6503	SO:0001583	missense	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89652196C>T	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.1527G>A	1.37:g.89652196C>T	ENSP00000359490:p.Met509Ile						p.M509I	NM_052941	NP_443173	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	10	1643	-			509			Potential.		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	c.1527G>A	CCDS721.1	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617721	0.28801	.	.	ENSG00000162654	ENST00000355754	T	0.53423	0.62	4.39	0.363	0.16118	Guanylate-binding protein, C-terminal (3);	0.601619	0.16827	N	0.197902	T	0.14700	0.0355	N	0.22421	0.69	0.09310	N	1	B	0.22211	0.066	B	0.28553	0.091	T	0.28681	-1.0036	10	0.56958	D	0.05	.	7.7927	0.29129	0.0:0.6063:0.0:0.3937	.	509	Q96PP9	GBP4_HUMAN	I	509	ENSP00000359490:M509I	ENSP00000359490:M509I	M	-	3	0	GBP4	89424784	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.399000	0.02506	0.175000	0.19841	0.561000	0.74099	ATG		0.483	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		12	31	0	0	0	0.001368	0	12	31				
HFM1	164045	broad.mit.edu	37	1	91850784	91850784	+	Silent	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:91850784T>C	ENST00000370425.3	-	6	860	c.762A>G	c.(760-762)acA>acG	p.T254T	HFM1_ENST00000370424.3_Intron|HFM1_ENST00000294696.5_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	254					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AACCATTTTCTGTTACCTCTG	0.264																																							uc001doa.3		NA																	0					0						c.(760-762)ACA>ACG		HFM1 protein							34.0	38.0	36.0					1																	91850784		2196	4284	6480	SO:0001819	synonymous_variant	164045						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr1:91850784T>C	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.762A>G	1.37:g.91850784T>C						HFM1_uc010osu.1_Intron|HFM1_uc010osv.1_Intron|HFM1_uc001doc.1_Silent_p.T254T	p.T254T	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)	6	862	-		all_lung(203;0.00961)|Lung NSC(277;0.0351)	254					B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	37	c.762A>G	CCDS30769.2																																																																																				0.264	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975		6	14	0	0	0	0.004482	0	6	14				
HIAT1	64645	broad.mit.edu	37	1	100547675	100547675	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:100547675G>A	ENST00000370152.3	+	12	1519	c.1383G>A	c.(1381-1383)tgG>tgA	p.W461*	SASS6_ENST00000462159.1_5'Flank|RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	461					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		CCAGCAGTTGGAGAAAGCACT	0.483																																							uc001dst.2		NA																	0					0						c.(1381-1383)TGG>TGA		hippocampus abundant transcript 1							94.0	84.0	87.0					1																	100547675		2203	4300	6503	SO:0001587	stop_gained	64645				transmembrane transport	integral to membrane|plasma membrane	transporter activity	g.chr1:100547675G>A	AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.1383G>A	1.37:g.100547675G>A	ENSP00000359171:p.Trp461*						p.W461*	NM_033055	NP_149044	Q96MC6	HIAT1_HUMAN		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)	12	1383	+		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)	461			Extracellular (Potential).		Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Nonsense_Mutation	SNP	ENST00000370152.3	37	c.1383G>A	CCDS763.1	.	.	.	.	.	.	.	.	.	.	G	34	5.379838	0.95945	.	.	ENSG00000156875	ENST00000370152	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-48.8907	20.1991	0.98252	0.0:0.0:1.0:0.0	.	.	.	.	X	461	.	ENSP00000359171:W461X	W	+	3	0	HIAT1	100320263	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.215000	0.65241	2.775000	0.95449	0.650000	0.86243	TGG		0.483	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029657.1	NM_033055		5	37	0	0	0	0.000602	0	5	37				
AMY2B	280	broad.mit.edu	37	1	104116440	104116440	+	Silent	SNP	G	G	T	rs571635275	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:104116440G>T	ENST00000361355.4	+	6	1240	c.624G>T	c.(622-624)ggG>ggT	p.G208G	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	208					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GTGTTGCAGGGTTCAGACTTG	0.433																																							uc001duq.2		NA																	0					0						c.(622-624)GGG>GGT		amylase, pancreatic, alpha-2B precursor							344.0	326.0	332.0					1																	104116440		2203	4300	6503	SO:0001819	synonymous_variant	280				carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding	g.chr1:104116440G>T	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.624G>T	1.37:g.104116440G>T						AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Silent_p.G208G|AMY2B_uc001dus.1_5'Flank	p.G208G	NM_020978	NP_066188	P19961	AMY2B_HUMAN		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)	6	1240	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	208					B3KTI1|B3KXB7|D3DT76|Q9UBH3	Silent	SNP	ENST00000361355.4	37	c.624G>T	CCDS782.1																																																																																				0.433	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030318.1	NM_020978		44	287	1	0	1.00776e-21	0.00361	1.28965e-21	44	287				
LRIG2	9860	broad.mit.edu	37	1	113638582	113638582	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:113638582A>G	ENST00000361127.5	+	7	1088	c.890A>G	c.(889-891)aAt>aGt	p.N297S		NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	297					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		GTGAGCCAGAATGCTATTGAA	0.448																																							uc001edf.1		NA																	0				ovary(3)	3						c.(889-891)AAT>AGT		leucine-rich repeats and immunoglobulin-like							109.0	102.0	104.0					1																	113638582		2203	4300	6503	SO:0001583	missense	9860					cytoplasm|integral to membrane|plasma membrane		g.chr1:113638582A>G	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.890A>G	1.37:g.113638582A>G	ENSP00000355396:p.Asn297Ser					LRIG2_uc009wgn.1_Missense_Mutation_p.N194S	p.N297S	NM_014813	NP_055628	O94898	LRIG2_HUMAN		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)	7	1088	+	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)	297			LRR 10.|Extracellular (Potential).		Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	37	c.890A>G	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.849868	0.91277	.	.	ENSG00000198799	ENST00000361127	T	0.72505	-0.66	6.15	6.15	0.99193	.	0.000000	0.85682	D	0.000000	D	0.87245	0.6129	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90530	0.4495	10	0.72032	D	0.01	.	16.7886	0.85580	1.0:0.0:0.0:0.0	.	297	O94898	LRIG2_HUMAN	S	297	ENSP00000355396:N297S	ENSP00000355396:N297S	N	+	2	0	LRIG2	113440105	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.210000	0.95106	2.363000	0.80096	0.523000	0.50628	AAT		0.448	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813		5	35	0	0	0	0.000602	0	5	35				
AMPD1	270	broad.mit.edu	37	1	115215835	115215835	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:115215835A>G	ENST00000520113.2	-	16	2258	c.2243T>C	c.(2242-2244)aTc>aCc	p.I748T	AMPD1_ENST00000369538.3_Missense_Mutation_p.I744T|AMPD1_ENST00000353928.6_Missense_Mutation_p.I715T			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	748					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TGTCCTCCGGATATCATTTCC	0.413																																							uc001efe.1		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(2143-2145)ATC>ACC		adenosine monophosphate deaminase 1 (isoform M)	Adenosine monophosphate(DB00131)						93.0	87.0	89.0					1																	115215835		2203	4300	6503	SO:0001583	missense	270				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:115215835A>G	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.2243T>C	1.37:g.115215835A>G	ENSP00000430075:p.Ile748Thr					DENND2C_uc001eez.2_5'Flank|AMPD1_uc001eff.1_Missense_Mutation_p.I711T	p.I715T	NM_000036	NP_000027	P23109	AMPD1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	16	2228	-	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	715					A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	c.2144T>C	CCDS876.2	.	.	.	.	.	.	.	.	.	.	A	22.9	4.347883	0.82022	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.83419	-1.72;-1.72;-1.72	5.62	5.62	0.85841	.	0.042419	0.85682	D	0.000000	D	0.90407	0.6997	M	0.85462	2.755	0.80722	D	1	D;D	0.64830	0.974;0.994	D;D	0.74348	0.973;0.983	D	0.91510	0.5226	10	0.59425	D	0.04	-25.2949	16.1172	0.81314	1.0:0.0:0.0:0.0	.	744;715	Q5TF02;P23109	.;AMPD1_HUMAN	T	748;744;715	ENSP00000430075:I748T;ENSP00000358551:I744T;ENSP00000316520:I715T	ENSP00000316520:I715T	I	-	2	0	AMPD1	115017358	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.287000	0.95975	2.266000	0.75297	0.533000	0.62120	ATC		0.413	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4			11	33	0	0	0	0.008291	0	11	33				
SYCP1	6847	broad.mit.edu	37	1	115428757	115428757	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:115428757G>T	ENST00000369522.3	+	14	1257	c.1017G>T	c.(1015-1017)aaG>aaT	p.K339N	SYCP1_ENST00000369518.1_Missense_Mutation_p.K339N	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	339					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCAAAAGGCTTTAGAGG	0.338																																							uc001efr.2		NA																	0				skin(1)	1						c.(1015-1017)AAG>AAT		synaptonemal complex protein 1							57.0	62.0	60.0					1																	115428757		2203	4300	6503	SO:0001583	missense	6847				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding	g.chr1:115428757G>T	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1017G>T	1.37:g.115428757G>T	ENSP00000358535:p.Lys339Asn					SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.K339N|SYCP1_uc009wgw.2_Missense_Mutation_p.K339N	p.K339N	NM_003176	NP_003167	Q15431	SYCP1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	14	1226	+	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)	339			Potential.		O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	c.1017G>T	CCDS879.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306577	0.23736	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.56611	0.45;0.45;0.45	5.83	-0.877	0.10621	.	0.536069	0.21845	N	0.068273	T	0.20780	0.0500	L	0.60455	1.87	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.23511	-1.0186	10	0.36615	T	0.2	-4.0444	5.1716	0.15112	0.3922:0.0:0.4794:0.1284	.	339;339	B7ZLS9;Q15431	.;SYCP1_HUMAN	N	339	ENSP00000358535:K339N;ENSP00000410011:K339N;ENSP00000358531:K339N	ENSP00000358531:K339N	K	+	3	2	SYCP1	115230280	0.409000	0.25368	0.395000	0.26283	0.799000	0.45148	0.140000	0.16056	-0.155000	0.11098	-0.268000	0.10319	AAG		0.338	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176		5	29	1	0	3.59834e-05	0.001168	3.92741e-05	5	29				
ANKRD35	148741	broad.mit.edu	37	1	145560150	145560150	+	Silent	SNP	G	G	A	rs375287957		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:145560150G>A	ENST00000355594.4	+	8	723	c.636G>A	c.(634-636)gcG>gcA	p.A212A	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	212										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAGCTGACGCGGGGGCTGTGG	0.607																																					Melanoma(9;127 754 22988 51047)	Melanoma(9;127 754 22988 51047)	uc001eob.1		NA																	0				ovary(4)|skin(1)	5						c.(634-636)GCG>GCA		ankyrin repeat domain 35		G		0,4406		0,0,2203	75.0	69.0	71.0		636	-11.1	0.0	1		71	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ANKRD35	NM_144698.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		212/1002	145560150	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	148741							g.chr1:145560150G>A	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.636G>A	1.37:g.145560150G>A						NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Silent_p.A55A	p.A212A	NM_144698	NP_653299	Q8N283	ANR35_HUMAN			8	744	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		212			ANK 5.		A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	ENST00000355594.4	37	c.636G>A	CCDS919.1																																																																																				0.607	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698		8	58	0	0	0	0.00308	0	8	58				
GJA8	2703	broad.mit.edu	37	1	147380719	147380719	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:147380719G>T	ENST00000369235.1	+	1	637	c.637G>T	c.(637-639)Gcc>Tcc	p.A213S	GJA8_ENST00000240986.4_Missense_Mutation_p.A213S			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	213					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GTTGTCTGTGGCCTCTGTGTC	0.607																																					Melanoma(76;1255 1795 8195 52096)	Melanoma(76;1255 1795 8195 52096)	uc001epu.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(637-639)GCC>TCC		connexin 50							126.0	106.0	113.0					1																	147380719		2203	4300	6503	SO:0001583	missense	2703				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity	g.chr1:147380719G>T	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.637G>T	1.37:g.147380719G>T	ENSP00000358238:p.Ala213Ser						p.A213S	NM_005267	NP_005258	P48165	CXA8_HUMAN			2	700	+	all_hematologic(923;0.0276)		213			Helical; (Potential).		A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	c.637G>T	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	g	22.9	4.348838	0.82132	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.94758	-3.51;-3.51	4.92	4.92	0.64577	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.94899	0.8351	L	0.37507	1.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95052	0.8188	10	0.48119	T	0.1	.	18.1038	0.89513	0.0:0.0:1.0:0.0	.	213	P48165	CXA8_HUMAN	S	213	ENSP00000240986:A213S;ENSP00000358238:A213S	ENSP00000240986:A213S	A	+	1	0	GJA8	145847343	1.000000	0.71417	0.997000	0.53966	0.677000	0.39632	9.772000	0.98984	2.267000	0.75376	0.313000	0.20887	GCC		0.607	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267		31	55	1	0	1.61788e-16	0.012213	2.02789e-16	31	55				
POGZ	23126	broad.mit.edu	37	1	151380974	151380974	+	Silent	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:151380974T>A	ENST00000271715.2	-	14	2459	c.2145A>T	c.(2143-2145)gcA>gcT	p.A715A	POGZ_ENST00000531094.1_Silent_p.A653A|POGZ_ENST00000392723.1_Silent_p.A662A|POGZ_ENST00000368863.2_Silent_p.A620A|POGZ_ENST00000409503.1_Silent_p.A706A|POGZ_ENST00000361398.3_Silent_p.A662A|POGZ_ENST00000491586.1_Silent_p.A671A|POGZ_ENST00000540984.1_Silent_p.A77A	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	715					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCAGCGGTGCTGCCTCCTGCA	0.567																																							uc001eyd.1		NA																	0				ovary(3)	3						c.(2143-2145)GCA>GCT		pogo transposable element with ZNF domain							68.0	69.0	69.0					1																	151380974		2203	4300	6503	SO:0001819	synonymous_variant	23126				cell division|kinetochore assembly|mitotic sister chromatid cohesion|regulation of transcription, DNA-dependent	cytoplasm|nuclear chromatin	DNA binding|protein binding|zinc ion binding	g.chr1:151380974T>A	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2145A>T	1.37:g.151380974T>A						POGZ_uc001eye.1_Silent_p.A662A|POGZ_uc010pdb.1_Silent_p.A706A|POGZ_uc001eyf.1_Silent_p.A671A|POGZ_uc010pdc.1_Silent_p.A653A|POGZ_uc009wmv.1_Silent_p.A620A|POGZ_uc010pdd.1_Silent_p.A206A	p.A715A	NM_015100	NP_055915	Q7Z3K3	POGZ_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		14	2451	-	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		715					B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Silent	SNP	ENST00000271715.2	37	c.2145A>T	CCDS997.1																																																																																				0.567	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171		41	70	0	0	0	0.005524	0	41	70				
IVL	3713	broad.mit.edu	37	1	152883987	152883987	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:152883987C>T	ENST00000368764.3	+	2	1778	c.1714C>T	c.(1714-1716)Cag>Tag	p.Q572*	IVL_ENST00000392667.2_Nonsense_Mutation_p.Q426*			P07476	INVO_HUMAN	involucrin	572					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGTAGAGCACCAGCAGCAGAA	0.567																																							uc001fau.2		NA																	0				ovary(3)	3						c.(1714-1716)CAG>TAG		involucrin							70.0	71.0	71.0					1																	152883987		2203	4300	6503	SO:0001587	stop_gained	3713				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity	g.chr1:152883987C>T	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1714C>T	1.37:g.152883987C>T	ENSP00000357753:p.Gln572*						p.Q572*	NM_005547	NP_005538	P07476	INVO_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	1760	+	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		572					Q5T7P4	Nonsense_Mutation	SNP	ENST00000368764.3	37	c.1714C>T	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527814	0.85706	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	.	.	.	3.74	2.81	0.32909	.	.	.	.	.	.	.	.	.	.	.	0.45822	D	0.998693	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6237	0.12467	0.2196:0.6683:0.0:0.1121	.	.	.	.	X	572;426	.	ENSP00000357753:Q572X	Q	+	1	0	IVL	151150611	0.036000	0.19791	0.727000	0.30756	0.133000	0.20885	0.323000	0.19593	1.139000	0.42245	-0.311000	0.09066	CAG		0.567	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547		19	59	0	0	0	0.007413	0	19	59				
UBQLN4	56893	broad.mit.edu	37	1	156013886	156013886	+	Silent	SNP	G	G	A	rs536510779		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:156013886G>A	ENST00000368309.3	-	6	1121	c.1029C>T	c.(1027-1029)ccC>ccT	p.P343P		NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	343					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					CACCGGACCCGGGGGCCTGGG	0.687													G|||	1	0.000199681	0.0008	0.0	5008	,	,		11083	0.0		0.0	False		,,,				2504	0.0						uc001fna.2		NA																	0				pancreas(1)|skin(1)	2						c.(1027-1029)CCC>CCT		ataxin-1 ubiquitin-like interacting protein																																				SO:0001819	synonymous_variant	56893					cytosol|endoplasmic reticulum membrane|nucleus	identical protein binding	g.chr1:156013886G>A	BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.1029C>T	1.37:g.156013886G>A						UBQLN4_uc010pgx.1_Silent_p.P323P	p.P343P	NM_020131	NP_064516	Q9NRR5	UBQL4_HUMAN			6	1053	-	Hepatocellular(266;0.133)|all_neural(408;0.195)		343					A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Silent	SNP	ENST00000368309.3	37	c.1029C>T	CCDS1127.1																																																																																				0.687	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046193.1	NM_020131		6	27	0	0	0	0.001168	0	6	27				
FCRL2	79368	broad.mit.edu	37	1	157740380	157740380	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:157740380G>T	ENST00000361516.3	-	3	177	c.129C>A	c.(127-129)aaC>aaA	p.N43K	FCRL2_ENST00000392274.3_Missense_Mutation_p.N43K|FCRL2_ENST00000368181.4_Missense_Mutation_p.N43K|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	43	Ig-like C2-type 1.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.N43N(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GAATTTTCCAGTTCTGTTCTC	0.433																																							uc001fre.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(1)|pancreas(1)	2						c.(127-129)AAC>AAA		Fc receptor-like 2 precursor							65.0	66.0	66.0					1																	157740380		2203	4300	6503	SO:0001583	missense	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157740380G>T	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.129C>A	1.37:g.157740380G>T	ENSP00000355157:p.Asn43Lys					FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.N43K|FCRL2_uc009wsp.2_Missense_Mutation_p.N43K|FCRL2_uc010pia.1_Missense_Mutation_p.N43K	p.N43K	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	188	-	all_hematologic(112;0.0378)		43			Ig-like C2-type 1.|Extracellular (Potential).		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	c.129C>A	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254004	0.22965	.	.	ENSG00000132704	ENST00000292389;ENST00000361516;ENST00000368181;ENST00000392274	T;T;T	0.13778	2.56;2.56;2.56	4.33	-5.41	0.02648	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	5.460890	0.00520	N	0.000191	T	0.04679	0.0127	L	0.46614	1.455	0.09310	N	1	B;B;B;B	0.29432	0.242;0.02;0.244;0.022	B;B;B;B	0.32393	0.145;0.055;0.038;0.06	T	0.38045	-0.9679	10	0.72032	D	0.01	.	7.4239	0.27088	0.6082:0.1309:0.261:0.0	.	43;43;43;43	B4E0W2;B4DVJ9;Q96LA5-5;Q96LA5	.;.;.;FCRL2_HUMAN	K	43	ENSP00000355157:N43K;ENSP00000357163:N43K;ENSP00000376100:N43K	ENSP00000292389:N43K	N	-	3	2	FCRL2	156007004	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-5.128000	0.00148	-1.251000	0.02494	-0.142000	0.14014	AAC		0.433	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		21	33	1	0	1.15919e-05	0.008871	1.28047e-05	21	33				
IFI16	3428	broad.mit.edu	37	1	158984538	158984538	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:158984538G>A	ENST00000295809.7	+	2	323	c.68G>A	c.(67-69)aGa>aAa	p.R23K	IFI16_ENST00000359709.3_Missense_Mutation_p.R23K|IFI16_ENST00000340979.6_Missense_Mutation_p.R23K|IFI16_ENST00000368131.4_Missense_Mutation_p.R23K|IFI16_ENST00000368132.3_Missense_Mutation_p.R23K|IFI16_ENST00000430894.2_Missense_Mutation_p.R27K|IFI16_ENST00000448393.2_Missense_Mutation_p.R23K			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	23	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.|Lys-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TATCATTTTAGAATGGTTAAG	0.308																																							uc001ftf.1		NA																	0				ovary(1)	1						c.(67-69)AGA>AAA		interferon, gamma-inducible protein 16							71.0	75.0	73.0					1																	158984538		2203	4300	6503	SO:0001583	missense	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:158984538G>A	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.68G>A	1.37:g.158984538G>A	ENSP00000295809:p.Arg23Lys					IFI16_uc001ftg.2_Missense_Mutation_p.R23K|IFI16_uc010pis.1_Missense_Mutation_p.R23K	p.R23K	NM_005531	NP_005522	Q16666	IF16_HUMAN			3	675	+	all_hematologic(112;0.0429)		23			DAPIN.|Lys-rich.		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37	c.68G>A		.	.	.	.	.	.	.	.	.	.	.	12.89	2.073893	0.36566	.	.	ENSG00000163565	ENST00000359709;ENST00000426592;ENST00000447473;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	T;T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01	2.9	-1.22	0.09494	Pyrin (2);DEATH-like (1);	.	.	.	.	T	0.12092	0.0294	L	0.44542	1.39	0.09310	N	1	B;B;B	0.24651	0.108;0.05;0.108	B;B;B	0.23716	0.048;0.014;0.04	T	0.32161	-0.9917	9	0.25106	T	0.35	.	6.1481	0.20296	0.5398:0.0:0.4602:0.0	.	27;23;23	E7EPR3;Q16666-2;Q16666	.;.;IF16_HUMAN	K	23;23;23;23;23;23;23;27	ENSP00000352740:R23K;ENSP00000406406:R23K;ENSP00000407052:R23K;ENSP00000295809:R23K;ENSP00000342741:R23K;ENSP00000357113:R23K;ENSP00000357114:R23K;ENSP00000394935:R27K	ENSP00000295809:R23K	R	+	2	0	IFI16	157251162	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.069000	0.11542	-0.274000	0.09232	-0.391000	0.06502	AGA		0.308	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		6	54	0	0	0	0.001168	0	6	54				
AIM2	9447	broad.mit.edu	37	1	159036039	159036039	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:159036039C>T	ENST00000368130.4	-	4	765	c.477G>A	c.(475-477)ctG>ctA	p.L159L	AIM2_ENST00000411768.1_5'Flank	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	159	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TCTTTGCTTTCAGTACCATAA	0.443																																							uc001ftj.1		NA																	0				ovary(2)|pancreas(1)	3						c.(475-477)CTG>CTA		absent in melanoma 2							84.0	86.0	85.0					1																	159036039		2203	4300	6503	SO:0001819	synonymous_variant	9447				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus		g.chr1:159036039C>T	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.477G>A	1.37:g.159036039C>T							p.L159L	NM_004833	NP_004824	O14862	AIM2_HUMAN			4	722	-	all_hematologic(112;0.0429)		159			HIN-200.		A8K7M7|Q5T3V9|Q96FG9	Silent	SNP	ENST00000368130.4	37	c.477G>A	CCDS1181.1																																																																																				0.443	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833		10	96	0	0	0	0.006214	0	10	96				
AIM2	9447	broad.mit.edu	37	1	159036077	159036077	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:159036077C>G	ENST00000368130.4	-	4	727	c.439G>C	c.(439-441)Gaa>Caa	p.E147Q	AIM2_ENST00000411768.1_5'Flank	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	147	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TGAAACCCTTCTCTGATAGAT	0.453																																							uc001ftj.1		NA																	0				ovary(2)|pancreas(1)	3						c.(439-441)GAA>CAA		absent in melanoma 2							63.0	68.0	66.0					1																	159036077		2203	4300	6503	SO:0001583	missense	9447				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus		g.chr1:159036077C>G	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.439G>C	1.37:g.159036077C>G	ENSP00000357112:p.Glu147Gln						p.E147Q	NM_004833	NP_004824	O14862	AIM2_HUMAN			4	684	-	all_hematologic(112;0.0429)		147			HIN-200.		A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	ENST00000368130.4	37	c.439G>C	CCDS1181.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.100917	0.37048	.	.	ENSG00000163568	ENST00000368130;ENST00000368129	T;T	0.15017	3.02;2.46	3.05	-1.09	0.09904	HIN-200/IF120x (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.05823	0.0152	M	0.65498	2.005	0.09310	N	1	B	0.21520	0.057	B	0.17098	0.017	T	0.36744	-0.9735	9	0.44086	T	0.13	-13.4709	4.9441	0.13980	0.0:0.4235:0.4103:0.1662	.	147	O14862	AIM2_HUMAN	Q	147;10	ENSP00000357112:E147Q;ENSP00000357111:E10Q	ENSP00000357111:E10Q	E	-	1	0	AIM2	157302701	0.000000	0.05858	0.005000	0.12908	0.104000	0.19210	-0.865000	0.04250	-0.394000	0.07727	0.491000	0.48974	GAA		0.453	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833		11	87	0	0	0	0.010729	0	11	87				
APCS	325	broad.mit.edu	37	1	159558225	159558225	+	Missense_Mutation	SNP	G	G	T	rs151221908		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:159558225G>T	ENST00000255040.2	+	2	496	c.399G>T	c.(397-399)ttG>ttT	p.L133F		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	133	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)	p.L133L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					GGACACCTTTGGTGAAAAAGG	0.498																																							uc001ftv.2		NA																	1	Substitution - coding silent(1)	p.L133L(1)	ovary(1)	ovary(1)|breast(1)	2						c.(397-399)TTG>TTT		serum amyloid P component precursor		G	PHE/LEU	0,4406		0,0,2203	74.0	74.0	74.0		399	0.3	0.3	1	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense	APCS	NM_001639.3	22	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	133/224	159558225	1,13005	2203	4300	6503	SO:0001583	missense	325				acute-phase response|chaperone-mediated protein complex assembly|protein folding	extracellular space	metal ion binding|sugar binding|unfolded protein binding	g.chr1:159558225G>T		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.399G>T	1.37:g.159558225G>T	ENSP00000255040:p.Leu133Phe						p.L133F	NM_001639	NP_001630	P02743	SAMP_HUMAN			2	495	+	all_hematologic(112;0.0429)		133			Pentaxin.			Missense_Mutation	SNP	ENST00000255040.2	37	c.399G>T	CCDS1186.1	.	.	.	.	.	.	.	.	.	.	G	9.644	1.139834	0.21205	0.0	1.16E-4	ENSG00000132703	ENST00000255040	T	0.63913	-0.07	4.25	0.296	0.15757	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.959569	0.08653	N	0.913607	T	0.38268	0.1034	L	0.55103	1.725	0.09310	N	1	B	0.26902	0.163	B	0.42882	0.401	T	0.51084	-0.8750	10	0.13853	T	0.58	-1.0889	3.3368	0.07103	0.4:0.0:0.4181:0.1819	.	133	P02743	SAMP_HUMAN	F	133	ENSP00000255040:L133F	ENSP00000255040:L133F	L	+	3	2	APCS	157824849	0.985000	0.35326	0.332000	0.25469	0.620000	0.37586	1.170000	0.31883	0.182000	0.20032	-0.140000	0.14226	TTG		0.498	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639		12	40	1	0	7.93312e-07	0.00245	8.97997e-07	12	40				
ATP1A4	480	broad.mit.edu	37	1	160136429	160136429	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:160136429G>A	ENST00000368081.4	+	8	1630	c.1159G>A	c.(1159-1161)Ggc>Agc	p.G387S		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	387					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGACAAGACGGGCACCCTCAC	0.592																																							uc001fve.3		NA																	0				ovary(2)|skin(2)	4						c.(1159-1161)GGC>AGC		Na+/K+ -ATPase alpha 4 subunit isoform 1							144.0	114.0	124.0					1																	160136429		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160136429G>A	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1159G>A	1.37:g.160136429G>A	ENSP00000357060:p.Gly387Ser					ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_5'UTR	p.G387S	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		8	1638	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		387			Cytoplasmic (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.1159G>A	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	G	33	5.285638	0.95517	.	.	ENSG00000132681	ENST00000368081	D	0.99458	-5.93	4.35	4.35	0.52113	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	H	0.99197	4.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96775	0.9571	10	0.87932	D	0	.	14.7749	0.69724	0.0:0.0:1.0:0.0	.	387	Q13733	AT1A4_HUMAN	S	387	ENSP00000357060:G387S	ENSP00000357060:G387S	G	+	1	0	ATP1A4	158403053	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	9.563000	0.98148	2.427000	0.82271	0.650000	0.86243	GGC		0.592	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		51	86	0	0	0	0.00361	0	51	86				
FAM78B	149297	broad.mit.edu	37	1	166135335	166135335	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:166135335C>T	ENST00000338353.3	-	2	740	c.151G>A	c.(151-153)Gcc>Acc	p.A51T	RP11-9L18.3_ENST00000451784.1_RNA|FAM78B_ENST00000354422.3_Missense_Mutation_p.A51T			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	51										central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					CGGGCGGAGGCTTTGAAGTAG	0.627																																							uc001gdr.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(151-153)GCC>ACC		hypothetical protein LOC149297							71.0	55.0	61.0					1																	166135335		2203	4300	6503	SO:0001583	missense	149297							g.chr1:166135335C>T	AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.151G>A	1.37:g.166135335C>T	ENSP00000339681:p.Ala51Thr					FAM78B_uc010plc.1_RNA	p.A51T	NM_001017961	NP_001017961	Q5VT40	FA78B_HUMAN			2	741	-	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)		51					B7Z693	Missense_Mutation	SNP	ENST00000338353.3	37	c.151G>A	CCDS30931.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847672	0.91277	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	4.29	4.29	0.51040	.	0.050948	0.85682	D	0.000000	T	0.71854	0.3389	M	0.72894	2.215	0.47547	D	0.999457	D	0.67145	0.996	D	0.77557	0.99	T	0.76830	-0.2814	8	0.72032	D	0.01	-20.7451	14.279	0.66199	0.0:1.0:0.0:0.0	.	51	Q5VT40	FA78B_HUMAN	T	51	.	ENSP00000339681:A51T	A	-	1	0	FAM78B	164401959	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.142000	0.77339	2.205000	0.71048	0.467000	0.42956	GCC		0.627	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343108.1	NM_001017961		7	19	0	0	0	0.00308	0	7	19				
FAM78B	149297	broad.mit.edu	37	1	166135338	166135338	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:166135338T>G	ENST00000338353.3	-	2	737	c.148A>C	c.(148-150)Aaa>Caa	p.K50Q	RP11-9L18.3_ENST00000451784.1_RNA|FAM78B_ENST00000354422.3_Missense_Mutation_p.K50Q			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	50										central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					GCGGAGGCTTTGAAGTAGGGG	0.622																																							uc001gdr.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(148-150)AAA>CAA		hypothetical protein LOC149297							72.0	55.0	61.0					1																	166135338		2203	4300	6503	SO:0001583	missense	149297							g.chr1:166135338T>G	AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.148A>C	1.37:g.166135338T>G	ENSP00000339681:p.Lys50Gln					FAM78B_uc010plc.1_RNA	p.K50Q	NM_001017961	NP_001017961	Q5VT40	FA78B_HUMAN			2	738	-	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)		50					B7Z693	Missense_Mutation	SNP	ENST00000338353.3	37	c.148A>C	CCDS30931.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222862	0.39300	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	4.29	4.29	0.51040	.	0.157753	0.53938	D	0.000047	T	0.24967	0.0606	L	0.36672	1.1	0.40253	D	0.978099	B	0.29301	0.241	B	0.26969	0.075	T	0.15321	-1.0441	8	0.39692	T	0.17	-26.9383	11.4309	0.50041	0.0:0.0:0.0:1.0	.	50	Q5VT40	FA78B_HUMAN	Q	50	.	ENSP00000339681:K50Q	K	-	1	0	FAM78B	164401962	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.648000	0.61425	1.789000	0.52484	0.383000	0.25322	AAA		0.622	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343108.1	NM_001017961		6	18	0	0	0	0.001168	0	6	18				
SELP	6403	broad.mit.edu	37	1	169580899	169580899	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:169580899G>T	ENST00000263686.6	-	7	1015	c.978C>A	c.(976-978)caC>caA	p.H326Q	SELP_ENST00000367786.2_Intron|SELP_ENST00000367792.2_Intron|SELP_ENST00000458599.2_Intron|SELP_ENST00000367793.2_Missense_Mutation_p.H264Q|SELP_ENST00000367788.2_Missense_Mutation_p.H264Q|SELP_ENST00000367794.2_Intron|SELP_ENST00000367791.2_Intron	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	326	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	GGGCTTCCAGGTGCTGACACT	0.507																																							uc001ggi.3		NA																	0				ovary(2)|skin(2)	4						c.(976-978)CAC>CAA		selectin P precursor	Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)						96.0	97.0	97.0					1																	169580899		2203	4300	6503	SO:0001583	missense	6403				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding	g.chr1:169580899G>T	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.978C>A	1.37:g.169580899G>T	ENSP00000263686:p.His326Gln					SELP_uc001ggh.2_Missense_Mutation_p.H161Q|SELP_uc009wvr.2_Missense_Mutation_p.H326Q	p.H326Q	NM_003005	NP_002996	P16109	LYAM3_HUMAN			7	1043	-	all_hematologic(923;0.208)		326			Sushi 3.|Extracellular (Potential).		Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	c.978C>A	CCDS1282.1	.	.	.	.	.	.	.	.	.	.	G	0.462	-0.888550	0.02511	.	.	ENSG00000174175	ENST00000367790;ENST00000426706;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367788	T;T;T	0.73363	-0.74;1.9;1.9	5.46	3.54	0.40534	Complement control module (2);Sushi/SCR/CCP (2);	1.962480	0.02185	N	0.060830	T	0.32615	0.0835	N	0.13198	0.31	0.21386	N	0.999701	B;B;B	0.27791	0.189;0.098;0.08	B;B;B	0.25614	0.062;0.062;0.037	T	0.33979	-0.9847	10	0.13470	T	0.59	0.9936	5.3596	0.16081	0.1906:0.1637:0.6456:0.0	.	326;326;326	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	Q	326;325;326;326;264;264	ENSP00000263686:H326Q;ENSP00000356767:H264Q;ENSP00000356762:H264Q	ENSP00000263686:H326Q	H	-	3	2	SELP	167847523	0.005000	0.15991	0.381000	0.26106	0.189000	0.23516	0.690000	0.25451	0.622000	0.30249	-0.123000	0.14984	CAC		0.507	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		28	74	1	0	9.80776e-20	0.00632	1.2522e-19	28	74				
KIFAP3	22920	broad.mit.edu	37	1	169953793	169953793	+	Silent	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:169953793A>T	ENST00000361580.2	-	12	1550	c.1323T>A	c.(1321-1323)atT>atA	p.I441I	KIFAP3_ENST00000540905.1_Silent_p.I143I|KIFAP3_ENST00000367765.1_Silent_p.I401I|KIFAP3_ENST00000367767.1_Silent_p.I397I|KIFAP3_ENST00000538366.1_Silent_p.I363I	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	441					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GTTCCAAGTCAATTCGTTCAT	0.363																																							uc001ggv.2		NA																	0				skin(1)	1						c.(1321-1323)ATT>ATA		kinesin-associated protein 3							99.0	93.0	95.0					1																	169953793		2203	4300	6503	SO:0001819	synonymous_variant	22920				blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding	g.chr1:169953793A>T	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.1323T>A	1.37:g.169953793A>T						KIFAP3_uc010plx.1_Silent_p.I143I	p.I441I	NM_014970	NP_055785	Q92845	KIFA3_HUMAN			12	1594	-	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		441					B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Silent	SNP	ENST00000361580.2	37	c.1323T>A	CCDS1288.1																																																																																				0.363	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970		13	28	0	0	0	0.00245	0	13	28				
METTL13	51603	broad.mit.edu	37	1	171753468	171753468	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:171753468G>T	ENST00000361735.3	+	2	1008	c.742G>T	c.(742-744)Gag>Tag	p.E248*	METTL13_ENST00000367737.5_Intron|METTL13_ENST00000362019.3_Nonsense_Mutation_p.E162*|METTL13_ENST00000458517.1_Nonsense_Mutation_p.E247*	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	248							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GGCGGTGCAGGAGCGACAGCA	0.667																																							uc001ghz.2		NA																	0				kidney(1)	1						c.(742-744)GAG>TAG		CGI-01 protein isoform 1							30.0	31.0	30.0					1																	171753468		2201	4300	6501	SO:0001587	stop_gained	51603						methyltransferase activity|protein binding	g.chr1:171753468G>T	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.742G>T	1.37:g.171753468G>T	ENSP00000354920:p.Glu248*					METTL13_uc001gia.2_Nonsense_Mutation_p.E162*|METTL13_uc001gib.2_Intron|METTL13_uc010pml.1_Nonsense_Mutation_p.E247*	p.E248*	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN			2	1089	+			248					A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Nonsense_Mutation	SNP	ENST00000361735.3	37	c.742G>T	CCDS1299.1	.	.	.	.	.	.	.	.	.	.	G	37	6.487851	0.97607	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000361735;ENST00000367736;ENST00000341850	.	.	.	5.33	4.41	0.53225	.	0.049037	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-13.7393	14.0447	0.64698	0.075:0.0:0.925:0.0	.	.	.	.	X	247;162;248;165;162	.	ENSP00000341732:E162X	E	+	1	0	METTL13	170020091	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.201000	0.95017	2.465000	0.83290	0.655000	0.94253	GAG		0.667	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955		18	45	1	0	1.02788e-11	0.00499	1.24297e-11	18	45				
TNR	7143	broad.mit.edu	37	1	175304935	175304935	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:175304935C>T	ENST00000367674.2	-	20	4251	c.3543G>A	c.(3541-3543)caG>caA	p.Q1181Q	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Silent_p.Q1181Q			Q92752	TENR_HUMAN	tenascin R	1181	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TCTGCCGCCTCTGGAATACCT	0.398																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(3541-3543)CAG>CAA		tenascin R precursor							97.0	98.0	98.0					1																	175304935		2203	4300	6503	SO:0001819	synonymous_variant	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175304935C>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3543G>A	1.37:g.175304935C>T						TNR_uc009wwu.1_Silent_p.Q1181Q	p.Q1181Q	NM_003285	NP_003276	Q92752	TENR_HUMAN			18	3624	-	Renal(580;0.146)		1181			Fibrinogen C-terminal.		C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	c.3543G>A	CCDS1318.1																																																																																				0.398	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		15	75	0	0	0	0.004007	0	15	75				
PAPPA2	60676	broad.mit.edu	37	1	176526212	176526212	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:176526212G>C	ENST00000367662.3	+	2	1918	c.754G>C	c.(754-756)Gag>Cag	p.E252Q	PAPPA2_ENST00000367661.3_Missense_Mutation_p.E252Q	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	252					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCGAGAAGCAGAGACCTTTAA	0.547																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(754-756)GAG>CAG		pappalysin 2 isoform 1							79.0	77.0	78.0					1																	176526212		1927	4146	6073	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176526212G>C	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.754G>C	1.37:g.176526212G>C	ENSP00000356634:p.Glu252Gln					PAPPA2_uc001gky.1_Missense_Mutation_p.E252Q|PAPPA2_uc009www.2_RNA	p.E252Q	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			2	1918	+			252					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.754G>C	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076282	0.76415	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.35789	4.56;1.29	4.25	3.32	0.38043	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.222293	0.28766	U	0.014219	T	0.30885	0.0779	M	0.65975	2.015	0.19575	N	0.999969	B;P	0.50617	0.396;0.937	B;B	0.39119	0.188;0.291	T	0.34675	-0.9819	10	0.48119	T	0.1	-11.8437	7.0388	0.25008	0.1245:0.0:0.8755:0.0	.	252;252	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	Q	252	ENSP00000356634:E252Q;ENSP00000356633:E252Q	ENSP00000356633:E252Q	E	+	1	0	PAPPA2	174792835	0.098000	0.21812	0.611000	0.29010	0.828000	0.46876	2.033000	0.41136	1.919000	0.55581	0.313000	0.20887	GAG		0.547	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			18	61	0	0	0	0.006122	0	18	61				
PAPPA2	60676	broad.mit.edu	37	1	176661345	176661345	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:176661345G>T	ENST00000367662.3	+	6	3679	c.2515G>T	c.(2515-2517)Gaa>Taa	p.E839*		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	839					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GCAGTGGACTGAAAGCAGAAA	0.493																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(2515-2517)GAA>TAA		pappalysin 2 isoform 1							167.0	171.0	170.0					1																	176661345		2056	4210	6266	SO:0001587	stop_gained	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176661345G>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2515G>T	1.37:g.176661345G>T	ENSP00000356634:p.Glu839*					PAPPA2_uc009www.2_RNA	p.E839*	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			6	3679	+			839					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Nonsense_Mutation	SNP	ENST00000367662.3	37	c.2515G>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	49	15.309522	0.99829	.	.	ENSG00000116183	ENST00000367662	.	.	.	5.81	-1.93	0.07594	.	0.788338	0.12650	N	0.450496	.	.	.	.	.	.	0.35361	D	0.788195	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-1.5513	17.3669	0.87366	0.0816:0.3646:0.5539:0.0	.	.	.	.	X	839	.	ENSP00000356634:E839X	E	+	1	0	PAPPA2	174927968	0.789000	0.28775	0.792000	0.32020	0.982000	0.71751	0.153000	0.16323	-0.172000	0.10779	-0.176000	0.13171	GAA		0.493	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			49	149	1	0	3.86236e-30	0.00361	5.10948e-30	49	149				
BRINP2	57795	broad.mit.edu	37	1	177249638	177249638	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:177249638C>A	ENST00000361539.4	+	8	1638	c.1326C>A	c.(1324-1326)agC>agA	p.S442R	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	442					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											AGAGCCACAGCTGCACCTGCC	0.602																																							uc001glf.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(1324-1326)AGC>AGA		family with sequence similarity 5, member B							51.0	46.0	48.0					1																	177249638		2203	4300	6503	SO:0001583	missense	57795					extracellular region		g.chr1:177249638C>A		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1326C>A	1.37:g.177249638C>A	ENSP00000354481:p.Ser442Arg					FAM5B_uc001glg.2_Missense_Mutation_p.S337R	p.S442R	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN			8	1638	+			442					O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	c.1326C>A	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223430	0.39300	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.63096	-0.02	5.29	5.29	0.74685	.	0.041556	0.85682	D	0.000000	T	0.66436	0.2789	L	0.58101	1.795	0.58432	D	0.999992	D;P	0.56521	0.976;0.61	P;B	0.54100	0.742;0.221	T	0.69921	-0.5014	10	0.87932	D	0	-27.187	8.0713	0.30691	0.1593:0.7599:0.0:0.0808	.	337;442	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	R	195;442	ENSP00000354481:S442R	ENSP00000354481:S442R	S	+	3	2	FAM5B	175516261	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	1.611000	0.36879	2.471000	0.83476	0.313000	0.20887	AGC		0.602	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165		20	50	1	0	9.7654e-05	0.007413	0.000105122	20	50				
RASAL2	9462	broad.mit.edu	37	1	178420782	178420782	+	Silent	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:178420782G>C	ENST00000462775.1	+	8	1385	c.1260G>C	c.(1258-1260)ctG>ctC	p.L420L	RASAL2_ENST00000448150.3_Silent_p.L550L|RASAL2_ENST00000367649.3_Silent_p.L568L	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	420	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						CTAGTGAACTGATAGACCATC	0.418																																							uc001glr.2		NA																	0				ovary(2)|breast(2)|large_intestine(1)	5						c.(1258-1260)CTG>CTC		RAS protein activator like 2 isoform 1							183.0	172.0	176.0					1																	178420782		2203	4300	6503	SO:0001819	synonymous_variant	9462				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity	g.chr1:178420782G>C	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1260G>C	1.37:g.178420782G>C						RASAL2_uc001glq.2_Silent_p.L568L|RASAL2_uc009wxc.2_5'Flank	p.L420L	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN			8	1385	+			420			Ras-GAP.		F8W755|O95174|Q2TB22|Q5TFU9	Silent	SNP	ENST00000462775.1	37	c.1260G>C	CCDS1322.1																																																																																				0.418	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692		23	94	0	0	0	0.002299	0	23	94				
CFH	3075	broad.mit.edu	37	1	196716443	196716443	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:196716443G>A	ENST00000367429.4	+	22	3936	c.3696G>A	c.(3694-3696)taG>taA	p.*1232*		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	0					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CAAAAAGATAGAATCAATCAT	0.338																																							uc001gtj.3		NA																	0				skin(4)|ovary(1)|breast(1)	6						c.(3694-3696)TAG>TAA		complement factor H isoform a precursor							123.0	100.0	108.0					1																	196716443		2203	4300	6503	SO:0001819	synonymous_variant	3075				complement activation, alternative pathway	extracellular space		g.chr1:196716443G>A	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3696G>A	1.37:g.196716443G>A							p.*1232*	NM_000186	NP_000177	P08603	CFAH_HUMAN			22	3936	+			1232					A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000367429.4	37	c.3696G>A	CCDS1385.1																																																																																				0.338	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186		4	24	0	0	0	0.009096	0	4	24				
CACNA1S	779	broad.mit.edu	37	1	201019618	201019618	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:201019618G>T	ENST00000362061.3	-	34	4366	c.4140C>A	c.(4138-4140)atC>atA	p.I1380I	CACNA1S_ENST00000367338.3_Silent_p.I1361I	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1380	Dihydropyridine binding. {ECO:0000250}.|Phenylalkylamine binding. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AATTGTCCATGATGACAGCCA	0.557																																							uc001gvv.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(4138-4140)ATC>ATA		calcium channel, voltage-dependent, L type,	Magnesium Sulfate(DB00653)|Verapamil(DB00661)						89.0	84.0	86.0					1																	201019618		2203	4300	6503	SO:0001819	synonymous_variant	779				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity	g.chr1:201019618G>T	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.4140C>A	1.37:g.201019618G>T							p.I1380I	NM_000069	NP_000060	Q13698	CAC1S_HUMAN			34	4367	-			1380			Phenylalkylamine binding (By similarity).|IV.|Helical; Name=S6 of repeat IV; (Potential).|Dihydropyridine binding (By similarity).		A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	37	c.4140C>A	CCDS1407.1																																																																																				0.557	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		14	44	1	0	2.48551e-13	0.00499	3.03907e-13	14	44				
CR1L	1379	broad.mit.edu	37	1	207868041	207868041	+	Silent	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:207868041T>C	ENST00000508064.2	+	5	867	c.807T>C	c.(805-807)caT>caC	p.H269H	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	269	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GGCCCTCCCATGTGAAGTGCC	0.498																																							uc001hga.3		NA																	0					0						c.(805-807)CAT>CAC		complement component (3b/4b) receptor 1-like							108.0	111.0	110.0					1																	207868041		1950	4146	6096	SO:0001819	synonymous_variant	1379					cytoplasm|extracellular region|membrane		g.chr1:207868041T>C	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.807T>C	1.37:g.207868041T>C						CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	p.H269H	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN			5	928	+			269			Sushi 4.		Q32MC9|Q8NEU7	Silent	SNP	ENST00000508064.2	37	c.807T>C	CCDS44310.1																																																																																				0.498	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735		62	148	0	0	0	0.00361	0	62	148				
PLXNA2	5362	broad.mit.edu	37	1	208216424	208216424	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:208216424G>A	ENST00000367033.3	-	21	4756	c.3999C>T	c.(3997-3999)ccC>ccT	p.P1333P		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1333					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CCCGCAGGACGGGGTGGTCCT	0.602																																							uc001hgz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(3997-3999)CCC>CCT		plexin A2 precursor							63.0	60.0	61.0					1																	208216424		2203	4300	6503	SO:0001819	synonymous_variant	5362				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr1:208216424G>A	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3999C>T	1.37:g.208216424G>A							p.P1333P	NM_025179	NP_079455	O75051	PLXA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.199)	21	4757	-			1333			Cytoplasmic (Potential).		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	ENST00000367033.3	37	c.3999C>T	CCDS31013.1																																																																																				0.602	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		14	41	0	0	0	0.004007	0	14	41				
EPRS	2058	broad.mit.edu	37	1	220156114	220156114	+	Splice_Site	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:220156114C>G	ENST00000366923.3	-	23	3642	c.3373G>C	c.(3373-3375)Gta>Cta	p.V1125L		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1125	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CTATTCTCACCTGTTTCACTA	0.413																																							uc001hly.1		NA																	0				ovary(1)|skin(1)	2						c.(3373-3375)GTA>CTA		glutamyl-prolyl tRNA synthetase	L-Glutamic Acid(DB00142)|L-Proline(DB00172)						148.0	145.0	146.0					1																	220156114		2203	4300	6503	SO:0001630	splice_region_variant	2058				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding	g.chr1:220156114C>G	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3373+1G>C	1.37:g.220156114C>G							p.V1125L	NM_004446	NP_004437	P07814	SYEP_HUMAN		GBM - Glioblastoma multiforme(131;0.0735)	23	3643	-			1125			Prolyl-tRNA synthetase.		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	c.3373G>C	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	C	34	5.338809	0.95783	.	.	ENSG00000136628	ENST00000366923	T	0.67865	-0.29	5.67	5.67	0.87782	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.80565	0.4647	M	0.64404	1.975	0.80722	D	1	D	0.65815	0.995	D	0.68039	0.955	T	0.81217	-0.1033	10	0.72032	D	0.01	-22.8185	19.8069	0.96534	0.0:1.0:0.0:0.0	.	1125	P07814	SYEP_HUMAN	L	1125	ENSP00000355890:V1125L	ENSP00000355890:V1125L	V	-	1	0	EPRS	218222737	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.401000	0.79962	2.688000	0.91661	0.650000	0.86243	GTA		0.413	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	Missense_Mutation	44	103	0	0	0	0.00361	0	44	103				
GALNT2	2590	broad.mit.edu	37	1	230372141	230372141	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:230372141C>G	ENST00000366672.4	+	5	588	c.516C>G	c.(514-516)atC>atG	p.I172M	GALNT2_ENST00000541865.1_Missense_Mutation_p.I82M|GALNT2_ENST00000543760.1_Missense_Mutation_p.I134M	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	172	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				AAGAAATCATCTTGGTGGATG	0.433																																							uc010pwa.1		NA																	0				ovary(2)	2						c.(514-516)ATC>ATG		polypeptide N-acetylgalactosaminyltransferase 2							75.0	74.0	74.0					1																	230372141		2203	4300	6503	SO:0001583	missense	2590				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr1:230372141C>G	BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.516C>G	1.37:g.230372141C>G	ENSP00000355632:p.Ile172Met					GALNT2_uc010pvy.1_Missense_Mutation_p.I134M|GALNT2_uc010pvz.1_RNA	p.I172M	NM_004481	NP_004472	Q10471	GALT2_HUMAN			5	588	+	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)	172			Lumenal (Potential).|Catalytic subdomain A.		A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Missense_Mutation	SNP	ENST00000366672.4	37	c.516C>G	CCDS1582.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138615	0.56936	.	.	ENSG00000143641	ENST00000543760;ENST00000366672;ENST00000541865	T;T;T	0.69561	-0.41;-0.41;-0.41	5.54	1.05	0.20165	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.86213	0.5879	H	0.99659	4.685	0.52501	D	0.999954	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.989	T	0.79574	-0.1747	10	0.87932	D	0	.	2.0903	0.03655	0.1353:0.4513:0.1183:0.2951	.	172;134	Q10471;G3V1S6	GALT2_HUMAN;.	M	134;172;82	ENSP00000445017:I134M;ENSP00000355632:I172M;ENSP00000444346:I82M	ENSP00000355632:I172M	I	+	3	3	GALNT2	228438764	0.013000	0.17824	0.993000	0.49108	0.985000	0.73830	0.018000	0.13422	0.298000	0.22638	-0.137000	0.14449	ATC		0.433	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481		30	52	0	0	0	0.012213	0	30	52				
DISC1	27185	broad.mit.edu	37	1	231829759	231829759	+	Missense_Mutation	SNP	G	G	T	rs199501041		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:231829759G>T	ENST00000602281.1	+	2	308	c.255G>T	c.(253-255)caG>caT	p.Q85H	DISC1_ENST00000317586.4_Missense_Mutation_p.Q85H|DISC1_ENST00000602873.1_Intron|TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000535983.1_Missense_Mutation_p.Q85H|DISC1_ENST00000539444.1_Missense_Mutation_p.Q85H|DISC1_ENST00000366633.3_Missense_Mutation_p.Q85H|DISC1_ENST00000366636.4_Missense_Mutation_p.Q85H|DISC1_ENST00000439617.2_Missense_Mutation_p.Q85H|DISC1_ENST00000537876.1_Missense_Mutation_p.Q85H	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	85	Interaction with MAP1A.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GGGCCAGACAGTGTGGCCTTG	0.627																																							uc001huz.2		NA																	0				skin(1)	1						c.(253-255)CAG>CAT		disrupted in schizophrenia 1 isoform L							33.0	30.0	31.0					1																	231829759		2203	4300	6503	SO:0001583	missense	27185				microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding	g.chr1:231829759G>T	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.255G>T	1.37:g.231829759G>T	ENSP00000473425:p.Gln85His					TSNAX-DISC1_uc010pwe.1_Missense_Mutation_p.Q40H|TSNAX-DISC1_uc010pwf.1_Missense_Mutation_p.Q40H|TSNAX-DISC1_uc010pwg.1_Missense_Mutation_p.Q74H|TSNAX-DISC1_uc010pwh.1_Missense_Mutation_p.Q40H|TSNAX-DISC1_uc010pwi.1_Missense_Mutation_p.Q40H|TSNAX-DISC1_uc010pwj.1_Missense_Mutation_p.Q74H|TSNAX-DISC1_uc010pwk.1_Missense_Mutation_p.Q74H|TSNAX-DISC1_uc010pwl.1_RNA|DISC1_uc010pwo.1_Missense_Mutation_p.Q85H|DISC1_uc010pwp.1_Missense_Mutation_p.Q85H|DISC1_uc010pwq.1_Missense_Mutation_p.Q85H|DISC1_uc010pwr.1_Missense_Mutation_p.Q85H|DISC1_uc010pws.1_Missense_Mutation_p.Q85H|DISC1_uc010pwt.1_Missense_Mutation_p.Q85H|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_RNA|DISC1_uc010pww.1_Missense_Mutation_p.Q85H|DISC1_uc010pwx.1_RNA|DISC1_uc010pwy.1_RNA|DISC1_uc010pwz.1_RNA|DISC1_uc010pxa.1_RNA|DISC1_uc001huy.2_Missense_Mutation_p.Q85H|DISC1_uc010pxb.1_Missense_Mutation_p.Q85H|DISC1_uc010pxc.1_Missense_Mutation_p.Q85H|DISC1_uc010pxd.1_5'UTR|DISC1_uc010pxe.1_Missense_Mutation_p.Q85H|DISC1_uc009xfr.2_Missense_Mutation_p.Q40H|DISC1_uc010pxf.1_Missense_Mutation_p.Q85H|DISC1_uc010pxg.1_Missense_Mutation_p.Q85H|DISC1_uc010pxh.1_Missense_Mutation_p.Q85H|DISC1_uc010pxi.1_RNA|DISC1_uc010pxj.1_5'UTR|DISC1_uc010pxk.1_RNA|DISC1_uc010pxl.1_RNA|DISC1_uc010pxm.1_Missense_Mutation_p.Q85H|DISC1_uc010pxn.1_5'UTR|DISC1_uc001hva.2_Missense_Mutation_p.Q85H|DISC1_uc010pwm.1_Missense_Mutation_p.Q85H|DISC1_uc001hux.1_Missense_Mutation_p.Q85H|DISC1_uc001hvc.3_Missense_Mutation_p.Q85H|DISC1_uc010pwn.1_Missense_Mutation_p.Q85H	p.Q85H	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN			2	308	+		all_cancers(173;0.0208)|Prostate(94;0.0975)	85			Interaction with MAP1A.		A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000602281.1	37	c.255G>T	CCDS59205.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147057	0.37923	.	.	ENSG00000162946	ENST00000439617;ENST00000366637;ENST00000317586;ENST00000366636;ENST00000366638;ENST00000532576;ENST00000535983;ENST00000537876;ENST00000366633;ENST00000539444;ENST00000295051;ENST00000535944	T;T;T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49	4.88	-6.65	0.01795	.	3.190150	0.00678	N	0.000666	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	B;P;P;P;P;P;P;P;P;P;B;P;P;P;P;P;P;P;P;P;B	0.48503	0.0;0.755;0.755;0.755;0.547;0.911;0.755;0.755;0.547;0.755;0.0;0.911;0.846;0.755;0.755;0.755;0.911;0.755;0.755;0.755;0.001	B;B;P;P;B;B;P;P;B;P;B;P;P;P;B;B;P;B;B;B;B	0.47941	0.001;0.346;0.465;0.465;0.346;0.443;0.465;0.465;0.346;0.465;0.001;0.562;0.465;0.465;0.346;0.346;0.465;0.346;0.346;0.346;0.001	T	0.31194	-0.9952	10	0.19147	T	0.46	3.9945	2.7267	0.05216	0.375:0.3576:0.1643:0.1031	.	85;85;85;85;85;85;85;85;85;85;85;85;85;85;85;85;85;85;85;85;85	C4P094;C4P0A3;C4P098;C4P0A1;C4P0A4;A6NLH2;C4P0A5;C4P095;C4P0B6;C4P0C4;C4P091;C4P0D2;C4P0D3;C4P0B1;A7E2W8;Q5T409;C4P0D0;Q9NRI5-2;Q9NRI5;Q9NRI5-3;Q9NRI5-4	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;DISC1_HUMAN;.;.	H	85	ENSP00000403888:Q85H;ENSP00000320784:Q85H;ENSP00000355596:Q85H;ENSP00000443996:Q85H;ENSP00000440909:Q85H;ENSP00000355593:Q85H;ENSP00000440953:Q85H;ENSP00000295051:Q85H;ENSP00000441193:Q85H	ENSP00000295051:Q85H	Q	+	3	2	DISC1	229896382	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.502000	0.00965	-0.892000	0.03935	0.655000	0.94253	CAG		0.627	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467451.1	NM_018662		12	21	1	0	5.50884e-06	0.001368	6.13459e-06	12	21				
RYR2	6262	broad.mit.edu	37	1	237580399	237580399	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:237580399G>A	ENST00000366574.2	+	11	1141	c.824G>A	c.(823-825)tGg>tAg	p.W275*	RYR2_ENST00000542537.1_Nonsense_Mutation_p.W259*|RYR2_ENST00000360064.6_Nonsense_Mutation_p.W273*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	275	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGTTCCCTTTGGAGACTAGAG	0.428																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(823-825)TGG>TAG		cardiac muscle ryanodine receptor							126.0	120.0	122.0					1																	237580399		2039	4204	6243	SO:0001587	stop_gained	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237580399G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.824G>A	1.37:g.237580399G>A	ENSP00000355533:p.Trp275*						p.W275*	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		11	944	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	275			Cytoplasmic (By similarity).|MIR 3.		Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	ENST00000366574.2	37	c.824G>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	39	7.288132	0.98189	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	.	.	.	X	275;273;259	.	ENSP00000353174:W273X	W	+	2	0	RYR2	235647022	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.781000	0.99029	2.835000	0.97688	0.650000	0.86243	TGG		0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		13	43	0	0	0	0.00245	0	13	43				
FMN2	56776	broad.mit.edu	37	1	240255892	240255893	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:240255892_240255893GG>TT	ENST00000319653.9	+	1	713_714	c.483_484GG>TT	c.(481-486)gaGGat>gaTTat	p.161_162ED>DY		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	161					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.D305Y(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGATCGCCGAGGATGTGGAAAC	0.644																																							uc010pyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(481-486)GAGGAT>GATTAT		formin 2																																				SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240255892_240255893GG>TT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	Exception_encountered	1.37:g.240255892_240255893delinsTT	ENSP00000318884:p.E161_D162delinsDY					FMN2_uc010pye.1_Missense_Mutation_p.161_162ED>DY	p.161_162ED>DY	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		1	708_709	+	Ovarian(103;0.127)	all_cancers(173;0.013)	161_162					B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	DNP	ENST00000319653.9	37	c.483_484GG>TT	CCDS31069.2																																																																																				0.644	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		12	43	0	0	0	0.004672	0	12	43				
RGS7	6000	broad.mit.edu	37	1	241262007	241262007	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:241262007G>A	ENST00000407727.1	-	2	133	c.134C>T	c.(133-135)aCg>aTg	p.T45M	RGS7_ENST00000331110.7_Missense_Mutation_p.T19M|RGS7_ENST00000366564.1_Missense_Mutation_p.T45M|RGS7_ENST00000348120.2_Missense_Mutation_p.T45M|RGS7_ENST00000401882.1_Missense_Mutation_p.T45M|RGS7_ENST00000366565.1_Missense_Mutation_p.T45M|RGS7_ENST00000366563.1_Missense_Mutation_p.T45M|RGS7_ENST00000366562.4_Missense_Mutation_p.T45M|RGS7_ENST00000446183.2_De_novo_Start_OutOfFrame			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	45	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GCTTTTGACCGTACGAATAGG	0.353																																							uc001hyv.2		NA																	0				ovary(4)|skin(2)|kidney(1)	7						c.(133-135)ACG>ATG		regulator of G-protein signaling 7							173.0	154.0	161.0					1																	241262007		2203	4300	6503	SO:0001583	missense	6000				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity	g.chr1:241262007G>A	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.134C>T	1.37:g.241262007G>A	ENSP00000384428:p.Thr45Met					RGS7_uc010pyh.1_Missense_Mutation_p.T19M|RGS7_uc010pyj.1_Translation_Start_Site|RGS7_uc001hyu.2_Missense_Mutation_p.T45M|RGS7_uc009xgn.1_Missense_Mutation_p.T45M|RGS7_uc001hyw.2_Missense_Mutation_p.T45M	p.T45M	NM_002924	NP_002915	P49802	RGS7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.027)		3	464	-		all_cancers(173;0.0131)	45			DEP.		Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37	c.134C>T		.	.	.	.	.	.	.	.	.	.	G	24.8	4.568628	0.86439	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000348120;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.53270	0.1786	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.997;0.999;0.963	T	0.57991	-0.7715	10	0.87932	D	0	-17.24	14.5808	0.68288	0.0:0.0:1.0:0.0	.	19;45;45;45;45	B7Z257;P49802-4;P49802-2;P49802-5;P49802-3	.;.;.;.;.	M	19;45;45;45;45;45;45;45	ENSP00000331485:T19M;ENSP00000355523:T45M;ENSP00000355522:T45M;ENSP00000355521:T45M;ENSP00000341242:T45M;ENSP00000355520:T45M;ENSP00000384428:T45M;ENSP00000385508:T45M	ENSP00000331485:T19M	T	-	2	0	RGS7	239328630	1.000000	0.71417	0.929000	0.37066	0.950000	0.60333	8.301000	0.89951	2.572000	0.86782	0.655000	0.94253	ACG		0.353	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		3	26	0	0	0	0.004672	0	3	26				
OR2L2	26246	broad.mit.edu	37	1	248201848	248201848	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:248201848C>A	ENST00000366479.2	+	1	375	c.279C>A	c.(277-279)ttC>ttA	p.F93L	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ctatctccttcactggatgtg	0.423																																							uc001idw.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(277-279)TTC>TTA		olfactory receptor, family 2, subfamily L,							158.0	149.0	152.0					1																	248201848		2203	4300	6503	SO:0001583	missense	26246				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248201848C>A	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.279C>A	1.37:g.248201848C>A	ENSP00000355435:p.Phe93Leu					OR2L13_uc001ids.2_Intron	p.F93L	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	375	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		93			Extracellular (Potential).		Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	c.279C>A	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	9.280	1.047853	0.19827	.	.	ENSG00000203663	ENST00000366479	T	0.00327	8.09	1.9	-0.453	0.12201	GPCR, rhodopsin-like superfamily (1);	0.256890	0.20169	N	0.097766	T	0.00178	0.0005	L	0.39020	1.185	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.41822	-0.9487	10	0.38643	T	0.18	.	3.4619	0.07536	0.0:0.4097:0.2139:0.3764	.	93	Q8NH16	OR2L2_HUMAN	L	93	ENSP00000355435:F93L	ENSP00000355435:F93L	F	+	3	2	OR2L2	246268471	0.000000	0.05858	0.720000	0.30636	0.144000	0.21451	-3.486000	0.00455	0.897000	0.36392	0.194000	0.17425	TTC		0.423	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		51	115	1	0	1.19451e-25	0.00361	1.55769e-25	51	115				
OR2M4	26245	broad.mit.edu	37	1	248402386	248402386	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:248402386G>A	ENST00000306687.1	+	1	156	c.156G>A	c.(154-156)gaG>gaA	p.E52E		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	52					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCTACATAGAGAAACAGCTCC	0.478																																							uc010pzh.1		NA																	0				breast(2)	2						c.(154-156)GAG>GAA		olfactory receptor, family 2, subfamily M,							203.0	190.0	195.0					1																	248402386		2203	4300	6503	SO:0001819	synonymous_variant	26245				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248402386G>A	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.156G>A	1.37:g.248402386G>A							p.E52E	NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	156	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		52			Cytoplasmic (Potential).		Q15611|Q8NG82	Silent	SNP	ENST00000306687.1	37	c.156G>A	CCDS31108.1																																																																																				0.478	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504		33	160	0	0	0	0.003755	0	33	160				
NET1	10276	broad.mit.edu	37	10	5471146	5471146	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:5471146G>C	ENST00000355029.4	+	3	351	c.209G>C	c.(208-210)aGa>aCa	p.R70T	NET1_ENST00000542715.1_5'UTR	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	70	Necessary for nuclear localization. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						AGAAAACGCAGAGAGAAAGAT	0.328																																							uc001iia.2		NA																	0				breast(1)	1						c.(208-210)AGA>ACA		neuroepithelial cell transforming gene 1 isoform							94.0	92.0	92.0					10																	5471146		1818	4077	5895	SO:0001583	missense	10276				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity	g.chr10:5471146G>C	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.209G>C	10.37:g.5471146G>C	ENSP00000347134:p.Arg70Thr					NET1_uc010qar.1_5'UTR	p.R70T	NM_001047160	NP_001040625	Q7Z628	ARHG8_HUMAN			3	347	+			70			Necessary for nuclear localization (By similarity).|Nuclear localization signal (By similarity).		Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	ENST00000355029.4	37	c.209G>C	CCDS41483.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.499882	0.26861	.	.	ENSG00000173848	ENST00000355029	T	0.13420	2.59	5.46	4.56	0.56223	.	0.000000	0.42821	D	0.000652	T	0.10035	0.0246	L	0.39898	1.24	0.80722	D	1	B	0.16396	0.017	B	0.14023	0.01	T	0.07083	-1.0791	10	0.06891	T	0.86	-8.4583	10.0761	0.42362	0.0925:0.0:0.9075:0.0	.	70	Q7Z628	ARHG8_HUMAN	T	70	ENSP00000347134:R70T	ENSP00000347134:R70T	R	+	2	0	NET1	5461146	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.488000	0.60300	1.316000	0.45131	0.650000	0.86243	AGA		0.328	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863		8	48	0	0	0	0.006214	0	8	48				
GPR158	57512	broad.mit.edu	37	10	25465055	25465055	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:25465055C>A	ENST00000376351.3	+	1	1065	c.706C>A	c.(706-708)Cgc>Agc	p.R236S	GPR158-AS1_ENST00000449643.1_RNA	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	236					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCACTTACACCGCCGCGGCCC	0.701																																							uc001isj.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(706-708)CGC>AGC		G protein-coupled receptor 158 precursor							9.0	10.0	10.0					10																	25465055		2153	4217	6370	SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25465055C>A	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.706C>A	10.37:g.25465055C>A	ENSP00000365529:p.Arg236Ser					LOC100128811_uc010qde.1_5'UTR	p.R236S	NM_020752	NP_065803	Q5T848	GP158_HUMAN			1	766	+			236			Extracellular (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	c.706C>A	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918428	0.73098	.	.	ENSG00000151025	ENST00000376351	T	0.61040	0.14	5.09	5.09	0.68999	.	0.000000	0.52532	D	0.000072	T	0.63780	0.2540	L	0.42245	1.32	0.45867	D	0.998721	D	0.53312	0.959	P	0.57548	0.823	T	0.66143	-0.5997	10	0.87932	D	0	.	12.8975	0.58108	0.2612:0.7388:0.0:0.0	.	236	Q5T848	GP158_HUMAN	S	236	ENSP00000365529:R236S	ENSP00000365529:R236S	R	+	1	0	GPR158	25505061	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.499000	0.35671	2.650000	0.89964	0.655000	0.94253	CGC		0.701	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		3	6	1	0	2.56e-06	0.009096	2.87411e-06	3	6				
APBB1IP	54518	broad.mit.edu	37	10	26849724	26849724	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:26849724G>T	ENST00000376236.4	+	13	1775	c.1320G>T	c.(1318-1320)tgG>tgT	p.W440C		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	440					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						CCTCTCGGTGGACAAACTTGG	0.498																																							uc001iss.2		NA																	0				lung(4)|skin(2)|central_nervous_system(1)	7						c.(1318-1320)TGG>TGT		amyloid beta (A4) precursor protein-binding,							115.0	111.0	112.0					10																	26849724		2203	4300	6503	SO:0001583	missense	54518				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium		g.chr10:26849724G>T	AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.1320G>T	10.37:g.26849724G>T	ENSP00000365411:p.Trp440Cys						p.W440C	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN			13	1641	+			440					Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	ENST00000376236.4	37	c.1320G>T	CCDS31167.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145824	0.57044	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.36520	1.25	5.75	3.77	0.43336	.	0.052976	0.85682	N	0.000000	T	0.59155	0.2173	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.61471	-0.7056	10	0.39692	T	0.17	.	11.5566	0.50752	0.0:0.1349:0.7249:0.1402	.	440	Q7Z5R6	AB1IP_HUMAN	C	440	ENSP00000365411:W440C	ENSP00000365411:W440C	W	+	3	0	APBB1IP	26889730	1.000000	0.71417	0.996000	0.52242	0.485000	0.33311	6.004000	0.70709	1.366000	0.46076	0.650000	0.86243	TGG		0.498	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047270.1	NM_019043		8	56	1	0	0.000442599	0.006214	0.000470905	8	56				
NRP1	8829	broad.mit.edu	37	10	33481304	33481304	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:33481304G>C	ENST00000265371.4	-	14	2492	c.1967C>G	c.(1966-1968)tCt>tGt	p.S656C	NRP1_ENST00000395995.1_Missense_Mutation_p.S656C|NRP1_ENST00000374867.2_Missense_Mutation_p.S656C|NRP1_ENST00000374875.1_Missense_Mutation_p.S468C			O14786	NRP1_HUMAN	neuropilin 1	656	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	GGTCTTGTGAGAGCCCCAGCC	0.453																																					Melanoma(104;886 1489 44640 45944 51153)	Melanoma(104;886 1489 44640 45944 51153)	uc001iwx.3		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1966-1968)TCT>TGT		neuropilin 1 isoform a	Palifermin(DB00039)|Pegaptanib(DB04895)						317.0	294.0	302.0					10																	33481304		2203	4300	6503	SO:0001583	missense	8829				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity	g.chr10:33481304G>C	AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1967C>G	10.37:g.33481304G>C	ENSP00000265371:p.Ser656Cys					NRP1_uc001iwv.3_Missense_Mutation_p.S656C|NRP1_uc009xlz.2_Missense_Mutation_p.S649C|NRP1_uc001iww.3_Missense_Mutation_p.S468C|NRP1_uc001iwy.3_Missense_Mutation_p.S649C	p.S656C	NM_003873	NP_003864	O14786	NRP1_HUMAN			13	2490	-			656			Extracellular (Potential).|MAM.		B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	ENST00000265371.4	37	c.1967C>G	CCDS7177.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989118	0.74589	.	.	ENSG00000099250	ENST00000265371;ENST00000374875;ENST00000374867;ENST00000395995	T;T;T;T	0.02301	4.35;4.35;4.35;4.35	5.83	5.83	0.93111	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.151998	0.64402	D	0.000013	T	0.10337	0.0253	L	0.47716	1.5	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.74023	0.982;0.969;0.982;0.982;0.931	T	0.00733	-1.1589	10	0.72032	D	0.01	-22.095	20.1338	0.98010	0.0:0.0:1.0:0.0	.	649;656;656;468;656	A8K9V7;Q68DN3;O14786;Q5JWQ6;E9PEP6	.;.;NRP1_HUMAN;.;.	C	656;468;656;656	ENSP00000265371:S656C;ENSP00000364009:S468C;ENSP00000364001:S656C;ENSP00000379317:S656C	ENSP00000265371:S656C	S	-	2	0	NRP1	33521310	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.223000	0.65283	2.770000	0.95276	0.655000	0.94253	TCT		0.453	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2			107	191	0	0	0	0.00361	0	107	191				
ANKRD30A	91074	broad.mit.edu	37	10	37421180	37421180	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:37421180C>A	ENST00000602533.1	+	4	454	c.355C>A	c.(355-357)Cca>Aca	p.P119T	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.P119T|RNU6-811P_ENST00000384069.1_RNA|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.P119T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	175					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TAGCCTCACACCACTTTTACT	0.289																																							uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(355-357)CCA>ACA		ankyrin repeat domain 30A							57.0	55.0	56.0					10																	37421180		1804	4075	5879	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37421180C>A	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.355C>A	10.37:g.37421180C>A	ENSP00000473551:p.Pro119Thr						p.P119T	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			4	454	+			175			ANK 4.		Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.355C>A		.	.	.	.	.	.	.	.	.	.	.	13.18	2.160830	0.38119	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.75260	-0.61;-0.92	2.37	2.37	0.29283	Ankyrin repeat-containing domain (4);	.	.	.	.	D	0.86665	0.5987	M	0.91612	3.225	0.29919	N	0.822912	D	0.76494	0.999	D	0.81914	0.995	T	0.80261	-0.1456	9	0.66056	D	0.02	.	8.0619	0.30638	0.0:1.0:0.0:0.0	.	175	Q9BXX3	AN30A_HUMAN	T	119	ENSP00000354432:P119T;ENSP00000363792:P119T	ENSP00000354432:P119T	P	+	1	0	ANKRD30A	37461186	1.000000	0.71417	0.640000	0.29408	0.080000	0.17528	2.688000	0.46984	1.181000	0.42912	0.289000	0.19496	CCA		0.289	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		12	28	1	0	2.31682e-05	0.003163	2.53879e-05	12	28				
ZNF33A	7581	broad.mit.edu	37	10	38343813	38343813	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:38343813G>A	ENST00000458705.2	+	5	916	c.758G>A	c.(757-759)aGa>aAa	p.R253K	ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000307441.9_Missense_Mutation_p.R253K|ZNF33A_ENST00000374618.3_Missense_Mutation_p.R254K|ZNF33A_ENST00000432900.2_Missense_Mutation_p.R260K			Q06730	ZN33A_HUMAN	zinc finger protein 33A	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						GAATTTGGGAGAACTTTGTGT	0.378																																							uc001izh.2		NA																	0				ovary(2)|skin(1)	3						c.(757-759)AGA>AAA		zinc finger protein 33A isoform b							75.0	70.0	72.0					10																	38343813		2203	4300	6503	SO:0001583	missense	7581					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38343813G>A	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.758G>A	10.37:g.38343813G>A	ENSP00000387713:p.Arg253Lys					ZNF33A_uc001izg.2_Missense_Mutation_p.R254K|ZNF33A_uc010qev.1_Missense_Mutation_p.R260K|ZNF33A_uc001izi.1_Intron	p.R253K	NM_006974	NP_008905	Q06730	ZN33A_HUMAN			5	936	+			253					A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	c.758G>A	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	G	2.101	-0.406098	0.04832	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.04970	3.54;3.52;3.53;3.53	2.26	0.254	0.15557	.	0.462553	0.16457	N	0.213569	T	0.01320	0.0043	N	0.01009	-1.055	0.22639	N	0.998908	B;B;B	0.33171	0.4;0.172;0.004	B;B;B	0.28011	0.085;0.039;0.008	T	0.41822	-0.9487	10	0.02654	T	1	.	4.4433	0.11584	0.5167:0.0:0.4833:0.0	.	260;253;254	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	K	254;260;253;253	ENSP00000363747:R254K;ENSP00000402467:R260K;ENSP00000387713:R253K;ENSP00000304268:R253K	ENSP00000304268:R253K	R	+	2	0	ZNF33A	38383819	0.003000	0.15002	0.006000	0.13384	0.184000	0.23303	0.156000	0.16382	0.265000	0.21872	0.460000	0.39030	AGA		0.378	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		11	26	0	0	0	0.010729	0	11	26				
RET	5979	broad.mit.edu	37	10	43596171	43596171	+	Splice_Site	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:43596171G>T	ENST00000355710.3	+	2	569		c.e2+1		RET_ENST00000340058.5_Splice_Site	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	AGTGTCCGCAGTAAGGGAGCC	0.622		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	uc001jal.2		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	T|Mis|N|F	ret proto-oncogene	yes	Hirschsprung disease	"""E, O"""	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma		0				thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451						c.e2+1		ret proto-oncogene isoform a	Sunitinib(DB01268)						22.0	20.0	20.0					10																	43596171		2200	4297	6497	SO:0001630	splice_region_variant	5979	Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity	g.chr10:43596171G>T	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.337+1G>T	10.37:g.43596171G>T						RET_uc001jak.1_Splice_Site_p.N113_splice	p.N113_splice	NM_020975	NP_066124	P07949	RET_HUMAN			2	527	+		Ovarian(717;0.0423)						A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Splice_Site	SNP	ENST00000355710.3	37	c.337_splice	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.768697	0.31320	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1491	0.81599	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RET	42916177	1.000000	0.71417	1.000000	0.80357	0.087000	0.18053	5.167000	0.64972	2.605000	0.88082	0.655000	0.94253	.		0.622	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	Intron	3	4	1	0	0.004672	0.004672	0.0048949	3	4				
CYP26C1	340665	broad.mit.edu	37	10	94828197	94828197	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:94828197G>T	ENST00000285949.5	+	6	1312	c.1312G>T	c.(1312-1314)Gaa>Taa	p.E438*		NM_183374.2	NP_899230.2	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C, polypeptide 1	438					anterior/posterior pattern specification (GO:0009952)|central nervous system development (GO:0007417)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|organelle fusion (GO:0048284)|oxidation-reduction process (GO:0055114)|retinoic acid catabolic process (GO:0034653)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			central_nervous_system(1)|lung(3)|ovary(1)	5		Colorectal(252;0.122)				CGCAGCGCGCGAAGATTCCCG	0.687																																							uc010qns.1		NA																	0				central_nervous_system(1)	1						c.(1312-1314)GAA>TAA		cytochrome P450, family 26, subfamily C,							13.0	16.0	15.0					10																	94828197		2102	4176	6278	SO:0001587	stop_gained	340665				anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr10:94828197G>T		CCDS7425.1	10q23.33	2003-11-20			ENSG00000187553	ENSG00000187553		"""Cytochrome P450s"""	20577	protein-coding gene	gene with protein product		608428					Standard	XR_246086		Approved		uc010qns.2	Q6V0L0	OTTHUMG00000018766	ENST00000285949.5:c.1312G>T	10.37:g.94828197G>T	ENSP00000285949:p.Glu438*					CYP26C1_uc009xud.2_RNA	p.E438*	NM_183374	NP_899230	Q6V0L0	CP26C_HUMAN			6	1312	+		Colorectal(252;0.122)	438					Q5VXH6	Nonsense_Mutation	SNP	ENST00000285949.5	37	c.1312G>T	CCDS7425.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534753	0.64972	.	.	ENSG00000187553	ENST00000285949	.	.	.	5.17	5.17	0.71159	.	0.742043	0.12783	N	0.439509	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-0.0402	15.3519	0.74396	0.0:0.1498:0.8502:0.0	.	.	.	.	X	438	.	ENSP00000285949:E438X	E	+	1	0	CYP26C1	94818187	0.259000	0.24043	0.886000	0.34754	0.176000	0.22953	1.513000	0.35823	2.403000	0.81681	0.555000	0.69702	GAA		0.687	CYP26C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049409.2	NM_183374		21	19	1	0	1.55795e-14	0.012319	1.92638e-14	21	19				
CYP2C18	1562	broad.mit.edu	37	10	96484212	96484212	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:96484212A>C	ENST00000285979.6	+	7	1270	c.1071A>C	c.(1069-1071)agA>agC	p.R357S	CYP2C19_ENST00000464755.1_3'UTR|CYP2C18_ENST00000339022.5_Missense_Mutation_p.R298S	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	357					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	AGATCCAGAGATACATTGACC	0.498																																							uc001kjv.3		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(1069-1071)AGA>AGC		cytochrome P450 family 2 subfamily C polypeptide							254.0	208.0	224.0					10																	96484212		2203	4300	6503	SO:0001583	missense	1562				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr10:96484212A>C	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.1071A>C	10.37:g.96484212A>C	ENSP00000285979:p.Arg357Ser					CYP2C18_uc001kjw.3_Missense_Mutation_p.R298S|CYP2C19_uc009xus.1_Intron|CYP2C19_uc010qny.1_5'UTR	p.R357S	NM_000772	NP_000763	P33260	CP2CI_HUMAN		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	7	1397	+		Colorectal(252;0.09)	357					B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	ENST00000285979.6	37	c.1071A>C	CCDS7435.1	.	.	.	.	.	.	.	.	.	.	a	12.67	2.006738	0.35415	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	D;D	0.97480	-4.4;-4.4	4.15	4.15	0.48705	.	0.000000	0.85682	U	0.000000	D	0.98883	0.9622	H	0.98918	4.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98298	1.0517	10	0.87932	D	0	.	6.1483	0.20298	0.8868:0.0:0.1132:0.0	.	298;357	Q4VAT5;P33260	.;CP2CI_HUMAN	S	298;357	ENSP00000341293:R298S;ENSP00000285979:R357S	ENSP00000285979:R357S	R	+	3	2	CYP2C18	96474202	0.011000	0.17503	0.995000	0.50966	0.048000	0.14542	-0.291000	0.08343	1.718000	0.51419	0.260000	0.18958	AGA		0.498	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772		90	67	0	0	0	0.00361	0	90	67				
C10orf12	26148	broad.mit.edu	37	10	98743574	98743574	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:98743574G>A	ENST00000286067.2	+	1	2534	c.2427G>A	c.(2425-2427)atG>atA	p.M809I		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	809										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CCCAGTACATGAAAGTTCAGA	0.453																																							uc001kmv.2		NA																	0				skin(2)	2						c.(2425-2427)ATG>ATA		hypothetical protein LOC26148							71.0	70.0	71.0					10																	98743574		2203	4300	6503	SO:0001583	missense	26148							g.chr10:98743574G>A	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.2427G>A	10.37:g.98743574G>A	ENSP00000286067:p.Met809Ile						p.M809I	NM_015652	NP_056467	Q8N655	CJ012_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	1	2534	+		Colorectal(252;0.172)	809					Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	c.2427G>A	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	G	7.351	0.622883	0.14193	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.07688	3.17	5.95	5.95	0.96441	.	0.319498	0.25845	N	0.027939	T	0.11281	0.0275	L	0.47716	1.5	0.29447	N	0.858769	B	0.28998	0.23	B	0.27170	0.077	T	0.08513	-1.0718	10	0.24483	T	0.36	-0.9717	20.3927	0.98949	0.0:0.0:1.0:0.0	.	809	Q8N655	CJ012_HUMAN	I	809;643	ENSP00000286067:M809I	ENSP00000286067:M809I	M	+	3	0	C10orf12	98733564	1.000000	0.71417	0.953000	0.39169	0.169000	0.22640	2.719000	0.47244	2.833000	0.97629	0.655000	0.94253	ATG		0.453	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		9	20	0	0	0	0.006214	0	9	20				
SFR1	119392	broad.mit.edu	37	10	105883633	105883633	+	Silent	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:105883633A>G	ENST00000369727.3	+	3	316	c.297A>G	c.(295-297)caA>caG	p.Q99Q	SFR1_ENST00000336358.5_Silent_p.Q161Q|SFR1_ENST00000369729.3_Silent_p.Q86Q	NM_001002759.1	NP_001002759.1	Q86XK3	SFR1_HUMAN	SWI5-dependent recombination repair 1	99					double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											TGGAATTTCAAGAAAGTTTTA	0.328																																							uc001kxu.2		NA																	0					0						c.(295-297)CAA>CAG		hypothetical protein LOC119392 isoform a							50.0	57.0	54.0					10																	105883633		2196	4300	6496	SO:0001819	synonymous_variant	119392				double-strand break repair via homologous recombination	Swi5-Sfr1 complex	protein binding	g.chr10:105883633A>G	BC020892	CCDS31279.1, CCDS31280.1	10q25.1	2013-10-11	2011-08-01	2011-08-01	ENSG00000156384	ENSG00000156384			29574	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 78"", ""MEI5 recombination repair protein homolog (S. cerevisiae)"""	C10orf78, MEIR5		21252223, 21779174, 20976249	Standard	NM_145247		Approved	MEI5, bA373N18.1, FLJ41960	uc001kxu.3	Q86XK3	OTTHUMG00000019000	ENST00000369727.3:c.297A>G	10.37:g.105883633A>G						C10orf78_uc001kxs.2_Silent_p.Q86Q|C10orf78_uc001kxt.2_Silent_p.Q53Q|C10orf78_uc001kxv.2_Silent_p.Q161Q	p.Q99Q	NM_001002759	NP_001002759	Q86XK3	SFR1_HUMAN		Epithelial(162;1.31e-09)|all cancers(201;3.84e-08)|BRCA - Breast invasive adenocarcinoma(275;0.014)	3	310	+		Colorectal(252;0.102)|Breast(234;0.122)	99					A8K569|B2RTV8|Q5JT39|Q5JT40|Q8WW47	Silent	SNP	ENST00000369727.3	37	c.297A>G	CCDS31279.1																																																																																				0.328	SFR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050191.1	NM_145247		23	21	0	0	0	0.012319	0	23	21				
SORCS1	114815	broad.mit.edu	37	10	108459107	108459107	+	Silent	SNP	C	C	G	rs370917531		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:108459107C>G	ENST00000263054.6	-	9	1285	c.1278G>C	c.(1276-1278)gcG>gcC	p.A426A	SORCS1_ENST00000344440.6_Silent_p.A426A|SORCS1_ENST00000369698.1_5'UTR	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	426					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ATTCTTGGACCGCTGCGAACA	0.478																																							uc001kym.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1276-1278)GCG>GCC		SORCS receptor 1 isoform a		C	,,,,,	1,4405	2.1+/-5.4	0,1,2202	237.0	184.0	202.0		1278,1278,1278,1278,1278,1278	-12.3	0.0	10		202	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SORCS1	NM_001013031.2,NM_001206569.1,NM_001206570.1,NM_001206571.1,NM_001206572.1,NM_052918.4	,,,,,	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	,,,,,	426/1199,426/1180,426/1131,426/1160,426/1180,426/1169	108459107	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108459107C>G	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1278G>C	10.37:g.108459107C>G						SORCS1_uc001kyl.2_Silent_p.A426A|SORCS1_uc009xxs.2_Silent_p.A426A|SORCS1_uc001kyn.1_Silent_p.A426A|SORCS1_uc001kyo.2_Silent_p.A426A	p.A426A	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	9	1286	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	426			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	c.1278G>C	CCDS7559.1																																																																																				0.478	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		25	15	0	0	0	0.008361	0	25	15				
TACC2	10579	broad.mit.edu	37	10	123810054	123810054	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:123810054A>T	ENST00000369005.1	+	3	475	c.135A>T	c.(133-135)agA>agT	p.R45S	TACC2_ENST00000334433.3_Missense_Mutation_p.R45S|TACC2_ENST00000453444.2_Missense_Mutation_p.R45S|TACC2_ENST00000515273.1_Missense_Mutation_p.R45S|TACC2_ENST00000515603.1_Missense_Mutation_p.R45S|TACC2_ENST00000513429.1_Missense_Mutation_p.R45S|TACC2_ENST00000358010.1_Missense_Mutation_p.R45S	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	45					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CTGACCACAGAGACGCGTCCA	0.582																																							uc001lfv.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(133-135)AGA>AGT		transforming, acidic coiled-coil containing							42.0	44.0	43.0					10																	123810054		2203	4300	6503	SO:0001583	missense	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123810054A>T	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.135A>T	10.37:g.123810054A>T	ENSP00000358001:p.Arg45Ser					TACC2_uc001lfw.2_Missense_Mutation_p.R45S|TACC2_uc009xzx.2_Missense_Mutation_p.R45S|TACC2_uc010qtv.1_Missense_Mutation_p.R45S	p.R45S	NM_206862	NP_996744	O95359	TACC2_HUMAN			3	495	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	45					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	c.135A>T	CCDS7626.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.062|9.062	0.994693|0.994693	0.19043|0.19043	.|.	.|.	ENSG00000138162|ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076|ENST00000491540	T;T;T;T;T;T;T|.	0.08546|.	4.14;3.08;4.12;4.13;4.14;3.08;4.12|.	4.39|4.39	-6.6|-6.6	0.01824|0.01824	.|.	.|.	.|.	.|.	.|.	T|.	0.13798|.	0.0334|.	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.22003|.	0.063;0.063;0.003;0.063|.	B;B;B;B|.	0.19666|.	0.026;0.026;0.006;0.016|.	T|.	0.40059|.	-0.9583|.	9|.	0.22109|0.02654	T|T	0.4|1	0.1835|0.1835	8.2246|8.2246	0.31562|0.31562	0.252:0.0:0.6168:0.1312|0.252:0.0:0.6168:0.1312	.|.	45;45;45;45|.	E9PBC6;E7EMZ9;O95359-5;O95359|.	.;.;.;TACC2_HUMAN|.	S|X	45;45;45;45;45;45;45;35|62	ENSP00000358001:R45S;ENSP00000425062:R45S;ENSP00000424467:R45S;ENSP00000427618:R45S;ENSP00000334280:R45S;ENSP00000350701:R45S;ENSP00000395048:R45S|.	ENSP00000334280:R45S|ENSP00000423069:R62X	R|R	+|+	3|1	2|2	TACC2|TACC2	123800044|123800044	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	-0.560000|-0.560000	0.05964|0.05964	-1.039000|-1.039000	0.03275|0.03275	-0.290000|-0.290000	0.09829|0.09829	AGA|AGA		0.582	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			19	19	0	0	0	0.007413	0	19	19				
BTBD16	118663	broad.mit.edu	37	10	124092011	124092011	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:124092011G>T	ENST00000260723.4	+	13	1398	c.1147G>T	c.(1147-1149)Ggg>Tgg	p.G383W	BTBD16_ENST00000495370.2_3'UTR|BTBD16_ENST00000368994.2_Missense_Mutation_p.G384W	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	383										breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				TGTGAGATTTGGGCTGCTCTT	0.512																																							uc001lgc.1		NA																	0				skin(1)	1						c.(1147-1149)GGG>TGG		BTB (POZ) domain containing 16							166.0	134.0	145.0					10																	124092011		2203	4300	6503	SO:0001583	missense	118663							g.chr10:124092011G>T	AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.1147G>T	10.37:g.124092011G>T	ENSP00000260723:p.Gly383Trp					BTBD16_uc001lgd.1_Missense_Mutation_p.G382W	p.G383W	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN			13	1398	+		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)	383					A6NM63|Q4VXL1|Q96LN0	Missense_Mutation	SNP	ENST00000260723.4	37	c.1147G>T	CCDS31301.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858821	0.51376	.	.	ENSG00000138152	ENST00000260723;ENST00000368994	T;T	0.62639	0.02;0.01	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000006	T	0.77738	0.4175	M	0.67953	2.075	0.47778	D	0.999512	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79102	-0.1941	10	0.87932	D	0	-28.9253	15.5805	0.76432	0.0:0.0:1.0:0.0	.	384;383	Q32M84-2;Q32M84	.;BTBDG_HUMAN	W	383;384	ENSP00000260723:G383W;ENSP00000357990:G384W	ENSP00000260723:G383W	G	+	1	0	BTBD16	124082001	1.000000	0.71417	0.995000	0.50966	0.341000	0.28922	4.866000	0.63005	2.738000	0.93877	0.655000	0.94253	GGG		0.512	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050780.3	NM_144587		28	28	1	0	7.26314e-15	0.007291	9.04187e-15	28	28				
ADAM12	8038	broad.mit.edu	37	10	127806654	127806655	+	Missense_Mutation	DNP	CG	CG	AA	rs377630592		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:127806654_127806655CG>AA	ENST00000368679.4	-	6	873_874	c.564_565CG>TT	c.(562-567)ctCGct>ctTTct	p.A189S	ADAM12_ENST00000368676.4_Missense_Mutation_p.A189S	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	189					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TTCTTTGCAGCGAGGTTTGGTG	0.48																																							uc001ljk.2		NA																	0				breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9						c.(562-567)CTCGCT>CTTTCT		ADAM metallopeptidase domain 12 isoform 1																																				SO:0001583	missense	8038				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding	g.chr10:127806654_127806655CG>AA	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.564_565delinsAA	10.37:g.127806654_127806655delinsAA	ENSP00000357668:p.Ala189Ser					ADAM12_uc010qul.1_Missense_Mutation_p.A186S|ADAM12_uc001ljm.2_Missense_Mutation_p.A189S|ADAM12_uc001ljn.2_Missense_Mutation_p.A186S|ADAM12_uc001ljl.3_Missense_Mutation_p.A186S	p.A189S	NM_003474	NP_003465	O43184	ADA12_HUMAN		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)	6	977_978	-		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)	189					O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	DNP	ENST00000368679.4	37	c.564_565CG>TT	CCDS7653.1																																																																																				0.480	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1			51	73	0	0	0	0.004672	0	51	73				
MKI67	4288	broad.mit.edu	37	10	129903851	129903851	+	Missense_Mutation	SNP	T	T	C	rs200052741		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:129903851T>C	ENST00000368654.3	-	13	6628	c.6253A>G	c.(6253-6255)Aca>Gca	p.T2085A	MKI67_ENST00000368653.3_Missense_Mutation_p.T1725A	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2085	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGGTCTGGTGTCTGGAAGAGC	0.493																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(6253-6255)ACA>GCA		antigen identified by monoclonal antibody Ki-67		T	ALA/THR,ALA/THR	0,4406		0,0,2203	285.0	278.0	280.0		5173,6253	1.5	0.0	10		280	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	MKI67	NM_001145966.1,NM_002417.4	58,58	0,2,6501	CC,CT,TT		0.0233,0.0,0.0154	benign,benign	1725/2897,2085/3257	129903851	2,13004	2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129903851T>C	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6253A>G	10.37:g.129903851T>C	ENSP00000357643:p.Thr2085Ala					MKI67_uc001lkf.2_Missense_Mutation_p.T1725A|MKI67_uc009yav.1_Missense_Mutation_p.T1660A|MKI67_uc009yaw.1_Missense_Mutation_p.T1235A	p.T2085A	NM_002417	NP_002408	P46013	KI67_HUMAN			13	6448	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	2085			16 X 122 AA approximate repeats.|9.		Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.6253A>G	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.084794	0.55861	0.0	2.33E-4	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02890	4.12;4.12	3.95	1.48	0.22813	.	0.345839	0.21595	N	0.072038	T	0.07098	0.0180	M	0.73962	2.25	0.09310	N	1	D;P;P	0.54207	0.965;0.932;0.945	P;P;P	0.54759	0.647;0.647;0.76	T	0.23332	-1.0191	10	0.27082	T	0.32	.	4.7982	0.13282	0.1641:0.0908:0.0:0.7451	.	2084;1725;2085	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	A	2085;1725;2084	ENSP00000357643:T2085A;ENSP00000357642:T1725A	ENSP00000357642:T1725A	T	-	1	0	MKI67	129793841	0.016000	0.18221	0.000000	0.03702	0.129000	0.20672	1.608000	0.36847	0.169000	0.19679	0.533000	0.62120	ACA		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		6	299	0	0	0	0.001984	0	6	299				
MUC5B	727897	broad.mit.edu	37	11	1265880	1265880	+	Silent	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:1265880C>G	ENST00000529681.1	+	31	7828	c.7770C>G	c.(7768-7770)acC>acG	p.T2590T	MUC5B_ENST00000447027.1_Silent_p.T2593T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2590	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCGGGGCCACCGGCTCTGTGG	0.647																																							uc009ycr.1		NA																	0					0						c.(9682-9684)ACC>ACG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							97.0	128.0	118.0					11																	1265880		2028	4186	6214	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1265880C>G	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7770C>G	11.37:g.1265880C>G						MUC5B_uc001ltb.2_Silent_p.T2593T	p.T3228T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	48	9810	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	2590	Missing (in Ref. 6; AAB61398).		7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.9684C>G	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	1.394	-0.580015	0.03854	.	.	ENSG00000117983	ENST00000537836	.	.	.	2.81	-5.62	0.02481	.	.	.	.	.	T	0.44052	0.1275	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.48692	-0.9013	5	0.41790	T	0.15	.	12.6628	0.56824	0.0:0.6572:0.0:0.3428	.	.	.	.	G	133	.	ENSP00000440615:R133G	R	+	1	2	MUC5B	1222456	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.211000	0.00273	-2.071000	0.00880	-2.454000	0.00207	CGG		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		73	144	0	0	0	0.00361	0	73	144				
ART5	116969	broad.mit.edu	37	11	3661095	3661095	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:3661095C>G	ENST00000397068.3	-	2	956	c.564G>C	c.(562-564)aaG>aaC	p.K188N	ART5_ENST00000359918.4_Missense_Mutation_p.K188N|ART5_ENST00000397067.3_Missense_Mutation_p.K188N|TRPC2_ENST00000526541.1_RNA	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	188					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGGCCACTGCCTTATCCAGGG	0.582																																							uc001lyb.1		NA																	0				ovary(1)	1						c.(562-564)AAG>AAC		ADP-ribosyltransferase 5 precursor							67.0	72.0	70.0					11																	3661095		2201	4298	6499	SO:0001583	missense	116969					extracellular region	NAD(P)+-protein-arginine ADP-ribosyltransferase activity	g.chr11:3661095C>G	Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.564G>C	11.37:g.3661095C>G	ENSP00000380258:p.Lys188Asn					ART5_uc001lyc.1_Missense_Mutation_p.K188N|ART5_uc001lyd.2_Missense_Mutation_p.K188N|ART5_uc009yea.2_Missense_Mutation_p.K188N	p.K188N	NM_053017	NP_443750	Q96L15	NAR5_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)	2	957	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	188					C9IYG7|Q6UX84|Q86W02	Missense_Mutation	SNP	ENST00000397068.3	37	c.564G>C	CCDS7743.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.491|6.491	0.458733|0.458733	0.12342|0.12342	.|.	.|.	ENSG00000167311|ENSG00000167311	ENST00000453353|ENST00000397068;ENST00000397067;ENST00000359918	.|T;T;T	.|0.09445	.|2.98;2.98;2.98	6.17|6.17	2.85|2.85	0.33270|0.33270	.|.	.|0.615544	.|0.18315	.|N	.|0.144969	T|T	0.13114|0.13114	0.0318|0.0318	L|L	0.52573|0.52573	1.65|1.65	0.25776|0.25776	N|N	0.984785|0.984785	.|P;B	.|0.39665	.|0.682;0.316	.|B;P	.|0.44647	.|0.222;0.456	T|T	0.09271|0.09271	-1.0682|-1.0682	5|10	.|0.28530	.|T	.|0.3	-15.8923|-15.8923	8.5135|8.5135	0.33231|0.33231	0.0:0.6728:0.0:0.3272|0.0:0.6728:0.0:0.3272	.|.	.|188;188	.|Q96L15-2;Q96L15	.|.;NAR5_HUMAN	R|N	145|188	.|ENSP00000380258:K188N;ENSP00000380257:K188N;ENSP00000352992:K188N	.|ENSP00000352992:K188N	G|K	-|-	1|3	0|2	ART5|ART5	3617671|3617671	0.000000|0.000000	0.05858|0.05858	0.940000|0.940000	0.37924|0.37924	0.762000|0.762000	0.43233|0.43233	-0.311000|-0.311000	0.08124|0.08124	0.911000|0.911000	0.36747|0.36747	0.655000|0.655000	0.94253|0.94253	GGC|AAG		0.582	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032760.2	NM_053017		24	44	0	0	0	0.004656	0	24	44				
ART1	417	broad.mit.edu	37	11	3681076	3681076	+	Silent	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:3681076C>G	ENST00000250693.1	+	3	428	c.327C>G	c.(325-327)ggC>ggG	p.G109G		NM_004314.2	NP_004305.2	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1	109					innate immune response (GO:0045087)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|skin(1)	8		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)		CACCCCTGGGCTTCCGCGATG	0.682																																							uc001lye.1		NA																	0					0						c.(325-327)GGC>GGG		ADP-ribosyltransferase 1 precursor	Becaplermin(DB00102)						25.0	26.0	26.0					11																	3681076		2199	4297	6496	SO:0001819	synonymous_variant	417				protein ADP-ribosylation	anchored to membrane|integral to plasma membrane|sarcoplasmic reticulum membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity	g.chr11:3681076C>G	S74683	CCDS7744.1	11p15	2006-02-23			ENSG00000129744	ENSG00000129744		"""CD molecules"""	723	protein-coding gene	gene with protein product		601625				8812442	Standard	NM_004314		Approved	ART2, CD296	uc001lye.1	P52961	OTTHUMG00000011845	ENST00000250693.1:c.327C>G	11.37:g.3681076C>G						ART1_uc009yeb.1_Silent_p.G109G	p.G109G	NM_004314	NP_004305	P52961	NAR1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)	3	428	+		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	109					Q6NTD2|Q96KT9	Silent	SNP	ENST00000250693.1	37	c.327C>G	CCDS7744.1																																																																																				0.682	ART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032765.1	NM_004314		22	15	0	0	0	0.002299	0	22	15				
OR51S1	119692	broad.mit.edu	37	11	4870112	4870112	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:4870112C>T	ENST00000322101.2	-	1	402	c.327G>A	c.(325-327)atG>atA	p.M109I	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGATAAAAACCATCTGTAGAA	0.557																																							uc010qyo.1		NA																	0				skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(325-327)ATG>ATA		olfactory receptor, family 51, subfamily S,							100.0	92.0	95.0					11																	4870112		2201	4298	6499	SO:0001583	missense	119692				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4870112C>T	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.327G>A	11.37:g.4870112C>T	ENSP00000322754:p.Met109Ile						p.M109I	NM_001004758	NP_001004758	Q8NGJ8	O51S1_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	327	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	109			Helical; Name=3; (Potential).		B9EGZ1|Q6IFI2	Missense_Mutation	SNP	ENST00000322101.2	37	c.327G>A	CCDS31362.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.738147	0.69304	.	.	ENSG00000176922	ENST00000322101	T	0.00318	8.12	4.65	4.65	0.58169	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000131	T	0.00580	0.0019	M	0.69523	2.12	0.40836	D	0.983637	D	0.67145	0.996	D	0.65987	0.94	T	0.80341	-0.1423	10	0.87932	D	0	-16.1339	15.0709	0.72037	0.0:1.0:0.0:0.0	.	109	Q8NGJ8	O51S1_HUMAN	I	109	ENSP00000322754:M109I	ENSP00000322754:M109I	M	-	3	0	OR51S1	4826688	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	2.798000	0.47884	2.404000	0.81709	0.563000	0.77884	ATG		0.557	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758		28	53	0	0	0	0.004656	0	28	53				
UBQLN3	50613	broad.mit.edu	37	11	5530072	5530072	+	Silent	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:5530072C>A	ENST00000311659.4	-	2	864	c.717G>T	c.(715-717)cgG>cgT	p.R239R	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	239										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TACTGAGCACCCGGTCCTGGC	0.478																																					Ovarian(72;684 1260 12332 41642 52180)	Ovarian(72;684 1260 12332 41642 52180)	uc001may.1		NA																	0				ovary(3)	3						c.(715-717)CGG>CGT		ubiquilin 3							91.0	86.0	88.0					11																	5530072		2201	4297	6498	SO:0001819	synonymous_variant	50613							g.chr11:5530072C>A	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.717G>T	11.37:g.5530072C>A						HBG2_uc001mak.1_Intron	p.R239R	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	803	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	239					Q9NRE0	Silent	SNP	ENST00000311659.4	37	c.717G>T	CCDS7758.1																																																																																				0.478	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		18	86	1	0	1.67942e-08	0.006122	1.97008e-08	18	86				
DCHS1	8642	broad.mit.edu	37	11	6644840	6644840	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:6644840C>T	ENST00000299441.3	-	21	8478	c.8067G>A	c.(8065-8067)ttG>ttA	p.L2689L	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2689	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCACTGGTGCCAAAGCAAAGT	0.577																																							uc001mem.1		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(8065-8067)TTG>TTA		dachsous 1 precursor							67.0	57.0	60.0					11																	6644840		2201	4296	6497	SO:0001819	synonymous_variant	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6644840C>T	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.8067G>A	11.37:g.6644840C>T							p.L2689L	NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	21	8477	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	2689			Cadherin 25.|Extracellular (Potential).		O15098	Silent	SNP	ENST00000299441.3	37	c.8067G>A	CCDS7771.1																																																																																				0.577	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		3	20	0	0	0	0.004672	0	3	20				
SYT9	143425	broad.mit.edu	37	11	7324274	7324274	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:7324274C>G	ENST00000318881.6	+	2	387	c.150C>G	c.(148-150)atC>atG	p.I50M	SYT9_ENST00000396716.2_Missense_Mutation_p.I18M	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	50					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.I50I(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TTGCAGATATCTCAGTGAGCC	0.542																																							uc001mfe.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(2)|large_intestine(1)	3						c.(148-150)ATC>ATG		synaptotagmin IX							161.0	144.0	150.0					11																	7324274		2201	4296	6497	SO:0001583	missense	143425					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr11:7324274C>G	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.150C>G	11.37:g.7324274C>G	ENSP00000324419:p.Ile50Met					SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_RNA	p.I50M	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN		Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)	2	387	+			50			Vesicular (Potential).			Missense_Mutation	SNP	ENST00000318881.6	37	c.150C>G	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.161607	0.57368	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.51325	0.71;0.71	5.91	4.03	0.46877	.	0.000000	0.64402	D	0.000001	T	0.52869	0.1761	L	0.46157	1.445	0.40794	D	0.983284	P	0.48640	0.913	P	0.55667	0.781	T	0.54450	-0.8292	10	0.66056	D	0.02	.	9.2949	0.37808	0.1451:0.7787:0.0:0.0762	.	50	Q86SS6	SYT9_HUMAN	M	18;50	ENSP00000379944:I18M;ENSP00000324419:I50M	ENSP00000324419:I50M	I	+	3	3	SYT9	7280850	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.749000	0.26320	0.826000	0.34661	0.650000	0.86243	ATC		0.542	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733		25	71	0	0	0	0.004656	0	25	71				
RIC3	79608	broad.mit.edu	37	11	8158962	8158962	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:8158962C>A	ENST00000309737.6	-	4	483	c.484G>T	c.(484-486)Gaa>Taa	p.E162*	RIC3_ENST00000530060.1_5'UTR|RIC3_ENST00000425599.2_Intron|RIC3_ENST00000343202.4_Nonsense_Mutation_p.E162*|RIC3_ENST00000539720.1_Nonsense_Mutation_p.E113*|RIC3_ENST00000335425.7_Intron			Q7Z5B4	RIC3_HUMAN	RIC3 acetylcholine receptor chaperone	162					cellular protein complex assembly (GO:0043623)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein folding (GO:0006457)|synaptic transmission, cholinergic (GO:0007271)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)	17				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		ATTAATTTTTCCATGGCTGCT	0.403																																							uc001mgd.2		NA																	0				large_intestine(1)|ovary(1)|pancreas(1)	3						c.(484-486)GAA>TAA		resistance to inhibitors of cholinesterase 3							189.0	175.0	180.0					11																	8158962		2201	4296	6497	SO:0001587	stop_gained	79608					endoplasmic reticulum membrane|Golgi membrane|integral to membrane		g.chr11:8158962C>A		CCDS7788.1, CCDS44533.1, CCDS55741.1, CCDS55742.1	11p15.4	2013-08-05	2013-08-05		ENSG00000166405	ENSG00000166405			30338	protein-coding gene	gene with protein product		610509	"""resistance to inhibitors of cholinesterase 3 homolog (C. elegans)"""			12821669	Standard	NM_024557		Approved	FLJ11608, PRO1385, AYST720	uc001mgd.2	Q7Z5B4	OTTHUMG00000165694	ENST00000309737.6:c.484G>T	11.37:g.8158962C>A	ENSP00000308820:p.Glu162*					RIC3_uc001mgb.2_5'UTR|RIC3_uc001mgc.2_Nonsense_Mutation_p.E162*|RIC3_uc001mge.2_Intron|RIC3_uc010rbl.1_Nonsense_Mutation_p.E112*|RIC3_uc010rbm.1_Nonsense_Mutation_p.E162*|RIC3_uc009yfm.2_Intron|RIC3_uc009yfn.2_Intron	p.E162*	NM_024557	NP_078833	Q7Z5B4	RIC3_HUMAN		Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)	4	538	-			162			Potential.|Cytoplasmic (Potential).		B0B1U0|B2RD25|D3DQU5|Q6UX78|Q7Z5B3|Q86T94|Q8TBJ9|Q9HAH8	Nonsense_Mutation	SNP	ENST00000309737.6	37	c.484G>T	CCDS55742.1	.	.	.	.	.	.	.	.	.	.	C	38	7.205758	0.98136	.	.	ENSG00000166405	ENST00000343202;ENST00000309737;ENST00000543346;ENST00000539720;ENST00000531450	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.4482	0.94857	0.0:1.0:0.0:0.0	.	.	.	.	X	162;162;162;113;162	.	ENSP00000308820:E162X	E	-	1	0	RIC3	8115538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.107000	0.71517	2.677000	0.91161	0.591000	0.81541	GAA		0.403	RIC3-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385900.1	NM_024557		14	96	1	0	9.31168e-06	0.001855	1.03275e-05	14	96				
PDE3B	5140	broad.mit.edu	37	11	14665637	14665637	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:14665637C>T	ENST00000282096.4	+	1	369	c.16C>T	c.(16-18)Cga>Tga	p.R6*	PDE3B_ENST00000455098.2_Nonsense_Mutation_p.R6*|PSMA1_ENST00000418988.2_5'Flank	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	6	Interaction with RAPGEF3.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	GAGGGACGAGCGAGACGCCAA	0.721																																							uc001mln.2		NA																	0					0						c.(16-18)CGA>TGA		phosphodiesterase 3B							6.0	7.0	6.0					11																	14665637		1964	4008	5972	SO:0001587	stop_gained	5140				cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding	g.chr11:14665637C>T	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.16C>T	11.37:g.14665637C>T	ENSP00000282096:p.Arg6*					PDE3B_uc001mlm.2_Nonsense_Mutation_p.R6*|PDE3B_uc010rcr.1_Nonsense_Mutation_p.R6*|PSMA1_uc001mll.2_5'Flank	p.R6*	NM_000922	NP_000913	Q13370	PDE3B_HUMAN			1	369	+			6					B7ZM37|O00639|Q14408|Q6SEI4	Nonsense_Mutation	SNP	ENST00000282096.4	37	c.16C>T	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	C	37	6.587475	0.97684	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	.	.	.	3.21	-2.27	0.06846	.	5.269290	0.01074	U	0.004873	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7128	0.28688	0.3732:0.2605:0.3663:0.0	.	.	.	.	X	6	.	ENSP00000282096:R6X	R	+	1	2	PDE3B	14622213	0.962000	0.33011	0.990000	0.47175	0.439000	0.31926	-0.003000	0.12901	-0.305000	0.08831	-0.823000	0.03104	CGA		0.721	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386974.1	NM_000922		3	9	0	0	0	0.004672	0	3	9				
SLC5A12	159963	broad.mit.edu	37	11	26725348	26725348	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:26725348A>T	ENST00000396005.3	-	5	981	c.672T>A	c.(670-672)caT>caA	p.H224Q	SLC5A12_ENST00000280467.6_Missense_Mutation_p.H224Q	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	224					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						ACTCAAATATATGTAGTCGAG	0.358																																							uc001mra.2		NA																	0				ovary(1)|skin(1)	2						c.(670-672)CAT>CAA		solute carrier family 5 (sodium/glucose							206.0	198.0	201.0					11																	26725348		2203	4299	6502	SO:0001583	missense	159963				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity	g.chr11:26725348A>T	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.672T>A	11.37:g.26725348A>T	ENSP00000379326:p.His224Gln					SLC5A12_uc001mrb.2_RNA|SLC5A12_uc001mrc.3_Missense_Mutation_p.H224Q	p.H224Q	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN			5	985	-			224			Extracellular (Potential).		Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	c.672T>A	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	9.959	1.222407	0.22457	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.87412	-2.25;-2.25;-2.25	5.07	-6.06	0.02165	.	0.890844	0.09918	N	0.738816	T	0.55561	0.1928	N	0.00554	-1.385	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.09377	0.0;0.004	T	0.52653	-0.8547	10	0.49607	T	0.09	.	3.8392	0.08906	0.351:0.0945:0.4215:0.133	.	224;224	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	Q	224;224;36	ENSP00000379326:H224Q;ENSP00000280467:H224Q;ENSP00000435053:H36Q	ENSP00000280467:H224Q	H	-	3	2	SLC5A12	26681924	0.000000	0.05858	0.130000	0.21974	0.894000	0.52154	-1.523000	0.02235	-0.634000	0.05538	0.397000	0.26171	CAT		0.358	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498		42	76	0	0	0	0.007835	0	42	76				
NAT10	55226	broad.mit.edu	37	11	34139952	34139952	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:34139952C>G	ENST00000257829.3	+	8	888	c.682C>G	c.(682-684)Ctt>Gtt	p.L228V	NAT10_ENST00000531159.2_Missense_Mutation_p.L156V|NAT10_ENST00000527971.1_Missense_Mutation_p.L228V	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	228						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				GGATGAGAGTCTTGGTCCTTC	0.552																																							uc001mvk.2		NA																	0				ovary(1)|skin(1)	2						c.(682-684)CTT>GTT		N-acetyltransferase 10 isoform a							106.0	93.0	97.0					11																	34139952		2202	4298	6500	SO:0001583	missense	55226					nucleolus	ATP binding|N-acetyltransferase activity|protein binding	g.chr11:34139952C>G	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.682C>G	11.37:g.34139952C>G	ENSP00000257829:p.Leu228Val					NAT10_uc010ren.1_Missense_Mutation_p.L156V	p.L228V	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN			8	926	+		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)	228					B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	c.682C>G	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.549518	0.27652	.	.	ENSG00000135372	ENST00000257829;ENST00000531159;ENST00000527971	T;T	0.30981	1.51;1.52	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.25827	0.0629	L	0.43923	1.385	0.49582	D	0.999807	B	0.24533	0.105	B	0.23419	0.046	T	0.04621	-1.0938	10	0.24483	T	0.36	-13.8538	11.7151	0.51647	0.0:0.9177:0.0:0.0823	.	228	Q9H0A0	NAT10_HUMAN	V	228;156;228	ENSP00000257829:L228V;ENSP00000433011:L156V	ENSP00000257829:L228V	L	+	1	0	NAT10	34096528	0.998000	0.40836	0.881000	0.34555	0.877000	0.50540	3.711000	0.54868	2.383000	0.81215	0.555000	0.69702	CTT		0.552	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662		4	23	0	0	0	0.009096	0	4	23				
TTC17	55761	broad.mit.edu	37	11	43411234	43411234	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:43411234A>C	ENST00000039989.4	+	3	296	c.282A>C	c.(280-282)gaA>gaC	p.E94D	RP11-484D2.4_ENST00000394183.2_RNA|TTC17_ENST00000299240.6_Missense_Mutation_p.E94D	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	94					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						TTCACATAGAAGAGAATGAGG	0.383																																							uc001mxi.2		NA																	0				ovary(5)	5						c.(280-282)GAA>GAC		tetratricopeptide repeat domain 17							107.0	101.0	103.0					11																	43411234		2203	4300	6503	SO:0001583	missense	55761						binding	g.chr11:43411234A>C	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.282A>C	11.37:g.43411234A>C	ENSP00000039989:p.Glu94Asp					TTC17_uc001mxh.2_Missense_Mutation_p.E94D|TTC17_uc010rfj.1_Missense_Mutation_p.E37D	p.E94D	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN			3	296	+			94					G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	c.282A>C	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.800458	0.70567	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.34472	1.36;1.41	4.87	1.76	0.24704	.	0.000000	0.85682	D	0.000000	T	0.35856	0.0946	L	0.41710	1.295	0.44762	D	0.997761	P;B;P	0.52692	0.874;0.402;0.955	P;B;P	0.52109	0.571;0.358;0.69	T	0.08617	-1.0713	10	0.56958	D	0.05	-18.3488	7.6025	0.28083	0.557:0.0:0.443:0.0	.	94;94;94	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	D	94	ENSP00000299240:E94D;ENSP00000039989:E94D	ENSP00000039989:E94D	E	+	3	2	TTC17	43367810	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.562000	0.45914	0.480000	0.27534	0.460000	0.39030	GAA		0.383	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259		14	48	0	0	0	0.003163	0	14	48				
EXT2	2132	broad.mit.edu	37	11	44129289	44129289	+	Silent	SNP	C	C	T	rs149841763		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:44129289C>T	ENST00000343631.3	+	2	156	c.27C>T	c.(25-27)atC>atT	p.I9I	EXT2_ENST00000533608.1_Silent_p.I9I|EXT2_ENST00000395673.3_Silent_p.I42I|EXT2_ENST00000358681.4_Silent_p.I9I			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	9					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)	p.I9I(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						AGTATAATATCCGGGGTCCTG	0.483			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																														uc001mxz.2		NA	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	Mis|N|F|S	multiple exostoses type 2 gene			M		exostoses|osteosarcoma			1	Substitution - coding silent(1)	p.I9I(1)	skin(1)	lung(2)|breast(2)|skin(1)	5						c.(25-27)ATC>ATT		exostosin 2 isoform 2							121.0	118.0	119.0					11																	44129289		2203	4300	6503	SO:0001819	synonymous_variant	2132	Hereditary_Multiple_Exostoses	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity	g.chr11:44129289C>T		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.27C>T	11.37:g.44129289C>T						EXT2_uc010rfo.1_Silent_p.I37I|EXT2_uc001mxy.2_Silent_p.I22I|EXT2_uc009ykt.2_Silent_p.I9I|EXT2_uc001mya.2_Silent_p.I42I	p.I9I	NM_207122	NP_997005	Q93063	EXT2_HUMAN			2	361	+			9			Cytoplasmic (Potential).		B2R5Z6|C9JU51|J3KPT2|O15288	Silent	SNP	ENST00000343631.3	37	c.27C>T	CCDS7908.1																																																																																				0.483	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390074.1	NM_000401		16	76	0	0	0	0.004007	0	16	76				
ALX4	60529	broad.mit.edu	37	11	44286517	44286517	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:44286517G>T	ENST00000329255.3	-	4	1226	c.1123C>A	c.(1123-1125)Cca>Aca	p.P375T		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	375					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						TTGAGGCCTGGGCTGAGGCTG	0.657																																							uc001myb.2		NA																	0					0						c.(1123-1125)CCA>ACA		aristaless-like homeobox 4							56.0	52.0	53.0					11																	44286517		2203	4299	6502	SO:0001583	missense	60529				hair follicle development			g.chr11:44286517G>T	AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.1123C>A	11.37:g.44286517G>T	ENSP00000332744:p.Pro375Thr						p.P375T	NM_021926	NP_068745	Q9H161	ALX4_HUMAN			4	1227	-			375					Q96JN7|Q9H198|Q9HAY9	Missense_Mutation	SNP	ENST00000329255.3	37	c.1123C>A	CCDS31468.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471081	0.63625	.	.	ENSG00000052850	ENST00000329255	D	0.92446	-3.04	5.19	5.19	0.71726	.	0.296491	0.33772	N	0.004572	D	0.88775	0.6528	L	0.36672	1.1	0.39268	D	0.964331	B	0.18166	0.026	B	0.16289	0.015	D	0.84946	0.0868	10	0.37606	T	0.19	.	19.084	0.93194	0.0:0.0:1.0:0.0	.	375	Q9H161	ALX4_HUMAN	T	375	ENSP00000332744:P375T	ENSP00000332744:P375T	P	-	1	0	ALX4	44243093	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.802000	0.47916	2.575000	0.86900	0.561000	0.74099	CCA		0.657	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390399.1			14	49	1	0	3.27435e-08	0.00245	3.77651e-08	14	49				
MYBPC3	4607	broad.mit.edu	37	11	47356692	47356692	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:47356692T>A	ENST00000545968.1	-	27	2860	c.2806A>T	c.(2806-2808)Acg>Tcg	p.T936S	MYBPC3_ENST00000256993.4_Missense_Mutation_p.T935S|MYBPC3_ENST00000399249.2_Missense_Mutation_p.T936S	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	936	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CGGGCCCCCGTGGGCAGGTCC	0.667																																							uc001nfa.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2806-2808)ACG>TCG		myosin binding protein C, cardiac							35.0	42.0	40.0					11																	47356692		1951	4132	6083	SO:0001583	missense	4607				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding	g.chr11:47356692T>A	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.2806A>T	11.37:g.47356692T>A	ENSP00000442795:p.Thr936Ser						p.T936S	NM_000256	NP_000247	Q14896	MYPC3_HUMAN		Lung(87;0.176)	26	2861	-			935			Fibronectin type-III 2.		A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	c.2806A>T	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	T	31	5.098871	0.94197	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.56776	0.44;0.44;0.44	5.29	5.29	0.74685	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70561	0.3238	M	0.65498	2.005	0.58432	D	0.999999	D	0.71674	0.998	D	0.76575	0.988	T	0.74414	-0.3673	9	0.87932	D	0	.	15.2256	0.73348	0.0:0.0:0.0:1.0	.	935	Q14896	MYPC3_HUMAN	S	936;936;935	ENSP00000442795:T936S;ENSP00000382193:T936S;ENSP00000256993:T935S	ENSP00000256993:T935S	T	-	1	0	MYBPC3	47313268	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	7.653000	0.83643	2.009000	0.58944	0.454000	0.30748	ACG		0.667	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3			17	29	0	0	0	0.007413	0	17	29				
OR5J2	282775	broad.mit.edu	37	11	55944574	55944574	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:55944574A>G	ENST00000312298.1	+	1	481	c.481A>G	c.(481-483)Atc>Gtc	p.I161V		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					AATCCACACAATCAGCTTGAG	0.443																																							uc010rjb.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(481-483)ATC>GTC		olfactory receptor, family 5, subfamily J,							177.0	156.0	163.0					11																	55944574		2201	4296	6497	SO:0001583	missense	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944574A>G	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.481A>G	11.37:g.55944574A>G	ENSP00000310788:p.Ile161Val						p.I161V	NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN			1	481	+	Esophageal squamous(21;0.00693)		161			Extracellular (Potential).		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	c.481A>G	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	A	4.458	0.084850	0.08583	.	.	ENSG00000174957	ENST00000312298	T	0.36878	1.23	4.67	-3.22	0.05125	GPCR, rhodopsin-like superfamily (1);	0.475913	0.18838	N	0.129747	T	0.14570	0.0352	N	0.25031	0.7	0.09310	N	1	B	0.14805	0.011	B	0.20955	0.032	T	0.19095	-1.0316	10	0.11794	T	0.64	.	1.1215	0.01725	0.3338:0.3211:0.1479:0.1972	.	161	Q8NH18	OR5J2_HUMAN	V	161	ENSP00000310788:I161V	ENSP00000310788:I161V	I	+	1	0	OR5J2	55701150	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-4.305000	0.00256	-0.325000	0.08577	0.475000	0.43553	ATC		0.443	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		25	30	0	0	0	0.00333	0	25	30				
ZFP91	80829	broad.mit.edu	37	11	58378469	58378469	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:58378469G>C	ENST00000316059.6	+	5	835	c.664G>C	c.(664-666)Gag>Cag	p.E222Q	ZFP91-CNTF_ENST00000389919.4_Missense_Mutation_p.E222Q	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	222	Glu-rich.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AATCAGTGAAGAGGAGATACC	0.373																																							uc001nmx.3		NA																	0				ovary(1)	1						c.(664-666)GAG>CAG		zinc finger protein 91							155.0	129.0	138.0					11																	58378469		2201	4295	6496	SO:0001583	missense	80829				activation of NF-kappaB-inducing kinase activity|protein K63-linked ubiquitination	nucleus	nucleic acid binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:58378469G>C	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.664G>C	11.37:g.58378469G>C	ENSP00000339030:p.Glu222Gln					ZFP91_uc001nmy.3_Missense_Mutation_p.E221Q|ZFP91-CNTF_uc010rkm.1_RNA	p.E222Q	NM_053023	NP_444251	Q96JP5	ZFP91_HUMAN			5	832	+		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)	222			Glu-rich.		A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	ENST00000316059.6	37	c.664G>C	CCDS31553.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773670	0.90108	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	T	0.13901	2.55	5.33	5.33	0.75918	.	.	.	.	.	T	0.24967	0.0606	N	0.24115	0.695	0.48185	D	0.9996	D;D	0.67145	0.996;0.993	D;D	0.78314	0.991;0.979	T	0.01537	-1.1330	9	0.35671	T	0.21	-19.8077	17.9574	0.89073	0.0:0.0:1.0:0.0	.	222;222	Q96JP5-2;Q96JP5	.;ZFP91_HUMAN	Q	222	ENSP00000339030:E222Q	ENSP00000374569:E222Q	E	+	1	0	ZFP91	58135045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.678000	0.84035	2.771000	0.95319	0.650000	0.86243	GAG		0.373	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023		11	30	0	0	0	0.001855	0	11	30				
SLC22A12	116085	broad.mit.edu	37	11	64367924	64367924	+	Missense_Mutation	SNP	C	C	G	rs545024143		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:64367924C>G	ENST00000377574.1	+	8	2118	c.1371C>G	c.(1369-1371)agC>agG	p.S457R	SLC22A12_ENST00000473690.1_Missense_Mutation_p.S236R|SLC22A12_ENST00000336464.7_Missense_Mutation_p.S423R|SLC22A12_ENST00000377572.1_Missense_Mutation_p.S349R|SLC22A12_ENST00000377567.2_Missense_Mutation_p.S349R	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	457					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	TCTACAGCAGCGAGCTCTTCC	0.677																																							uc001oam.1		NA																	0				ovary(1)	1						c.(1369-1371)AGC>AGG		urate anion exchanger 1 isoform a							29.0	29.0	29.0					11																	64367924		2201	4295	6496	SO:0001583	missense	116085				cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity	g.chr11:64367924C>G	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.1371C>G	11.37:g.64367924C>G	ENSP00000366797:p.Ser457Arg					SLC22A12_uc001oal.1_Missense_Mutation_p.S236R|SLC22A12_uc009yps.1_Missense_Mutation_p.S423R|SLC22A12_uc001oan.1_Missense_Mutation_p.S349R|SLC22A12_uc009ypt.2_Missense_Mutation_p.S275R	p.S457R	NM_144585	NP_653186	Q96S37	S22AC_HUMAN			8	2118	+			457					B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Missense_Mutation	SNP	ENST00000377574.1	37	c.1371C>G	CCDS8075.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573794	0.65765	.	.	ENSG00000197891	ENST00000377567;ENST00000377574;ENST00000377572;ENST00000473690;ENST00000336464	T;T;T;T;T	0.77489	-1.1;0.19;-1.1;0.18;0.18	4.86	-7.72	0.01250	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.260610	0.37095	N	0.002246	T	0.72851	0.3512	M	0.85197	2.74	0.20975	N	0.999817	P;B;P	0.38565	0.637;0.433;0.506	B;B;B	0.40741	0.339;0.143;0.287	T	0.66200	-0.5983	10	0.59425	D	0.04	.	6.7212	0.23330	0.0:0.2999:0.2157:0.4845	.	423;349;457	B5ME56;Q96S37-2;Q96S37	.;.;S22AC_HUMAN	R	349;457;349;236;423	ENSP00000366790:S349R;ENSP00000366797:S457R;ENSP00000366795:S349R;ENSP00000438437:S236R;ENSP00000336836:S423R	ENSP00000336836:S423R	S	+	3	2	SLC22A12	64124500	0.000000	0.05858	0.004000	0.12327	0.670000	0.39368	-6.458000	0.00065	-1.605000	0.01593	0.561000	0.74099	AGC		0.677	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585		11	16	0	0	0	0.001368	0	11	16				
EFEMP2	30008	broad.mit.edu	37	11	65635412	65635412	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:65635412G>C	ENST00000307998.6	-	10	1320	c.1090C>G	c.(1090-1092)Cag>Gag	p.Q364E	EFEMP2_ENST00000528176.1_Missense_Mutation_p.Q364E|EFEMP2_ENST00000532648.1_5'Flank	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	364					blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		GAGGTCGCCTGGATCTGGAAC	0.577																																							uc001ofy.3		NA																	0				ovary(1)	1						c.(1090-1092)CAG>GAG		EGF-containing fibulin-like extracellular matrix							114.0	107.0	110.0					11																	65635412		2201	4296	6497	SO:0001583	missense	30008				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity	g.chr11:65635412G>C	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.1090C>G	11.37:g.65635412G>C	ENSP00000309953:p.Gln364Glu					EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.Q364E	p.Q364E	NM_016938	NP_058634	O95967	FBLN4_HUMAN		READ - Rectum adenocarcinoma(159;0.169)	10	1284	-			364					A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	ENST00000307998.6	37	c.1090C>G	CCDS8116.1	.	.	.	.	.	.	.	.	.	.	G	35	5.552379	0.96501	.	.	ENSG00000172638	ENST00000526911;ENST00000531645;ENST00000528176;ENST00000307998;ENST00000530806	D;D;D;T;T	0.85556	-2.0;-1.52;-1.56;-1.48;-1.13	5.37	5.37	0.77165	.	0.000000	0.49916	D	0.000130	D	0.91019	0.7175	M	0.78637	2.42	0.80722	D	1	D;P	0.54964	0.969;0.924	D;P	0.64877	0.93;0.9	D	0.88504	0.3084	10	0.18710	T	0.47	.	16.5806	0.84714	0.0:0.0:1.0:0.0	.	364;364	E9PRU1;O95967	.;FBLN4_HUMAN	E	23;80;364;364;17	ENSP00000436536:Q23E;ENSP00000436521:Q80E;ENSP00000434151:Q364E;ENSP00000309953:Q364E;ENSP00000436526:Q17E	ENSP00000309953:Q364E	Q	-	1	0	EFEMP2	65391988	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.416000	0.97383	2.529000	0.85273	0.455000	0.32223	CAG		0.577	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938		14	83	0	0	0	0.001855	0	14	83				
CTTN	2017	broad.mit.edu	37	11	70279327	70279327	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:70279327G>C	ENST00000301843.8	+	16	1593	c.1387G>C	c.(1387-1389)Gcc>Ccc	p.A463P	CTTN_ENST00000346329.3_Missense_Mutation_p.A426P|CTTN_ENST00000538675.1_Missense_Mutation_p.A147P|CTTN_ENST00000376561.3_Missense_Mutation_p.A426P	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	463					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)		p.A463T(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GCAGGGCCTGGCCTATGCCAC	0.682																																							uc001opv.3		NA																	1	Substitution - Missense(1)		prostate(1)	ovary(1)	1						c.(1387-1389)GCC>CCC		cortactin isoform a							27.0	29.0	28.0					11																	70279327		2200	4293	6493	SO:0001583	missense	2017					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding	g.chr11:70279327G>C	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.1387G>C	11.37:g.70279327G>C	ENSP00000301843:p.Ala463Pro					CTTN_uc001opu.2_Missense_Mutation_p.A426P|CTTN_uc001opw.3_Missense_Mutation_p.A426P|CTTN_uc010rqm.1_Missense_Mutation_p.A147P|CTTN_uc001opx.2_Missense_Mutation_p.A147P	p.A463P	NM_005231	NP_005222	Q14247	SRC8_HUMAN	BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)	16	1593	+			463					Q8N707|Q96H99	Missense_Mutation	SNP	ENST00000301843.8	37	c.1387G>C	CCDS41680.1	.	.	.	.	.	.	.	.	.	.	G	9.825	1.186884	0.21870	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561;ENST00000538675;ENST00000529736	T;T;T;T;T	0.32515	1.47;1.49;1.45;1.86;1.87	4.39	3.45	0.39498	Src homology-3 domain (1);	0.915597	0.09269	N	0.825497	T	0.22742	0.0549	N	0.24115	0.695	0.29211	N	0.874561	P;B;B;B	0.44478	0.836;0.006;0.003;0.009	B;B;B;B	0.41860	0.368;0.008;0.007;0.009	T	0.06917	-1.0800	10	0.24483	T	0.36	-6.4957	10.1139	0.42579	0.096:0.0:0.904:0.0	.	147;426;463;426	B4E358;Q96H99;Q14247;Q8N707	.;.;SRC8_HUMAN;.	P	426;463;426;147;120	ENSP00000317189:A426P;ENSP00000301843:A463P;ENSP00000365745:A426P;ENSP00000439762:A147P;ENSP00000431421:A120P	ENSP00000301843:A463P	A	+	1	0	CTTN	69956975	0.855000	0.29742	0.879000	0.34478	0.198000	0.23893	3.442000	0.52900	0.790000	0.33803	0.651000	0.88453	GCC		0.682	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565		11	32	0	0	0	0.008291	0	11	32				
USP35	57558	broad.mit.edu	37	11	77919914	77919914	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:77919914T>G	ENST00000529308.1	+	9	1758	c.1497T>G	c.(1495-1497)atT>atG	p.I499M	USP35_ENST00000530535.1_Intron|USP35_ENST00000526425.1_Missense_Mutation_p.I230M|USP35_ENST00000441408.2_Missense_Mutation_p.I85M|USP35_ENST00000530267.1_Missense_Mutation_p.I67M	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	499	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			GGCCTGCCATTTCCCCAGAGA	0.607																																							uc009yva.1		NA																	0				lung(2)|ovary(1)	3						c.(1495-1497)ATT>ATG		ubiquitin specific protease 35							97.0	103.0	101.0					11																	77919914		2091	4210	6301	SO:0001583	missense	57558				ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr11:77919914T>G	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1497T>G	11.37:g.77919914T>G	ENSP00000431876:p.Ile499Met					USP35_uc001oze.2_Missense_Mutation_p.I255M|USP35_uc001ozc.2_Missense_Mutation_p.I67M|USP35_uc010rsp.1_Intron|USP35_uc001ozd.2_Missense_Mutation_p.I110M|USP35_uc001ozf.2_Missense_Mutation_p.I230M	p.I499M	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)		9	1743	+	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		499						Missense_Mutation	SNP	ENST00000529308.1	37	c.1497T>G	CCDS41693.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086897	0.36855	.	.	ENSG00000118369	ENST00000530267;ENST00000528910;ENST00000529308;ENST00000441408;ENST00000526425	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	4.5	-1.5	0.08691	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.116440	0.35378	N	0.003245	T	0.45418	0.1341	L	0.59436	1.845	0.29511	N	0.854192	D;D	0.54397	0.966;0.966	P;P	0.58331	0.708;0.837	T	0.50118	-0.8865	10	0.54805	T	0.06	-11.412	11.5411	0.50667	0.0:0.6651:0.0:0.3349	.	499;85	Q9P2H5;E7EWV7	UBP35_HUMAN;.	M	67;255;499;85;230	ENSP00000435468:I67M;ENSP00000436001:I255M;ENSP00000431876:I499M;ENSP00000400825:I85M;ENSP00000434942:I230M	ENSP00000400825:I85M	I	+	3	3	USP35	77597562	0.981000	0.34729	0.998000	0.56505	0.864000	0.49448	0.134000	0.15932	-0.111000	0.12001	0.477000	0.44152	ATT		0.607	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527		172	131	0	0	0	0.00361	0	172	131				
GAB2	9846	broad.mit.edu	37	11	77991716	77991716	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:77991716C>T	ENST00000361507.4	-	2	392	c.307G>A	c.(307-309)Gag>Aag	p.E103K	GAB2_ENST00000526030.1_5'UTR|GAB2_ENST00000340149.2_Missense_Mutation_p.E65K	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	103	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			TTCATGTCCTCTTCTGTCTCA	0.483																																							uc001ozh.2		NA																	0				ovary(5)|lung(1)	6						c.(307-309)GAG>AAG		GRB2-associated binding protein 2 isoform a							208.0	183.0	191.0					11																	77991716		2200	4292	6492	SO:0001583	missense	9846				osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr11:77991716C>T	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.307G>A	11.37:g.77991716C>T	ENSP00000354952:p.Glu103Lys					GAB2_uc001ozg.2_Missense_Mutation_p.E65K	p.E103K	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)		2	307	-	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		103			PH.		A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	ENST00000361507.4	37	c.307G>A	CCDS8259.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257936	0.80246	.	.	ENSG00000033327	ENST00000340149;ENST00000361507;ENST00000528886;ENST00000530915	T;T;T;T	0.76060	-0.99;2.5;-0.99;-0.99	5.37	5.37	0.77165	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.155184	0.41823	U	0.000818	T	0.75436	0.3849	L	0.59912	1.85	0.58432	D	0.999991	B	0.28713	0.22	B	0.33121	0.158	T	0.74551	-0.3628	10	0.59425	D	0.04	-6.8429	19.4818	0.95013	0.0:1.0:0.0:0.0	.	103	Q9UQC2	GAB2_HUMAN	K	65;103;65;65	ENSP00000343959:E65K;ENSP00000354952:E103K;ENSP00000433762:E65K;ENSP00000431868:E65K	ENSP00000343959:E65K	E	-	1	0	GAB2	77669364	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.959000	0.70339	2.667000	0.90743	0.563000	0.77884	GAG		0.483	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491		34	258	0	0	0	0.003755	0	34	258				
NAALAD2	10003	broad.mit.edu	37	11	89885504	89885504	+	Silent	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:89885504C>A	ENST00000534061.1	+	6	878	c.648C>A	c.(646-648)atC>atA	p.I216I	NAALAD2_ENST00000321955.4_Silent_p.I216I|NAALAD2_ENST00000375944.3_Silent_p.I216I|NAALAD2_ENST00000525171.1_Silent_p.I216I	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	216					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TAGGAATCATCTTGTACTCAG	0.438																																							uc001pdf.3		NA																	0				pancreas(1)|skin(1)	2						c.(646-648)ATC>ATA		N-acetylated alpha-linked acidic dipeptidase 2							120.0	102.0	108.0					11																	89885504		2201	4299	6500	SO:0001819	synonymous_variant	10003				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity	g.chr11:89885504C>A	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.648C>A	11.37:g.89885504C>A						NAALAD2_uc009yvx.2_Silent_p.I216I|NAALAD2_uc009yvy.2_Silent_p.I216I|NAALAD2_uc001pdd.2_Silent_p.I216I|NAALAD2_uc001pde.2_Silent_p.I216I	p.I216I	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN			6	757	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)	216			Extracellular (Potential).		B3KQR4|Q4KKV4|Q4VAM9	Silent	SNP	ENST00000534061.1	37	c.648C>A	CCDS8288.1																																																																																				0.438	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467		16	40	1	0	1.99824e-07	0.00499	2.28548e-07	16	40				
FAT3	120114	broad.mit.edu	37	11	92087809	92087809	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:92087809C>T	ENST00000298047.6	+	1	2548	c.2531C>T	c.(2530-2532)tCa>tTa	p.S844L	FAT3_ENST00000541502.1_Missense_Mutation_p.S844L|FAT3_ENST00000409404.2_Missense_Mutation_p.S844L|FAT3_ENST00000525166.1_Missense_Mutation_p.S694L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	844	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTTGAAAGTTCAGGCATTGGT	0.398										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(2530-2532)TCA>TTA		FAT tumor suppressor homolog 3							89.0	84.0	86.0					11																	92087809		1924	4142	6066	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92087809C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2531C>T	11.37:g.92087809C>T	ENSP00000298047:p.Ser844Leu	TCGA Ovarian(4;0.039)					p.S844L	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			1	2548	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	844			Cadherin 8.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.2531C>T		.	.	.	.	.	.	.	.	.	.	C	12.55	1.970372	0.34754	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.52754	4.64;4.64;0.65;4.64	5.71	3.8	0.43715	.	.	.	.	.	T	0.31513	0.0799	N	0.25031	0.7	0.32836	D	0.504717	B	0.32188	0.359	B	0.26202	0.067	T	0.38178	-0.9673	9	0.42905	T	0.14	.	10.7146	0.46005	0.0:0.7965:0.132:0.0715	.	844	Q8TDW7-3	.	L	844;844;844;694	ENSP00000298047:S844L;ENSP00000387040:S844L;ENSP00000443786:S844L;ENSP00000432586:S694L	ENSP00000298047:S844L	S	+	2	0	FAT3	91727457	0.910000	0.30920	0.909000	0.35828	0.988000	0.76386	1.602000	0.36783	0.731000	0.32448	0.467000	0.42956	TCA		0.398	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		21	43	0	0	0	0.010504	0	21	43				
FAT3	120114	broad.mit.edu	37	11	92534064	92534064	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:92534064G>A	ENST00000298047.6	+	9	7902	c.7885G>A	c.(7885-7887)Gat>Aat	p.D2629N	FAT3_ENST00000409404.2_Missense_Mutation_p.D2629N|FAT3_ENST00000525166.1_Missense_Mutation_p.D2479N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2629	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGATCCCGATGATGGAGCAAA	0.502										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(7885-7887)GAT>AAT		FAT tumor suppressor homolog 3							41.0	40.0	40.0					11																	92534064		1941	4143	6084	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92534064G>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7885G>A	11.37:g.92534064G>A	ENSP00000298047:p.Asp2629Asn	TCGA Ovarian(4;0.039)					p.D2629N	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			9	7902	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2629			Cadherin 24.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.7885G>A		.	.	.	.	.	.	.	.	.	.	G	23.8	4.464008	0.84425	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.50277	0.75;0.75;0.75	6.16	6.16	0.99307	.	.	.	.	.	T	0.47857	0.1468	N	0.17838	0.53	0.80722	D	1	D	0.53745	0.962	P	0.50082	0.63	T	0.47142	-0.9140	9	0.62326	D	0.03	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	2629	Q8TDW7-3	.	N	2629;2629;2479	ENSP00000298047:D2629N;ENSP00000387040:D2629N;ENSP00000432586:D2479N	ENSP00000298047:D2629N	D	+	1	0	FAT3	92173712	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.708000	0.54845	2.937000	0.99478	0.650000	0.86243	GAT		0.502	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		5	25	0	0	0	0.000602	0	5	25				
CNTN5	53942	broad.mit.edu	37	11	100179184	100179184	+	Missense_Mutation	SNP	G	G	A	rs200120909		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:100179184G>A	ENST00000524871.1	+	21	3004	c.2714G>A	c.(2713-2715)aGa>aAa	p.R905K	CNTN5_ENST00000279463.3_Missense_Mutation_p.R905K|CNTN5_ENST00000418526.2_Missense_Mutation_p.R831K|CNTN5_ENST00000527185.1_Missense_Mutation_p.R905K|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000528682.1_Missense_Mutation_p.R905K	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	905	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGTCTAGGAAGACCACAGGGA	0.428																																							uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(2713-2715)AGA>AAA		contactin 5 isoform long							67.0	66.0	67.0					11																	100179184		1869	4100	5969	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:100179184G>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2714G>A	11.37:g.100179184G>A	ENSP00000435637:p.Arg905Lys					CNTN5_uc001pfz.2_Missense_Mutation_p.R905K|CNTN5_uc001pgb.2_Missense_Mutation_p.R831K|CNTN5_uc010ruk.1_Missense_Mutation_p.R176K	p.R905K	NM_014361	NP_055176	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	21	3053	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	905			Fibronectin type-III 3.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.2714G>A	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142244	0.37825	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.55413	2.34;0.52;0.52;0.52;0.52	5.69	5.69	0.88448	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.125717	0.64402	D	0.000001	T	0.41305	0.1153	L	0.35854	1.095	0.43907	D	0.996549	B;B	0.14805	0.009;0.011	B;B	0.19946	0.004;0.027	T	0.20107	-1.0285	10	0.14252	T	0.57	.	12.4806	0.55839	0.0765:0.0:0.9235:0.0	.	831;905	O94779-2;O94779	.;CNTN5_HUMAN	K	905;905;905;831;905	ENSP00000433575:R905K;ENSP00000436185:R905K;ENSP00000435637:R905K;ENSP00000393229:R831K;ENSP00000279463:R905K	ENSP00000279463:R905K	R	+	2	0	CNTN5	99684394	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.982000	0.56909	2.843000	0.97960	0.591000	0.81541	AGA		0.428	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		4	29	0	0	0	0.009096	0	4	29				
DSCAML1	57453	broad.mit.edu	37	11	117392000	117392000	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:117392000T>G	ENST00000321322.6	-	6	1239	c.1238A>C	c.(1237-1239)gAg>gCg	p.E413A	DSCAML1_ENST00000527706.1_Missense_Mutation_p.E143A	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	353	Ig-like C2-type 5.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CAGCACCAGCTCCGTGTTGCG	0.627																																							uc001prh.1		NA																	0				ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1237-1239)GAG>GCG		Down syndrome cell adhesion molecule like 1							101.0	85.0	90.0					11																	117392000		2201	4296	6497	SO:0001583	missense	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117392000T>G		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1238A>C	11.37:g.117392000T>G	ENSP00000315465:p.Glu413Ala					DSCAML1_uc001pri.1_Missense_Mutation_p.E217A	p.E413A	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	6	1240	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	353			Extracellular (Potential).|Ig-like C2-type 4.		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	c.1238A>C	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	T	19.35	3.811037	0.70797	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.68025	-0.3;-0.3	4.67	4.67	0.58626	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.73690	0.3619	M	0.64630	1.985	0.80722	D	1	P;P	0.37985	0.613;0.526	B;P	0.50708	0.358;0.648	T	0.72023	-0.4415	9	0.32370	T	0.25	.	14.2688	0.66138	0.0:0.0:0.0:1.0	.	143;353	G3V1B5;Q8TD84	.;DSCL1_HUMAN	A	143;413;120	ENSP00000434335:E143A;ENSP00000315465:E413A	ENSP00000315465:E413A	E	-	2	0	DSCAML1	116897210	1.000000	0.71417	0.988000	0.46212	0.943000	0.58893	7.833000	0.86765	1.957000	0.56846	0.496000	0.49642	GAG		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		41	71	0	0	0	0.006999	0	41	71				
ABCG4	64137	broad.mit.edu	37	11	119029015	119029015	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:119029015G>A	ENST00000449422.2	+	10	1328	c.1140G>A	c.(1138-1140)agG>agA	p.R380R	ABCG4_ENST00000307417.3_Silent_p.R380R|ABCG4_ENST00000531739.1_Silent_p.R380R|AP002956.1_ENST00000599663.1_5'Flank	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	380					cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TCTTCAAGAGGACCTTCCTGT	0.572																																							uc001pvs.2		NA																	0				ovary(2)	2						c.(1138-1140)AGG>AGA		ATP-binding cassette, subfamily G, member 4							242.0	220.0	228.0					11																	119029015		2200	4295	6495	SO:0001819	synonymous_variant	64137				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:119029015G>A	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1140G>A	11.37:g.119029015G>A						ABCG4_uc009zar.2_Silent_p.R380R	p.R380R	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)	10	1476	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	380			Cytoplasmic (Potential).		A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Silent	SNP	ENST00000449422.2	37	c.1140G>A	CCDS8415.1																																																																																				0.572	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169		119	239	0	0	0	0.00361	0	119	239				
OR8D4	338662	broad.mit.edu	37	11	123777258	123777260	+	Missense_Mutation	TNP	GGG	GGG	TTT	rs377190285		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	GGG	GGG	-	-	GGG	GGG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:123777258_123777260GGG>TTT	ENST00000321355.2	+	1	150_152	c.120_122GGG>TTT	c.(118-123)gtGGGa>gtTTTa	p.G41L		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		TTACTGTGGTGGGAAACCTCAGC	0.414																																							uc010saa.1		NA																	0				skin(1)	1						c.(118-123)GTGGGA>GTTTTA		olfactory receptor, family 8, subfamily D,																																				SO:0001583	missense	338662				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123777258_123777260GGG>TTT	AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.120_122GGG>TTT	11.37:g.123777258GGG>TTT	ENSP00000325381:p.Gly41Leu						p.G41L	NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)	1	120_122	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	41			Helical; Name=1; (Potential).		Q6IFE9	Missense_Mutation	TNP	ENST00000321355.2	37	c.120_122GGG>TTT	CCDS31698.1																																																																																				0.414	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387262.1	NM_001005197		25	98	0	0	0	0.004672	0	25	98				
OR10S1	219873	broad.mit.edu	37	11	123847664	123847664	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:123847664G>T	ENST00000531945.1	-	1	824	c.735C>A	c.(733-735)gcC>gcA	p.A245A		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GCCGGCCCTGGGCTGTGCGGA	0.607																																							uc001pzm.1		NA																	0				ovary(1)|skin(1)	2						c.(733-735)GCC>GCA		olfactory receptor, family 10, subfamily S,							45.0	47.0	46.0					11																	123847664		2202	4299	6501	SO:0001819	synonymous_variant	219873				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123847664G>T	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.735C>A	11.37:g.123847664G>T							p.A245A	NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	735	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	245			Cytoplasmic (Potential).		B9EH43|Q6IEV3|Q96R78	Silent	SNP	ENST00000531945.1	37	c.735C>A	CCDS31701.1																																																																																				0.607	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474		34	68	1	0	6.05902e-23	0.003755	7.84529e-23	34	68				
OR10G4	390264	broad.mit.edu	37	11	123886650	123886650	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:123886650G>T	ENST00000320891.4	+	1	369	c.369G>T	c.(367-369)ttG>ttT	p.L123F		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		ATCGCTACTTGGCCATCAGTT	0.562																																							uc010sac.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(367-369)TTG>TTT		olfactory receptor, family 10, subfamily G,							119.0	112.0	114.0					11																	123886650		2202	4297	6499	SO:0001583	missense	390264				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123886650G>T	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.369G>T	11.37:g.123886650G>T	ENSP00000325076:p.Leu123Phe						p.L123F	NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	369	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	123			Cytoplasmic (Potential).		Q6IEW0	Missense_Mutation	SNP	ENST00000320891.4	37	c.369G>T	CCDS31702.1	.	.	.	.	.	.	.	.	.	.	g	17.27	3.347799	0.61183	.	.	ENSG00000254737	ENST00000320891	T	0.02158	4.42	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36555	N	0.002534	T	0.05731	0.0150	L	0.46741	1.465	0.37446	D	0.914621	D	0.58620	0.983	P	0.61592	0.891	T	0.21484	-1.0244	10	0.87932	D	0	.	6.2456	0.20815	0.1039:0.0:0.7092:0.187	.	123	Q8NGN3	O10G4_HUMAN	F	123	ENSP00000325076:L123F	ENSP00000325076:L123F	L	+	3	2	OR10G4	123391860	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.767000	0.26575	1.961000	0.56991	0.580000	0.79431	TTG		0.562	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		35	151	1	0	1.32136e-16	0.00874	1.66001e-16	35	151				
ROBO4	54538	broad.mit.edu	37	11	124766430	124766430	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:124766430G>T	ENST00000306534.3	-	3	1022	c.537C>A	c.(535-537)gcC>gcA	p.A179A	ROBO4_ENST00000533054.1_Silent_p.A34A|ROBO4_ENST00000526899.1_5'UTR	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	179	Ig-like C2-type 2.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CGGGCTGGAGGGCCAGGGGTT	0.637																																							uc001qbg.2		NA																	0				ovary(1)|skin(1)	2						c.(535-537)GCC>GCA		roundabout homolog 4, magic roundabout							68.0	76.0	74.0					11																	124766430		2201	4299	6500	SO:0001819	synonymous_variant	54538				angiogenesis|cell differentiation	integral to membrane	receptor activity	g.chr11:124766430G>T	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.537C>A	11.37:g.124766430G>T						ROBO4_uc010sas.1_Silent_p.A34A|ROBO4_uc001qbh.2_Silent_p.A69A|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	p.A179A	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)	3	677	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	179			Ig-like C2-type 2.		A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	c.537C>A	CCDS8455.1																																																																																				0.637	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		11	120	1	0	7.03913e-09	0.001368	8.27512e-09	11	120				
ADAMTS15	170689	broad.mit.edu	37	11	130343292	130343292	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:130343292C>G	ENST00000299164.2	+	8	2429	c.2429C>G	c.(2428-2430)tCt>tGt	p.S810C		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	810	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GACAAGTCCTCTCATCCCAAG	0.657																																							uc010scd.1		NA																	0				large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5						c.(2428-2430)TCT>TGT		a disintegrin-like and metalloprotease							103.0	120.0	114.0					11																	130343292		2201	4297	6498	SO:0001583	missense	170689				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:130343292C>G	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2429C>G	11.37:g.130343292C>G	ENSP00000299164:p.Ser810Cys						p.S810C	NM_139055	NP_620686	Q8TE58	ATS15_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)	8	2429	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	810			Spacer.		Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	c.2429C>G	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	C	12.79	2.044244	0.36085	.	.	ENSG00000166106	ENST00000299164	T	0.61627	0.09	5.69	5.69	0.88448	.	.	.	.	.	T	0.40719	0.1128	N	0.08118	0	0.09310	N	1	B	0.24368	0.102	B	0.27262	0.078	T	0.35748	-0.9776	9	0.56958	D	0.05	.	12.3199	0.54979	0.0:0.9224:0.0:0.0776	.	810	Q8TE58	ATS15_HUMAN	C	810	ENSP00000299164:S810C	ENSP00000299164:S810C	S	+	2	0	ADAMTS15	129848502	0.003000	0.15002	0.021000	0.16686	0.974000	0.67602	1.765000	0.38481	2.692000	0.91855	0.655000	0.94253	TCT		0.657	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		33	236	0	0	0	0.004289	0	33	236				
CD163	9332	broad.mit.edu	37	12	7632510	7632510	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:7632510C>A	ENST00000359156.4	-	16	3628	c.3426G>T	c.(3424-3426)aaG>aaT	p.K1142N	CD163_ENST00000432237.2_Splice_Site|CD163_ENST00000396620.3_Splice_Site|CD163_ENST00000541972.1_Splice_Site	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	1142					acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	GAATGGCCTCCTTTTCCATTC	0.373																																							uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(3424-3426)AAG>AAT		CD163 antigen isoform a							103.0	102.0	102.0					12																	7632510		2203	4300	6503	SO:0001583	missense	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7632510C>A	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.3426G>T	12.37:g.7632510C>A	ENSP00000352071:p.Lys1142Asn					CD163_uc001qta.3_Splice_Site_p.G1115_splice|CD163_uc009zfw.2_Splice_Site_p.G1148_splice	p.K1142N	NM_004244	NP_004235	Q86VB7	C163A_HUMAN			16	3554	-			1142			Cytoplasmic (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	c.3426G>T	CCDS8578.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	6.945|6.945|6.945	0.544256|0.544256|0.544256	0.13312|0.13312|0.13312	.|.|.	.|.|.	ENSG00000177575|ENSG00000177575|ENSG00000177575	ENST00000541972;ENST00000396620;ENST00000432237|ENST00000359156;ENST00000542280|ENST00000537626	.|T;T|.	.|0.02446|.	.|5.03;4.29|.	3.6|3.6|3.6	2.7|2.7|2.7	0.31948|0.31948|0.31948	.|.|.	.|5.434740|.	.|0.00424|.	.|N|.	.|0.000076|.	.|T|T	.|0.34600|0.34600	.|0.0903|0.0903	N|N|N	0.14661|0.14661|0.14661	0.345|0.345|0.345	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D|.	.|0.62365|.	.|0.991|.	.|P|.	.|0.55011|.	.|0.766|.	.|T|T	.|0.07908|0.07908	.|-1.0748|-1.0748	.|9|5	.|.|.	.|.|.	.|.|.	.|.|.	6.2383|6.2383|6.2383	0.20776|0.20776|0.20776	0.0:0.8642:0.0:0.1358|0.0:0.8642:0.0:0.1358|0.0:0.8642:0.0:0.1358	.|.|.	.|1142|.	.|Q86VB7|.	.|C163A_HUMAN|.	.|N|M	-1|1142;110|123	.|ENSP00000352071:K1142N;ENSP00000445438:K110N|.	.|.|.	.|K|R	-|-|-	.|3|2	.|2|0	CD163|CD163|CD163	7523777|7523777|7523777	0.436000|0.436000|0.436000	0.25586|0.25586|0.25586	0.957000|0.957000|0.957000	0.39632|0.39632|0.39632	0.473000|0.473000|0.473000	0.32948|0.32948|0.32948	0.738000|0.738000|0.738000	0.26158|0.26158|0.26158	2.038000|2.038000|2.038000	0.60285|0.60285|0.60285	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	.|AAG|AGG		0.373	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		14	38	1	0	3.27435e-08	0.00245	3.77651e-08	14	38				
FAM90A1	55138	broad.mit.edu	37	12	8374865	8374865	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:8374865G>A	ENST00000538603.1	-	7	1506	c.948C>T	c.(946-948)ccC>ccT	p.P316P	FAM90A1_ENST00000307435.6_Silent_p.P316P	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	316							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		TGGCGCTTTCGGGGATCTGGA	0.627																																							uc001qui.2		NA																	0				ovary(1)	1						c.(946-948)CCC>CCT		hypothetical protein LOC55138							13.0	16.0	15.0					12																	8374865		1963	4004	5967	SO:0001819	synonymous_variant	55138						nucleic acid binding|zinc ion binding	g.chr12:8374865G>A	AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.948C>T	12.37:g.8374865G>A						FAM90A1_uc001quh.2_Silent_p.P316P	p.P316P	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN		Kidney(36;0.0866)	7	1507	-			316					D3DUU9|Q9NVZ6	Silent	SNP	ENST00000538603.1	37	c.948C>T	CCDS31738.1																																																																																				0.627	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088		13	61	0	0	0	0.001368	0	13	61				
TM7SF3	51768	broad.mit.edu	37	12	27128438	27128438	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:27128438G>A	ENST00000343028.4	-	11	1666	c.1441C>T	c.(1441-1443)Caa>Taa	p.Q481*	RP11-421F16.3_ENST00000500632.1_RNA	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	481						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					CCATTAGTTTGAAAAGGCACA	0.418																																							uc010sjl.1		NA																	0				upper_aerodigestive_tract(2)	2						c.(1441-1443)CAA>TAA		transmembrane 7 superfamily member 3 precursor							115.0	111.0	112.0					12																	27128438		2203	4300	6503	SO:0001587	stop_gained	51768					integral to membrane|plasma membrane		g.chr12:27128438G>A	AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.1441C>T	12.37:g.27128438G>A	ENSP00000342322:p.Gln481*						p.Q481*	NM_016551	NP_057635	Q9NS93	TM7S3_HUMAN			11	1679	-	Colorectal(261;0.0847)		481			Helical; (Potential).		B3KMZ3|Q9NUS4	Nonsense_Mutation	SNP	ENST00000343028.4	37	c.1441C>T	CCDS8710.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492527	0.84962	.	.	ENSG00000064115	ENST00000343028;ENST00000545344	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-6.3331	20.0609	0.97674	0.0:0.0:1.0:0.0	.	.	.	.	X	481;195	.	ENSP00000342322:Q481X	Q	-	1	0	TM7SF3	27019705	1.000000	0.71417	0.994000	0.49952	0.844000	0.47949	9.417000	0.97391	2.824000	0.97209	0.655000	0.94253	CAA		0.418	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	NM_016551		6	37	0	0	0	0.001984	0	6	37				
OVOS2	144203	broad.mit.edu	37	12	31297876	31297876	+	IGR	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:31297876A>G								RP11-551L14.1 (27471 upstream) : FAM60A (135641 downstream)																							TTTCAGTAGAAGGACGTTCCC	0.483																																							uc010sjy.1		NA																	0					NA						c.(1753-1755)CTT>CCT		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							108.0	107.0	107.0					12																	31297876		1902	4116	6018	SO:0001628	intergenic_variant	0							g.chr12:31297876A>G																													12.37:g.31297876A>G							p.L585P							13	1754	-									Missense_Mutation	SNP		37	c.1754T>C																																																																																				0	0.483									31	106	0	0	0	0.009535	0	31	106				
ALG10B	144245	broad.mit.edu	37	12	38714725	38714725	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:38714725A>G	ENST00000308742.4	+	3	1448	c.1132A>G	c.(1132-1134)Ata>Gta	p.I378V	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	378					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TCCAGCCTATATATTTGCTGG	0.303																																							uc001rln.3		NA																	0				ovary(2)|skin(1)	3						c.(1132-1134)ATA>GTA		asparagine-linked glycosylation 10 homolog B							75.0	80.0	78.0					12																	38714725		2198	4295	6493	SO:0001583	missense	144245				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:38714725A>G	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.1132A>G	12.37:g.38714725A>G	ENSP00000310120:p.Ile378Val					ALG10B_uc001rlo.3_Missense_Mutation_p.I348V|ALG10B_uc010skk.1_Missense_Mutation_p.I318V	p.I378V	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN			3	1271	+	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)	378			Helical; (Potential).		B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	c.1132A>G	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	a	5.599	0.295302	0.10622	.	.	ENSG00000175548	ENST00000308742	T	0.50001	0.76	3.34	0.939	0.19506	.	0.606403	0.18664	N	0.134654	T	0.16685	0.0401	N	0.02403	-0.565	0.80722	D	1	B	0.13594	0.008	B	0.16722	0.016	T	0.05582	-1.0876	10	0.13853	T	0.58	.	4.3061	0.10947	0.4624:0.4198:0.1178:0.0	.	378	Q5I7T1	AG10B_HUMAN	V	378	ENSP00000310120:I378V	ENSP00000310120:I378V	I	+	1	0	ALG10B	37000992	0.692000	0.27719	0.757000	0.31301	0.984000	0.73092	-0.028000	0.12350	0.189000	0.20188	0.533000	0.62120	ATA		0.303	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620		13	64	0	0	0	0.00245	0	13	64				
WNT10B	7480	broad.mit.edu	37	12	49361889	49361889	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:49361889G>C	ENST00000301061.4	-	4	899	c.551C>G	c.(550-552)tCa>tGa	p.S184*	WNT10B_ENST00000407467.1_Intron|WNT10B_ENST00000403957.1_Intron	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	184					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						gctggggcttgagccagggcc	0.607																																							uc001rss.2		NA																	0				skin(4)|lung(3)	7						c.(550-552)TCA>TGA		wingless-type MMTV integration site family,							34.0	35.0	35.0					12																	49361889		2203	4300	6503	SO:0001587	stop_gained	7480				axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity	g.chr12:49361889G>C	X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.551C>G	12.37:g.49361889G>C	ENSP00000301061:p.Ser184*					WNT10B_uc001rst.2_Intron	p.S184*	NM_003394	NP_003385	O00744	WN10B_HUMAN			4	897	-			184					B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Nonsense_Mutation	SNP	ENST00000301061.4	37	c.551C>G	CCDS8775.1	.	.	.	.	.	.	.	.	.	.	G	36	5.669544	0.96754	.	.	ENSG00000169884	ENST00000301061	.	.	.	5.01	5.01	0.66863	.	0.316812	0.30126	N	0.010346	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	13.8543	0.63517	0.0:0.1542:0.8458:0.0	.	.	.	.	X	184	.	ENSP00000301061:S184X	S	-	2	0	WNT10B	47648156	0.612000	0.27000	0.985000	0.45067	0.869000	0.49853	2.083000	0.41615	2.504000	0.84457	0.561000	0.74099	TCA		0.607	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394		21	29	0	0	0	0.00278	0	21	29				
KMT2D	8085	broad.mit.edu	37	12	49434560	49434560	+	Silent	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:49434560C>A	ENST00000301067.7	-	31	6992	c.6993G>T	c.(6991-6993)ctG>ctT	p.L2331L		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2331	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCCGAGGGGTCAGGGGGGCTT	0.637																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(6991-6993)CTG>CTT		myeloid/lymphoid or mixed-lineage leukemia 2							19.0	22.0	21.0					12																	49434560		1837	4082	5919	SO:0001819	synonymous_variant	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49434560C>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6993G>T	12.37:g.49434560C>A		HNSCC(34;0.089)					p.L2331L	NM_003482	NP_003473	O14686	MLL2_HUMAN			31	6993	-			2331			Pro-rich.		O14687	Silent	SNP	ENST00000301067.7	37	c.6993G>T	CCDS44873.1																																																																																				0.637	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			16	21	1	0	6.94344e-10	0.006122	8.28685e-10	16	21				
FIGNL2	401720	broad.mit.edu	37	12	52215995	52215995	+	lincRNA	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:52215995G>C	ENST00000562343.2	+	0	4188				RP11-923I11.4_ENST00000567167.1_lincRNA																							CAAGACCCCAGAGTACTTCTC	0.652																																							uc001rzc.2		NA																	0					0						c.(202-204)TCT>TGT		fidgetin-like 2							60.0	63.0	62.0					12																	52215995		2111	4224	6335			401720						ATP binding|nucleoside-triphosphatase activity	g.chr12:52215995G>C																													12.37:g.52215995G>C							p.S68C	NM_001013690	NP_001013712	A6NMB9	FIGL2_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.135)	1	214	-			68						Missense_Mutation	SNP	ENST00000562343.2	37	c.203C>G																																																																																					0.652	RP11-923I11.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000430848.2			6	14	0	0	0	0.001168	0	6	14				
SLC26A10	65012	broad.mit.edu	37	12	58015561	58015561	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:58015561T>A	ENST00000320442.4	+	4	955	c.644T>A	c.(643-645)gTc>gAc	p.V215D	AC025165.8_ENST00000593846.1_RNA|SLC26A10_ENST00000379218.2_Missense_Mutation_p.V215D	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	215						integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					CTCGTGCCGGTCAAGGAATTG	0.692											OREG0021948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001spe.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(643-645)GTC>GAC		solute carrier family 26, member 10							19.0	20.0	19.0					12																	58015561		2200	4296	6496	SO:0001583	missense	65012					integral to membrane	antiporter activity	g.chr12:58015561T>A		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.644T>A	12.37:g.58015561T>A	ENSP00000320217:p.Val215Asp		OREG0021948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1027	SLC26A10_uc001spf.2_RNA|SLC26A10_uc009zpz.1_5'Flank	p.V215D	NM_133489	NP_597996	Q8NG04	S2610_HUMAN			4	955	+	Melanoma(17;0.122)		215					A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	ENST00000320442.4	37	c.644T>A	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	29.8	5.038393	0.93630	.	.	ENSG00000135502	ENST00000320442;ENST00000379218	D;D	0.93604	-3.25;-3.25	3.79	3.79	0.43588	Sulphate transporter (1);	.	.	.	.	D	0.96219	0.8767	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.95603	0.8665	9	0.45353	T	0.12	.	10.835	0.46681	0.0:0.0:0.0:1.0	.	215	Q8NG04	S2610_HUMAN	D	215	ENSP00000320217:V215D;ENSP00000368520:V215D	ENSP00000320217:V215D	V	+	2	0	SLC26A10	56301828	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	5.048000	0.64238	1.739000	0.51704	0.454000	0.30748	GTC		0.692	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2			10	17	0	0	0	0.006214	0	10	17				
MGAT4C	25834	broad.mit.edu	37	12	86374139	86374139	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:86374139G>A	ENST00000604798.1	-	8	1569	c.365C>T	c.(364-366)tCa>tTa	p.S122L	MGAT4C_ENST00000332156.1_Missense_Mutation_p.S122L|MGAT4C_ENST00000552808.2_Missense_Mutation_p.S122L|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000549405.2_Missense_Mutation_p.S122L|MGAT4C_ENST00000393205.2_Missense_Mutation_p.S151L|MGAT4C_ENST00000548651.1_Missense_Mutation_p.S122L			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	122					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CTCAAAAATTGACTTAATTGT	0.373																																							uc001tai.3		NA																	0				ovary(3)	3						c.(364-366)TCA>TTA		alpha-1,3-mannosyl-glycoprotein							64.0	66.0	65.0					12																	86374139		2203	4299	6502	SO:0001583	missense	25834				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr12:86374139G>A		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.365C>T	12.37:g.86374139G>A	ENSP00000474896:p.Ser122Leu					MGAT4C_uc001tal.3_Missense_Mutation_p.S122L|MGAT4C_uc001taj.3_Missense_Mutation_p.S122L|MGAT4C_uc001tak.3_Missense_Mutation_p.S122L|MGAT4C_uc010sum.1_Missense_Mutation_p.S146L|MGAT4C_uc001tah.3_Missense_Mutation_p.S122L	p.S122L	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN			8	1615	-			122			Lumenal (Potential).		B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	37	c.365C>T	CCDS9030.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066831	0.76301	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.19	5.19	0.71726	.	0.138948	0.49305	D	0.000156	D	0.95921	0.8672	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96355	0.9261	10	0.87932	D	0	-16.4879	19.0859	0.93202	0.0:0.0:1.0:0.0	.	151;122	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	L	122;151;122;122;122;122;122	ENSP00000331664:S122L;ENSP00000376900:S151L;ENSP00000449022:S122L;ENSP00000446647:S122L;ENSP00000447253:S122L;ENSP00000449172:S122L	ENSP00000331664:S122L	S	-	2	0	MGAT4C	84898270	1.000000	0.71417	0.856000	0.33681	0.763000	0.43281	9.809000	0.99208	2.565000	0.86533	0.591000	0.81541	TCA		0.373	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244		14	33	0	0	0	0.00245	0	14	33				
RAD9B	144715	broad.mit.edu	37	12	110944491	110944491	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:110944491C>T	ENST00000409778.3	+	4	405	c.381C>T	c.(379-381)taC>taT	p.Y127Y	RAD9B_ENST00000409425.1_Silent_p.Y55Y|RAD9B_ENST00000409300.1_Silent_p.Y127Y|RAD9B_ENST00000392672.4_Silent_p.Y127Y|RAD9B_ENST00000433301.1_3'UTR|RAD9B_ENST00000409246.1_Silent_p.Y55Y			Q6WBX8	RAD9B_HUMAN	RAD9 homolog B (S. pombe)	124					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	checkpoint clamp complex (GO:0030896)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	7						AATTCTTCTACAGACATGGTA	0.299																																							uc001trf.3		NA																	0				pancreas(1)|skin(1)	2						c.(379-381)TAC>TAT		RAD9 homolog B							100.0	98.0	99.0					12																	110944491		1568	3580	5148	SO:0001819	synonymous_variant	144715				cell cycle checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding	g.chr12:110944491C>T		CCDS9148.2, CCDS66469.1, CCDS73526.1, CCDS73527.1	12q24.13	2008-12-15	2008-12-15		ENSG00000151164	ENSG00000151164			21700	protein-coding gene	gene with protein product		608368					Standard	NM_152442		Approved	FLJ40346	uc001trf.4	Q6WBX8	OTTHUMG00000152952	ENST00000409778.3:c.381C>T	12.37:g.110944491C>T						RAD9B_uc001trg.3_Silent_p.Y127Y|RAD9B_uc010sya.1_Silent_p.Y127Y|RAD9B_uc001tre.3_Silent_p.Y55Y|RAD9B_uc001trd.3_5'UTR	p.Y127Y	NM_152442	NP_689655	Q6WBX8	RAD9B_HUMAN			4	519	+			124					Q5U5K0|Q6NVJ1|Q6ZVT7|Q8N7T9|Q96LI8	Silent	SNP	ENST00000409778.3	37	c.381C>T																																																																																					0.299	RAD9B-009	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404634.1	NM_152442		15	64	0	0	0	0.00245	0	15	64				
SLC8B1	80024	broad.mit.edu	37	12	113748059	113748059	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:113748059G>A	ENST00000552014.1	-	13	1752	c.1237C>T	c.(1237-1239)Cag>Tag	p.Q413*	SLC8B1_ENST00000553238.1_5'UTR|SLC8B1_ENST00000546737.1_Nonsense_Mutation_p.Q357*|SLC8B1_ENST00000550047.1_5'Flank|SLC8B1_ENST00000202831.3_Nonsense_Mutation_p.Q413*			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	413					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)										CTGGGGGGCTGGCTGTCAGAT	0.592																																							uc001tvc.2		NA																	0				central_nervous_system(1)	1						c.(1237-1239)CAG>TAG		solute carrier family 24 member 6 precursor							57.0	57.0	57.0					12																	113748059		2203	4300	6503	SO:0001587	stop_gained	80024				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity	g.chr12:113748059G>A	AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.1237C>T	12.37:g.113748059G>A	ENSP00000447091:p.Gln413*					SLC24A6_uc001tuz.2_Nonsense_Mutation_p.Q118*|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Nonsense_Mutation_p.Q151*	p.Q413*	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN			12	1447	-			413			Extracellular (Potential).		A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Nonsense_Mutation	SNP	ENST00000552014.1	37	c.1237C>T	CCDS31909.1	.	.	.	.	.	.	.	.	.	.	G	10.46	1.357184	0.24598	.	.	ENSG00000089060	ENST00000552014;ENST00000202831;ENST00000377458;ENST00000546737	.	.	.	5.09	-0.708	0.11241	.	0.584242	0.18257	N	0.146750	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	10.2593	0.43416	0.0:0.5299:0.338:0.1321	.	.	.	.	X	413;413;357;357	.	ENSP00000202831:Q413X	Q	-	1	0	SLC24A6	112232442	0.000000	0.05858	0.039000	0.18376	0.003000	0.03518	-0.425000	0.07017	-0.053000	0.13289	-1.107000	0.02091	CAG		0.592	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404830.3	NM_024959		7	33	0	0	0	0.004482	0	7	33				
ABCB9	23457	broad.mit.edu	37	12	123419844	123419844	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:123419844C>T	ENST00000542678.1	-	10	4716	c.1878G>A	c.(1876-1878)atG>atA	p.M626I	ABCB9_ENST00000540285.1_Missense_Mutation_p.M563I|ABCB9_ENST00000442028.2_Missense_Mutation_p.M626I|ABCB9_ENST00000280560.8_Missense_Mutation_p.M626I|ABCB9_ENST00000346530.5_Missense_Mutation_p.M583I|ABCB9_ENST00000392439.3_Missense_Mutation_p.M626I|ABCB9_ENST00000442833.2_Missense_Mutation_p.M626I|ABCB9_ENST00000344275.7_Missense_Mutation_p.M626I			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	626	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		CCTGGAGTTCCATGATGAAGC	0.617																																					Ovarian(49;786 1333 9175 38236)	Ovarian(49;786 1333 9175 38236)	uc001udm.3		NA																	0					0						c.(1876-1878)ATG>ATA		ATP-binding cassette, sub-family B (MDR/TAP),							71.0	50.0	57.0					12																	123419844		2203	4300	6503	SO:0001583	missense	23457				positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding	g.chr12:123419844C>T	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.1878G>A	12.37:g.123419844C>T	ENSP00000440288:p.Met626Ile					ABCB9_uc010tai.1_Missense_Mutation_p.M233I|ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Missense_Mutation_p.M583I|ABCB9_uc010taj.1_Missense_Mutation_p.M563I|ABCB9_uc001udp.2_Missense_Mutation_p.M626I|ABCB9_uc001udq.2_Missense_Mutation_p.M345I	p.M626I	NM_019625	NP_062571	Q9NP78	ABCB9_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)	10	2188	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		626			ABC transporter.		B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	ENST00000542678.1	37	c.1878G>A	CCDS9241.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390646	0.42410	.	.	ENSG00000150967	ENST00000280560;ENST00000540285;ENST00000346530;ENST00000392439;ENST00000542678;ENST00000442028;ENST00000546289;ENST00000542448	D;D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-2.63	5.14	4.25	0.50352	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.110369	0.64402	D	0.000018	D	0.86669	0.5988	N	0.20881	0.62	0.32868	D	0.50889	B;B;B;B;B	0.25390	0.029;0.098;0.029;0.125;0.056	B;B;B;B;B	0.29440	0.102;0.029;0.063;0.072;0.042	D	0.85298	0.1071	10	0.38643	T	0.18	-49.2414	7.8202	0.29284	0.0:0.7153:0.1428:0.1419	.	563;233;345;583;626	B4E2J0;B4DFR8;B3KNJ8;Q9NP78-2;Q9NP78	.;.;.;.;ABCB9_HUMAN	I	626;563;583;626;626;626;170;252	ENSP00000280560:M626I;ENSP00000441734:M563I;ENSP00000280559:M583I;ENSP00000376234:M626I;ENSP00000440288:M626I;ENSP00000394898:M626I;ENSP00000442281:M170I;ENSP00000440244:M252I	ENSP00000280560:M626I	M	-	3	0	ABCB9	121985797	0.243000	0.23878	1.000000	0.80357	0.898000	0.52572	-0.347000	0.07750	2.371000	0.80710	0.563000	0.77884	ATG		0.617	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624		4	14	0	0	0	0.009096	0	4	14				
DNAH10	196385	broad.mit.edu	37	12	124397651	124397651	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr12:124397651A>T	ENST00000409039.3	+	59	9812	c.9787A>T	c.(9787-9789)Agg>Tgg	p.R3263W		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3263	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TTAGGTGGCCAGGCTGGAGCG	0.498																																							uc001uft.3		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(9787-9789)AGG>TGG		dynein, axonemal, heavy chain 10							27.0	28.0	28.0					12																	124397651		1868	4085	5953	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124397651A>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.9787A>T	12.37:g.124397651A>T	ENSP00000386770:p.Arg3263Trp						p.R3263W	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	59	9812	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		3263			Potential.|Stalk (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.9787A>T	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	21.8	4.209174	0.79240	.	.	ENSG00000197653	ENST00000409039	T	0.75260	-0.92	5.54	3.0	0.34707	Dynein heavy chain, coiled coil stalk (1);	1.049230	0.07512	N	0.909092	D	0.84106	0.5399	M	0.71581	2.175	0.40998	D	0.984908	D	0.63880	0.993	P	0.61275	0.886	T	0.78021	-0.2367	10	0.72032	D	0.01	.	12.0363	0.53427	0.7269:0.2731:0.0:0.0	.	3263	Q8IVF4	DYH10_HUMAN	W	3263	ENSP00000386770:R3263W	ENSP00000386770:R3263W	R	+	1	2	DNAH10	122963604	0.952000	0.32445	1.000000	0.80357	0.911000	0.54048	1.954000	0.40362	0.904000	0.36572	0.533000	0.62120	AGG		0.498	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			5	13	0	0	0	0.000602	0	5	13				
TUBA3C	7278	broad.mit.edu	37	13	19748132	19748132	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:19748132G>A	ENST00000400113.3	-	5	1328	c.1224C>T	c.(1222-1224)taC>taT	p.Y408Y		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	408					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTTCTCCCACGTACCAGTGCA	0.602																																							uc009zzj.2		NA																	0				ovary(3)|skin(2)	5						c.(1222-1224)TAC>TAT		tubulin, alpha 3c							151.0	142.0	145.0					13																	19748132		2203	4300	6503	SO:0001819	synonymous_variant	7278				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr13:19748132G>A	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.1224C>T	13.37:g.19748132G>A							p.Y408Y	NM_006001	NP_005992	Q13748	TBA3C_HUMAN		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)	5	1273	-		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)	408					A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	c.1224C>T	CCDS9284.1																																																																																				0.602	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001		56	127	0	0	0	0.00361	0	56	127				
ATP12A	479	broad.mit.edu	37	13	25262552	25262552	+	Silent	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:25262552C>G	ENST00000381946.3	+	4	491	c.324C>G	c.(322-324)ctC>ctG	p.L108L	ATP12A_ENST00000218548.6_Silent_p.L108L			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	108					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TCAAGTTCCTCAAGCAGATGG	0.607																																					Pancreas(156;1582 1935 18898 22665 26498)	Pancreas(156;1582 1935 18898 22665 26498)	uc001upp.2		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6						c.(322-324)CTC>CTG		hydrogen/potassium-exchanging ATPase 12A	Esomeprazole(DB00736)|Pantoprazole(DB00213)						224.0	232.0	229.0					13																	25262552		2203	4300	6503	SO:0001819	synonymous_variant	479				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding	g.chr13:25262552C>G	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.324C>G	13.37:g.25262552C>G						ATP12A_uc010aaa.2_Silent_p.L108L	p.L108L	NM_001676	NP_001667	P54707	AT12A_HUMAN		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	4	511	+		Lung SC(185;0.0225)|Breast(139;0.077)	108			Helical; (Potential).		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	37	c.324C>G	CCDS31948.1																																																																																				0.607	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676		58	284	0	0	0	0.00361	0	58	284				
FRY	10129	broad.mit.edu	37	13	32749689	32749689	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:32749689G>A	ENST00000380250.3	+	20	2837	c.2341G>A	c.(2341-2343)Gac>Aac	p.D781N		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	781						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ACAGGATGACGACAGGCCGAT	0.453																																							uc001utx.2		NA																	0				ovary(5)|large_intestine(1)|skin(1)	7						c.(2341-2343)GAC>AAC		furry homolog							146.0	141.0	142.0					13																	32749689		1932	4127	6059	SO:0001583	missense	10129				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane		g.chr13:32749689G>A	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.2341G>A	13.37:g.32749689G>A	ENSP00000369600:p.Asp781Asn					FRY_uc010tdw.1_RNA	p.D781N	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)	20	2837	+		Lung SC(185;0.0271)	781					Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	c.2341G>A	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.046649	0.93740	.	.	ENSG00000073910	ENST00000380250	T	0.23552	1.9	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.27900	0.0687	L	0.52266	1.64	0.80722	D	1	P	0.51351	0.944	B	0.41174	0.349	T	0.02190	-1.1198	10	0.20046	T	0.44	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	781	Q5TBA9	FRY_HUMAN	N	781	ENSP00000369600:D781N	ENSP00000369600:D781N	D	+	1	0	FRY	31647689	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	7.562000	0.82300	2.788000	0.95919	0.650000	0.86243	GAC		0.453	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037		22	38	0	0	0	0.00278	0	22	38				
SERTM1	400120	broad.mit.edu	37	13	37269436	37269436	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:37269436C>T	ENST00000315190.3	+	2	667	c.221C>T	c.(220-222)tCc>tTc	p.S74F		NM_203451.2	NP_982276.2	A2A2V5	SRTM1_HUMAN	serine-rich and transmembrane domain containing 1	74	Poly-Ser.					integral component of membrane (GO:0016021)											TCCTCCAGTTCCTCCTACCCA	0.448																																							uc001uvt.3		NA																	0				skin(1)	1						c.(220-222)TCC>TTC		hypothetical protein LOC400120							143.0	139.0	140.0					13																	37269436		2203	4300	6503	SO:0001583	missense	400120					integral to membrane		g.chr13:37269436C>T		CCDS9358.1	13q13.3	2011-08-10	2011-08-10	2011-08-09	ENSG00000180440	ENSG00000180440			33792	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 36"""	C13orf36			Standard	NM_203451		Approved		uc001uvt.4	A2A2V5	OTTHUMG00000016735	ENST00000315190.3:c.221C>T	13.37:g.37269436C>T	ENSP00000325776:p.Ser74Phe						p.S74F	NM_203451	NP_982276	A2A2V5	CM036_HUMAN			2	667	+			74			Poly-Ser.		Q8N469	Missense_Mutation	SNP	ENST00000315190.3	37	c.221C>T	CCDS9358.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529176	0.44969	.	.	ENSG00000180440	ENST00000315190	.	.	.	5.18	5.18	0.71444	.	0.173808	0.52532	D	0.000070	T	0.57330	0.2046	N	0.19112	0.55	0.49483	D	0.999798	B	0.23735	0.09	B	0.37304	0.246	T	0.60244	-0.7301	9	0.87932	D	0	-8.485	17.6906	0.88268	0.0:1.0:0.0:0.0	.	74	A2A2V5	SRTM1_HUMAN	F	74	.	ENSP00000325776:S74F	S	+	2	0	SERTM1	36167436	1.000000	0.71417	0.987000	0.45799	0.992000	0.81027	7.093000	0.76937	2.398000	0.81561	0.557000	0.71058	TCC		0.448	SERTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044518.2	NM_203451		26	106	0	0	0	0.00333	0	26	106				
SUCLA2	8803	broad.mit.edu	37	13	48528386	48528386	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:48528386C>A	ENST00000378654.3	-	8	1052	c.996G>T	c.(994-996)atG>atT	p.M332I	SUCLA2_ENST00000543413.1_Missense_Mutation_p.M274I|SUCLA2_ENST00000544100.1_Missense_Mutation_p.M198I|SUCLA2_ENST00000534875.1_Missense_Mutation_p.M274I	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	332					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TTATTATATCCATTGTGGCCA	0.368																																							uc001vbs.2		NA																	0				central_nervous_system(1)	1						c.(994-996)ATG>ATT		succinate-CoA ligase, ADP-forming, beta subunit	Succinic acid(DB00139)						79.0	83.0	81.0					13																	48528386		2203	4300	6503	SO:0001583	missense	8803				succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity	g.chr13:48528386C>A	AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.996G>T	13.37:g.48528386C>A	ENSP00000367923:p.Met332Ile					SUCLA2_uc010tgb.1_Missense_Mutation_p.M272I|SUCLA2_uc010tgc.1_Missense_Mutation_p.M198I|SUCLA2_uc010tgd.1_Missense_Mutation_p.M272I|SUCLA2_uc001vbt.1_RNA	p.M332I	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN		GBM - Glioblastoma multiforme(144;2.1e-06)	8	1053	-		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)	332					B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	Missense_Mutation	SNP	ENST00000378654.3	37	c.996G>T	CCDS9406.1	.	.	.	.	.	.	.	.	.	.	c	21.9	4.212090	0.79240	.	.	ENSG00000136143	ENST00000378654;ENST00000378645;ENST00000378642;ENST00000544100;ENST00000534875;ENST00000543413;ENST00000541732;ENST00000434484	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.48	5.48	0.80851	Succinyl-CoA synthetase-like (2);Succinyl-CoA synthetase, beta subunit, conserved site (1);ATP-citrate lyase/succinyl-CoA ligase (1);	0.000000	0.85682	D	0.000000	T	0.81555	0.4847	M	0.93062	3.375	0.80722	D	1	P	0.44344	0.833	P	0.53760	0.734	D	0.85436	0.1152	10	0.87932	D	0	-9.9188	18.692	0.91586	0.0:1.0:0.0:0.0	.	332	Q9P2R7	SUCB1_HUMAN	I	332;310;262;198;274;274;160;262	ENSP00000367923:M332I;ENSP00000443412:M198I;ENSP00000438182:M274I;ENSP00000441056:M274I;ENSP00000392771:M262I	ENSP00000367909:M262I	M	-	3	0	SUCLA2	47426387	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.657000	0.67996	2.736000	0.93811	0.555000	0.69702	ATG		0.368	SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044852.1			11	50	1	0	3.27435e-08	0.00245	3.77651e-08	11	50				
PCDH17	27253	broad.mit.edu	37	13	58208714	58208714	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:58208714G>C	ENST00000377918.3	+	1	2060	c.2034G>C	c.(2032-2034)aaG>aaC	p.K678N		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAGTGGCCAAGCTCATCATCC	0.652																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(2032-2034)AAG>AAC		protocadherin 17 precursor							84.0	82.0	83.0					13																	58208714		2203	4300	6503	SO:0001583	missense	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58208714G>C	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2034G>C	13.37:g.58208714G>C	ENSP00000367151:p.Lys678Asn					PCDH17_uc010aec.1_Missense_Mutation_p.K678N	p.K678N	NM_001040429	NP_001035519	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	2926	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	678			Extracellular (Potential).|Cadherin 6.		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	c.2034G>C	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021274	0.35701	.	.	ENSG00000118946	ENST00000377918	T	0.51817	0.69	5.32	3.45	0.39498	Cadherin (4);Cadherin-like (1);	0.102165	0.64402	D	0.000004	T	0.47619	0.1455	L	0.39020	1.185	0.45733	D	0.998635	P;D	0.53151	0.837;0.958	P;P	0.57468	0.617;0.821	T	0.36962	-0.9726	9	.	.	.	.	7.1237	0.25458	0.1585:0.143:0.6985:0.0	.	678;678	O14917-2;O14917	.;PCD17_HUMAN	N	678	ENSP00000367151:K678N	.	K	+	3	2	PCDH17	57106715	0.990000	0.36364	1.000000	0.80357	0.991000	0.79684	0.237000	0.17985	1.207000	0.43291	0.561000	0.74099	AAG		0.652	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		33	78	0	0	0	0.002836	0	33	78				
SLITRK6	84189	broad.mit.edu	37	13	86369241	86369241	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:86369241T>C	ENST00000400286.2	-	2	2001	c.1403A>G	c.(1402-1404)aAc>aGc	p.N468S		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	468					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GAGGAGGTTGTTATTTAAATA	0.333																																							uc001vll.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1402-1404)AAC>AGC		slit and trk like 6 precursor							76.0	74.0	75.0					13																	86369241		1796	4069	5865	SO:0001583	missense	84189					integral to membrane		g.chr13:86369241T>C	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1403A>G	13.37:g.86369241T>C	ENSP00000383143:p.Asn468Ser					SLITRK6_uc010afe.1_Intron	p.N468S	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN		GBM - Glioblastoma multiforme(99;0.0456)	2	1862	-	all_neural(89;0.117)|Medulloblastoma(90;0.163)		468			Extracellular (Potential).|LRR 10.		A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	37	c.1403A>G	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.276207	0.59649	.	.	ENSG00000184564	ENST00000400286	T	0.57907	0.37	5.86	5.86	0.93980	.	0.000000	0.64402	U	0.000001	T	0.65719	0.2718	L	0.45285	1.41	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.66118	-0.6003	10	0.51188	T	0.08	-10.348	15.0909	0.72192	0.0:0.0:0.0:1.0	.	468	Q9H5Y7	SLIK6_HUMAN	S	468	ENSP00000383143:N468S	ENSP00000383143:N468S	N	-	2	0	SLITRK6	85267242	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.040000	0.89188	2.240000	0.73641	0.533000	0.62120	AAC		0.333	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229		15	60	0	0	0	0.00245	0	15	60				
SLC15A1	6564	broad.mit.edu	37	13	99340768	99340768	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:99340768G>A	ENST00000376503.5	-	19	1585	c.1530C>T	c.(1528-1530)atC>atT	p.I510I		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	510					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TGTAGCTGCTGATGTTTGCAT	0.368																																							uc001vno.2		NA																	0				ovary(1)	1						c.(1528-1530)ATC>ATT		solute carrier family 15 (oligopeptide	Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)						133.0	130.0	131.0					13																	99340768		2203	4300	6503	SO:0001819	synonymous_variant	6564				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity	g.chr13:99340768G>A	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1530C>T	13.37:g.99340768G>A							p.I510I	NM_005073	NP_005064	P46059	S15A1_HUMAN			19	1607	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		510			Extracellular (Potential).		Q5VW82	Silent	SNP	ENST00000376503.5	37	c.1530C>T	CCDS9489.1																																																																																				0.368	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045560.3	NM_005073		11	35	0	0	0	0.008291	0	11	35				
NALCN	259232	broad.mit.edu	37	13	101763510	101763510	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:101763510G>A	ENST00000251127.6	-	19	2341	c.2260C>T	c.(2260-2262)Ctc>Ttc	p.L754F		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	754					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGCACGCTGAGGATTGACCTC	0.512																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(2260-2262)CTC>TTC		voltage gated channel like 1							158.0	150.0	153.0					13																	101763510		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101763510G>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2260C>T	13.37:g.101763510G>A	ENSP00000251127:p.Leu754Phe						p.L754F	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			19	2449	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		754			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.2260C>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604245	0.87157	.	.	ENSG00000102452	ENST00000251127	D	0.97870	-4.58	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.97133	0.9063	L	0.39898	1.24	0.80722	D	1	D	0.64830	0.994	P	0.52672	0.706	D	0.97314	0.9939	10	0.51188	T	0.08	.	19.1765	0.93604	0.0:0.0:1.0:0.0	.	754	Q8IZF0	NALCN_HUMAN	F	754	ENSP00000251127:L754F	ENSP00000251127:L754F	L	-	1	0	NALCN	100561511	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.229000	0.95273	2.538000	0.85594	0.650000	0.86243	CTC		0.512	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		33	147	0	0	0	0.004878	0	33	147				
COL4A2	1284	broad.mit.edu	37	13	111114675	111114675	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr13:111114675G>A	ENST00000360467.5	+	24	2026	c.1720G>A	c.(1720-1722)Gat>Aat	p.D574N	COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	574	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GAAAGGTGACGATGGCAGCCC	0.642																																							uc001vqx.2		NA																	0				skin(3)|central_nervous_system(2)|ovary(1)	6						c.(1720-1722)GAT>AAT		alpha 2 type IV collagen preproprotein							43.0	53.0	50.0					13																	111114675		1994	4145	6139	SO:0001583	missense	1284				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding	g.chr13:111114675G>A	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1720G>A	13.37:g.111114675G>A	ENSP00000353654:p.Asp574Asn						p.D574N	NM_001846	NP_001837	P08572	CO4A2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)		24	2009	+	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	574			Triple-helical region.		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	c.1720G>A	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	G	7.577	0.667952	0.14710	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93488	-3.23	5.48	4.63	0.57726	.	0.000000	0.56097	D	0.000023	D	0.89223	0.6654	L	0.33293	1	0.22745	N	0.998787	D	0.62365	0.991	P	0.44921	0.464	T	0.81302	-0.0994	10	0.23891	T	0.37	.	13.2781	0.60198	0.0768:0.0:0.9232:0.0	.	574	P08572	CO4A2_HUMAN	N	574	ENSP00000353654:D574N	ENSP00000257309:D574N	D	+	1	0	COL4A2	109912676	0.949000	0.32298	0.007000	0.13788	0.013000	0.08279	2.761000	0.47589	1.321000	0.45227	0.655000	0.94253	GAT		0.642	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846		14	42	0	0	0	0.004007	0	14	42				
OR4E2	26686	broad.mit.edu	37	14	22133935	22133935	+	Silent	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:22133935C>G	ENST00000408935.1	+	1	639	c.639C>G	c.(637-639)gcC>gcG	p.A213A		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		GTTTCTTGGCCGTGGTCACCT	0.512																																							uc010tmd.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(637-639)GCC>GCG		olfactory receptor, family 4, subfamily E,							158.0	147.0	151.0					14																	22133935		1979	4164	6143	SO:0001819	synonymous_variant	26686				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22133935C>G		CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.639C>G	14.37:g.22133935C>G							p.A213A	NM_001001912	NP_001001912	Q8NGC2	OR4E2_HUMAN		GBM - Glioblastoma multiforme(265;0.0137)	1	639	+	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	213			Helical; Name=5; (Potential).		Q6IET6|Q96R62	Silent	SNP	ENST00000408935.1	37	c.639C>G	CCDS41916.1																																																																																				0.512	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1			26	39	0	0	0	0.00632	0	26	39				
C14orf93	60686	broad.mit.edu	37	14	23465468	23465468	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:23465468C>T	ENST00000299088.6	-	3	1036	c.607G>A	c.(607-609)Gat>Aat	p.D203N	C14orf93_ENST00000397379.3_Missense_Mutation_p.D203N|C14orf93_ENST00000406429.2_Missense_Mutation_p.D203N|RP11-298I3.4_ENST00000557615.1_RNA|C14orf93_ENST00000397382.4_Missense_Mutation_p.D203N|RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000557513.1_5'Flank|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000341470.4_Missense_Mutation_p.D203N|C14orf93_ENST00000397377.1_Missense_Mutation_p.D23N	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	203						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		GCCACGTAATCATCCACCAGC	0.493																																							uc001wib.1		NA																	0				ovary(1)	1						c.(607-609)GAT>AAT		hypothetical protein LOC60686 precursor							74.0	67.0	70.0					14																	23465468		2203	4300	6503	SO:0001583	missense	60686					extracellular region		g.chr14:23465468C>T	AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.607G>A	14.37:g.23465468C>T	ENSP00000299088:p.Asp203Asn					C14orf93_uc001wic.1_Missense_Mutation_p.D23N|C14orf93_uc001wid.1_Missense_Mutation_p.D203N|C14orf93_uc001wig.2_Missense_Mutation_p.D203N|C14orf93_uc001wih.2_Missense_Mutation_p.D203N|C14orf93_uc001wie.2_Missense_Mutation_p.D203N|C14orf93_uc001wia.3_Missense_Mutation_p.D203N|C14orf93_uc001wif.2_Missense_Mutation_p.D23N	p.D203N	NM_021944	NP_068763	Q9H972	CN093_HUMAN		GBM - Glioblastoma multiforme(265;0.0127)	3	917	-	all_cancers(95;3.3e-05)		203					B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Missense_Mutation	SNP	ENST00000299088.6	37	c.607G>A	CCDS9583.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541620	0.45280	.	.	ENSG00000100802	ENST00000299088;ENST00000341470;ENST00000397379;ENST00000397382;ENST00000397377;ENST00000406429;ENST00000397376;ENST00000397380	T;T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000001	T	0.62527	0.2435	L	0.29908	0.895	0.44736	D	0.997732	D;D	0.67145	0.996;0.996	D;D	0.79784	0.993;0.993	T	0.59563	-0.7431	10	0.39692	T	0.17	-11.967	17.6123	0.88058	0.0:1.0:0.0:0.0	.	203;203	Q9H972;Q9H972-2	CN093_HUMAN;.	N	203;203;203;203;23;203;23;203	ENSP00000299088:D203N;ENSP00000341353:D203N;ENSP00000380535:D203N;ENSP00000380538:D203N;ENSP00000380533:D23N;ENSP00000384768:D203N;ENSP00000380532:D23N;ENSP00000380536:D203N	ENSP00000299088:D203N	D	-	1	0	C14orf93	22535308	1.000000	0.71417	0.979000	0.43373	0.162000	0.22319	4.031000	0.57267	2.769000	0.95229	0.655000	0.94253	GAT		0.493	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	NM_021944		22	26	0	0	0	0.00278	0	22	26				
LRRC16B	90668	broad.mit.edu	37	14	24528901	24528901	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:24528901T>G	ENST00000342740.5	+	22	1982	c.1828T>G	c.(1828-1830)Tct>Gct	p.S610A	LRRC16B_ENST00000334420.7_De_novo_Start_OutOfFrame	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	610						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GAACAATACATCTGCCCTGGG	0.597																																							uc001wlj.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(1828-1830)TCT>GCT		leucine rich repeat containing 16B							97.0	84.0	88.0					14																	24528901		2203	4300	6503	SO:0001583	missense	90668							g.chr14:24528901T>G	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.1828T>G	14.37:g.24528901T>G	ENSP00000340467:p.Ser610Ala					LRRC16B_uc001wlk.2_5'Flank	p.S610A	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN		GBM - Glioblastoma multiforme(265;0.019)	22	1985	+			610					Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	c.1828T>G	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945325	0.53079	.	.	ENSG00000186648	ENST00000342740	T	0.56103	0.48	5.04	3.86	0.44501	.	0.138850	0.46442	D	0.000294	T	0.61615	0.2361	M	0.80183	2.485	0.80722	D	1	D	0.53151	0.958	P	0.53649	0.731	T	0.62685	-0.6802	10	0.38643	T	0.18	-13.4977	7.651	0.28348	0.0:0.0973:0.0:0.9027	.	610	Q8ND23	LR16B_HUMAN	A	610	ENSP00000340467:S610A	ENSP00000340467:S610A	S	+	1	0	LRRC16B	23598741	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	3.622000	0.54217	2.117000	0.64856	0.459000	0.35465	TCT		0.597	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360		9	14	0	0	0	0.006214	0	9	14				
NOVA1	4857	broad.mit.edu	37	14	26949326	26949326	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:26949326T>A	ENST00000344429.5	-	3	307	c.304A>T	c.(304-306)Atc>Ttc	p.I102F	NOVA1_ENST00000539517.2_Missense_Mutation_p.I102F|NOVA1_ENST00000547619.1_Missense_Mutation_p.I102F|NOVA1_ENST00000465357.2_Missense_Mutation_p.I102F|NOVA1_ENST00000574031.1_Missense_Mutation_p.I102F|NOVA1_ENST00000267422.7_5'UTR	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	105	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		GTTCCCTGGATCAAGCACACT	0.378																																							uc001wpy.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5						c.(304-306)ATC>TTC		neuro-oncological ventral antigen 1 isoform 1							99.0	84.0	89.0					14																	26949326		2203	4300	6503	SO:0001583	missense	4857				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding	g.chr14:26949326T>A	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.304A>T	14.37:g.26949326T>A	ENSP00000342387:p.Ile102Phe					NOVA1_uc001wpz.2_Missense_Mutation_p.I102F|NOVA1_uc001wqa.2_5'UTR|NOVA1_uc001wqb.2_Missense_Mutation_p.I102F	p.I102F	NM_002515	NP_002506	P51513	NOVA1_HUMAN		GBM - Glioblastoma multiforme(265;0.0135)	3	622	-			105			KH 1.		A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	ENST00000344429.5	37	c.304A>T	CCDS9635.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.970412	0.74246	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000449198;ENST00000549571;ENST00000344429;ENST00000547619	T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62	5.26	5.26	0.73747	.	0.394425	0.25433	N	0.030704	T	0.71384	0.3333	M	0.85462	2.755	0.80722	D	1	D;D;D	0.69078	0.997;0.968;0.96	D;D;D	0.71870	0.975;0.954;0.923	T	0.77135	-0.2699	10	0.87932	D	0	-30.1432	15.1667	0.72833	0.0:0.0:0.0:1.0	.	102;102;102	P51513-2;D3DS81;P51513-4	.;.;.	F	102;102;61;65;102;102	ENSP00000447391:I102F;ENSP00000438875:I102F;ENSP00000408914:I61F;ENSP00000449185:I65F;ENSP00000342387:I102F;ENSP00000448157:I102F	ENSP00000342387:I102F	I	-	1	0	NOVA1	26019166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.013000	0.88655	2.002000	0.58637	0.477000	0.44152	ATC		0.378	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276557.1	NM_006491		21	24	0	0	0	0.010504	0	21	24				
STRN3	29966	broad.mit.edu	37	14	31416332	31416332	+	Missense_Mutation	SNP	C	C	A	rs145004284		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:31416332C>A	ENST00000357479.5	-	5	876	c.680G>T	c.(679-681)gGt>gTt	p.G227V	STRN3_ENST00000355683.5_Missense_Mutation_p.G227V	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	227					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AGGAGATTCACCTCCATTCAG	0.328																																							uc001wqu.2		NA																	0					0						c.(679-681)GGT>GTT		nuclear autoantigen isoform 1							125.0	116.0	119.0					14																	31416332		2203	4300	6503	SO:0001583	missense	29966				negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity	g.chr14:31416332C>A		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.680G>T	14.37:g.31416332C>A	ENSP00000350071:p.Gly227Val					STRN3_uc001wqv.2_Missense_Mutation_p.G227V|STRN3_uc010tpj.1_RNA	p.G227V	NM_001083893	NP_001077362	Q13033	STRN3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)	5	896	-	Hepatocellular(127;0.0877)|Breast(36;0.148)		227					A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	ENST00000357479.5	37	c.680G>T	CCDS41938.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007642	0.54361	.	.	ENSG00000196792	ENST00000355683;ENST00000357479;ENST00000555152	T;T	0.63913	-0.07;0.04	5.9	5.9	0.94986	.	0.146599	0.64402	D	0.000010	T	0.64638	0.2616	L	0.44542	1.39	0.80722	D	1	P;P	0.48911	0.465;0.917	B;P	0.47470	0.232;0.548	T	0.62191	-0.6906	10	0.40728	T	0.16	-34.1822	20.2704	0.98474	0.0:1.0:0.0:0.0	.	227;227	Q13033-2;Q13033	.;STRN3_HUMAN	V	227;227;108	ENSP00000347909:G227V;ENSP00000350071:G227V	ENSP00000347909:G227V	G	-	2	0	STRN3	30486083	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.645000	0.61404	2.793000	0.96121	0.591000	0.81541	GGT		0.328	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574		14	31	1	0	2.61681e-11	0.00245	3.15051e-11	14	31				
C14orf28	122525	broad.mit.edu	37	14	45369754	45369754	+	Missense_Mutation	SNP	G	G	T	rs146051011	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:45369754G>T	ENST00000325192.3	+	2	391	c.116G>T	c.(115-117)cGc>cTc	p.R39L	RP11-857B24.5_ENST00000555157.1_RNA|C14orf28_ENST00000557112.1_Missense_Mutation_p.R39L	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	39										endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						AAAGCTGGCCGCAAAGCAGTA	0.363																																							uc001wvo.2		NA																	0				ovary(1)	1						c.(115-117)CGC>CTC		hypothetical protein LOC122525							77.0	79.0	78.0					14																	45369754		2203	4300	6503	SO:0001583	missense	122525							g.chr14:45369754G>T	AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.116G>T	14.37:g.45369754G>T	ENSP00000326846:p.Arg39Leu					C14orf28_uc001wvp.1_Missense_Mutation_p.R39L	p.R39L	NM_001017923	NP_001017923	Q4W4Y0	CN028_HUMAN			2	382	+			39						Missense_Mutation	SNP	ENST00000325192.3	37	c.116G>T	CCDS32069.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.576906	0.65878	.	.	ENSG00000179476	ENST00000325192;ENST00000557112	T;T	0.32515	1.45;1.45	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	N	0.19112	0.55	0.80722	D	1	D	0.67145	0.996	D	0.76575	0.988	T	0.40440	-0.9563	10	0.87932	D	0	.	17.455	0.87604	0.0:0.0:1.0:0.0	.	39	Q4W4Y0	CN028_HUMAN	L	39	ENSP00000326846:R39L;ENSP00000451791:R39L	ENSP00000326846:R39L	R	+	2	0	C14orf28	44439504	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.130000	0.89598	2.802000	0.96397	0.650000	0.86243	CGC		0.363	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410086.1	NM_001017923		16	20	1	0	2.31682e-05	0.003163	2.53879e-05	16	20				
FAM179B	23116	broad.mit.edu	37	14	45465012	45465012	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:45465012G>A	ENST00000361577.3	+	2	2324	c.2110G>A	c.(2110-2112)Gat>Aat	p.D704N	KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000382233.2_Missense_Mutation_p.D704N|FAM179B_ENST00000361462.2_Missense_Mutation_p.D704N	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	704										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						GCCAGTCAATGATGATTTATG	0.318																																							uc001wvv.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)	3						c.(2110-2112)GAT>AAT		hypothetical protein LOC23116							92.0	90.0	91.0					14																	45465012		2203	4300	6503	SO:0001583	missense	23116						binding	g.chr14:45465012G>A	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2110G>A	14.37:g.45465012G>A	ENSP00000355045:p.Asp704Asn					FAM179B_uc001wvw.2_Missense_Mutation_p.D704N|FAM179B_uc010anc.2_RNA|FAM179B_uc010anb.1_Missense_Mutation_p.D704N|FAM179B_uc001wvu.2_Missense_Mutation_p.D704N	p.D704N	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN			2	2319	+			704					Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	c.2110G>A	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672511	0.88348	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233;ENST00000555874	T;T;T;T	0.04015	3.73;3.73;3.73;3.73	5.42	5.42	0.78866	Armadillo-type fold (1);	0.000000	0.56097	D	0.000028	T	0.12561	0.0305	L	0.27053	0.805	0.40482	D	0.98045	D;D;D;D	0.76494	0.991;0.999;0.996;0.991	P;D;D;P	0.72338	0.895;0.977;0.922;0.895	T	0.03453	-1.1035	10	0.72032	D	0.01	-17.1076	15.924	0.79597	0.0:0.0:1.0:0.0	.	704;704;704;704	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	N	704;704;704;704;23	ENSP00000355045:D704N;ENSP00000354917:D704N;ENSP00000371668:D704N;ENSP00000451141:D23N	ENSP00000354917:D704N	D	+	1	0	FAM179B	44534762	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.462000	0.66707	2.554000	0.86153	0.585000	0.79938	GAT		0.318	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		11	14	0	0	0	0.001855	0	11	14				
DNAAF2	55172	broad.mit.edu	37	14	50100361	50100361	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:50100361C>A	ENST00000298292.8	-	1	1587	c.1507G>T	c.(1507-1509)Ggc>Tgc	p.G503C	DNAAF2_ENST00000406043.3_Missense_Mutation_p.G503C	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	503					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						GAGCGCTGGCCGCCCGTGCCC	0.622																																							uc001wws.3		NA																	0					0						c.(1507-1509)GGC>TGC		kintoun isoform 1							25.0	25.0	25.0					14																	50100361		2203	4300	6503	SO:0001583	missense	55172	Kartagener_syndrome			axonemal dynein complex assembly|ciliary cell motility|flagellar cell motility	cytoplasm		g.chr14:50100361C>A	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1507G>T	14.37:g.50100361C>A	ENSP00000298292:p.Gly503Cys					SDCCAG1_uc010anj.1_Intron|C14orf104_uc001wwt.3_Missense_Mutation_p.G503C	p.G503C	NM_018139	NP_060609	Q9NVR5	KTU_HUMAN			1	1588	-	all_epithelial(31;0.0021)|Breast(41;0.0124)		503					B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Missense_Mutation	SNP	ENST00000298292.8	37	c.1507G>T	CCDS9691.2	.	.	.	.	.	.	.	.	.	.	C	9.366	1.069155	0.20147	.	.	ENSG00000165506	ENST00000298292;ENST00000406043	T;T	0.18338	2.22;2.47	3.99	-7.97	0.01139	.	.	.	.	.	T	0.07369	0.0186	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35822	-0.9773	9	0.51188	T	0.08	.	4.8786	0.13668	0.1031:0.4205:0.3455:0.1309	.	503;503	Q9NVR5-2;Q9NVR5	.;KTU_HUMAN	C	503	ENSP00000298292:G503C;ENSP00000384862:G503C	ENSP00000298292:G503C	G	-	1	0	DNAAF2	49170111	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.430000	0.01024	-2.168000	0.00778	-1.702000	0.00720	GGC		0.622	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1			5	19	1	0	0.00116845	0.001168	0.00123361	5	19				
KLHDC2	23588	broad.mit.edu	37	14	50245145	50245146	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:50245145_50245146GA>TT	ENST00000298307.5	+	6	1427_1428	c.566_567GA>TT	c.(565-567)aGA>aTT	p.R189I	KLHDC2_ENST00000557247.1_Missense_Mutation_p.R189I|KLHDC2_ENST00000554589.1_Missense_Mutation_p.R189I	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	189						nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					AGTCATCCAAGAGGATGGAATG	0.322																																							uc001wwx.2		NA																	0				ovary(1)	1						c.(565-567)AGA>ATT		kelch domain containing 2																																				SO:0001583	missense	23588					nucleus	protein binding	g.chr14:50245145_50245146GA>TT	AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	Exception_encountered	14.37:g.50245145_50245146delinsTT	ENSP00000298307:p.Arg189Ile					SDCCAG1_uc010anj.1_Intron|KLHDC2_uc001wwy.2_Missense_Mutation_p.R189I|KLHDC2_uc010anp.2_Missense_Mutation_p.R189I	p.R189I	NM_014315	NP_055130	Q9Y2U9	KLDC2_HUMAN			6	966_967	+	all_epithelial(31;0.000959)|Breast(41;0.0117)		189			Kelch 3.		B3KPF9|Q6IAF0|Q86TY9	Missense_Mutation	DNP	ENST00000298307.5	37	c.566_567GA>TT	CCDS9693.1																																																																																				0.322	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276869.1			14	18	0	0	0	0.004672	0	14	18				
NEMF	9147	broad.mit.edu	37	14	50266231	50266231	+	Silent	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:50266231T>C	ENST00000298310.5	-	25	2876	c.2427A>G	c.(2425-2427)aaA>aaG	p.K809K	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000545773.1_Silent_p.K767K|NEMF_ENST00000546046.1_Silent_p.K788K			O60524	NEMF_HUMAN	nuclear export mediator factor	809					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						GGCTCTGTGATTTACTGTCAC	0.299																																							uc001wxc.2		NA																	0					0						c.(2425-2427)AAA>AAG		serologically defined colon cancer antigen 1							92.0	100.0	97.0					14																	50266231		2203	4297	6500	SO:0001819	synonymous_variant	9147					cytoplasm|nucleus		g.chr14:50266231T>C	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.2427A>G	14.37:g.50266231T>C						SDCCAG1_uc010anj.1_Silent_p.K809K|SDCCAG1_uc001wwz.2_5'UTR|SDCCAG1_uc001wxa.2_Silent_p.K89K|SDCCAG1_uc010tqi.1_Silent_p.K788K|SDCCAG1_uc001wxe.2_Silent_p.K767K|SDCCAG1_uc001wxd.1_Silent_p.K214K	p.K809K	NM_004713	NP_004704	O60524	NEMF_HUMAN		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)	25	2495	-	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)	809					A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Silent	SNP	ENST00000298310.5	37	c.2427A>G	CCDS9694.1																																																																																				0.299	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713		35	39	0	0	0	0.004878	0	35	39				
AP5M1	55745	broad.mit.edu	37	14	57741544	57741544	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:57741544C>T	ENST00000261558.3	+	2	1063	c.657C>T	c.(655-657)tcC>tcT	p.S219S	AP5M1_ENST00000431972.2_Silent_p.S233S	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	219	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											AGGTAAAATCCATGCAATATG	0.393																																							uc001xcv.2		NA																	0				ovary(1)	1						c.(655-657)TCC>TCT		Mu-2 related death-inducing protein							85.0	94.0	91.0					14																	57741544		2188	4291	6479	SO:0001819	synonymous_variant	55745				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex		g.chr14:57741544C>T	AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.657C>T	14.37:g.57741544C>T						MUDENG_uc001xcu.3_Silent_p.S219S|MUDENG_uc010tri.1_Intron|MUDENG_uc010trj.1_Silent_p.S116S	p.S219S	NM_018229	NP_060699	Q9H0R1	MUDEN_HUMAN			2	1084	+			219			MHD.		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Silent	SNP	ENST00000261558.3	37	c.657C>T	CCDS9729.1																																																																																				0.393	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276922.1	NM_018229		20	29	0	0	0	0.012319	0	20	29				
SYNE2	23224	broad.mit.edu	37	14	64494420	64494420	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:64494420A>T	ENST00000344113.4	+	43	6835	c.6623A>T	c.(6622-6624)tAc>tTc	p.Y2208F	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.Y2208F|SYNE2_ENST00000358025.3_Missense_Mutation_p.Y2208F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2208					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CAGGGAAACTACCTCTTGGAG	0.418																																							uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(6622-6624)TAC>TTC		spectrin repeat containing, nuclear envelope 2							75.0	72.0	73.0					14																	64494420		1822	4085	5907	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64494420A>T	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6623A>T	14.37:g.64494420A>T	ENSP00000341781:p.Tyr2208Phe					SYNE2_uc001xgl.2_Missense_Mutation_p.Y2208F	p.Y2208F	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	43	6853	+			2208			Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.6623A>T	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.708393	0.48517	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.34275	1.37;1.37;1.37	5.38	5.38	0.77491	.	0.124467	0.36482	N	0.002561	T	0.40222	0.1108	L	0.29908	0.895	0.80722	D	1	D;D	0.64830	0.99;0.994	P;D	0.63033	0.815;0.91	T	0.14504	-1.0470	10	0.13853	T	0.58	.	10.7423	0.46160	0.841:0.159:0.0:0.0	.	2208;2208	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	F	2208	ENSP00000350719:Y2208F;ENSP00000341781:Y2208F;ENSP00000452570:Y2208F	ENSP00000261678:Y2208F	Y	+	2	0	SYNE2	63564173	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.333000	0.43912	2.035000	0.60131	0.482000	0.46254	TAC		0.418	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		15	20	0	0	0	0.003163	0	15	20				
LTBP2	4053	broad.mit.edu	37	14	74970292	74970292	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:74970292C>T	ENST00000261978.4	-	32	4986	c.4600G>A	c.(4600-4602)Gac>Aac	p.D1534N	LTBP2_ENST00000556690.1_Missense_Mutation_p.D1490N	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1534	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CAGGCCAGGTCCTGGCACTCA	0.622																																							uc001xqa.2		NA																	0				liver(1)|skin(1)	2						c.(4600-4602)GAC>AAC		latent transforming growth factor beta binding							73.0	46.0	55.0					14																	74970292		2203	4300	6503	SO:0001583	missense	4053				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding	g.chr14:74970292C>T		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4600G>A	14.37:g.74970292C>T	ENSP00000261978:p.Asp1534Asn						p.D1534N	NM_000428	NP_000419	Q14767	LTBP2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)	32	4987	-			1534			EGF-like 18; calcium-binding (Potential).		Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	c.4600G>A	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861740	0.91433	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	D;D	0.92199	-2.99;-2.99	4.86	4.86	0.63082	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.157548	0.29515	N	0.011921	D	0.91012	0.7173	L	0.37630	1.12	0.37930	D	0.931979	P	0.45986	0.87	P	0.53549	0.729	D	0.89736	0.3930	10	0.26408	T	0.33	.	12.5791	0.56380	0.0:0.9177:0.0:0.0823	.	1534	Q14767	LTBP2_HUMAN	N	1534;1490	ENSP00000261978:D1534N;ENSP00000451477:D1490N	ENSP00000261978:D1534N	D	-	1	0	LTBP2	74040045	0.869000	0.29996	1.000000	0.80357	0.973000	0.67179	3.607000	0.54102	2.507000	0.84556	0.561000	0.74099	GAC		0.622	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428		6	7	0	0	0	0.001168	0	6	7				
PROX2	283571	broad.mit.edu	37	14	75329988	75329988	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:75329988G>A	ENST00000445876.1	-	1	549	c.550C>T	c.(550-552)Cgc>Tgc	p.R184C	PROX2_ENST00000556084.2_Missense_Mutation_p.R184C|PROX2_ENST00000556489.2_Missense_Mutation_p.R184C			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	184					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		ACCCAGGGGCGAGGCCCACAG	0.617																																							uc001xqr.1		NA																	0					0						c.(550-552)CGC>TGC		prospero homeobox 2							36.0	36.0	36.0					14																	75329988		1961	4138	6099	SO:0001583	missense	283571				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr14:75329988G>A		CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.550C>T	14.37:g.75329988G>A	ENSP00000405932:p.Arg184Cys					PROX2_uc001xqq.1_Missense_Mutation_p.R110C	p.R184C	NM_001080408	NP_001073877	Q3B8N5	PROX2_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)	1	550	-			184					C9J5W1|Q8N9Q3	Missense_Mutation	SNP	ENST00000445876.1	37	c.550C>T	CCDS45136.2	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012775	0.54468	.	.	ENSG00000119608	ENST00000556489;ENST00000389664;ENST00000424024;ENST00000445876	T;T	0.47177	0.85;0.85	5.67	-8.45	0.00946	.	4.008150	0.00633	N	0.000488	T	0.40791	0.1131	L	0.36672	1.1	0.09310	N	1	D;D	0.61697	0.99;0.982	P;P	0.46975	0.533;0.533	T	0.58532	-0.7620	10	0.59425	D	0.04	5.8482	10.1029	0.42515	0.0:0.3308:0.359:0.3102	.	184;184	G3V3G0;Q3B8N5-2	.;.	C	184	ENSP00000451223:R184C;ENSP00000405932:R184C	ENSP00000374315:R184C	R	-	1	0	PROX2	74399741	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-1.652000	0.01988	-1.506000	0.01805	-0.321000	0.08615	CGC		0.617	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				9	32	0	0	0	0.008291	0	9	32				
TTC8	123016	broad.mit.edu	37	14	89291101	89291101	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:89291101G>T	ENST00000345383.5	+	1	134	c.50G>T	c.(49-51)cGc>cTc	p.R17L	TTC8_ENST00000346301.4_Missense_Mutation_p.R17L|TTC8_ENST00000380656.2_Missense_Mutation_p.R17L|TTC8_ENST00000536576.1_5'UTR|TTC8_ENST00000354441.6_Missense_Mutation_p.R17L|TTC8_ENST00000338104.6_Missense_Mutation_p.R17L	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	17					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TATTTTAGGCGCAGGAAGTTC	0.642																																							uc010ath.2		NA																	0					0						c.(49-51)CGC>CTC		tetratricopeptide repeat domain 8 isoform B							22.0	22.0	22.0					14																	89291101		2203	4300	6503	SO:0001583	missense	123016	Bardet-Biedl_syndrome			cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding	g.chr14:89291101G>T	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.50G>T	14.37:g.89291101G>T	ENSP00000339486:p.Arg17Leu					TTC8_uc010atg.1_RNA|TTC8_uc001xxl.2_5'UTR|TTC8_uc010ati.2_5'UTR|TTC8_uc001xxm.2_Missense_Mutation_p.R17L|TTC8_uc010atj.2_Missense_Mutation_p.R17L|TTC8_uc001xxi.2_Missense_Mutation_p.R17L|TTC8_uc001xxj.2_Missense_Mutation_p.R17L|TTC8_uc001xxk.2_Missense_Mutation_p.R17L	p.R17L	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN			1	184	+			17			TPR 1.		A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	ENST00000345383.5	37	c.50G>T	CCDS9885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.469617|5.469617	0.96274|0.96274	.|.	.|.	ENSG00000165533|ENSG00000165533	ENST00000554686|ENST00000343648;ENST00000345383;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000556651	.|T;T;T;T;T;T	.|0.80393	.|0.18;1.63;1.63;-1.37;1.63;0.18	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90239|0.90239	0.6948|0.6948	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	.|D;P;D;P;D;P	.|0.89917	.|0.996;0.943;1.0;0.943;0.999;0.898	.|D;P;D;P;D;P	.|0.76575	.|0.988;0.791;0.964;0.665;0.933;0.614	D|D	0.91121|0.91121	0.4930|0.4930	5|10	.|0.72032	.|D	.|0.01	-11.8083|-11.8083	18.2024|18.2024	0.89843|0.89843	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|17;17;17;17;17;17	.|Q8TAM2-2;Q8TAM2;G3V2Z9;Q8TAM2-3;G3V324;Q8TAM2-4	.|.;TTC8_HUMAN;.;.;.;.	S|L	7|17	.|ENSP00000339486:R17L;ENSP00000298324:R17L;ENSP00000337653:R17L;ENSP00000346427:R17L;ENSP00000370031:R17L;ENSP00000450993:R17L	.|ENSP00000337653:R17L	A|R	+|+	1|2	0|0	TTC8|TTC8	88360854|88360854	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.437000|5.437000	0.66544|0.66544	2.592000|2.592000	0.87571|0.87571	0.650000|0.650000	0.86243|0.86243	GCA|CGC		0.642	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596		5	10	1	0	3.59834e-05	0.001168	3.92741e-05	5	10				
C14orf159	80017	broad.mit.edu	37	14	91633606	91633606	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:91633606C>T	ENST00000523771.1	+	4	744	c.141C>T	c.(139-141)tcC>tcT	p.S47S	C14orf159_ENST00000519019.1_Silent_p.S47S|C14orf159_ENST00000517877.1_Silent_p.S47S|C14orf159_ENST00000525393.2_Intron|C14orf159_ENST00000520328.1_Silent_p.S47S|C14orf159_ENST00000518665.2_Silent_p.S47S|C14orf159_ENST00000522322.1_Silent_p.S47S|C14orf159_ENST00000298858.4_Silent_p.S47S|C14orf159_ENST00000523816.1_Silent_p.S47S|C14orf159_ENST00000412671.2_Silent_p.S47S|C14orf159_ENST00000518868.1_Silent_p.S47S|C14orf159_ENST00000256324.10_Silent_p.S47S|C14orf159_ENST00000521077.2_Silent_p.S47S|C14orf159_ENST00000428926.2_Silent_p.S47S			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	47						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		TGCCCAGGTCCCTTGCTCCAG	0.557																																							uc001xzb.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(139-141)TCC>TCT		hypothetical protein LOC80017 isoform a							105.0	103.0	103.0					14																	91633606		2203	4300	6503	SO:0001819	synonymous_variant	80017					mitochondrion		g.chr14:91633606C>T	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.141C>T	14.37:g.91633606C>T						C14orf159_uc010atu.1_Silent_p.S47S|C14orf159_uc010atv.1_RNA|C14orf159_uc001xyy.2_Silent_p.S47S|C14orf159_uc001xyx.2_Silent_p.S47S|C14orf159_uc001xyw.2_Silent_p.S47S|C14orf159_uc001xzc.2_Silent_p.S47S|C14orf159_uc001xza.2_Silent_p.S47S|C14orf159_uc001xyv.2_Silent_p.S47S|C14orf159_uc001xyz.2_Intron|C14orf159_uc010twj.1_Silent_p.S47S|C14orf159_uc001xze.2_Silent_p.S47S	p.S47S	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)	6	909	+		all_cancers(154;0.0191)|all_epithelial(191;0.241)	47					B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Silent	SNP	ENST00000523771.1	37	c.141C>T	CCDS32141.1																																																																																				0.557	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952		65	46	0	0	0	0.00361	0	65	46				
GSKIP	51527	broad.mit.edu	37	14	96848614	96848614	+	Silent	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:96848614A>T	ENST00000556095.1	+	3	1842	c.30A>T	c.(28-30)ctA>ctT	p.L10L	GSKIP_ENST00000555181.1_Silent_p.L10L|RNU2-33P_ENST00000410344.1_RNA|GSKIP_ENST00000554182.1_Silent_p.L10L|GSKIP_ENST00000438650.1_Silent_p.L10L	NM_001271904.1	NP_001258833.1	Q9P0R6	GSKIP_HUMAN	GSK3B interacting protein	10						cytoplasm (GO:0005737)											CCATGGAGCTAAGCAGTATGT	0.348																																							uc001yfj.3		NA																	0					0						c.(28-30)CTA>CTT		chromosome 14 open reading frame 129							90.0	87.0	88.0					14																	96848614		2203	4300	6503	SO:0001819	synonymous_variant	51527					cytoplasm	protein binding	g.chr14:96848614A>T	AF151044	CCDS32153.1	14q32.2	2012-09-25	2012-09-25	2012-09-25	ENSG00000100744	ENSG00000100744			20343	protein-coding gene	gene with protein product	"""GSK3beta interaction protein"""		"""chromosome 14 open reading frame 129"""	C14orf129		16981698, 21328310	Standard	NM_001271904		Approved		uc031qqf.1	Q9P0R6	OTTHUMG00000171420	ENST00000556095.1:c.30A>T	14.37:g.96848614A>T						C14orf129_uc001yfl.2_Silent_p.L10L	p.L10L	NM_016472	NP_057556	Q9P0R6	GSKIP_HUMAN		Epithelial(152;0.109)|COAD - Colon adenocarcinoma(157;0.205)	3	175	+		Melanoma(154;0.226)	10					B3KSZ0|Q9BST1|Q9NWK0	Silent	SNP	ENST00000556095.1	37	c.30A>T	CCDS32153.1																																																																																				0.348	GSKIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413338.1	NM_016472		19	20	0	0	0	0.006122	0	19	20				
DLK1	8788	broad.mit.edu	37	14	101195281	101195281	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:101195281C>A	ENST00000341267.4	+	3	382	c.140C>A	c.(139-141)cCt>cAt	p.P47H	DLK1_ENST00000556051.1_Missense_Mutation_p.P47H|DLK1_ENST00000331224.6_Missense_Mutation_p.P47H	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	47	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.			Missing (in Ref. 3; CAA35582). {ECO:0000305}.|QP -> HV (in Ref. 1; CAA78163). {ECO:0000305}.	cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				AGGTGCCAGCCTGGCTGGCAG	0.617																																							uc001yhs.3		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(139-141)CCT>CAT		delta-like 1 homolog precursor							97.0	103.0	101.0					14																	101195281		2203	4300	6503	SO:0001583	missense	8788				multicellular organismal development	extracellular space|integral to membrane|soluble fraction		g.chr14:101195281C>A	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.140C>A	14.37:g.101195281C>A	ENSP00000340292:p.Pro47His					DLK1_uc001yhu.3_Missense_Mutation_p.P47H	p.P47H	NM_003836	NP_003827	P80370	DLK1_HUMAN			3	293	+		Melanoma(154;0.155)	47	QP -> HV (in Ref. 1; CAA78163).|Missing (in Ref. 3; CAA35582).		Extracellular (Potential).|EGF-like 1.		P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	37	c.140C>A	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470261	0.63625	.	.	ENSG00000185559	ENST00000392848;ENST00000341267;ENST00000331224;ENST00000556051	T;T;T;T	0.66099	0.01;-0.19;2.59;0.01	4.41	3.5	0.40072	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.149569	0.45126	D	0.000381	T	0.76183	0.3952	M	0.76574	2.34	0.38998	D	0.95929	D;D	0.76494	0.997;0.999	D;D	0.72625	0.935;0.978	T	0.78940	-0.2006	10	0.62326	D	0.03	.	11.8046	0.52147	0.0:0.9123:0.0:0.0877	.	47;47	P80370-2;P80370	.;DLK1_HUMAN	H	47	ENSP00000376589:P47H;ENSP00000340292:P47H;ENSP00000331081:P47H;ENSP00000450821:P47H	ENSP00000331081:P47H	P	+	2	0	DLK1	100265034	0.653000	0.27358	0.996000	0.52242	0.965000	0.64279	3.894000	0.56250	0.824000	0.34613	0.591000	0.81541	CCT		0.617	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1			91	109	1	0	5.62478e-27	0.00361	7.36994e-27	91	109				
KIF26A	26153	broad.mit.edu	37	14	104640602	104640602	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:104640602G>T	ENST00000423312.2	+	11	2148	c.2148G>T	c.(2146-2148)gtG>gtT	p.V716V	KIF26A_ENST00000315264.7_Silent_p.V577V	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	716	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TCAGCACCGTGCAGCTCGCCG	0.697																																							uc001yos.3		NA																	0				pancreas(1)	1						c.(2146-2148)GTG>GTT		kinesin family member 26A							16.0	23.0	21.0					14																	104640602		2146	4230	6376	SO:0001819	synonymous_variant	26153				blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity	g.chr14:104640602G>T	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2148G>T	14.37:g.104640602G>T							p.V716V	NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	Epithelial(46;0.152)	Epithelial(152;0.161)	11	2148	+		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	716					Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	c.2148G>T	CCDS45171.1																																																																																				0.697	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1			4	3	1	0	0.00024832	0.009096	0.000265229	4	3				
AHNAK2	113146	broad.mit.edu	37	14	105417947	105417947	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr14:105417947C>T	ENST00000333244.5	-	7	3960	c.3841G>A	c.(3841-3843)Gag>Aag	p.E1281K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1281						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCGTCACCTCTGCCTTATGA	0.617																																							uc010axc.1		NA																	0				ovary(1)	1						c.(3841-3843)GAG>AAG		AHNAK nucleoprotein 2							69.0	59.0	62.0					14																	105417947		1850	3257	5107	SO:0001583	missense	113146					nucleus		g.chr14:105417947C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3841G>A	14.37:g.105417947C>T	ENSP00000353114:p.Glu1281Lys					AHNAK2_uc001ypx.2_Missense_Mutation_p.E1181K	p.E1281K	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	3961	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	1281					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.3841G>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	8.560	0.877645	0.17395	.	.	ENSG00000185567	ENST00000333244	T	0.00705	5.81	3.77	1.91	0.25777	.	.	.	.	.	T	0.00637	0.0021	L	0.35249	1.045	0.09310	N	1	P	0.41393	0.748	B	0.40982	0.345	T	0.19844	-1.0293	9	0.02654	T	1	-17.484	4.0967	0.09995	0.0:0.58:0.1977:0.2222	.	1281	Q8IVF2	AHNK2_HUMAN	K	1281	ENSP00000353114:E1281K	ENSP00000353114:E1281K	E	-	1	0	AHNAK2	104488992	0.000000	0.05858	0.008000	0.14137	0.001000	0.01503	0.081000	0.14823	0.236000	0.21180	-0.326000	0.08463	GAG		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		103	84	0	0	0	0.00361	0	103	84				
OR4M2	390538	broad.mit.edu	37	15	22368926	22368926	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:22368926G>A	ENST00000332663.2	+	1	449	c.351G>A	c.(349-351)gtG>gtA	p.V117V	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGCTCACAGTGATGGCCTTTG	0.488																																							uc010tzu.1		NA																	0				ovary(1)	1						c.(349-351)GTG>GTA		olfactory receptor, family 4, subfamily M,							296.0	245.0	262.0					15																	22368926		2203	4300	6503	SO:0001819	synonymous_variant	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22368926G>A	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.351G>A	15.37:g.22368926G>A						LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.V117V	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	351	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	117			Helical; Name=3; (Potential).		B9EH16|Q6IEY2	Silent	SNP	ENST00000332663.2	37	c.351G>A	CCDS32172.1																																																																																				0.488	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			73	501	0	0	0	0.00361	0	73	501				
RPS8P10	388076	broad.mit.edu	37	15	22440594	22440594	+	IGR	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:22440594C>T								RP11-2F9.4 (4417 upstream) : IGHV1OR15-1 (7787 downstream)																							TTATTAGATGCATTGTAGACA	0.473																																							uc001yug.2		NA																	0					NA						c.(253-255)GCA>ACA		full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																																				SO:0001628	intergenic_variant	0							g.chr15:22440594C>T																													15.37:g.22440594C>T							p.A85T							1	272	-									Missense_Mutation	SNP		37	c.253G>A																																																																																				0	0.473									11	55	0	0	0	0.001368	0	11	55				
MEIS2	4212	broad.mit.edu	37	15	37184626	37184626	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:37184626C>T	ENST00000561208.1	-	12	1600	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	MEIS2_ENST00000424352.2_3'UTR|MEIS2_ENST00000338564.5_Silent_p.Q387Q|MEIS2_ENST00000397620.2_3'UTR|MEIS2_ENST00000557796.2_3'UTR|MEIS2_ENST00000382766.2_Silent_p.Q387Q|MEIS2_ENST00000340545.5_3'UTR|MEIS2_ENST00000559085.1_3'UTR|MEIS2_ENST00000559408.1_5'Flank|MEIS2_ENST00000397624.3_3'UTR|MEIS2_ENST00000444725.1_3'UTR|MEIS2_ENST00000219869.9_3'UTR			O14770	MEIS2_HUMAN	Meis homeobox 2	394	Transcriptional activation domain.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TAGGACCACCCTGAGAAACGT	0.458																																							uc001zjr.2		NA																	0				ovary(2)	2						c.(1180-1182)CAG>CAA		Meis homeobox 2 isoform c							187.0	188.0	188.0					15																	37184626		2201	4297	6498	SO:0001819	synonymous_variant	4212				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr15:37184626C>T	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.1182G>A	15.37:g.37184626C>T						MEIS2_uc001zjl.2_3'UTR|MEIS2_uc010ucj.1_Silent_p.Q374Q|MEIS2_uc001zjm.2_3'UTR|MEIS2_uc001zjn.2_3'UTR|MEIS2_uc001zjo.2_3'UTR|MEIS2_uc001zjp.2_3'UTR|MEIS2_uc001zjs.2_Silent_p.Q387Q|MEIS2_uc001zju.2_3'UTR|MEIS2_uc001zjt.2_Silent_p.Q387Q|MEIS2_uc001zjj.2_Silent_p.Q90Q|MEIS2_uc001zjk.2_Silent_p.Q83Q	p.Q394Q	NM_170675	NP_733775	O14770	MEIS2_HUMAN		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)	12	2219	-		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)	394					A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Silent	SNP	ENST00000561208.1	37	c.1182G>A	CCDS10044.1																																																																																				0.458	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		121	107	0	0	0	0.00361	0	121	107				
MEIS2	4212	broad.mit.edu	37	15	37376025	37376025	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:37376025C>A	ENST00000561208.1	-	7	1119	c.701G>T	c.(700-702)gGg>gTg	p.G234V	MEIS2_ENST00000424352.2_Missense_Mutation_p.G234V|MEIS2_ENST00000338564.5_Missense_Mutation_p.G234V|MEIS2_ENST00000397620.2_Missense_Mutation_p.G146V|MEIS2_ENST00000559561.1_Missense_Mutation_p.G234V|MEIS2_ENST00000557796.2_Missense_Mutation_p.G221V|MEIS2_ENST00000382766.2_Missense_Mutation_p.G234V|MEIS2_ENST00000340545.5_Missense_Mutation_p.G221V|MEIS2_ENST00000559085.1_Missense_Mutation_p.G221V|MEIS2_ENST00000397624.3_Missense_Mutation_p.G146V|MEIS2_ENST00000444725.1_Missense_Mutation_p.G234V|MEIS2_ENST00000219869.9_Missense_Mutation_p.G88V			O14770	MEIS2_HUMAN	Meis homeobox 2	234	Ser/Thr-rich.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		ACTGGAGGGCCCTGGGGTGCC	0.512																																							uc001zjr.2		NA																	0				ovary(2)	2						c.(700-702)GGG>GTG		Meis homeobox 2 isoform c							95.0	91.0	92.0					15																	37376025		2201	4297	6498	SO:0001583	missense	4212				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr15:37376025C>A	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.701G>T	15.37:g.37376025C>A	ENSP00000453793:p.Gly234Val					MEIS2_uc001zjl.2_Missense_Mutation_p.G221V|MEIS2_uc010ucj.1_Missense_Mutation_p.G221V|MEIS2_uc001zjm.2_Missense_Mutation_p.G146V|MEIS2_uc001zjn.2_Missense_Mutation_p.G88V|MEIS2_uc001zjo.2_Missense_Mutation_p.G234V|MEIS2_uc001zjp.2_Missense_Mutation_p.G234V|MEIS2_uc001zjs.2_Missense_Mutation_p.G234V|MEIS2_uc001zju.2_Missense_Mutation_p.G221V|MEIS2_uc001zjt.2_Missense_Mutation_p.G234V	p.G234V	NM_170675	NP_733775	O14770	MEIS2_HUMAN		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)	7	1738	-		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)	234			Ser/Thr-rich.		A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	c.701G>T	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683043	0.88542	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624;ENST00000397620;ENST00000219869	T;D;D;D;D;D;D;D	0.88975	1.9;-2.22;-2.22;-2.13;-2.19;-2.2;-2.2;-2.45	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.94653	0.8276	M	0.74881	2.28	0.80722	D	1	P;D;D;P;D;P;D;P	0.89917	0.918;1.0;0.992;0.943;0.965;0.599;0.982;0.843	P;D;P;P;P;B;P;P	0.77557	0.558;0.99;0.854;0.891;0.726;0.356;0.839;0.613	D	0.93772	0.7076	10	0.59425	D	0.04	0.0052	20.8598	0.99761	0.0:1.0:0.0:0.0	.	221;234;234;234;234;88;146;221	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KP81;B3KPQ6;B3KP98	.;.;MEIS2_HUMAN;.;.;.;.;.	V	234;234;234;234;234;221;221;146;88	ENSP00000326296:G234V;ENSP00000341400:G234V;ENSP00000372216:G234V;ENSP00000404185:G234V;ENSP00000391887:G234V;ENSP00000339549:G221V;ENSP00000380745:G146V;ENSP00000219869:G88V	ENSP00000219869:G88V	G	-	2	0	MEIS2	35163317	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GGG		0.512	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		36	46	1	0	1.15505e-17	0.009718	1.46448e-17	36	46				
SPG11	80208	broad.mit.edu	37	15	44955723	44955723	+	Silent	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:44955723G>C	ENST00000261866.7	-	1	139	c.123C>G	c.(121-123)ctC>ctG	p.L41L	SPG11_ENST00000427534.2_Silent_p.L41L|SPG11_ENST00000535302.2_Silent_p.L41L|SPG11_ENST00000558319.1_Silent_p.L41L|SPG11_ENST00000559193.1_Silent_p.L41L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	41					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CCCGGGAGCCGAGCTGCCCCA	0.726																																							uc001ztx.2		NA																	0				ovary(4)|skin(1)	5						c.(121-123)CTC>CTG		spatacsin isoform 1							5.0	6.0	6.0					15																	44955723		1978	3925	5903	SO:0001819	synonymous_variant	80208				cell death	cytosol|integral to membrane|nucleus	protein binding	g.chr15:44955723G>C		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.123C>G	15.37:g.44955723G>C						SPG11_uc010ueh.1_Silent_p.L41L|SPG11_uc010uei.1_Silent_p.L41L|SPG11_uc001zua.1_Silent_p.L41L	p.L41L	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)	1	154	-		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)	41			Extracellular (Potential).		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	ENST00000261866.7	37	c.123C>G	CCDS10112.1																																																																																				0.726	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1			5	11	0	0	0	0.000602	0	5	11				
SLC24A5	283652	broad.mit.edu	37	15	48413264	48413264	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:48413264C>T	ENST00000341459.3	+	1	96	c.23C>T	c.(22-24)aCa>aTa	p.T8I	SLC24A5_ENST00000449382.2_Missense_Mutation_p.T8I|SLC24A5_ENST00000482911.2_Missense_Mutation_p.T8I	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	8					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		GGGGGCCAAACATGGGCGAGA	0.572																																							uc001zwe.2		NA																	0					0						c.(22-24)ACA>ATA		solute carrier family 24, member 5 precursor							74.0	61.0	65.0					15																	48413264		2198	4297	6495	SO:0001583	missense	283652				response to stimulus	integral to membrane|melanosome|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr15:48413264C>T	AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.23C>T	15.37:g.48413264C>T	ENSP00000341550:p.Thr8Ile					SLC24A5_uc001zwd.2_Missense_Mutation_p.T8I|SLC24A5_uc010bel.2_Missense_Mutation_p.T8I	p.T8I	NM_205850	NP_995322	Q71RS6	NCKX5_HUMAN		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)	1	96	+		all_lung(180;0.00217)	8					A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Missense_Mutation	SNP	ENST00000341459.3	37	c.23C>T	CCDS10128.1	.	.	.	.	.	.	.	.	.	.	C	4.485	0.089884	0.08632	.	.	ENSG00000188467	ENST00000341459;ENST00000449382	T;T	0.74842	-0.87;-0.88	5.53	0.282	0.15692	.	1.071300	0.07208	N	0.858690	T	0.50326	0.1609	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.0;0.001;0.003	B;B;B	0.06405	0.0;0.0;0.002	T	0.25047	-1.0143	10	0.21014	T	0.42	.	0.3616	0.00365	0.2323:0.2423:0.2858:0.2396	.	8;8;8	A5X8Z9;Q71RS6;A5X8Z8	.;NCKX5_HUMAN;.	I	8	ENSP00000341550:T8I;ENSP00000389966:T8I	ENSP00000341550:T8I	T	+	2	0	SLC24A5	46200556	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	-0.419000	0.07071	-0.087000	0.12528	-0.274000	0.10170	ACA		0.572	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254340.2	NM_205850		4	16	0	0	0	0.009096	0	4	16				
USP8	9101	broad.mit.edu	37	15	50773724	50773724	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:50773724G>C	ENST00000396444.3	+	11	1603	c.1265G>C	c.(1264-1266)aGa>aCa	p.R422T	USP8_ENST00000433963.1_Missense_Mutation_p.R422T|USP8_ENST00000307179.4_Missense_Mutation_p.R422T|USP8_ENST00000425032.3_Missense_Mutation_p.R345T	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	422					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GAAGAGCATAGAATAAAATCT	0.378																																							uc001zym.3		NA																	0				lung(1)|central_nervous_system(1)	2						c.(1264-1266)AGA>ACA		ubiquitin specific peptidase 8							58.0	57.0	57.0					15																	50773724		2196	4294	6490	SO:0001583	missense	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50773724G>C	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.1265G>C	15.37:g.50773724G>C	ENSP00000379721:p.Arg422Thr					USP8_uc001zyk.1_Missense_Mutation_p.R123T|USP8_uc001zyl.3_Missense_Mutation_p.R422T|USP8_uc001zyn.3_Missense_Mutation_p.R422T|USP8_uc010ufh.1_Missense_Mutation_p.R345T|USP8_uc010bev.1_Missense_Mutation_p.R51T	p.R422T	NM_001128611	NP_001122083	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	12	1765	+			422					B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	37	c.1265G>C	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	G	2.724	-0.265877	0.05754	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.19	0.988	0.19796	.	0.674929	0.14387	N	0.322756	T	0.25938	0.0632	N	0.12182	0.205	0.09310	N	0.999992	B;B;B	0.26935	0.008;0.008;0.164	B;B;B	0.25405	0.01;0.01;0.06	T	0.17592	-1.0364	10	0.12103	T	0.63	-8.99	4.7256	0.12939	0.3561:0.0:0.4992:0.1447	.	345;422;422	B4DKA8;P40818;A8K8N5	.;UBP8_HUMAN;.	T	422;422;422;345	ENSP00000379721:R422T;ENSP00000405537:R422T;ENSP00000302239:R422T;ENSP00000412682:R345T	ENSP00000302239:R422T	R	+	2	0	USP8	48561016	0.035000	0.19736	0.785000	0.31869	0.540000	0.34992	0.092000	0.15066	0.572000	0.29383	0.557000	0.71058	AGA		0.378	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		9	26	0	0	0	0.004482	0	9	26				
WDR72	256764	broad.mit.edu	37	15	53992079	53992079	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:53992079C>T	ENST00000396328.1	-	13	1872	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K	WDR72_ENST00000360509.5_Missense_Mutation_p.E545K|WDR72_ENST00000557913.1_Missense_Mutation_p.E542K|WDR72_ENST00000559418.1_Missense_Mutation_p.E555K	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	545										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		CTCTTTCCCTCAAGGTGAAGG	0.453																																							uc002acj.2		NA																	0				lung(1)|skin(1)	2						c.(1633-1635)GAG>AAG		WD repeat domain 72							118.0	123.0	121.0					15																	53992079		2194	4293	6487	SO:0001583	missense	256764							g.chr15:53992079C>T	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.1633G>A	15.37:g.53992079C>T	ENSP00000379619:p.Glu545Lys					WDR72_uc010bfi.1_Missense_Mutation_p.E545K	p.E545K	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN		all cancers(107;0.0511)	13	1675	-			545			WD 7.		Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	c.1633G>A	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191807	0.58017	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.01279	5.06;5.06	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.138534	0.50627	D	0.000116	T	0.01558	0.0050	N	0.25144	0.715	0.34171	D	0.66976	P	0.48407	0.91	B	0.42462	0.388	T	0.68108	-0.5496	10	0.23302	T	0.38	.	14.1101	0.65115	0.0:0.7535:0.2464:0.0	.	545	Q3MJ13	WDR72_HUMAN	K	545	ENSP00000379619:E545K;ENSP00000353699:E545K	ENSP00000353699:E545K	E	-	1	0	WDR72	51779371	0.994000	0.37717	0.937000	0.37676	0.918000	0.54935	2.068000	0.41471	2.865000	0.98341	0.655000	0.94253	GAG		0.453	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758		77	64	0	0	0	0.00361	0	77	64				
HOMER2	9455	broad.mit.edu	37	15	83561536	83561536	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr15:83561536C>T	ENST00000304231.8	-	2	255	c.63G>A	c.(61-63)aaG>aaA	p.K21K	HOMER2_ENST00000450735.2_Silent_p.K21K|HOMER2_ENST00000426485.1_Silent_p.K21K|HOMER2_ENST00000399166.2_Silent_p.K21K	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	21	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				cervix(1)|endometrium(2)|lung(6)	9						TCCAGTTCTTCTTGGTGTTGG	0.522																																							uc002bjg.2		NA																	0					0						c.(61-63)AAG>AAA		homer 2 isoform 2							160.0	159.0	159.0					15																	83561536		2007	4159	6166	SO:0001819	synonymous_variant	9455				metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane		g.chr15:83561536C>T	AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.63G>A	15.37:g.83561536C>T						HOMER2_uc002bjh.2_Silent_p.K21K|HOMER2_uc002bjj.2_Silent_p.K21K|HOMER2_uc002bji.2_Silent_p.K21K	p.K21K	NM_199330	NP_955362	Q9NSB8	HOME2_HUMAN			2	249	-			21			WH1.		O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Silent	SNP	ENST00000304231.8	37	c.63G>A	CCDS45334.1																																																																																				0.522	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1			18	113	0	0	0	0.00499	0	18	113				
CASKIN1	57524	broad.mit.edu	37	16	2233834	2233834	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:2233834C>T	ENST00000343516.6	-	15	1617	c.1525G>A	c.(1525-1527)Gag>Aag	p.E509K	CASKIN1_ENST00000564289.1_Intron	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	509	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						AAGCTCACCTCGGGAGTCATG	0.667																																							uc010bsg.1		NA																	0				skin(2)	2						c.(1525-1527)GAG>AAG		CASK interacting protein 1							38.0	47.0	44.0					16																	2233834		2173	4275	6448	SO:0001583	missense	57524				signal transduction	cytoplasm		g.chr16:2233834C>T	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.1525G>A	16.37:g.2233834C>T	ENSP00000345436:p.Glu509Lys						p.E509K	NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN			15	1557	-			509			SAM 1.		Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	37	c.1525G>A	CCDS42103.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.758116	0.69648	.	.	ENSG00000167971	ENST00000343516;ENST00000382453	T	0.54675	0.56	4.03	4.03	0.46877	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	.	.	.	.	T	0.75287	0.3829	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.81241	-0.1022	9	0.72032	D	0.01	-24.2432	15.6736	0.77297	0.0:1.0:0.0:0.0	.	509	Q8WXD9	CSKI1_HUMAN	K	509;338	ENSP00000345436:E509K	ENSP00000345436:E509K	E	-	1	0	CASKIN1	2173835	1.000000	0.71417	0.999000	0.59377	0.138000	0.21146	7.441000	0.80485	2.236000	0.73375	0.313000	0.20887	GAG		0.667	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764		12	54	0	0	0	0.010729	0	12	54				
SLX4	84464	broad.mit.edu	37	16	3634838	3634838	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:3634838T>G	ENST00000294008.3	-	13	5311	c.4671A>C	c.(4669-4671)aaA>aaC	p.K1557N	RP11-461A8.1_ENST00000573982.1_lincRNA	NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1557	Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						TTATGGGCACTTTGGGGGGCA	0.502								Direct reversal of damage																															uc002cvp.2		NA																	0					0						c.(4669-4671)AAA>AAC	Direct_reversal_of_damage|Homologous_recombination	BTB (POZ) domain containing 12							170.0	163.0	165.0					16																	3634838		2197	4300	6497	SO:0001583	missense	84464	FanconAnemia			DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding	g.chr16:3634838T>G	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.4671A>C	16.37:g.3634838T>G	ENSP00000294008:p.Lys1557Asn						p.K1557N	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN			13	5298	-			1557			Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.		Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	c.4671A>C	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710298	0.68730	.	.	ENSG00000188827	ENST00000294008	T	0.01252	5.1	5.47	5.47	0.80525	.	0.198487	0.43579	D	0.000542	T	0.05914	0.0154	M	0.72894	2.215	0.29157	N	0.87803	D	0.71674	0.998	D	0.74348	0.983	T	0.11036	-1.0604	10	0.54805	T	0.06	.	6.1427	0.20269	0.0:0.0826:0.1641:0.7533	.	1557	Q8IY92	SLX4_HUMAN	N	1557	ENSP00000294008:K1557N	ENSP00000294008:K1557N	K	-	3	2	SLX4	3574839	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	1.584000	0.36589	2.199000	0.70637	0.533000	0.62120	AAA		0.502	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444		101	82	0	0	0	0.00361	0	101	82				
TEKT5	146279	broad.mit.edu	37	16	10769983	10769983	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:10769983G>C	ENST00000283025.2	-	5	990	c.919C>G	c.(919-921)Cag>Gag	p.Q307E		NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	307						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						CGCATGTTCTGAGAGTGTTTG	0.552																																							uc002czz.1		NA																	0				ovary(2)	2						c.(919-921)CAG>GAG		tektin 5							129.0	109.0	116.0					16																	10769983		2197	4300	6497	SO:0001583	missense	146279				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule		g.chr16:10769983G>C		CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.919C>G	16.37:g.10769983G>C	ENSP00000283025:p.Gln307Glu						p.Q307E	NM_144674	NP_653275	Q96M29	TEKT5_HUMAN			5	991	-			307			Potential.		A1L3Z3	Missense_Mutation	SNP	ENST00000283025.2	37	c.919C>G	CCDS10542.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496641	0.64186	.	.	ENSG00000153060	ENST00000283025	T	0.02032	4.49	5.01	5.01	0.66863	.	0.000000	0.53938	D	0.000051	T	0.02888	0.0086	L	0.31804	0.96	0.80722	D	1	B	0.28880	0.226	B	0.31101	0.124	T	0.60692	-0.7213	10	0.33940	T	0.23	-41.5565	17.2338	0.86992	0.0:0.0:1.0:0.0	.	307	Q96M29	TEKT5_HUMAN	E	307	ENSP00000283025:Q307E	ENSP00000283025:Q307E	Q	-	1	0	TEKT5	10677484	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	8.995000	0.93534	2.488000	0.83962	0.563000	0.77884	CAG		0.552	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674		11	46	0	0	0	0.001855	0	11	46				
ACSM2B	348158	broad.mit.edu	37	16	20576009	20576009	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:20576009G>T	ENST00000329697.6	-	2	327	c.159C>A	c.(157-159)caC>caA	p.H53Q	ACSM2B_ENST00000565322.1_Intron|ACSM2B_ENST00000565232.1_Missense_Mutation_p.H53Q|ACSM2B_ENST00000567001.1_Missense_Mutation_p.H53Q|ACSM2B_ENST00000414188.2_Missense_Mutation_p.H53Q	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	53					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						TGTCAGCCCAGTGATCCAACA	0.438																																							uc002dhj.3		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(157-159)CAC>CAA		acyl-CoA synthetase medium-chain family member							71.0	66.0	68.0					16																	20576009		2201	4300	6501	SO:0001583	missense	348158				fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding	g.chr16:20576009G>T	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.159C>A	16.37:g.20576009G>T	ENSP00000327453:p.His53Gln					ACSM2B_uc002dhk.3_Missense_Mutation_p.H53Q|ACSM2B_uc010bwf.1_Missense_Mutation_p.H53Q	p.H53Q	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN			3	369	-			53					Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	37	c.159C>A	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.343952	0.01277	.	.	ENSG00000066813	ENST00000329697;ENST00000414188	T;T	0.47869	0.83;0.83	3.27	2.26	0.28386	.	0.461691	0.18329	N	0.144557	T	0.22282	0.0537	N	0.11427	0.14	0.27643	N	0.94765	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.19811	-1.0294	10	0.12103	T	0.63	-5.896	6.3931	0.21597	0.0:0.382:0.423:0.195	.	53;53	A8K051;Q68CK6	.;ACS2B_HUMAN	Q	53	ENSP00000327453:H53Q;ENSP00000390378:H53Q	ENSP00000327453:H53Q	H	-	3	2	ACSM2B	20483510	0.991000	0.36638	0.993000	0.49108	0.897000	0.52465	0.073000	0.14640	0.529000	0.28599	0.505000	0.49811	CAC		0.438	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617		18	9	1	0	2.39556e-15	0.00278	2.98901e-15	18	9				
PLK1	5347	broad.mit.edu	37	16	23690396	23690396	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:23690396G>A	ENST00000300093.4	+	1	254	c.143G>A	c.(142-144)cGc>cAc	p.R48H	PLK1_ENST00000564202.1_3'UTR	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	48					activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		GTGGACCCACGCAGCCGGCGG	0.697																																					Colon(12;240 564 27038 33155)	Colon(12;240 564 27038 33155)	uc002dlz.1		NA																	0				lung(1)|skin(1)	2						c.(142-144)CGC>CAC		polo-like kinase 1							13.0	16.0	15.0					16																	23690396		2192	4296	6488	SO:0001583	missense	5347				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G2/M transition DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic prophase|negative regulation of cyclin-dependent protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|protein localization to chromatin|protein ubiquitination|regulation of mitotic anaphase|regulation of protein binding	centrosome|condensed nuclear chromosome outer kinetochore|cytosol|nucleoplasm|spindle microtubule|spindle midzone|spindle pole	anaphase-promoting complex binding|ATP binding|polo kinase kinase activity|protein kinase binding	g.chr16:23690396G>A		CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.143G>A	16.37:g.23690396G>A	ENSP00000300093:p.Arg48His						p.R48H	NM_005030	NP_005021	P53350	PLK1_HUMAN		GBM - Glioblastoma multiforme(48;0.0156)	1	196	+			48					Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	c.143G>A	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559266	0.65538	.	.	ENSG00000166851	ENST00000300093;ENST00000330792	D	0.87412	-2.25	4.28	3.3	0.37823	Protein kinase-like domain (1);	0.050852	0.85682	D	0.000000	T	0.79924	0.4530	L	0.32530	0.975	0.80722	D	1	B	0.18013	0.025	B	0.12837	0.008	T	0.75031	-0.3461	10	0.41790	T	0.15	-19.1358	12.0046	0.53251	0.0:0.1763:0.8237:0.0	.	48	P53350	PLK1_HUMAN	H	48	ENSP00000300093:R48H	ENSP00000300093:R48H	R	+	2	0	PLK1	23597897	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.451000	0.90343	1.118000	0.41863	0.561000	0.74099	CGC		0.697	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030		11	11	0	0	0	0.001368	0	11	11				
GTF3C1	2975	broad.mit.edu	37	16	27506568	27506568	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:27506568T>C	ENST00000356183.4	-	15	2611	c.2596A>G	c.(2596-2598)Acc>Gcc	p.T866A	GTF3C1_ENST00000561623.1_Missense_Mutation_p.T866A	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	866					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCCTCCCAGGTGACACCATCT	0.642																																							uc002dov.1		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(2596-2598)ACC>GCC		general transcription factor IIIC, polypeptide							36.0	38.0	37.0					16																	27506568		2196	4298	6494	SO:0001583	missense	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27506568T>C	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.2596A>G	16.37:g.27506568T>C	ENSP00000348510:p.Thr866Ala					GTF3C1_uc002dou.2_Missense_Mutation_p.T866A	p.T866A	NM_001520	NP_001511	Q12789	TF3C1_HUMAN			15	2636	-			866					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	c.2596A>G	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	9.818	1.184938	0.21870	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.20881	2.04	4.93	-8.75	0.00834	.	1.449120	0.04070	N	0.307949	T	0.08492	0.0211	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.30822	-0.9965	10	0.08179	T	0.78	-14.4203	1.2503	0.01980	0.2659:0.2969:0.2596:0.1776	.	866;866	Q12789;Q12789-3	TF3C1_HUMAN;.	A	866;864	ENSP00000348510:T866A	ENSP00000348510:T866A	T	-	1	0	GTF3C1	27414069	0.000000	0.05858	0.000000	0.03702	0.319000	0.28217	-0.564000	0.05936	-1.802000	0.01244	0.460000	0.39030	ACC		0.642	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		35	48	0	0	0	0.003271	0	35	48				
SH2B1	25970	broad.mit.edu	37	16	28878713	28878713	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:28878713C>A	ENST00000322610.8	+	5	1440	c.1001C>A	c.(1000-1002)gCc>gAc	p.A334D	SH2B1_ENST00000545570.1_Missense_Mutation_p.A24D|SH2B1_ENST00000395532.4_Missense_Mutation_p.A334D|SH2B1_ENST00000337120.5_Missense_Mutation_p.A334D|SH2B1_ENST00000538342.1_5'UTR|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000359285.5_Missense_Mutation_p.A334D			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	334	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.|PH.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						ACAACCACAGCCCTGGAGATG	0.552																																							uc002dri.2		NA																	0				ovary(2)	2						c.(1000-1002)GCC>GAC		SH2B adaptor protein 1 isoform 1							192.0	194.0	193.0					16																	28878713		2197	4300	6497	SO:0001583	missense	25970				blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity	g.chr16:28878713C>A	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1001C>A	16.37:g.28878713C>A	ENSP00000321221:p.Ala334Asp					uc010vct.1_Intron|SH2B1_uc010vdc.1_Missense_Mutation_p.A24D|SH2B1_uc002drj.2_Missense_Mutation_p.A334D|SH2B1_uc002drk.2_Missense_Mutation_p.A334D|SH2B1_uc002drl.2_Missense_Mutation_p.A334D|SH2B1_uc010vdd.1_5'UTR|SH2B1_uc010vde.1_Missense_Mutation_p.A334D|SH2B1_uc002drm.2_Missense_Mutation_p.A334D	p.A334D	NM_001145795	NP_001139267	Q9NRF2	SH2B1_HUMAN			5	1440	+			334			Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation) (By similarity).|PH.		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	c.1001C>A	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.895989	0.91962	.	.	ENSG00000178188	ENST00000322610;ENST00000545570;ENST00000359285;ENST00000395532;ENST00000337120	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	4.35	4.35	0.52113	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.166402	0.37761	N	0.001944	T	0.81880	0.4916	L	0.46157	1.445	0.58432	D	0.999999	D;D;D;D	0.69078	0.997;0.978;0.978;0.993	D;P;P;D	0.78314	0.991;0.792;0.792;0.912	T	0.83344	-0.0006	10	0.54805	T	0.06	-28.5647	16.0061	0.80363	0.0:1.0:0.0:0.0	.	24;334;334;334	F5GXU7;Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;.;SH2B1_HUMAN	D	334;24;334;334;334	ENSP00000321221:A334D;ENSP00000440354:A24D;ENSP00000352232:A334D;ENSP00000378903:A334D;ENSP00000337163:A334D	ENSP00000321221:A334D	A	+	2	0	SH2B1	28786214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.723000	0.54955	2.127000	0.65507	0.563000	0.77884	GCC		0.552	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		116	146	1	0	1.19196e-58	0.00361	1.61976e-58	116	146				
SALL1	6299	broad.mit.edu	37	16	51174068	51174068	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:51174068A>G	ENST00000251020.4	-	2	2098	c.2065T>C	c.(2065-2067)Tcc>Ccc	p.S689P	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.S592P	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	689					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGAAGCTTGGACGTCTCTGAT	0.542																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	0				skin(5)|ovary(3)	8						c.(2065-2067)TCC>CCC		sal-like 1 isoform a							88.0	91.0	90.0					16																	51174068		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174068A>G	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2065T>C	16.37:g.51174068A>G	ENSP00000251020:p.Ser689Pro					SALL1_uc010vgr.1_Missense_Mutation_p.S592P|SALL1_uc010cbv.2_Intron	p.S689P	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	2096	-		all_cancers(37;0.0322)	689					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.2065T>C	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.467138	0.63625	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.09255	3.02;3.0	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.25195	0.0612	L	0.57536	1.79	0.80722	D	1	D	0.69078	0.997	P	0.59221	0.854	T	0.01087	-1.1456	10	0.87932	D	0	.	14.4824	0.67592	1.0:0.0:0.0:0.0	.	689	Q9NSC2	SALL1_HUMAN	P	689;592;653	ENSP00000251020:S689P;ENSP00000407914:S592P	ENSP00000251020:S689P	S	-	1	0	SALL1	49731569	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	9.139000	0.94554	2.001000	0.58596	0.451000	0.29950	TCC		0.542	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		40	112	0	0	0	0.007835	0	40	112				
POLR2C	5432	broad.mit.edu	37	16	57503178	57503178	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:57503178C>T	ENST00000219252.5	+	5	698	c.360C>T	c.(358-360)ctC>ctT	p.L120L	POLR2C_ENST00000564651.1_3'UTR	NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	120					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.L120L(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						CTCGAGACCTCATCTCCAACA	0.582																																							uc002elt.1		NA																	1	Substitution - coding silent(1)		upper_aerodigestive_tract(1)		0						c.(358-360)CTC>CTT		DNA directed RNA polymerase II polypeptide C							113.0	95.0	101.0					16																	57503178		2198	4300	6498	SO:0001819	synonymous_variant	5432				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity	g.chr16:57503178C>T		CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	ENST00000219252.5:c.360C>T	16.37:g.57503178C>T						POLR2C_uc010vhq.1_Silent_p.L120L	p.L120L	NM_032940	NP_116558	P19387	RPB3_HUMAN			5	446	+			120					O15161	Silent	SNP	ENST00000219252.5	37	c.360C>T	CCDS10782.1																																																																																				0.582	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257340.3	NM_032940		9	95	0	0	0	0.004482	0	9	95				
POLR2C	5432	broad.mit.edu	37	16	57503195	57503195	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:57503195G>A	ENST00000219252.5	+	5	715	c.377G>A	c.(376-378)cGg>cAg	p.R126Q	POLR2C_ENST00000564651.1_3'UTR	NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	126					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						AACAGCCCCCGGGTCATTCCG	0.577																																							uc002elt.1		NA																	0					0						c.(376-378)CGG>CAG		DNA directed RNA polymerase II polypeptide C							87.0	76.0	80.0					16																	57503195		2198	4300	6498	SO:0001583	missense	5432				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity	g.chr16:57503195G>A		CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	ENST00000219252.5:c.377G>A	16.37:g.57503195G>A	ENSP00000219252:p.Arg126Gln					POLR2C_uc010vhq.1_Missense_Mutation_p.R126Q	p.R126Q	NM_032940	NP_116558	P19387	RPB3_HUMAN			5	463	+			126					O15161	Missense_Mutation	SNP	ENST00000219252.5	37	c.377G>A	CCDS10782.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532578	0.85812	.	.	ENSG00000102978	ENST00000219252	.	.	.	5.77	5.77	0.91146	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, insert domain (3);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.109243	0.64402	D	0.000007	T	0.67211	0.2869	L	0.61036	1.89	0.80722	D	1	D;B	0.56968	0.978;0.157	P;B	0.54100	0.742;0.056	T	0.63571	-0.6607	9	0.31617	T	0.26	.	17.2149	0.86940	0.0:0.0:1.0:0.0	.	126;126	B7Z377;P19387	.;RPB3_HUMAN	Q	126	.	ENSP00000219252:R126Q	R	+	2	0	POLR2C	56060696	1.000000	0.71417	0.986000	0.45419	0.351000	0.29236	9.792000	0.99085	2.732000	0.93576	0.650000	0.86243	CGG		0.577	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257340.3	NM_032940		28	65	0	0	0	0.004656	0	28	65				
GPR97	222487	broad.mit.edu	37	16	57719568	57719568	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:57719568G>A	ENST00000333493.4	+	11	1431	c.1270G>A	c.(1270-1272)Gaa>Aaa	p.E424K	GPR97_ENST00000450388.3_Missense_Mutation_p.E304K|GPR97_ENST00000327655.6_Missense_Mutation_p.E214K|RP11-405F3.4_ENST00000563062.1_RNA	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	424					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTGGTTCCGTGAAGGGACAAC	0.582																																							uc002emh.2		NA																	0				ovary(1)	1						c.(1270-1272)GAA>AAA		G protein-coupled receptor 97 precursor							158.0	143.0	148.0					16																	57719568		2198	4300	6498	SO:0001583	missense	222487				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr16:57719568G>A	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1270G>A	16.37:g.57719568G>A	ENSP00000332900:p.Glu424Lys					GPR97_uc010vhv.1_Missense_Mutation_p.E304K|GPR97_uc010cdd.2_RNA|GPR97_uc010cde.2_Missense_Mutation_p.E32K	p.E424K	NM_170776	NP_740746	Q86Y34	GPR97_HUMAN			11	1373	+			424			Extracellular (Potential).		Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	ENST00000333493.4	37	c.1270G>A	CCDS10786.1	.	.	.	.	.	.	.	.	.	.	G	0.551	-0.849619	0.02651	.	.	ENSG00000182885	ENST00000333493;ENST00000327655;ENST00000450388	T;T;T	0.43294	0.95;1.37;0.95	5.35	0.255	0.15561	GPCR, family 2-like (1);	1.737730	0.02758	N	0.118233	T	0.25419	0.0618	N	0.16656	0.425	0.09310	N	1	B	0.13145	0.007	B	0.12837	0.008	T	0.10730	-1.0617	10	0.20046	T	0.44	.	3.7728	0.08649	0.4684:0.0:0.3631:0.1685	.	424	Q86Y34	GPR97_HUMAN	K	424;214;304	ENSP00000332900:E424K;ENSP00000331199:E214K;ENSP00000404803:E304K	ENSP00000331199:E214K	E	+	1	0	GPR97	56277069	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.160000	0.16462	0.241000	0.21283	-0.182000	0.12963	GAA		0.582	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776		20	119	0	0	0	0.00278	0	20	119				
PDPR	55066	broad.mit.edu	37	16	70190514	70190514	+	Missense_Mutation	SNP	G	G	T	rs117263218	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:70190514G>T	ENST00000288050.4	+	19	3329	c.2372G>T	c.(2371-2373)cGg>cTg	p.R791L	PDPR_ENST00000567046.1_Missense_Mutation_p.R149L|PDPR_ENST00000562100.1_3'UTR|RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000398122.3_Missense_Mutation_p.R691L|PDPR_ENST00000568530.1_Missense_Mutation_p.R791L|PDPR_ENST00000542659.1_Missense_Mutation_p.R136L|RP11-296I10.3_ENST00000502126.1_RNA	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	791					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCCATTTACCGGAATGGGCAG	0.532																																							uc002eyf.1		NA																	0				breast(1)	1						c.(2371-2373)CGG>CTG		pyruvate dehydrogenase phosphatase regulatory							227.0	250.0	242.0					16																	70190514		2082	4223	6305	SO:0001583	missense	55066				glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity	g.chr16:70190514G>T		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2372G>T	16.37:g.70190514G>T	ENSP00000288050:p.Arg791Leu					CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.R691L|PDPR_uc002eyg.1_Missense_Mutation_p.R458L|PDPR_uc002eyh.2_Missense_Mutation_p.R136L|PDPR_uc010vls.1_Missense_Mutation_p.R136L	p.R791L	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.124)	19	3329	+			791					A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	c.2372G>T	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	G	36	5.769268	0.96914	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055;ENST00000542659	T;T;T	0.77229	-1.08;-1.08;-1.08	6.03	6.03	0.97812	Glycine cleavage T-protein, C-terminal barrel (1);	0.115046	0.64402	D	0.000012	D	0.85915	0.5808	L	0.61218	1.895	0.80722	D	1	D;D	0.62365	0.991;0.969	P;P	0.61477	0.889;0.817	D	0.84611	0.0678	10	0.48119	T	0.1	.	19.5634	0.95382	0.0:0.0:1.0:0.0	.	458;791	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	L	791;691;458;136	ENSP00000288050:R791L;ENSP00000381190:R691L;ENSP00000441690:R136L	ENSP00000205055:R458L	R	+	2	0	PDPR	68748015	1.000000	0.71417	0.993000	0.49108	0.953000	0.61014	9.793000	0.99091	2.868000	0.98415	0.557000	0.71058	CGG		0.532	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990		47	151	1	0	7.77372e-23	0.00361	1.00418e-22	47	151				
GAN	8139	broad.mit.edu	37	16	81348805	81348805	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr16:81348805C>G	ENST00000568107.2	+	1	249	c.87C>G	c.(85-87)ttC>ttG	p.F29L	RP11-55K13.1_ENST00000570148.1_RNA	NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	29					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				AGTCTCGCTTCTGCGACGCGC	0.701																																					GBM(106;1239 1507 7582 9741 33976)	GBM(106;1239 1507 7582 9741 33976)	uc002fgo.2		NA																	0				ovary(2)	2						c.(85-87)TTC>TTG		gigaxonin							13.0	13.0	13.0					16																	81348805		2187	4288	6475	SO:0001583	missense	8139				cell death	cytoplasm|neurofilament	protein binding	g.chr16:81348805C>G	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.87C>G	16.37:g.81348805C>G	ENSP00000476795:p.Phe29Leu						p.F29L	NM_022041	NP_071324	Q9H2C0	GAN_HUMAN			1	235	+		Colorectal(91;0.153)	29						Missense_Mutation	SNP	ENST00000568107.2	37	c.87C>G	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	c	11.07	1.530030	0.27387	.	.	ENSG00000127688	ENST00000248272	T	0.65364	-0.15	4.16	4.16	0.48862	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.41558	0.1164	N	0.13352	0.335	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.38824	-0.9643	10	0.02654	T	1	.	16.6564	0.85229	0.0:1.0:0.0:0.0	.	29	Q9H2C0	GAN_HUMAN	L	29	ENSP00000248272:F29L	ENSP00000248272:F29L	F	+	3	2	GAN	79906306	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.821000	0.39041	2.133000	0.65898	0.454000	0.30748	TTC		0.701	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			3	5	0	0	0	0.004672	0	3	5				
OR3A2	4995	broad.mit.edu	37	17	3181738	3181738	+	Missense_Mutation	SNP	G	G	T	rs554078410	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:3181738G>T	ENST00000408891.2	-	1	530	c.492C>A	c.(490-492)aaC>aaA	p.N164K	RP11-64J4.2_ENST00000573491.1_RNA	NM_002551.3	NP_002542.3	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A, member 2	164					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			ovary(1)	1						GGGTCAGTGCGTTGGTGAAGG	0.582																																					GBM(166;478 2018 3875 5042 31983)|Esophageal Squamous(77;407 1232 1405 14297 15272)	GBM(166;478 2018 3875 5042 31983)|Esophageal Squamous(77;407 1232 1405 14297 15272)	uc002fvg.2		NA																	0				ovary(1)	1						c.(490-492)AAC>AAA		olfactory receptor, family 3, subfamily A,							153.0	141.0	145.0					17																	3181738		2203	4300	6503	SO:0001583	missense	4995				sensory perception of smell	integral to plasma membrane	olfactory receptor activity	g.chr17:3181738G>T	U04713	CCDS42233.1	17p13.3	2012-08-09				ENSG00000221882		"""GPCR / Class A : Olfactory receptors"""	8283	protein-coding gene	gene with protein product						8921386, 10673334	Standard	NM_002551		Approved	OLFRA04, OR228, OR17-228	uc002fvg.3	P47893		ENST00000408891.2:c.492C>A	17.37:g.3181738G>T	ENSP00000386180:p.Asn164Lys						p.N164K	NM_002551	NP_002542	P47893	OR3A2_HUMAN			1	531	-			164			Helical; Name=4; (Potential).		Q6IFM3|Q9P1Q3	Missense_Mutation	SNP	ENST00000408891.2	37	c.492C>A	CCDS42233.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.272907	0.23221	.	.	ENSG00000221882	ENST00000408891	T	0.37411	1.2	4.3	1.83	0.25207	GPCR, rhodopsin-like superfamily (1);	0.116296	0.38837	N	0.001558	T	0.59945	0.2231	M	0.89214	3.015	0.25481	N	0.987734	D	0.71674	0.998	D	0.74023	0.982	T	0.52373	-0.8584	10	0.66056	D	0.02	-14.504	8.5381	0.33375	0.8281:0.0:0.1719:0.0	.	164	P47893	OR3A2_HUMAN	K	164	ENSP00000386180:N164K	ENSP00000386180:N164K	N	-	3	2	OR3A2	3128488	0.000000	0.05858	0.997000	0.53966	0.013000	0.08279	-0.904000	0.04080	0.405000	0.25532	-0.471000	0.05019	AAC		0.582	OR3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438370.1			57	63	1	0	2.18419e-29	0.00361	2.87559e-29	57	63				
TP53	7157	broad.mit.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	C	A	rs587782144		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:7578457C>A	ENST00000269305.4	-	5	662	c.473G>T	c.(472-474)cGc>cTc	p.R158L	TP53_ENST00000420246.2_Missense_Mutation_p.R158L|TP53_ENST00000445888.2_Missense_Mutation_p.R158L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R158L|TP53_ENST00000455263.2_Missense_Mutation_p.R158L|TP53_ENST00000359597.4_Missense_Mutation_p.R158L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	158	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R158L(77)|p.R158H(74)|p.R158P(9)|p.R65L(8)|p.0?(8)|p.R26L(8)|p.R158fs(6)|p.R158fs*11(6)|p.R65H(5)|p.R26H(5)|p.R158_A159insX(4)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R26fs(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R65fs*11(1)|p.R156fs*20(1)|p.R158C(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCATGGCGCGGACGCGGGT	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		244	Substitution - Missense(188)|Deletion - Frameshift(19)|Deletion - In frame(13)|Complex(10)|Whole gene deletion(8)|Insertion - In frame(4)|Complex - frameshift(2)	p.R158H(58)|p.R158L(55)|p.R158C(17)|p.R158G(10)|p.R158P(9)|p.0?(7)|p.R158R(6)|p.R158fs*12(5)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R158fs*11(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.R65L(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.R26L(1)|p.V157fs*21(1)|p.R158fs*8(1)	lung(78)|central_nervous_system(33)|oesophagus(20)|haematopoietic_and_lymphoid_tissue(19)|large_intestine(18)|upper_aerodigestive_tract(12)|stomach(12)|urinary_tract(9)|prostate(7)|kidney(6)|liver(6)|breast(5)|bone(4)|soft_tissue(3)|ovary(3)|pancreas(3)|thyroid(2)|biliary_tract(2)|vulva(1)|thymus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM994513	TP53	M		c.(472-474)CGC>CTC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							49.0	51.0	50.0					17																	7578457		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578457C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.473G>T	17.37:g.7578457C>A	ENSP00000269305:p.Arg158Leu	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.R158L|TP53_uc002gih.2_Missense_Mutation_p.R158L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R26L|TP53_uc010cng.1_Missense_Mutation_p.R26L|TP53_uc002gii.1_Missense_Mutation_p.R26L|TP53_uc010cnh.1_Missense_Mutation_p.R158L|TP53_uc010cni.1_Missense_Mutation_p.R158L|TP53_uc002gij.2_Missense_Mutation_p.R158L|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R65L|TP53_uc002gio.2_Missense_Mutation_p.R26L|TP53_uc010vug.1_Missense_Mutation_p.R119L	p.R158L	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	667	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	158		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.473G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.538284	0.65085	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99866	-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110116	0.64402	D	0.000010	D	0.99869	0.9938	M	0.92026	3.265	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.988;0.981;0.996;0.99;0.986;1.0	D	0.96498	0.9369	10	0.87932	D	0	-10.4795	12.6491	0.56751	0.0:0.9196:0.0:0.0804	.	119;158;158;65;158;158;158	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	158;158;158;158;158;158;147;65;26;65;26;158	ENSP00000410739:R158L;ENSP00000352610:R158L;ENSP00000269305:R158L;ENSP00000398846:R158L;ENSP00000391127:R158L;ENSP00000391478:R158L;ENSP00000425104:R26L;ENSP00000423862:R65L;ENSP00000424104:R158L	ENSP00000269305:R158L	R	-	2	0	TP53	7519182	1.000000	0.71417	0.034000	0.17996	0.175000	0.22909	7.775000	0.85489	1.514000	0.48869	-0.140000	0.14226	CGC		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		24	29	1	0	2.89027e-11	0.002299	3.47212e-11	24	29				
MYH8	4626	broad.mit.edu	37	17	10299898	10299898	+	Silent	SNP	C	C	G	rs146773971		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:10299898C>G	ENST00000403437.2	-	32	4594	c.4500G>C	c.(4498-4500)acG>acC	p.T1500T	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1500					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTCTTCTTAGCGTTTCGAGTT	0.478									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	0				skin(6)|ovary(3)|breast(2)	11						c.(4498-4500)ACG>ACC		myosin, heavy chain 8, skeletal muscle,							85.0	87.0	86.0					17																	10299898		2203	4300	6503	SO:0001819	synonymous_variant	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10299898C>G		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4500G>C	17.37:g.10299898C>G						uc002gml.1_Intron	p.T1500T	NM_002472	NP_002463	P13535	MYH8_HUMAN			32	4595	-			1500			Potential.		Q14910	Silent	SNP	ENST00000403437.2	37	c.4500G>C	CCDS11153.1																																																																																				0.478	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		12	16	0	0	0	0.010729	0	12	16				
COX10	1352	broad.mit.edu	37	17	14095532	14095532	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:14095532G>A	ENST00000261643.3	+	6	999	c.922G>A	c.(922-924)Gat>Aat	p.D308N	COX10_ENST00000537334.1_Missense_Mutation_p.D91N|COX10_ENST00000536205.1_Missense_Mutation_p.D116N	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	308					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GGGCAGCCTCGATGCTGGTAA	0.577																																							uc002gof.3		NA																	0					0						c.(922-924)GAT>AAT		heme A:farnesyltransferase precursor							90.0	88.0	89.0					17																	14095532		2203	4300	6503	SO:0001583	missense	1352				heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity	g.chr17:14095532G>A	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.922G>A	17.37:g.14095532G>A	ENSP00000261643:p.Asp308Asn					COX10_uc010vvs.1_Missense_Mutation_p.D91N|COX10_uc010vvt.1_Missense_Mutation_p.D116N	p.D308N	NM_001303	NP_001294	Q12887	COX10_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)	6	1126	+		all_lung(20;0.06)|Lung SC(565;0.168)	308					B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	ENST00000261643.3	37	c.922G>A	CCDS11166.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778053	0.70107	.	.	ENSG00000006695	ENST00000261643;ENST00000536205;ENST00000537334	D;D;D	0.92299	-3.01;-3.01;-3.01	4.7	3.73	0.42828	.	0.222398	0.45867	N	0.000325	D	0.88093	0.6344	M	0.64080	1.96	0.80722	D	1	B;P	0.37141	0.334;0.584	B;B	0.28638	0.085;0.092	D	0.86203	0.1620	10	0.44086	T	0.13	-8.2302	11.3791	0.49746	0.0851:0.0:0.9149:0.0	.	116;308	B4DJ50;Q12887	.;COX10_HUMAN	N	308;116;91	ENSP00000261643:D308N;ENSP00000439494:D116N;ENSP00000443354:D91N	ENSP00000261643:D308N	D	+	1	0	COX10	14036257	1.000000	0.71417	0.826000	0.32828	0.942000	0.58702	5.069000	0.64370	1.120000	0.41904	0.655000	0.94253	GAT		0.577	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303		8	46	0	0	0	0.004482	0	8	46				
TRPV2	51393	broad.mit.edu	37	17	16326824	16326824	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:16326824G>T	ENST00000338560.7	+	5	1066	c.667G>T	c.(667-669)Gat>Tat	p.D223Y	TRPV2_ENST00000577397.1_Intron	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	223	Required for interaction with SLC50A1. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CAAGCAGTGGGATGTGGTAAG	0.612																																							uc002gpy.2		NA																	0				ovary(1)	1						c.(667-669)GAT>TAT		transient receptor potential cation channel,							55.0	51.0	52.0					17																	16326824		2203	4300	6503	SO:0001583	missense	51393				sensory perception	integral to plasma membrane|melanosome	calcium channel activity	g.chr17:16326824G>T	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.667G>T	17.37:g.16326824G>T	ENSP00000342222:p.Asp223Tyr					TRPV2_uc002gpz.2_Intron	p.D223Y	NM_016113	NP_057197	Q9Y5S1	TRPV2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)	5	1034	+			223			Cytoplasmic (Potential).|Required for interaction with SLC50A1 (By similarity).|ANK 4.		A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	c.667G>T	CCDS32576.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.08|19.08	3.757561|3.757561	0.69648|0.69648	.|.	.|.	ENSG00000187688|ENSG00000187688	ENST00000338560|ENST00000455666	T|.	0.66995|.	-0.24|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Ankyrin repeat-containing domain (4);|.	0.311435|.	0.38837|.	N|.	0.001542|.	T|T	0.66752|0.66752	0.2821|0.2821	M|M	0.70903|0.70903	2.155|2.155	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.70716|.	0.97|.	T|T	0.66097|0.66097	-0.6008|-0.6008	10|5	0.87932|.	D|.	0|.	-23.2172|-23.2172	9.5792|9.5792	0.39477|0.39477	0.0711:0.0:0.7862:0.1427|0.0711:0.0:0.7862:0.1427	.|.	223|.	Q9Y5S1|.	TRPV2_HUMAN|.	Y|V	223|180	ENSP00000342222:D223Y|.	ENSP00000342222:D223Y|.	D|G	+|+	1|2	0|0	TRPV2|TRPV2	16267549|16267549	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	2.153000|2.153000	0.42282|0.42282	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|GGA		0.612	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113		28	25	1	0	4.59853e-10	0.005443	5.5002e-10	28	25				
MPRIP	23164	broad.mit.edu	37	17	17078657	17078657	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:17078657G>A	ENST00000341712.4	+	19	2640	c.2640G>A	c.(2638-2640)ctG>ctA	p.L880L	RP11-45M22.3_ENST00000584203.1_RNA|MPRIP_ENST00000444976.1_Silent_p.L842L|MPRIP_ENST00000395811.5_Silent_p.L880L|MPRIP_ENST00000395804.3_Silent_p.L880L			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	880						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						GGACGCTGCTGACTGGGGACG	0.632																																							uc002gqu.1		NA																	0					0						c.(2638-2640)CTG>CTA		myosin phosphatase-Rho interacting protein							44.0	41.0	42.0					17																	17078657		2203	4296	6499	SO:0001819	synonymous_variant	23164					cytoplasm|cytoskeleton	actin binding	g.chr17:17078657G>A	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2640G>A	17.37:g.17078657G>A						MPRIP_uc002gqv.1_Silent_p.L880L|MPRIP_uc002gqw.1_Silent_p.L635L|MPRIP_uc002gqx.1_Silent_p.L1109L|MPRIP_uc002gqy.1_Silent_p.L1109L|MPRIP_uc010cpl.1_Intron|MPRIP_uc010cpm.1_Intron	p.L880L	NM_201274	NP_958431	Q6WCQ1	MPRIP_HUMAN			19	2696	+			880			Potential.		Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Silent	SNP	ENST00000341712.4	37	c.2640G>A	CCDS32578.1	.	.	.	.	.	.	.	.	.	.	G	6.667	0.491594	0.12702	.	.	ENSG00000133030	ENST00000313485	.	.	.	5.77	4.81	0.61882	.	.	.	.	.	T	0.62660	0.2446	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61108	-0.7129	4	.	.	.	-11.1856	10.8983	0.47036	0.1429:0.0:0.8571:0.0	.	.	.	.	N	1245	.	.	D	+	1	0	MPRIP	17019382	1.000000	0.71417	0.939000	0.37840	0.639000	0.38242	3.708000	0.54845	1.447000	0.47661	-0.136000	0.14681	GAC		0.632	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134		8	21	0	0	0	0.004482	0	8	21				
UBBP4	23666	broad.mit.edu	37	17	21730916	21730916	+	Missense_Mutation	SNP	G	G	T	rs111245273	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:21730916G>T	ENST00000578713.1	+	1	222	c.218G>T	c.(217-219)cGg>cTg	p.R73L	UBBP4_ENST00000584398.1_Intron|UBBP4_ENST00000583708.1_Intron|UBBP4_ENST00000584755.1_Missense_Mutation_p.R73L					ubiquitin B pseudogene 4									p.R73L(24)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						GTCCTGCGTCGGAGAGGTGGT	0.552													.|||	27	0.00539137	0.0182	0.0029	5008	,	,		20752	0.0		0.0	False		,,,				2504	0.001						uc002gyy.3		NA																	24	Substitution - Missense(24)		kidney(9)|urinary_tract(6)|endometrium(6)|prostate(3)		NA						c.(217-219)CGG>CTG		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21730916G>T	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.218G>T	17.37:g.21730916G>T	ENSP00000464265:p.Arg73Leu						p.R73L							2	343	+									Missense_Mutation	SNP	ENST00000578713.1	37	c.218G>T																																																																																					0.552	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			5	75	1	0	1.23904e-05	0.000602	1.36593e-05	5	75				
SLC13A2	9058	broad.mit.edu	37	17	26823582	26823582	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:26823582G>A	ENST00000314669.5	+	11	2005	c.1585G>A	c.(1585-1587)Ggg>Agg	p.G529R	SLC13A2_ENST00000444914.3_Missense_Mutation_p.G578R|SLC13A2_ENST00000545060.1_Missense_Mutation_p.G486R|SLC13A2_ENST00000537681.1_Missense_Mutation_p.G458R	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	529					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CTTCTCTTTCGGGGACCTCAA	0.567																																							uc002hbh.2		NA																	0					0						c.(1585-1587)GGG>AGG		solute carrier family 13, member 2 isoform b	Succinic acid(DB00139)						106.0	93.0	97.0					17																	26823582		2203	4300	6503	SO:0001583	missense	9058					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity	g.chr17:26823582G>A	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.1585G>A	17.37:g.26823582G>A	ENSP00000316202:p.Gly529Arg					SLC13A2_uc010wam.1_Missense_Mutation_p.G485R|SLC13A2_uc010wan.1_Missense_Mutation_p.G578R|SLC13A2_uc010wao.1_Missense_Mutation_p.G486R|SLC13A2_uc002hbi.2_Missense_Mutation_p.G458R	p.G529R	NM_003984	NP_003975	Q13183	S13A2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	11	1652	+	all_lung(13;0.000871)|Lung NSC(42;0.0027)		529			Helical; (Potential).		B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	37	c.1585G>A	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000491	0.74818	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000537681	T;T;T;T	0.03745	3.82;3.82;3.82;3.82	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.30916	0.0780	H	0.95114	3.625	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.995;1.0;0.999	T	0.45862	-0.9232	10	0.87932	D	0	-4.3742	19.48	0.95005	0.0:0.0:1.0:0.0	.	486;578;458;529	F5GWV6;E7ETH5;G3V1L2;Q13183	.;.;.;S13A2_HUMAN	R	529;578;486;458	ENSP00000316202:G529R;ENSP00000392411:G578R;ENSP00000441935:G486R;ENSP00000440802:G458R	ENSP00000316202:G529R	G	+	1	0	SLC13A2	23847709	1.000000	0.71417	0.575000	0.28536	0.280000	0.26924	9.243000	0.95416	2.606000	0.88127	0.655000	0.94253	GGG		0.567	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984		15	102	0	0	0	0.003163	0	15	102				
SUPT6H	6830	broad.mit.edu	37	17	27000441	27000441	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:27000441G>A	ENST00000314616.6	+	2	305	c.22G>A	c.(22-24)Gag>Aag	p.E8K	SUPT6H_ENST00000347486.4_Missense_Mutation_p.E8K|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	8	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGTGGAAAGCGAGGCTGAGGA	0.468																																							uc002hby.2		NA																	0				ovary(2)|skin(1)	3						c.(22-24)GAG>AAG		suppressor of Ty 6 homolog							82.0	77.0	79.0					17																	27000441		2203	4300	6503	SO:0001583	missense	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27000441G>A	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.22G>A	17.37:g.27000441G>A	ENSP00000319104:p.Glu8Lys					SUPT6H_uc010crt.2_Missense_Mutation_p.E8K	p.E8K	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN			2	112	+	Lung NSC(42;0.00431)		8			Asp/Glu-rich.		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	c.22G>A	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279073	0.59758	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.63896	0.2550	N	0.19112	0.55	0.80722	D	1	D	0.63046	0.992	P	0.62649	0.905	T	0.65010	-0.6272	9	0.51188	T	0.08	-25.3078	20.3409	0.98764	0.0:0.0:1.0:0.0	.	8	Q7KZ85	SPT6H_HUMAN	K	8	.	ENSP00000319104:E8K	E	+	1	0	SUPT6H	24024568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.354000	0.97083	2.814000	0.96858	0.655000	0.94253	GAG		0.468	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		11	29	0	0	0	0.010729	0	11	29				
ASIC2	40	broad.mit.edu	37	17	32483356	32483356	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:32483356A>G	ENST00000359872.6	-	1	957	c.196T>C	c.(196-198)Tac>Cac	p.Y66H		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	66					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GAGAAGTAGTAGGACACCCTC	0.592																																							uc002hhu.2		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(196-198)TAC>CAC		amiloride-sensitive cation channel 1, neuronal	Amiloride(DB00594)						58.0	64.0	62.0					17																	32483356		2201	4296	6497	SO:0001583	missense	40				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding	g.chr17:32483356A>G	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.196T>C	17.37:g.32483356A>G	ENSP00000352934:p.Tyr66His						p.Y66H	NM_001094	NP_001085	Q16515	ACCN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	1	470	-		Breast(31;0.042)|Ovarian(249;0.202)	66			Extracellular (By similarity).		E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	c.196T>C	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	A	13.42	2.232742	0.39498	.	.	ENSG00000108684	ENST00000359872	T	0.64085	-0.08	4.72	4.72	0.59763	.	.	.	.	.	T	0.58004	0.2092	L	0.56769	1.78	0.44194	D	0.997017	B	0.02656	0.0	B	0.18561	0.022	T	0.56456	-0.7976	9	0.39692	T	0.17	.	12.2015	0.54328	1.0:0.0:0.0:0.0	.	66	Q16515	ACCN1_HUMAN	H	66	ENSP00000352934:Y66H	ENSP00000352934:Y66H	Y	-	1	0	ACCN1	29507469	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.333000	0.79214	1.977000	0.57605	0.533000	0.62120	TAC		0.592	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094		11	41	0	0	0	0.010729	0	11	41				
MED1	5469	broad.mit.edu	37	17	37584015	37584015	+	Silent	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:37584015G>C	ENST00000394287.3	-	10	883	c.678C>G	c.(676-678)gtC>gtG	p.V226V	MED1_ENST00000300651.6_Silent_p.V226V			O95243	MBD4_HUMAN	mediator complex subunit 1	111					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CAGAAGGAGAGACATAGTACT	0.308										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	0				lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(676-678)GTC>GTG		mediator complex subunit 1							95.0	94.0	94.0					17																	37584015		2203	4300	6503	SO:0001819	synonymous_variant	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37584015G>C	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.678C>G	17.37:g.37584015G>C		HNSCC(31;0.082)				MED1_uc010wee.1_Silent_p.V54V|MED1_uc002hru.2_Silent_p.V226V	p.V226V	NM_004774	NP_004765	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	10	890	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	226			Interaction with ESR1.|Interaction with the Mediator complex.|Interaction with the Mediator complex and THRA.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Silent	SNP	ENST00000394287.3	37	c.678C>G																																																																																					0.308	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000256944.1	NM_004774		7	25	0	0	0	0.004482	0	7	25				
MED24	9862	broad.mit.edu	37	17	38186033	38186033	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:38186033G>A	ENST00000394128.2	-	13	1315	c.1234C>T	c.(1234-1236)Cgg>Tgg	p.R412W	MED24_ENST00000501516.3_Missense_Mutation_p.R431W|MED24_ENST00000356271.3_Missense_Mutation_p.R399W|SNORD124_ENST00000459577.1_RNA|MED24_ENST00000394127.2_Missense_Mutation_p.R399W|MED24_ENST00000394126.1_Missense_Mutation_p.R437W	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	412					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GGCTCCGCCCGGAGGATCAGC	0.572																																							uc002htt.2		NA																	0				ovary(1)	1						c.(1234-1236)CGG>TGG		mediator complex subunit 24 isoform 1							230.0	182.0	198.0					17																	38186033		2203	4300	6503	SO:0001583	missense	9862				androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:38186033G>A	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1234C>T	17.37:g.38186033G>A	ENSP00000377686:p.Arg412Trp					MED24_uc010wes.1_Missense_Mutation_p.R272W|MED24_uc010wet.1_Intron|MED24_uc002hts.2_Missense_Mutation_p.R437W|MED24_uc002htu.2_Missense_Mutation_p.R399W|MED24_uc010cwn.2_Missense_Mutation_p.R399W|MED24_uc010weu.1_Missense_Mutation_p.R322W|MED24_uc010wev.1_Missense_Mutation_p.R362W|MED24_uc010wew.1_Missense_Mutation_p.R341W|MED24_uc010wex.1_Missense_Mutation_p.R117W	p.R412W	NM_014815	NP_055630	O75448	MED24_HUMAN			13	1547	-	Colorectal(19;0.000442)		412					A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	c.1234C>T	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517790	0.27123	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000431269	T;T;T	0.62639	0.01;0.01;0.01	5.91	4.95	0.65309	Mediator complex, subunit Med24, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74824	0.3767	M	0.68952	2.095	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.71414	0.91;0.973;0.973;0.95;0.971;0.973	T	0.77305	-0.2637	10	0.87932	D	0	-26.4267	10.8622	0.46833	0.069:0.0:0.7937:0.1373	.	353;362;322;399;412;354	B4DSQ6;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;MED24_HUMAN;.	W	412;412;412;362;399;354;322	ENSP00000377686:R412W;ENSP00000443344:R362W;ENSP00000377685:R399W	ENSP00000348610:R412W	R	-	1	2	MED24	35439559	1.000000	0.71417	0.955000	0.39395	0.540000	0.34992	3.267000	0.51577	1.518000	0.48934	0.462000	0.41574	CGG		0.572	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815		25	42	0	0	0	0.008361	0	25	42				
HEXIM1	10614	broad.mit.edu	37	17	43226847	43226847	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:43226847C>T	ENST00000332499.2	+	1	2164	c.290C>T	c.(289-291)tCg>tTg	p.S97L	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	97					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGGGACGACTCGTCCGCTGGC	0.652											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002iig.2		NA																	0				ovary(1)	1						c.(289-291)TCG>TTG		hexamethylene bis-acetamide inducible 1							10.0	12.0	12.0					17																	43226847		2187	4289	6476	SO:0001583	missense	10614				negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding	g.chr17:43226847C>T	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.290C>T	17.37:g.43226847C>T	ENSP00000328773:p.Ser97Leu		OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	914		p.S97L	NM_006460	NP_006451	O94992	HEXI1_HUMAN			1	2164	+			97					B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	37	c.290C>T	CCDS11495.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.436919	0.00182	.	.	ENSG00000186834	ENST00000332499	.	.	.	3.88	0.263	0.15602	.	1.992730	0.03189	N	0.173073	T	0.09113	0.0225	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14035	-1.0487	9	0.25106	T	0.35	-0.13	3.3202	0.07048	0.0:0.2323:0.2088:0.5588	.	97	O94992	HEXI1_HUMAN	L	97	.	ENSP00000328773:S97L	S	+	2	0	HEXIM1	40582630	0.001000	0.12720	0.003000	0.11579	0.120000	0.20174	-0.481000	0.06552	-0.154000	0.11118	-0.340000	0.08031	TCG		0.652	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	NM_006460		7	22	0	0	0	0.001984	0	7	22				
HOXB8	3218	broad.mit.edu	37	17	46691978	46691978	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:46691978T>G	ENST00000239144.4	-	1	323	c.89A>C	c.(88-90)cAg>cCg	p.Q30P	HOXB7_ENST00000567101.2_Intron|HOXB8_ENST00000576562.1_Missense_Mutation_p.Q30P	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	30					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|dorsal spinal cord development (GO:0021516)|embryonic skeletal system morphogenesis (GO:0048704)|grooming behavior (GO:0007625)|negative regulation of myeloid cell differentiation (GO:0045638)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A29_D31delAQD(1)		large_intestine(1)|lung(8)|urinary_tract(2)	11						GCCCAGGTCCTGGGCGAAGCC	0.572																																							uc002inw.2		NA																	1	Deletion - In frame(1)		urinary_tract(1)		0						c.(88-90)CAG>CCG		homeobox B8							11.0	12.0	11.0					17																	46691978		2201	4296	6497	SO:0001583	missense	3218					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46691978T>G		CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068		"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D		1973146, 1358459	Standard	XM_005257286		Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.89A>C	17.37:g.46691978T>G	ENSP00000239144:p.Gln30Pro						p.Q30P	NM_024016	NP_076921	P17481	HXB8_HUMAN			1	324	-			30					Q9H1I2	Missense_Mutation	SNP	ENST00000239144.4	37	c.89A>C	CCDS11533.1	.	.	.	.	.	.	.	.	.	.	t	14.10	2.433899	0.43224	.	.	ENSG00000120068	ENST00000239144	T	0.33654	1.4	2.86	2.86	0.33363	.	0.000000	0.56097	U	0.000030	T	0.46580	0.1400	L	0.49571	1.57	0.54753	D	0.999983	D	0.55800	0.973	D	0.64042	0.921	T	0.28267	-1.0049	10	0.23891	T	0.37	.	10.9972	0.47582	0.0:0.0:0.0:1.0	.	30	P17481	HXB8_HUMAN	P	30	ENSP00000239144:Q30P	ENSP00000239144:Q30P	Q	-	2	0	HOXB8	44046977	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.358000	0.79466	1.182000	0.42928	0.241000	0.17934	CAG		0.572	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358092.3			8	7	0	0	0	0.00308	0	8	7				
ABCA8	10351	broad.mit.edu	37	17	66902184	66902184	+	Splice_Site	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:66902184C>A	ENST00000269080.2	-	17	2416		c.e17+1		ABCA8_ENST00000586539.1_Splice_Site|ABCA8_ENST00000430352.2_Splice_Site	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8						transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					ATTTTATTTACCCGATTCATT	0.333																																							uc002jhp.2		NA																	0				ovary(2)|skin(1)	3						c.e17+1		ATP-binding cassette, sub-family A member 8							114.0	115.0	115.0					17																	66902184		2203	4298	6501	SO:0001630	splice_region_variant	10351					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr17:66902184C>A	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.2278+1G>T	17.37:g.66902184C>A						ABCA8_uc002jhq.2_Splice_Site_p.D800_splice|ABCA8_uc010wqq.1_Splice_Site_p.D800_splice|ABCA8_uc010wqr.1_Splice_Site_p.D739_splice|ABCA8_uc002jhr.2_Splice_Site_p.D800_splice	p.D760_splice	NM_007168	NP_009099	O94911	ABCA8_HUMAN			17	2457	-	Breast(10;4.56e-13)							A1L3U3|C9JQE6|Q86WW0	Splice_Site	SNP	ENST00000269080.2	37	c.2278_splice	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357215	0.61293	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	.	.	.	5.38	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0095	0.47654	0.0:0.9143:0.0:0.0857	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA8	64413779	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.275000	0.51639	1.511000	0.48818	0.655000	0.94253	.		0.333	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	Intron	14	73	1	0	1.49906e-05	0.00245	1.64927e-05	14	73				
LLGL2	3993	broad.mit.edu	37	17	73566162	73566162	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr17:73566162G>A	ENST00000392550.3	+	15	1817	c.1700G>A	c.(1699-1701)cGc>cAc	p.R567H	LLGL2_ENST00000167462.5_Missense_Mutation_p.R567H|LLGL2_ENST00000577200.1_Missense_Mutation_p.R567H	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	567					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CTGGCAGCCCGCTCAGGGCCC	0.672																																							uc002joh.2		NA																	0				ovary(2)	2						c.(1699-1701)CGC>CAC		lethal giant larvae homolog 2 isoform c							28.0	27.0	27.0					17																	73566162		2200	4297	6497	SO:0001583	missense	3993				cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding	g.chr17:73566162G>A	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1700G>A	17.37:g.73566162G>A	ENSP00000376333:p.Arg567His					LLGL2_uc002joi.2_Missense_Mutation_p.R567H|LLGL2_uc010dgg.1_Missense_Mutation_p.R567H|LLGL2_uc002joj.2_Missense_Mutation_p.R556H|LLGL2_uc010wsd.1_Missense_Mutation_p.R194H	p.R567H	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)		15	1854	+	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		567			WD 9.		Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	c.1700G>A	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.706203	0.30232	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.52057	0.68;0.68	5.19	3.16	0.36331	.	0.173050	0.52532	D	0.000061	T	0.67059	0.2853	M	0.88570	2.965	0.53005	D	0.999962	P;D;D;B;B	0.64830	0.914;0.99;0.994;0.261;0.218	B;P;P;B;B	0.61592	0.3;0.781;0.891;0.113;0.109	T	0.70952	-0.4732	10	0.51188	T	0.08	-12.2955	10.2024	0.43092	0.0743:0.1379:0.7879:0.0	.	194;556;556;567;567	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	H	567;567;556	ENSP00000167462:R567H;ENSP00000376333:R567H	ENSP00000167462:R567H	R	+	2	0	LLGL2	71077757	1.000000	0.71417	0.801000	0.32222	0.186000	0.23388	6.367000	0.73099	1.165000	0.42670	0.549000	0.68633	CGC		0.672	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524		12	15	0	0	0	0.010729	0	12	15				
NDC80	10403	broad.mit.edu	37	18	2610858	2610858	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:2610858G>A	ENST00000261597.4	+	16	1971	c.1789G>A	c.(1789-1791)Gag>Aag	p.E597K		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	597	Interaction with NEK2 and ZWINT.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						TGGGTCTGTAGAGGTAAGTAT	0.348																																							uc002kli.2		NA																	0				ovary(1)	1						c.(1789-1791)GAG>AAG		kinetochore associated 2							148.0	127.0	134.0					18																	2610858		2203	4300	6503	SO:0001583	missense	10403				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding	g.chr18:2610858G>A	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1789G>A	18.37:g.2610858G>A	ENSP00000261597:p.Glu597Lys						p.E597K	NM_006101	NP_006092	O14777	NDC80_HUMAN			16	1971	+			597			Potential.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.|Interaction with NEK2 and ZWINT.		Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	37	c.1789G>A	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.715839	0.68844	.	.	ENSG00000080986	ENST00000261597	T	0.54866	0.55	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.65026	0.2652	M	0.66939	2.045	0.58432	D	0.999999	D	0.71674	0.998	P	0.58013	0.831	T	0.59721	-0.7401	10	0.13853	T	0.58	-13.6144	18.0052	0.89207	0.0:0.0:1.0:0.0	.	597	O14777	NDC80_HUMAN	K	597	ENSP00000261597:E597K	ENSP00000261597:E597K	E	+	1	0	NDC80	2600858	1.000000	0.71417	0.999000	0.59377	0.141000	0.21300	5.968000	0.70413	2.547000	0.85894	0.650000	0.86243	GAG		0.348	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101		28	71	0	0	0	0.005443	0	28	71				
PPP4R1	9989	broad.mit.edu	37	18	9595070	9595070	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:9595070A>G	ENST00000400556.3	-	3	207	c.134T>C	c.(133-135)tTg>tCg	p.L45S	PPP4R1_ENST00000580583.1_5'Flank|PPP4R1_ENST00000400555.3_Missense_Mutation_p.L28S	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	45					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						CAGGGGCGTCAACATTTCATC	0.418																																					Melanoma(188;1232 2082 5061 11948 35994)	Melanoma(188;1232 2082 5061 11948 35994)	uc002koe.1		NA																	0				skin(1)	1						c.(133-135)TTG>TCG		protein phosphatase 4, regulatory subunit 1							146.0	134.0	138.0					18																	9595070		1899	4117	6016	SO:0001583	missense	9989				protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity	g.chr18:9595070A>G	AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.134T>C	18.37:g.9595070A>G	ENSP00000383402:p.Leu45Ser					PPP4R1_uc010wzo.1_Missense_Mutation_p.L2S|PPP4R1_uc002kod.1_Missense_Mutation_p.L28S|PPP4R1_uc010wzp.1_RNA	p.L45S	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN			3	252	-			45			HEAT 2.		Q99774|Q9UNQ7	Missense_Mutation	SNP	ENST00000400556.3	37	c.134T>C	CCDS42412.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.377030	0.42105	.	.	ENSG00000154845	ENST00000400556;ENST00000400555	T;T	0.35236	1.32;1.32	4.66	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.085587	0.49305	D	0.000158	T	0.57242	0.2040	M	0.65975	2.015	0.48696	D	0.999691	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.57969	-0.7719	9	.	.	.	-12.0162	14.5404	0.67990	1.0:0.0:0.0:0.0	.	28;45;28	A8K923;Q8TF05;Q8TF05-2	.;PP4R1_HUMAN;.	S	45;28	ENSP00000383402:L45S;ENSP00000383401:L28S	.	L	-	2	0	PPP4R1	9585070	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.640000	0.91028	2.089000	0.63090	0.460000	0.39030	TTG		0.418	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268571.1	NM_005134		21	48	0	0	0	0.002299	0	21	48				
OSBPL1A	114876	broad.mit.edu	37	18	21747364	21747364	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:21747364C>T	ENST00000319481.3	-	25	2670	c.2464G>A	c.(2464-2466)Gaa>Aaa	p.E822K	OSBPL1A_ENST00000399443.3_Missense_Mutation_p.E309K|OSBPL1A_ENST00000357041.4_Missense_Mutation_p.E440K	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	822					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					AATACACTTTCAGAATCCGGC	0.458																																							uc002kve.2		NA																	0				ovary(4)	4						c.(2464-2466)GAA>AAA		oxysterol-binding protein-like 1A isoform B							96.0	103.0	100.0					18																	21747364		2203	4300	6503	SO:0001583	missense	114876				cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding	g.chr18:21747364C>T	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2464G>A	18.37:g.21747364C>T	ENSP00000320291:p.Glu822Lys					OSBPL1A_uc002kvd.2_Missense_Mutation_p.E309K|OSBPL1A_uc010xbc.1_Missense_Mutation_p.E440K	p.E822K	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN			25	2638	-	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)		822					B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	c.2464G>A	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	C	16.06	3.017130	0.54576	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.47177	0.85;0.87;0.86	6.02	6.02	0.97574	.	0.042849	0.85682	D	0.000000	T	0.57330	0.2046	L	0.42744	1.35	0.80722	D	1	D	0.56968	0.978	P	0.57911	0.829	T	0.39781	-0.9597	10	0.15952	T	0.53	-28.9863	20.5195	0.99215	0.0:1.0:0.0:0.0	.	822	Q9BXW6	OSBL1_HUMAN	K	822;309;440	ENSP00000320291:E822K;ENSP00000382372:E309K;ENSP00000349545:E440K	ENSP00000320291:E822K	E	-	1	0	OSBPL1A	20001362	1.000000	0.71417	0.955000	0.39395	0.505000	0.33919	6.817000	0.75252	2.855000	0.98099	0.655000	0.94253	GAA		0.458	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597		17	166	0	0	0	0.006122	0	17	166				
ZNF521	25925	broad.mit.edu	37	18	22805128	22805128	+	Silent	SNP	G	G	T	rs149662480		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:22805128G>T	ENST00000361524.3	-	4	2902	c.2754C>A	c.(2752-2754)atC>atA	p.I918I	ZNF521_ENST00000538137.2_Silent_p.I918I|ZNF521_ENST00000584787.1_Silent_p.I698I|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	918					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TCTTTTTCACGATGGCACTTT	0.498			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(2752-2754)ATC>ATA		zinc finger protein 521							135.0	131.0	132.0					18																	22805128		2203	4300	6503	SO:0001819	synonymous_variant	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22805128G>T	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2754C>A	18.37:g.22805128G>T						ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.I918I|ZNF521_uc002kvl.2_Silent_p.I698I	p.I918I	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	3001	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		918					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	c.2754C>A	CCDS32806.1																																																																																				0.498	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		18	75	1	0	7.07596e-05	0.006122	7.64705e-05	18	75				
ZNF521	25925	broad.mit.edu	37	18	22807050	22807050	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:22807050G>A	ENST00000361524.3	-	4	980	c.832C>T	c.(832-834)Cga>Tga	p.R278*	ZNF521_ENST00000538137.2_Nonsense_Mutation_p.R278*|ZNF521_ENST00000584787.1_Nonsense_Mutation_p.R58*|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	278					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AGGGCCGCTCGGTCCTCATTT	0.557			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(832-834)CGA>TGA		zinc finger protein 521							103.0	96.0	98.0					18																	22807050		2203	4300	6503	SO:0001587	stop_gained	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22807050G>A	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.832C>T	18.37:g.22807050G>A	ENSP00000354794:p.Arg278*					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Nonsense_Mutation_p.R278*|ZNF521_uc002kvl.2_Nonsense_Mutation_p.R58*	p.R278*	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	1079	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		278					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Nonsense_Mutation	SNP	ENST00000361524.3	37	c.832C>T	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453808	0.84209	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	.	.	.	6.02	4.17	0.49024	.	0.059638	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-19.8172	14.7308	0.69379	0.0:0.0:0.52:0.48	.	.	.	.	X	278;312;278	.	ENSP00000354794:R278X	R	-	1	2	ZNF521	21061048	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	1.382000	0.34374	1.535000	0.49220	0.655000	0.94253	CGA		0.557	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		31	103	0	0	0	0.012213	0	31	103				
DSC1	1823	broad.mit.edu	37	18	28710636	28710636	+	Silent	SNP	A	A	G	rs139389841		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:28710636A>G	ENST00000257198.5	-	16	2787	c.2526T>C	c.(2524-2526)caT>caC	p.H842H	DSC1_ENST00000257197.3_3'UTR|RP11-408H20.3_ENST00000582307.1_RNA|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	842					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			AGTCTTCACAATGTTTATGCT	0.398																																							uc002kwn.2		NA																	0				ovary(3)|skin(1)	4						c.(2524-2526)CAT>CAC		desmocollin 1 isoform Dsc1a preproprotein		A	,	0,4406		0,0,2203	127.0	126.0	126.0		,2526	1.0	0.0	18	dbSNP_134	126	1,8599	1.2+/-3.3	0,1,4299	no	utr-3,coding-synonymous	DSC1	NM_004948.3,NM_024421.2	,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,	,842/895	28710636	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1823				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding	g.chr18:28710636A>G	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2526T>C	18.37:g.28710636A>G						DSC1_uc002kwm.2_3'UTR|uc002kwo.1_5'Flank	p.H842H	NM_024421	NP_077739	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)		16	2788	-			842			Cytoplasmic (Potential).		Q9HB01	Silent	SNP	ENST00000257198.5	37	c.2526T>C	CCDS11894.1																																																																																				0.398	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421		26	29	0	0	0	0.00632	0	26	29				
DTNA	1837	broad.mit.edu	37	18	32374075	32374075	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:32374075G>A	ENST00000399113.3	+	3	223	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	DTNA_ENST00000269191.6_Missense_Mutation_p.E75K|DTNA_ENST00000596745.1_Missense_Mutation_p.E75K|DTNA_ENST00000283365.9_Missense_Mutation_p.E75K|DTNA_ENST00000399097.3_5'UTR|DTNA_ENST00000348997.5_Missense_Mutation_p.E75K|DTNA_ENST00000444659.1_Missense_Mutation_p.E75K|DTNA_ENST00000595022.1_Missense_Mutation_p.E75K|DTNA_ENST00000598334.1_Missense_Mutation_p.E75K|DTNA_ENST00000399121.5_Missense_Mutation_p.E75K|DTNA_ENST00000598774.1_Missense_Mutation_p.E75K|DTNA_ENST00000598142.1_Missense_Mutation_p.E75K|DTNA_ENST00000554864.3_Missense_Mutation_p.E75K|DTNA_ENST00000315456.6_Missense_Mutation_p.E75K|DTNA_ENST00000269190.7_Missense_Mutation_p.E75K|DTNA_ENST00000597599.1_Missense_Mutation_p.E75K			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	75	Interaction with MAGEE1. {ECO:0000250}.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						CCCAAACACTGAACTCAACGT	0.463																																							uc010dmn.1		NA																	0					0						c.(223-225)GAA>AAA		dystrobrevin alpha isoform 1							223.0	166.0	185.0					18																	32374075		2203	4300	6503	SO:0001583	missense	1837				neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding	g.chr18:32374075G>A	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.223G>A	18.37:g.32374075G>A	ENSP00000382064:p.Glu75Lys					DTNA_uc002kxu.2_Missense_Mutation_p.E75K|DTNA_uc010xbx.1_Missense_Mutation_p.E75K|DTNA_uc002kxv.3_Missense_Mutation_p.E75K|DTNA_uc002kxw.2_Missense_Mutation_p.E75K|DTNA_uc002kxx.2_Missense_Mutation_p.E75K|DTNA_uc010dmj.2_Missense_Mutation_p.E75K|DTNA_uc002kxz.2_Missense_Mutation_p.E75K|DTNA_uc002kxy.2_Missense_Mutation_p.E75K|DTNA_uc010dmk.1_RNA|DTNA_uc010dml.2_Missense_Mutation_p.E75K|DTNA_uc002kyb.3_Missense_Mutation_p.E75K|DTNA_uc010dmm.2_Missense_Mutation_p.E75K	p.E75K	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN			3	224	+			75			Interaction with MAGEE1 (By similarity).		A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	37	c.223G>A	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721758	0.89298	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000315456;ENST00000556176;ENST00000399114;ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113	T;T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.43	5.43	0.79202	EF-hand domain, type 1 (1);EF-hand-like domain (1);	0.053242	0.85682	D	0.000000	T	0.77592	0.4153	M	0.80982	2.52	0.80722	D	1	P;P;P;B;P;P;B;P;P;P;P;P	0.52061	0.77;0.775;0.95;0.198;0.917;0.915;0.198;0.932;0.924;0.917;0.728;0.907	B;P;P;B;P;P;B;P;P;P;B;P	0.57009	0.242;0.627;0.716;0.292;0.713;0.574;0.369;0.811;0.629;0.713;0.156;0.495	T	0.80178	-0.1490	10	0.66056	D	0.02	-18.4277	17.7791	0.88518	0.0:0.0:1.0:0.0	.	75;75;75;75;75;75;75;86;75;75;75;75	B4DGS6;Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-4;E9PEH8;Q59GK7;Q9BS59;Q9Y4J8-2;Q9Y4J8-5;Q9Y4J8-7	.;DTNA_HUMAN;.;.;.;.;.;.;.;.;.;.	K	75	ENSP00000283365:E75K;ENSP00000322519:E75K;ENSP00000269190:E75K;ENSP00000336682:E75K;ENSP00000382072:E75K;ENSP00000405819:E75K;ENSP00000269191:E75K;ENSP00000382064:E75K	ENSP00000269190:E75K	E	+	1	0	DTNA	30628073	1.000000	0.71417	0.907000	0.35723	0.457000	0.32468	9.826000	0.99387	2.708000	0.92522	0.563000	0.77884	GAA		0.463	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390		8	45	0	0	0	0.006214	0	8	45				
RTTN	25914	broad.mit.edu	37	18	67688031	67688031	+	Silent	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr18:67688031T>A	ENST00000255674.6	-	45	6259	c.5973A>T	c.(5971-5973)tcA>tcT	p.S1991S	RTTN_ENST00000579986.1_5'UTR|RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1991					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				GTCCACAACTTGACCAACAAA	0.438																																							uc002lkp.2		NA																	0				ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8						c.(5971-5973)TCA>TCT		rotatin							109.0	103.0	105.0					18																	67688031		1917	4111	6028	SO:0001819	synonymous_variant	25914						binding	g.chr18:67688031T>A	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.5973A>T	18.37:g.67688031T>A						RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Silent_p.S1079S|RTTN_uc002lkn.2_5'UTR|RTTN_uc010dqp.2_Silent_p.S243S	p.S1991S	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN			45	6041	-		Esophageal squamous(42;0.129)	1991					Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	37	c.5973A>T	CCDS42443.1																																																																																				0.438	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630		20	40	0	0	0	0.008871	0	20	40				
THOP1	7064	broad.mit.edu	37	19	2790526	2790526	+	Missense_Mutation	SNP	G	G	A	rs142015327		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:2790526G>A	ENST00000307741.6	+	2	327	c.124G>A	c.(124-126)Gag>Aag	p.E42K		NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	42					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGCTCATCGAGCAGACCAA	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		20651	0.0		0.001	False		,,,				2504	0.0						uc002lwj.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(124-126)GAG>AAG		thimet oligopeptidase 1		G	LYS/GLU	0,4406		0,0,2203	117.0	93.0	101.0		124	4.9	1.0	19	dbSNP_134	101	3,8597	2.2+/-6.3	0,3,4297	yes	missense	THOP1	NM_003249.3	56	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	42/690	2790526	3,13003	2203	4300	6503	SO:0001583	missense	7064				proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding	g.chr19:2790526G>A		CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.124G>A	19.37:g.2790526G>A	ENSP00000304467:p.Glu42Lys						p.E42K	NM_003249	NP_003240	P52888	THOP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	279	+			42					B3KSE2|Q9UCB3	Missense_Mutation	SNP	ENST00000307741.6	37	c.124G>A	CCDS12095.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	6.303	0.424082	0.11928	0.0	3.49E-4	ENSG00000172009	ENST00000307741	T	0.08370	3.1	4.9	4.9	0.64082	Neurolysin/Thimet oligopeptidase, N-terminal (1);	0.429872	0.24229	N	0.040368	T	0.07052	0.0179	L	0.31294	0.92	0.80722	D	1	B	0.18461	0.028	B	0.09377	0.004	T	0.18178	-1.0345	10	0.08179	T	0.78	-44.1223	16.6353	0.85058	0.0:0.0:1.0:0.0	.	42	P52888	THOP1_HUMAN	K	42	ENSP00000304467:E42K	ENSP00000304467:E42K	E	+	1	0	THOP1	2741526	1.000000	0.71417	0.981000	0.43875	0.087000	0.18053	3.968000	0.56809	2.266000	0.75297	0.561000	0.74099	GAG		0.612	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2			11	44	0	0	0	0.008291	0	11	44				
CACTIN	58509	broad.mit.edu	37	19	3623983	3623983	+	Silent	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:3623983T>C	ENST00000429344.2	-	2	397	c.345A>G	c.(343-345)gcA>gcG	p.A115A	CACTIN_ENST00000221899.3_Silent_p.A47A|CACTIN_ENST00000248420.5_Silent_p.A115A	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	115					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CGGAGCTGGATGCTGAGGAGC	0.726																																							uc002lyh.2		NA																	0					0						c.(343-345)GCA>GCG		chromosome 19 open reading frame 29							13.0	17.0	16.0					19																	3623983		1978	4120	6098	SO:0001819	synonymous_variant	58509					catalytic step 2 spliceosome	protein binding	g.chr19:3623983T>C	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.345A>G	19.37:g.3623983T>C						C19orf29_uc010dtn.2_5'Flank|C19orf29_uc002lyi.3_Silent_p.A115A|C19orf29_uc010dto.2_RNA	p.A115A	NM_001080543	NP_001074012	Q8WUQ7	CS029_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	2	398	-		Hepatocellular(1079;0.137)	115					A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Silent	SNP	ENST00000429344.2	37	c.345A>G	CCDS45920.1																																																																																				0.726	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2			8	10	0	0	0	0.00308	0	8	10				
SAFB	6294	broad.mit.edu	37	19	5654150	5654150	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:5654150G>C	ENST00000292123.5	+	12	1712	c.1605G>C	c.(1603-1605)aaG>aaC	p.K535N	SAFB_ENST00000454510.1_Missense_Mutation_p.K466N|SAFB_ENST00000538656.1_Missense_Mutation_p.K378N|SAFB_ENST00000433404.1_Missense_Mutation_p.K365N|SAFB_ENST00000592224.1_Missense_Mutation_p.K535N|SAFB_ENST00000588852.1_Missense_Mutation_p.K535N	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	535	Interaction with POLR2A.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GTGGAGAAAAGAGTAAGGACC	0.458																																					Colon(88;338 1345 6184 8214 20897)	Colon(88;338 1345 6184 8214 20897)	uc002mcf.2		NA																	0				ovary(1)|liver(1)|skin(1)	3						c.(1603-1605)AAG>AAC		scaffold attachment factor B							121.0	113.0	116.0					19																	5654150		2203	4300	6503	SO:0001583	missense	6294				chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding	g.chr19:5654150G>C	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.1605G>C	19.37:g.5654150G>C	ENSP00000292123:p.Lys535Asn					SAFB_uc002mcg.2_Missense_Mutation_p.K535N|SAFB_uc002mce.3_Missense_Mutation_p.K535N|SAFB_uc010xir.1_Missense_Mutation_p.K535N|SAFB_uc010xis.1_Missense_Mutation_p.K466N|SAFB_uc010xit.1_Missense_Mutation_p.K378N|SAFB_uc010xiu.1_Missense_Mutation_p.K334N	p.K535N	NM_002967	NP_002958	Q15424	SAFB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)	12	1658	+			535			Interaction with POLR2A.		A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	ENST00000292123.5	37	c.1605G>C	CCDS12142.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866046	0.51588	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.12465	2.68;2.88;2.7;2.68	5.34	5.34	0.76211	.	0.354480	0.24384	N	0.038989	T	0.24699	0.0599	L	0.40543	1.245	0.44085	D	0.99684	P;P;P;D;D;D;D	0.71674	0.799;0.902;0.873;0.998;0.988;0.988;0.988	B;P;P;D;P;P;P	0.66196	0.205;0.621;0.544;0.942;0.696;0.829;0.696	T	0.00453	-1.1730	10	0.28530	T	0.3	-34.4865	12.4244	0.55538	0.082:0.0:0.918:0.0	.	334;378;466;535;535;535;535	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	N	466;430;365;535;378	ENSP00000415895:K466N;ENSP00000404545:K365N;ENSP00000292123:K535N;ENSP00000438880:K378N	ENSP00000292123:K535N	K	+	3	2	SAFB	5605150	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	2.631000	0.46502	2.654000	0.90174	0.563000	0.77884	AAG		0.458	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451641.2			14	15	0	0	0	0.00245	0	14	15				
KHSRP	8570	broad.mit.edu	37	19	6427134	6427134	+	5'Flank	SNP	C	C	A	rs371218043		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:6427134C>A	ENST00000398148.3	-	0	0				SLC25A41_ENST00000321510.6_Missense_Mutation_p.R307L	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						CATCCTGGTGCGCACCAGAGT	0.632																																					Colon(55;593 1006 2067 9135 22980)		uc010dus.2		NA																	0					0						c.(919-921)CGC>CTC		solute carrier family 25, member 41							17.0	22.0	20.0					19																	6427134		2118	4234	6352	SO:0001631	upstream_gene_variant	284427				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr19:6427134C>A	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945			19.37:g.6427134C>A	Exception_encountered					KHSRP_uc002mer.3_5'Flank|SLC25A41_uc010dut.2_Missense_Mutation_p.R169L	p.R307L	NM_173637	NP_775908	Q8N5S1	S2541_HUMAN			6	1006	-			307			Solcar 3.		O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	c.920G>T	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901543	0.92035	.	.	ENSG00000181240	ENST00000321510	T	0.80824	-1.42	4.22	4.22	0.49857	Mitochondrial carrier domain (2);	.	.	.	.	D	0.92938	0.7753	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95328	0.8427	9	0.87932	D	0	-12.7717	15.5172	0.75833	0.0:1.0:0.0:0.0	.	307	Q8N5S1	S2541_HUMAN	L	307	ENSP00000322649:R307L	ENSP00000322649:R307L	R	-	2	0	SLC25A41	6378134	1.000000	0.71417	0.793000	0.32043	0.991000	0.79684	4.415000	0.59809	2.167000	0.68274	0.462000	0.41574	CGC		0.632	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1			4	8	1	0	0.000602214	0.000602	0.000638254	4	8				
SLC25A23	79085	broad.mit.edu	37	19	6459599	6459599	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:6459599C>A	ENST00000301454.4	-	1	147	c.41G>T	c.(40-42)tGg>tTg	p.W14L	SLC25A23_ENST00000334510.5_Missense_Mutation_p.W14L	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	14	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CAGGCGACCCCAGCGCTGCCG	0.771																																							uc002mex.1		NA																	0				ovary(1)|pancreas(1)	2						c.(40-42)TGG>TTG		solute carrier family 25, member 23							9.0	12.0	11.0					19																	6459599		2118	4183	6301	SO:0001583	missense	79085				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding	g.chr19:6459599C>A	AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.41G>T	19.37:g.6459599C>A	ENSP00000301454:p.Trp14Leu					SLC25A23_uc002mev.2_RNA	p.W14L	NM_024103	NP_077008	Q9BV35	SCMC3_HUMAN			1	183	-			14			Mitochondrial intermembrane (Potential).|EF-hand 1.		B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	37	c.41G>T	CCDS32882.1	.	.	.	.	.	.	.	.	.	.	C	8.605	0.887668	0.17540	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000334510	T;T;T	0.60424	1.67;1.67;0.19	4.18	4.18	0.49190	EF-hand-like domain (1);	0.430873	0.25068	N	0.033390	T	0.22704	0.0548	N	0.01446	-0.86	0.43852	D	0.996441	B	0.02656	0.0	B	0.04013	0.001	T	0.28776	-1.0033	10	0.02654	T	1	-14.69	8.2918	0.31963	0.0:0.8889:0.0:0.1111	.	14	Q9BV35	SCMC3_HUMAN	L	14	ENSP00000264088:W14L;ENSP00000301454:W14L;ENSP00000334537:W14L	ENSP00000264088:W14L	W	-	2	0	SLC25A23	6410599	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.266000	0.58871	2.052000	0.61016	0.561000	0.74099	TGG		0.771	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103		9	10	1	0	3.86212e-05	0.008291	4.19862e-05	9	10				
INSR	3643	broad.mit.edu	37	19	7141783	7141783	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:7141783C>T	ENST00000302850.5	-	13	2729	c.2587G>A	c.(2587-2589)Gag>Aag	p.E863K	INSR_ENST00000341500.5_Missense_Mutation_p.E851K	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	863	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	ACGTTGTTCTCAAAGATTTCA	0.502																																							uc002mgd.1		NA																	0				ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12						c.(2587-2589)GAG>AAG		insulin receptor isoform Long precursor	Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						173.0	128.0	143.0					19																	7141783		2203	4300	6503	SO:0001583	missense	3643				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding	g.chr19:7141783C>T	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2587G>A	19.37:g.7141783C>T	ENSP00000303830:p.Glu863Lys					INSR_uc002mge.1_Missense_Mutation_p.E851K	p.E863K	NM_000208	NP_000199	P06213	INSR_HUMAN			13	2696	-			863			Fibronectin type-III 3.|Extracellular (Potential).		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	c.2587G>A	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887945	0.52014	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.56941	0.43;0.43	5.3	5.3	0.74995	Fibronectin, type III (4);	0.000000	0.45126	U	0.000385	T	0.50752	0.1634	L	0.59436	1.845	0.80722	D	1	B;B	0.13145	0.007;0.006	B;B	0.22152	0.015;0.038	T	0.44467	-0.9326	10	0.21540	T	0.41	.	16.4491	0.83973	0.0:1.0:0.0:0.0	.	851;863	P06213-2;P06213	.;INSR_HUMAN	K	863;851	ENSP00000303830:E863K;ENSP00000342838:E851K	ENSP00000303830:E863K	E	-	1	0	INSR	7092783	0.999000	0.42202	0.994000	0.49952	0.156000	0.22039	4.271000	0.58902	2.464000	0.83262	0.650000	0.86243	GAG		0.502	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			10	56	0	0	0	0.008291	0	10	56				
MUC16	94025	broad.mit.edu	37	19	9077470	9077470	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:9077470C>T	ENST00000397910.4	-	3	10179	c.9976G>A	c.(9976-9978)Ggg>Agg	p.G3326R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3327	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGACCAGTCCCTGTGATGCTT	0.517																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(9976-9978)GGG>AGG		mucin 16							120.0	114.0	116.0					19																	9077470		2016	4179	6195	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9077470C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9976G>A	19.37:g.9077470C>T	ENSP00000381008:p.Gly3326Arg						p.G3326R	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	10180	-			3327			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.9976G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	4.367	0.067645	0.08436	.	.	ENSG00000181143	ENST00000397910	T	0.03607	3.87	1.94	0.854	0.19007	.	.	.	.	.	T	0.02533	0.0077	N	0.08118	0	.	.	.	D	0.54047	0.964	P	0.45037	0.467	T	0.44298	-0.9337	8	0.87932	D	0	.	6.4016	0.21642	0.0:0.6919:0.3081:0.0	.	3326	B5ME49	.	R	3326	ENSP00000381008:G3326R	ENSP00000381008:G3326R	G	-	1	0	MUC16	8938470	0.001000	0.12720	0.003000	0.11579	0.067000	0.16453	-0.553000	0.06012	0.346000	0.23899	0.205000	0.17691	GGG		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		49	37	0	0	0	0.00361	0	49	37				
MUC16	94025	broad.mit.edu	37	19	9082874	9082874	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:9082874C>A	ENST00000397910.4	-	1	9144	c.8941G>T	c.(8941-8943)Gga>Tga	p.G2981*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2982	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCCCTGTTCCTGAAGTGGGG	0.498																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(8941-8943)GGA>TGA		mucin 16							109.0	110.0	110.0					19																	9082874		2056	4230	6286	SO:0001587	stop_gained	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9082874C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8941G>T	19.37:g.9082874C>A	ENSP00000381008:p.Gly2981*						p.G2981*	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	9145	-			2982			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	c.8941G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	49	15.951292	0.99850	.	.	ENSG00000181143	ENST00000397910	.	.	.	0.733	-0.525	0.11917	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.1045	0.06337	0.0:0.6378:0.0:0.3622	.	.	.	.	X	2981	.	ENSP00000381008:G2981X	G	-	1	0	MUC16	8943874	0.004000	0.15560	0.003000	0.11579	0.039000	0.13416	-0.270000	0.08584	-0.154000	0.11118	0.306000	0.20318	GGA		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		47	53	1	0	6.81593e-30	0.00361	8.99506e-30	47	53				
RAVER1	125950	broad.mit.edu	37	19	10431489	10431489	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:10431489G>C	ENST00000293677.6	-	9	1744	c.1663C>G	c.(1663-1665)Cca>Gca	p.P555A	CTD-2369P2.12_ENST00000586529.1_5'Flank	NM_133452.2	NP_597709.2	Q8IY67	RAVR1_HUMAN	ribonucleoprotein, PTB-binding 1	0						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	18			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			CCCTCAGCTGGGCGGCGGCTT	0.697																																							uc002moa.2		NA																	0				ovary(1)	1						c.(1663-1665)CCA>GCA		RAVER1							5.0	6.0	6.0					19																	10431489		1662	3765	5427	SO:0001583	missense	125950					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding	g.chr19:10431489G>C		CCDS45960.1	19p13.2	2013-02-12				ENSG00000161847		"""RNA binding motif (RRM) containing"""	30296	protein-coding gene	gene with protein product		609950				11853319, 11724819	Standard	NM_133452		Approved	KIAA1978	uc002moa.3	Q8IY67		ENST00000293677.6:c.1663C>G	19.37:g.10431489G>C	ENSP00000293677:p.Pro555Ala					RAVER1_uc002mnz.2_5'Flank	p.P555A	NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)		9	1743	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NMU4|Q8IY60|Q8TF24	Missense_Mutation	SNP	ENST00000293677.6	37	c.1663C>G	CCDS45960.1	.	.	.	.	.	.	.	.	.	.	G	6.597	0.478456	0.12521	.	.	ENSG00000161847	ENST00000293677	T	0.12147	2.71	4.29	1.96	0.26148	.	0.579319	0.13346	U	0.394799	T	0.06096	0.0158	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.12156	0.007	T	0.37126	-0.9719	10	0.19590	T	0.45	-4.6112	7.6177	0.28167	0.0:0.1759:0.6445:0.1796	.	555	E9PAU2	.	A	555	ENSP00000293677:P555A	ENSP00000293677:P555A	P	-	1	0	RAVER1	10292489	0.573000	0.26676	0.967000	0.41034	0.715000	0.41141	1.155000	0.31700	1.951000	0.56629	0.561000	0.74099	CCA		0.697	RAVER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451227.1	NM_133452		5	11	0	0	0	0.000602	0	5	11				
USE1	55850	broad.mit.edu	37	19	17330079	17330079	+	Silent	SNP	C	C	T	rs371303603		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:17330079C>T	ENST00000263897.5	+	7	527	c.480C>T	c.(478-480)ctC>ctT	p.L160L	USE1_ENST00000379776.4_Intron|USE1_ENST00000596136.1_Intron|USE1_ENST00000445667.2_Silent_p.L160L	NM_018467.3	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog (S. cerevisiae)	160					endoplasmic reticulum tubular network organization (GO:0071786)|lysosomal transport (GO:0007041)|protein catabolic process (GO:0030163)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|secretion by cell (GO:0032940)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|lung(3)	6						AGCTAGACCTCGTCCTGCAGC	0.592													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15399	0.0		0.0	False		,,,				2504	0.0						uc002nfo.2		NA																	0					0						c.(478-480)CTC>CTT		unconventional SNARE in the ER 1 homolog		C		0,4098		0,0,2049	49.0	55.0	53.0		480	-0.4	1.0	19		53	2,8380		0,2,4189	no	coding-synonymous	USE1	NM_018467.3		0,2,6238	TT,TC,CC		0.0239,0.0,0.016		160/260	17330079	2,12478	2049	4191	6240	SO:0001819	synonymous_variant	55850				lysosomal transport|protein catabolic process|protein transport|secretion by cell|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr19:17330079C>T	AF220052	CCDS46011.1	19p13.11	2007-08-20				ENSG00000053501			30882	protein-coding gene	gene with protein product	"""Q-SNARE"", ""SNARE-like tail-anchored protein 1 homolog (S. cerevisiae)"""	610675				16354670, 15029241	Standard	NM_018467		Approved	p31, SLT1, MDS032	uc002nfo.2	Q9NZ43		ENST00000263897.5:c.480C>T	19.37:g.17330079C>T						USE1_uc010eal.1_Intron	p.L160L	NM_018467	NP_060937	Q9NZ43	USE1_HUMAN			7	540	+			160			Cytoplasmic (Potential).|Potential.		Q8NCK1|Q9BRT4	Silent	SNP	ENST00000263897.5	37	c.480C>T	CCDS46011.1																																																																																				0.592	USE1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463295.1	NM_018467		5	30	0	0	0	0.000602	0	5	30				
CRLF1	9244	broad.mit.edu	37	19	18710483	18710483	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:18710483C>A	ENST00000392386.3	-	2	482	c.289G>T	c.(289-291)Gct>Tct	p.A97S		NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	97	Ig-like C2-type.				negative regulation of motor neuron apoptotic process (GO:2000672)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|ureteric bud development (GO:0001657)	CRLF-CLCF1 complex (GO:0097058)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9						AGGGCCAGAGCCAAGGTGGAG	0.692																																							uc010ebt.1		NA																	0				central_nervous_system(1)	1						c.(289-291)GCT>TCT		cytokine receptor-like factor 1 precursor							24.0	23.0	23.0					19																	18710483		2201	4298	6499	SO:0001583	missense	9244				negative regulation of neuron apoptosis|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	cytokine binding|protein heterodimerization activity|receptor activity	g.chr19:18710483C>A	AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016		"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237				9686600	Standard	NM_004750		Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.289G>T	19.37:g.18710483C>A	ENSP00000376188:p.Ala97Ser						p.A97S	NM_004750	NP_004741	O75462	CRLF1_HUMAN			2	483	-			97			Ig-like C2-type.		Q9UHH5	Missense_Mutation	SNP	ENST00000392386.3	37	c.289G>T	CCDS32962.1	.	.	.	.	.	.	.	.	.	.	C	0.792	-0.758503	0.03019	.	.	ENSG00000006016	ENST00000392386	D	0.83673	-1.75	5.23	5.23	0.72850	Immunoglobulin-like fold (1);	0.099616	0.64402	D	0.000003	T	0.52581	0.1743	N	0.01352	-0.895	0.35993	D	0.836813	B	0.10296	0.003	B	0.08055	0.003	T	0.58808	-0.7571	10	0.02654	T	1	-35.2234	8.1755	0.31278	0.0:0.8282:0.0:0.1718	.	97	O75462	CRLF1_HUMAN	S	97	ENSP00000376188:A97S	ENSP00000376188:A97S	A	-	1	0	CRLF1	18571483	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	3.501000	0.53325	2.449000	0.82847	0.511000	0.50034	GCT		0.692	CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1			7	7	1	0	0.00198382	0.001984	0.00208643	7	7				
ZNF676	163223	broad.mit.edu	37	19	22362910	22362910	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:22362910C>G	ENST00000397121.2	-	3	1926	c.1609G>C	c.(1609-1611)Gaa>Caa	p.E537Q		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	537					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TTGCCACATTCTTCACATTTG	0.418																																							uc002nqs.1		NA																	0					0						c.(1609-1611)GAA>CAA		zinc finger protein 676							63.0	66.0	65.0					19																	22362910		2140	4261	6401	SO:0001583	missense	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22362910C>G	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1609G>C	19.37:g.22362910C>G	ENSP00000380310:p.Glu537Gln						p.E537Q	NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN			3	1927	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	537			C2H2-type 14.		A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	c.1609G>C	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	12.45	1.940396	0.34283	.	.	ENSG00000196109	ENST00000397121	T	0.07444	3.19	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05364	0.0142	N	0.21282	0.65	0.09310	N	1	P	0.47841	0.901	B	0.40702	0.338	T	0.40794	-0.9544	9	0.45353	T	0.12	.	7.3206	0.26526	0.0:0.7253:0.2747:0.0	.	537	Q8N7Q3	ZN676_HUMAN	Q	537	ENSP00000380310:E537Q	ENSP00000380310:E537Q	E	-	1	0	ZNF676	22154750	0.000000	0.05858	0.190000	0.23270	0.191000	0.23601	-2.000000	0.01466	0.181000	0.19994	0.184000	0.17185	GAA		0.418	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		14	43	0	0	0	0.003163	0	14	43				
TSHZ3	57616	broad.mit.edu	37	19	31769504	31769504	+	Nonsense_Mutation	SNP	G	G	A	rs577310091		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:31769504G>A	ENST00000240587.4	-	2	1522	c.1195C>T	c.(1195-1197)Cag>Tag	p.Q399*		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	399					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTGAGCTCCTGCAGGGTGTCA	0.572																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(1195-1197)CAG>TAG		zinc finger protein 537							154.0	143.0	147.0					19																	31769504		2203	4300	6503	SO:0001587	stop_gained	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31769504G>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1195C>T	19.37:g.31769504G>A	ENSP00000240587:p.Gln399*						p.Q399*	NM_020856	NP_065907	Q63HK5	TSH3_HUMAN			2	1260	-	Esophageal squamous(110;0.226)		399			C2H2-type 3; atypical.		Q9H0G6|Q9P254	Nonsense_Mutation	SNP	ENST00000240587.4	37	c.1195C>T	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	38	7.187180	0.98121	.	.	ENSG00000121297	ENST00000240587	.	.	.	5.73	4.69	0.59074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-35.3376	14.4647	0.67475	0.0704:0.0:0.9296:0.0	.	.	.	.	X	399	.	ENSP00000240587:Q399X	Q	-	1	0	TSHZ3	36461344	1.000000	0.71417	0.994000	0.49952	0.956000	0.61745	9.441000	0.97557	1.411000	0.46957	0.655000	0.94253	CAG		0.572	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		118	75	0	0	0	0.00361	0	118	75				
PDCD5	9141	broad.mit.edu	37	19	33076808	33076808	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:33076808G>A	ENST00000590247.2	+	4	447	c.253G>A	c.(253-255)Gag>Aag	p.E85K	PDCD5_ENST00000419343.3_Missense_Mutation_p.E85K|PDCD5_ENST00000379316.3_Intron|PDCD5_ENST00000586035.1_Missense_Mutation_p.E47K|PDCD5_ENST00000592786.1_Intron	NM_004708.3	NP_004699.1	O14737	PDCD5_HUMAN	programmed cell death 5	85					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|large_intestine(2)|lung(1)|ovary(1)	5	Esophageal squamous(110;0.137)					ACAACTAAGTGAGAAGGTAAG	0.358																																							uc002ntm.2		NA																	0		p.E85D(1)		ovary(1)|lung(1)	2						c.(253-255)GAG>AAG		programmed cell death 5							103.0	108.0	106.0					19																	33076808		2203	4300	6503	SO:0001583	missense	9141				apoptosis|induction of apoptosis	cytoplasm|nucleus	DNA binding	g.chr19:33076808G>A	AF014955	CCDS12423.1	19q13.11	2012-10-15			ENSG00000105185	ENSG00000105185			8764	protein-coding gene	gene with protein product	"""TFAR19 novel apoptosis-related"", ""TF1 cell apoptosis-related gene 19"""	604583				9920759	Standard	NM_004708		Approved	TFAR19, MGC9294	uc002ntm.3	O14737	OTTHUMG00000180224	ENST00000590247.2:c.253G>A	19.37:g.33076808G>A	ENSP00000466214:p.Glu85Lys					PDCD5_uc002ntl.2_Missense_Mutation_p.E85K|PDCD5_uc010ede.2_Intron	p.E85K	NM_004708	NP_004699	O14737	PDCD5_HUMAN			4	317	+	Esophageal squamous(110;0.137)		85					B4DE64|Q53YC9|Q6IB70	Missense_Mutation	SNP	ENST00000590247.2	37	c.253G>A	CCDS12423.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058514	0.76074	.	.	ENSG00000105185	ENST00000419343;ENST00000221784	.	.	.	5.6	5.6	0.85130	.	0.148836	0.64402	D	0.000011	T	0.54415	0.1857	L	0.28649	0.875	0.39615	D	0.969943	B;B	0.22683	0.044;0.073	B;B	0.32980	0.156;0.05	T	0.50039	-0.8874	9	0.11485	T	0.65	-14.8081	18.188	0.89798	0.0:0.0:1.0:0.0	.	85;85	O14737;B4DE64	PDCD5_HUMAN;.	K	85	.	ENSP00000221784:E85K	E	+	1	0	PDCD5	37768648	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	8.317000	0.89987	2.618000	0.88619	0.563000	0.77884	GAG		0.358	PDCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450320.2	NM_004708		75	42	0	0	0	0.00361	0	75	42				
ZNF461	92283	broad.mit.edu	37	19	37130289	37130289	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:37130289G>A	ENST00000588268.1	-	6	1185	c.958C>T	c.(958-960)Cag>Tag	p.Q320*	ZNF461_ENST00000360357.4_Nonsense_Mutation_p.Q297*|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TGAAGTCTCTGATGTTGAGTA	0.413																																							uc002oem.2		NA																	0					0						c.(958-960)CAG>TAG		gonadotropin inducible transcription repressor							54.0	59.0	57.0					19																	37130289		2202	4300	6502	SO:0001587	stop_gained	92283				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37130289G>A	BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.958C>T	19.37:g.37130289G>A	ENSP00000467931:p.Gln320*					ZNF461_uc002oen.2_Nonsense_Mutation_p.Q289*|ZNF461_uc010xtj.1_Nonsense_Mutation_p.Q297*	p.Q320*	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		6	1186	-	Esophageal squamous(110;0.198)		320			C2H2-type 4.		A8K9W9|Q6VSF7|Q9ULZ8	Nonsense_Mutation	SNP	ENST00000588268.1	37	c.958C>T	CCDS54257.1	.	.	.	.	.	.	.	.	.	.	G	38	6.652869	0.97734	.	.	ENSG00000197808	ENST00000396893;ENST00000396896;ENST00000360357;ENST00000540605	.	.	.	3.6	3.6	0.41247	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	14.4924	0.67660	0.0:0.0:1.0:0.0	.	.	.	.	X	320;51;297;193	.	ENSP00000353515:Q297X	Q	-	1	0	ZNF461	41822129	0.447000	0.25673	1.000000	0.80357	0.979000	0.70002	0.837000	0.27558	2.007000	0.58848	0.585000	0.79938	CAG		0.413	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453202.1	NM_153257		8	30	0	0	0	0.00308	0	8	30				
ZNF461	92283	broad.mit.edu	37	19	37130448	37130448	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:37130448G>A	ENST00000588268.1	-	6	1026	c.799C>T	c.(799-801)Cat>Tat	p.H267Y	ZNF461_ENST00000360357.4_Missense_Mutation_p.H244Y|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TCACCATTATGAATTCTTAGA	0.353																																							uc002oem.2		NA																	0					0						c.(799-801)CAT>TAT		gonadotropin inducible transcription repressor							55.0	60.0	58.0					19																	37130448		2149	4264	6413	SO:0001583	missense	92283				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37130448G>A	BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.799C>T	19.37:g.37130448G>A	ENSP00000467931:p.His267Tyr					ZNF461_uc002oen.2_Missense_Mutation_p.H236Y|ZNF461_uc010xtj.1_Missense_Mutation_p.H244Y	p.H267Y	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		6	1027	-	Esophageal squamous(110;0.198)		267			C2H2-type 2.		A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	ENST00000588268.1	37	c.799C>T	CCDS54257.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455841	0.26161	.	.	ENSG00000197808	ENST00000396893;ENST00000360357;ENST00000540605	T	0.67523	-0.27	3.71	0.342	0.15996	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84142	0.5407	H	0.95504	3.68	0.22827	N	0.998682	B;D;B	0.71674	0.02;0.998;0.035	B;D;B	0.79108	0.012;0.992;0.02	T	0.71745	-0.4500	9	0.87932	D	0	.	7.856	0.29483	0.2898:0.0:0.7102:0.0	.	244;189;267	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	Y	267;244;140	ENSP00000353515:H244Y	ENSP00000353515:H244Y	H	-	1	0	ZNF461	41822288	0.998000	0.40836	0.021000	0.16686	0.651000	0.38670	2.564000	0.45931	0.053000	0.16036	0.585000	0.79938	CAT		0.353	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453202.1	NM_153257		6	39	0	0	0	0.001168	0	6	39				
ZNF573	126231	broad.mit.edu	37	19	38229543	38229543	+	Silent	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:38229543C>A	ENST00000590414.2	-	4	1869	c.1848G>T	c.(1846-1848)ggG>ggT	p.G616G	ZNF573_ENST00000339503.4_Silent_p.G558G|ZNF573_ENST00000392138.1_Silent_p.G529G|ZNF573_ENST00000357309.3_Silent_p.G528G|ZNF573_ENST00000536220.1_Silent_p.G528G			Q86YE8	ZN573_HUMAN	zinc finger protein 573	616					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TGAAGGCCTTCCCACATTCTT	0.393																																							uc002ohe.2		NA																	0				ovary(1)	1						c.(1846-1848)GGG>GGT		zinc finger protein 573							89.0	90.0	89.0					19																	38229543		2203	4300	6503	SO:0001819	synonymous_variant	126231				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38229543C>A	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1848G>T	19.37:g.38229543C>A						ZNF573_uc010efs.2_Silent_p.G529G|ZNF573_uc002ohd.2_Silent_p.G614G|ZNF573_uc002ohf.2_Silent_p.G558G|ZNF573_uc002ohg.2_Silent_p.G528G	p.G616G	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)		4	1870	-			596			C2H2-type 18.		B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Silent	SNP	ENST00000590414.2	37	c.1848G>T	CCDS59381.1																																																																																				0.393	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360		77	31	1	0	1.07363e-35	0.00361	1.44113e-35	77	31				
PRR19	284338	broad.mit.edu	37	19	42814213	42814213	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:42814213G>A	ENST00000499536.2	+	1	1288	c.477G>A	c.(475-477)caG>caA	p.Q159Q	PRR19_ENST00000598490.1_Silent_p.Q159Q|PRR19_ENST00000341747.3_Silent_p.Q159Q			A6NJB7	PRR19_HUMAN	proline rich 19	159										NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				GTTTGCCACAGGCCTTCCCCC	0.632																																							uc002oti.2		NA																	0					0						c.(475-477)CAG>CAA		proline rich 19							49.0	49.0	49.0					19																	42814213		2203	4300	6503	SO:0001819	synonymous_variant	284338							g.chr19:42814213G>A	AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.477G>A	19.37:g.42814213G>A						PRR19_uc002oth.1_Silent_p.Q159Q|PRR19_uc002otj.2_Silent_p.Q159Q	p.Q159Q	NM_199285	NP_954979	A6NJB7	PRR19_HUMAN			2	855	+		Prostate(69;0.00682)	159					A8K663|B3KW48|Q6P584	Silent	SNP	ENST00000499536.2	37	c.477G>A	CCDS33036.1																																																																																				0.632	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285		55	24	0	0	0	0.00361	0	55	24				
PHLDB3	653583	broad.mit.edu	37	19	44005962	44005962	+	Missense_Mutation	SNP	C	C	T	rs200443446		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:44005962C>T	ENST00000292140.5	-	4	818	c.458G>A	c.(457-459)cGg>cAg	p.R153Q	PHLDB3_ENST00000599242.1_Missense_Mutation_p.R153Q	NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	153							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				CTCCTCCTCCCGGCGAGCGGC	0.711																																							uc002own.3		NA																	0					0						c.(457-459)CGG>CAG		pleckstrin homology-like domain, family B,							8.0	10.0	9.0					19																	44005962		2166	4214	6380	SO:0001583	missense	653583							g.chr19:44005962C>T		CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.458G>A	19.37:g.44005962C>T	ENSP00000292140:p.Arg153Gln					PHLDB3_uc002owo.2_Missense_Mutation_p.R153Q	p.R153Q	NM_198850	NP_942147	Q6NSJ2	PHLB3_HUMAN			4	717	-		Prostate(69;0.0153)	153			Potential.		Q8N7Z4	Missense_Mutation	SNP	ENST00000292140.5	37	c.458G>A	CCDS12621.2	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511773	0.85389	.	.	ENSG00000176531	ENST00000292140	T	0.44482	0.92	4.93	3.89	0.44902	.	0.829067	0.10580	N	0.658086	T	0.55832	0.1945	L	0.46157	1.445	0.23416	N	0.997728	D;D	0.89917	1.0;0.997	D;P	0.72338	0.977;0.791	T	0.40327	-0.9569	10	0.66056	D	0.02	.	9.4906	0.38958	0.0:0.9005:0.0:0.0995	.	153;153	Q6NSJ2-2;Q6NSJ2	.;PHLB3_HUMAN	Q	153	ENSP00000292140:R153Q	ENSP00000292140:R153Q	R	-	2	0	PHLDB3	48697802	0.996000	0.38824	0.992000	0.48379	0.941000	0.58515	1.081000	0.30791	1.215000	0.43411	0.306000	0.20318	CGG		0.711	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319643.2			13	10	0	0	0	0.001368	0	13	10				
ZNF234	10780	broad.mit.edu	37	19	44661636	44661636	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:44661636C>A	ENST00000426739.2	+	6	1725	c.1467C>A	c.(1465-1467)tgC>tgA	p.C489*	ZNF234_ENST00000592437.1_Nonsense_Mutation_p.C489*	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				GTGAAGAGTGCGGAAAGGGAT	0.453																																							uc002oym.2		NA																	0					0						c.(1465-1467)TGC>TGA		zinc finger protein 234							77.0	79.0	78.0					19																	44661636		2078	4250	6328	SO:0001587	stop_gained	10780				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44661636C>A	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1467C>A	19.37:g.44661636C>A	ENSP00000400878:p.Cys489*					ZNF234_uc002oyl.3_Nonsense_Mutation_p.C489*	p.C489*	NM_006630	NP_006621	Q14588	ZN234_HUMAN			6	1774	+		Prostate(69;0.0435)	489			C2H2-type 13.		A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Nonsense_Mutation	SNP	ENST00000426739.2	37	c.1467C>A	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	C	32	5.156705	0.94686	.	.	ENSG00000167380	ENST00000426739	.	.	.	4.12	-0.416	0.12351	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7213	0.40304	0.0:0.2413:0.0:0.7587	.	.	.	.	X	489	.	ENSP00000400878:C489X	C	+	3	2	ZNF226	49353476	0.520000	0.26250	0.609000	0.28983	0.350000	0.29205	-0.348000	0.07740	-0.294000	0.08973	-2.427000	0.00216	TGC		0.453	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2			62	29	1	0	1.4709e-25	0.00361	1.91356e-25	62	29				
ZNF227	7770	broad.mit.edu	37	19	44739918	44739918	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:44739918C>G	ENST00000313040.7	+	6	1540	c.1335C>G	c.(1333-1335)ttC>ttG	p.F445L	ZNF227_ENST00000391961.2_Missense_Mutation_p.F394L|ZNF227_ENST00000589005.1_Missense_Mutation_p.F394L	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				GTAAGGGCTTCAGCCACAATT	0.483																																							uc002oyu.2		NA																	0				ovary(1)	1						c.(1333-1335)TTC>TTG		zinc finger protein 227							90.0	89.0	89.0					19																	44739918		2203	4300	6503	SO:0001583	missense	7770				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44739918C>G	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1335C>G	19.37:g.44739918C>G	ENSP00000321049:p.Phe445Leu					ZNF227_uc010xwu.1_Missense_Mutation_p.F394L|ZNF227_uc002oyv.2_Missense_Mutation_p.F445L|ZNF227_uc010xwv.1_Missense_Mutation_p.F394L|ZNF227_uc010xww.1_Missense_Mutation_p.F366L|ZNF227_uc002oyw.2_Missense_Mutation_p.F417L|ZNF227_uc010ejh.2_Missense_Mutation_p.F438L|ZNF235_uc002oyx.1_Intron	p.F445L	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN			6	1540	+		Prostate(69;0.0435)	445			C2H2-type 7.		B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	c.1335C>G	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730368	0.69074	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.46063	0.88;0.88	4.55	2.4	0.29515	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.65554	0.2702	M	0.90082	3.085	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.81914	0.992;0.989;0.993;0.995	T	0.66208	-0.5981	9	0.87932	D	0	.	7.7074	0.28659	0.0:0.7304:0.0:0.2696	.	366;424;397;445	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	L	445;402;394;424;146	ENSP00000321049:F445L;ENSP00000375823:F394L	ENSP00000321049:F445L	F	+	3	2	ZNF227	49431758	0.031000	0.19500	1.000000	0.80357	0.992000	0.81027	-0.045000	0.12003	0.459000	0.27016	0.563000	0.77884	TTC		0.483	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490		37	73	0	0	0	0.004878	0	37	73				
ZNF227	7770	broad.mit.edu	37	19	44740270	44740270	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:44740270C>G	ENST00000313040.7	+	6	1892	c.1687C>G	c.(1687-1689)Ctt>Gtt	p.L563V	ZNF235_ENST00000589799.1_3'UTR|ZNF227_ENST00000391961.2_Missense_Mutation_p.L512V|ZNF227_ENST00000589005.1_Missense_Mutation_p.L512V	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	563					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				TAGTTCAAATCTTAAACTACA	0.408																																							uc002oyu.2		NA																	0				ovary(1)	1						c.(1687-1689)CTT>GTT		zinc finger protein 227							71.0	77.0	75.0					19																	44740270		2203	4300	6503	SO:0001583	missense	7770				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44740270C>G	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1687C>G	19.37:g.44740270C>G	ENSP00000321049:p.Leu563Val					ZNF227_uc010xwu.1_Missense_Mutation_p.L512V|ZNF227_uc002oyv.2_Missense_Mutation_p.L563V|ZNF227_uc010xwv.1_Missense_Mutation_p.L512V|ZNF227_uc010xww.1_Missense_Mutation_p.L484V|ZNF227_uc002oyw.2_Missense_Mutation_p.L535V|ZNF227_uc010ejh.2_Missense_Mutation_p.L556V|ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_3'UTR	p.L563V	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN			6	1892	+		Prostate(69;0.0435)	563			C2H2-type 11.		B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	c.1687C>G	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	C	11.63	1.696419	0.30142	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980	T;T	0.52983	0.64;0.64	4.4	0.822	0.18806	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.65668	0.2713	M	0.85299	2.745	0.24421	N	0.994614	P;P;D;P	0.67145	0.846;0.941;0.996;0.941	P;P;D;P	0.81914	0.511;0.511;0.995;0.511	T	0.53194	-0.8473	9	0.87932	D	0	.	4.9197	0.13864	0.1527:0.6145:0.1478:0.0849	.	484;542;515;563	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	V	563;520;512;542	ENSP00000321049:L563V;ENSP00000375823:L512V	ENSP00000321049:L563V	L	+	1	0	ZNF227	49432110	0.755000	0.28372	0.005000	0.12908	0.603000	0.37013	1.472000	0.35376	0.039000	0.15632	0.655000	0.94253	CTT		0.408	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490		24	42	0	0	0	0.00333	0	24	42				
LRRC4B	94030	broad.mit.edu	37	19	51022063	51022063	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:51022063G>A	ENST00000599957.1	-	3	1104	c.907C>T	c.(907-909)Ctc>Ttc	p.L303F	LRRC4B_ENST00000389201.3_Missense_Mutation_p.L303F			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	303					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		ACGCGCTCGAGGCGGTGCAGG	0.637																																							uc002pss.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(907-909)CTC>TTC		leucine rich repeat containing 4B precursor							84.0	99.0	94.0					19																	51022063		2169	4260	6429	SO:0001583	missense	94030					cell junction|integral to membrane|presynaptic membrane		g.chr19:51022063G>A	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.907C>T	19.37:g.51022063G>A	ENSP00000471502:p.Leu303Phe						p.L303F	NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)	3	1044	-		all_neural(266;0.131)	303			Extracellular (Potential).		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	c.907C>T	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878706	0.72294	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	D	0.82711	-1.64	3.7	3.7	0.42460	.	0.000000	0.64402	U	0.000008	D	0.94228	0.8147	H	0.98525	4.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.95843	0.8868	10	0.87932	D	0	.	13.3505	0.60599	0.0:0.0:1.0:0.0	.	303	Q9NT99	LRC4B_HUMAN	F	303	ENSP00000373853:L303F	ENSP00000373853:L303F	L	-	1	0	LRRC4B	55713875	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	6.486000	0.73629	2.084000	0.62774	0.561000	0.74099	CTC		0.637	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457		87	44	0	0	0	0.00361	0	87	44				
LILRA6	79168	broad.mit.edu	37	19	54744411	54744411	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:54744411G>T	ENST00000396365.2	-	6	1036	c.997C>A	c.(997-999)Ccc>Acc	p.P333T	LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000245621.5_Missense_Mutation_p.P333T|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000419410.2_Missense_Mutation_p.P333T	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	333	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCCACTGTGGGGCCCGGCTGT	0.592																																							uc002qeu.1		NA																	0				skin(2)	2						c.(997-999)CCC>ACC		leukocyte immunoglobulin-like receptor,							18.0	30.0	26.0					19																	54744411		2124	4265	6389	SO:0001583	missense	79168					integral to membrane	receptor activity	g.chr19:54744411G>T	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.997C>A	19.37:g.54744411G>T	ENSP00000379651:p.Pro333Thr					LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Missense_Mutation_p.P333T|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Missense_Mutation_p.P333T|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Missense_Mutation_p.P333T|LILRA6_uc010yeq.1_Missense_Mutation_p.P333T|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Missense_Mutation_p.P194T	p.P333T	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	6	1121	-	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		333			Extracellular (Potential).|Ig-like C2-type 2.			Missense_Mutation	SNP	ENST00000396365.2	37	c.997C>A	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900087	0.33535	.	.	ENSG00000244482	ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T	0.03272	3.99;3.99;3.99	2.16	1.08	0.20341	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.940397	0.08726	N	0.902830	T	0.19644	0.0472	M	0.92970	3.365	0.09310	N	1	D;D;D	0.76494	0.998;0.991;0.999	D;P;D	0.74023	0.982;0.886;0.982	T	0.06356	-1.0831	10	0.48119	T	0.1	.	4.6478	0.12580	0.1952:0.0:0.8048:0.0	.	333;333;333	C9JFH3;Q6PI73;D3YTC4	.;LIRA6_HUMAN;.	T	333	ENSP00000411227:P333T;ENSP00000379651:P333T;ENSP00000245621:P333T	ENSP00000245621:P333T	P	-	1	0	LILRA6	59436223	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	0.268000	0.18571	0.457000	0.26962	0.195000	0.17529	CCC		0.592	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318		33	48	1	0	1.07121e-22	0.006999	1.3805e-22	33	48				
LILRA4	23547	broad.mit.edu	37	19	54849257	54849257	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:54849257G>T	ENST00000291759.4	-	4	661	c.605C>A	c.(604-606)aCc>aAc	p.T202N	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	202	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CACGTATGGGGTGTTGTTTTC	0.552																																							uc002qfj.2		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(604-606)ACC>AAC		leukocyte immunoglobulin-like receptor subfamily							92.0	78.0	83.0					19																	54849257		2203	4300	6503	SO:0001583	missense	23547					integral to membrane	receptor activity	g.chr19:54849257G>T	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.605C>A	19.37:g.54849257G>T	ENSP00000291759:p.Thr202Asn					LILRA4_uc002qfi.2_Missense_Mutation_p.T136N	p.T202N	NM_012276	NP_036408	P59901	LIRA4_HUMAN		GBM - Glioblastoma multiforme(193;0.0565)	4	662	-	Ovarian(34;0.19)		202			Extracellular (Potential).|Ig-like C2-type 2.		Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	c.605C>A	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	2.812	-0.246752	0.05867	.	.	ENSG00000239961	ENST00000291759	T	0.00737	5.76	2.38	-4.77	0.03219	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.476350	0.01416	N	0.014186	T	0.00608	0.0020	N	0.21583	0.68	0.09310	N	1	B	0.20780	0.048	B	0.13407	0.009	T	0.47898	-0.9081	10	0.22109	T	0.4	.	1.8885	0.03243	0.1352:0.2759:0.3973:0.1915	.	202	P59901	LIRA4_HUMAN	N	202	ENSP00000291759:T202N	ENSP00000291759:T202N	T	-	2	0	LILRA4	59541069	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.409000	0.01041	-1.215000	0.02610	-0.251000	0.11542	ACC		0.552	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276		42	21	1	0	1.03325e-14	0.011902	1.28337e-14	42	21				
ZNF835	90485	broad.mit.edu	37	19	57175427	57175427	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:57175427G>A	ENST00000537055.2	-	2	1371	c.1140C>T	c.(1138-1140)caC>caT	p.H380H		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						GCACGAGGCGGTGCTGGAGGA	0.672																																							uc010ygo.1		NA																	0				pancreas(3)|skin(1)	4						c.(1204-1206)CAC>CAT		zinc finger protein 835							25.0	27.0	26.0					19																	57175427		2194	4292	6486	SO:0001819	synonymous_variant	90485							g.chr19:57175427G>A	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1140C>T	19.37:g.57175427G>A						ZNF835_uc010ygn.1_Silent_p.H380H	p.H402H	NM_001005850	NP_001005850					2	1206	-								B7Z5Y0|G3V1S0	Silent	SNP	ENST00000537055.2	37	c.1206C>T	CCDS56105.1																																																																																				0.672	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850		33	28	0	0	0	0.012213	0	33	28				
PEG3	5178	broad.mit.edu	37	19	57328382	57328382	+	Silent	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:57328382T>C	ENST00000326441.9	-	10	1791	c.1428A>G	c.(1426-1428)agA>agG	p.R476R	ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Silent_p.R350R|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000423103.2_Silent_p.R476R|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Silent_p.R352R	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	476					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGAGGTTCTCTCTAGTATGCA	0.438																																							uc002qnu.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(1426-1428)AGA>AGG		paternally expressed 3 isoform 1							193.0	168.0	177.0					19																	57328382		2203	4300	6503	SO:0001819	synonymous_variant	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57328382T>C	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1428A>G	19.37:g.57328382T>C						ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Silent_p.R447R|PEG3_uc002qnv.2_Silent_p.R476R|PEG3_uc002qnw.2_Silent_p.R352R|PEG3_uc002qnx.2_Silent_p.R350R|PEG3_uc010etr.2_Silent_p.R476R	p.R476R	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	1779	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	476					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	37	c.1428A>G	CCDS12948.1																																																																																				0.438	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			118	54	0	0	0	0.00361	0	118	54				
ZIM3	114026	broad.mit.edu	37	19	57646645	57646645	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr19:57646645C>A	ENST00000269834.1	-	5	1445	c.1060G>T	c.(1060-1062)Gag>Tag	p.E354*	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	354					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGAATTTTCTCATGATCGATG	0.383																																							uc002qnz.1		NA																	0				pancreas(1)|skin(1)	2						c.(1060-1062)GAG>TAG		zinc finger, imprinted 3							162.0	160.0	161.0					19																	57646645		2203	4300	6503	SO:0001587	stop_gained	114026				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57646645C>A	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.1060G>T	19.37:g.57646645C>A	ENSP00000269834:p.Glu354*						p.E354*	NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	5	1446	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)	354			C2H2-type 7.		Q14CA6	Nonsense_Mutation	SNP	ENST00000269834.1	37	c.1060G>T	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.312927	0.81358	.	.	ENSG00000141946	ENST00000269834	.	.	.	2.71	0.195	0.15151	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	4.3779	0.11279	0.0:0.4596:0.3869:0.1534	.	.	.	.	X	354	.	ENSP00000269834:E354X	E	-	1	0	ZIM3	62338457	0.002000	0.14202	0.279000	0.24732	0.090000	0.18270	0.730000	0.26043	0.464000	0.27142	0.313000	0.20887	GAG		0.383	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1			73	46	1	0	7.59065e-32	0.00361	1.01147e-31	73	46				
PDIA6	10130	broad.mit.edu	37	2	10932003	10932003	+	Missense_Mutation	SNP	C	C	T	rs528723508	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:10932003C>T	ENST00000272227.3	-	6	649	c.502G>A	c.(502-504)Gac>Aac	p.D168N	PDIA6_ENST00000381611.4_Missense_Mutation_p.D173N|PDIA6_ENST00000404824.2_Missense_Mutation_p.D216N|PDIA6_ENST00000540494.1_Missense_Mutation_p.D165N|PDIA6_ENST00000404371.2_Missense_Mutation_p.D220N	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	168	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		TCAAAGCTGTCGTCTGTCAGC	0.398													C|||	8	0.00159744	0.0	0.0	5008	,	,		21478	0.0		0.0	False		,,,				2504	0.0082				GBM(73;509 1219 34219 41343 41551)	GBM(73;509 1219 34219 41343 41551)	uc002rau.2		NA																	0					0						c.(502-504)GAC>AAC		protein disulfide isomerase A6 precursor							281.0	207.0	232.0					2																	10932003		2203	4300	6503	SO:0001583	missense	10130				cell redox homeostasis|glycerol ether metabolic process|protein folding	endoplasmic reticulum lumen|ER-Golgi intermediate compartment|melanosome|plasma membrane	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr2:10932003C>T	BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.502G>A	2.37:g.10932003C>T	ENSP00000272227:p.Asp168Asn					PDIA6_uc010yjg.1_Missense_Mutation_p.D165N|PDIA6_uc002rav.2_Missense_Mutation_p.D220N|PDIA6_uc010yjh.1_Missense_Mutation_p.D173N|PDIA6_uc002raw.2_Missense_Mutation_p.D216N	p.D168N	NM_005742	NP_005733	Q15084	PDIA6_HUMAN		Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)	6	640	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		168			Thioredoxin 2.		B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	ENST00000272227.3	37	c.502G>A	CCDS1675.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020246	0.54576	.	.	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.54	4.65	0.58169	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.000000	0.85682	D	0.000000	T	0.52581	0.1743	L	0.28504	0.86	0.80722	D	1	P;B;B;D	0.76494	0.926;0.28;0.144;0.999	P;B;B;D	0.85130	0.666;0.146;0.102;0.997	T	0.52571	-0.8558	10	0.40728	T	0.16	.	15.9363	0.79712	0.1363:0.8637:0.0:0.0	.	165;216;220;168	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	N	168;220;216;165;173	ENSP00000272227:D168N;ENSP00000385385:D220N;ENSP00000384459:D216N;ENSP00000438778:D165N;ENSP00000371024:D173N	ENSP00000272227:D168N	D	-	1	0	PDIA6	10849454	1.000000	0.71417	0.775000	0.31657	0.376000	0.30014	6.050000	0.71063	1.451000	0.47736	0.655000	0.94253	GAC		0.398	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1	NM_005742		8	39	0	0	0	0.00308	0	8	39				
BIRC6	57448	broad.mit.edu	37	2	32774406	32774406	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:32774406C>T	ENST00000421745.2	+	65	13136	c.13002C>T	c.(13000-13002)gtC>gtT	p.V4334V		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4334					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TAAATCCCGTCAGTAGTGCGG	0.383																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	0				ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(13000-13002)GTC>GTT		baculoviral IAP repeat-containing 6							127.0	117.0	120.0					2																	32774406		2203	4300	6503	SO:0001819	synonymous_variant	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32774406C>T	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13002C>T	2.37:g.32774406C>T							p.V4334V	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN			65	13136	+	Acute lymphoblastic leukemia(172;0.155)		4334					Q9ULD1	Silent	SNP	ENST00000421745.2	37	c.13002C>T	CCDS33175.2																																																																																				0.383	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		6	86	0	0	0	0.001168	0	6	86				
PNPT1	87178	broad.mit.edu	37	2	55912132	55912132	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:55912132G>C	ENST00000447944.2	-	4	435	c.349C>G	c.(349-351)Ctg>Gtg	p.L117V		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	117					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCTCTTCTCAGATAGTTTGTG	0.353																																							uc002rzf.2		NA																	0					0						c.(349-351)CTG>GTG		polyribonucleotide nucleotidyltransferase 1							90.0	81.0	84.0					2																	55912132		2203	4300	6503	SO:0001583	missense	87178				mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding	g.chr2:55912132G>C	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.349C>G	2.37:g.55912132G>C	ENSP00000400646:p.Leu117Val					PNPT1_uc002rzg.2_RNA	p.L117V	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)		4	402	-			117					Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	c.349C>G	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350235	0.61183	.	.	ENSG00000138035	ENST00000447944	T	0.44482	0.92	5.25	5.25	0.73442	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.64402	D	0.000004	T	0.58609	0.2134	M	0.68317	2.08	0.46279	D	0.998966	D	0.57899	0.981	D	0.66084	0.941	T	0.59958	-0.7356	10	0.59425	D	0.04	-20.6512	10.7995	0.46480	0.1216:0.0:0.8784:0.0	.	117	Q8TCS8	PNPT1_HUMAN	V	117	ENSP00000400646:L117V	ENSP00000260604:L117V	L	-	1	2	PNPT1	55765636	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.456000	0.44997	2.611000	0.88343	0.563000	0.77884	CTG		0.353	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109		21	17	0	0	0	0.005443	0	21	17				
USP34	9736	broad.mit.edu	37	2	61416060	61416060	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:61416060C>G	ENST00000398571.2	-	79	10094	c.10018G>C	c.(10018-10020)Gaa>Caa	p.E3340Q	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3340					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GTTTTTCTTTCTTTGGCTTCT	0.408																																							uc002sbe.2		NA																	0				ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(10018-10020)GAA>CAA		ubiquitin specific protease 34							143.0	127.0	132.0					2																	61416060		1858	4104	5962	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61416060C>G	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.10018G>C	2.37:g.61416060C>G	ENSP00000381577:p.Glu3340Gln					USP34_uc002sbd.2_Missense_Mutation_p.E142Q	p.E3340Q	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		79	10040	-			3340					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.10018G>C	CCDS42686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.29|14.29	2.490773|2.490773	0.44249|0.44249	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000436269|ENST00000411912	T|.	0.03951|.	3.75|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.048369|.	0.85682|.	D|.	0.000000|.	T|T	0.56411|0.56411	0.1983|0.1983	N|N	0.22421|0.22421	0.69|0.69	0.54753|0.54753	D|D	0.999985|0.999985	B|.	0.34214|.	0.442|.	B|.	0.27076|.	0.076|.	T|T	0.49818|0.49818	-0.8899|-0.8899	10|5	0.41790|.	T|.	0.15|.	.|.	19.7619|19.7619	0.96323|0.96323	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3340|.	Q70CQ2|.	UBP34_HUMAN|.	Q|T	3188;3105;3340;218|1016	ENSP00000381577:E3340Q|.	ENSP00000263989:E3188Q|.	E|R	-|-	1|2	0|0	USP34|USP34	61269564|61269564	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.774000|6.774000	0.75012|0.75012	2.652000|2.652000	0.90054|0.90054	0.585000|0.585000	0.79938|0.79938	GAA|AGA		0.408	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			8	55	0	0	0	0.008291	0	8	55				
USP34	9736	broad.mit.edu	37	2	61622131	61622131	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:61622131C>G	ENST00000398571.2	-	5	686	c.610G>C	c.(610-612)Gaa>Caa	p.E204Q		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	204					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AATGGTACTTCTACATCCTGG	0.323																																							uc002sbe.2		NA																	0				ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(610-612)GAA>CAA		ubiquitin specific protease 34							76.0	65.0	68.0					2																	61622131		1834	4086	5920	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61622131C>G	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.610G>C	2.37:g.61622131C>G	ENSP00000381577:p.Glu204Gln						p.E204Q	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		5	632	-			204					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.610G>C	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398962	0.42512	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.15256	2.44	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.36026	0.0952	L	0.46157	1.445	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	T	0.04413	-1.0953	10	0.66056	D	0.02	.	18.9908	0.92791	0.0:1.0:0.0:0.0	.	204	Q70CQ2	UBP34_HUMAN	Q	52;52;204	ENSP00000381577:E204Q	ENSP00000263989:E52Q	E	-	1	0	USP34	61475635	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.776000	0.85560	2.567000	0.86603	0.591000	0.81541	GAA		0.323	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			12	7	0	0	0	0.010729	0	12	7				
REG3A	5068	broad.mit.edu	37	2	79384798	79384798	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:79384798C>G	ENST00000409839.3	-	5	396	c.360G>C	c.(358-360)tgG>tgC	p.W120C	REG3A_ENST00000305165.2_Missense_Mutation_p.W120C|REG3A_ENST00000393878.1_Missense_Mutation_p.W120C|AC011754.1_ENST00000415201.1_RNA	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	120	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						TACTCCACTCCCAACCTTCTC	0.552																																							uc002sod.1		NA																	0				skin(1)	1						c.(358-360)TGG>TGC		pancreatitis-associated protein precursor							116.0	110.0	112.0					2																	79384798		2203	4300	6503	SO:0001583	missense	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79384798C>G	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.360G>C	2.37:g.79384798C>G	ENSP00000386630:p.Trp120Cys					REG3A_uc002soe.1_Missense_Mutation_p.W120C|REG3A_uc002sof.1_Missense_Mutation_p.W120C	p.W120C	NM_138938	NP_620355	Q06141	REG3A_HUMAN			4	615	-			120			C-type lectin.			Missense_Mutation	SNP	ENST00000409839.3	37	c.360G>C	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.313401	0.23908	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.21932	1.98;1.98;1.98	3.87	2.99	0.34606	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.49305	D	0.000158	T	0.55226	0.1907	H	0.96970	3.915	0.51482	D	0.999922	D	0.89917	1.0	D	0.97110	1.0	T	0.62627	-0.6814	10	0.87932	D	0	.	7.4342	0.27145	0.0:0.8817:0.0:0.1183	.	120	Q06141	REG3A_HUMAN	C	120	ENSP00000386630:W120C;ENSP00000377456:W120C;ENSP00000304311:W120C	ENSP00000304311:W120C	W	-	3	0	REG3A	79238306	0.991000	0.36638	0.996000	0.52242	0.114000	0.19823	1.678000	0.37586	1.216000	0.43427	0.491000	0.48974	TGG		0.552	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580		46	31	0	0	0	0.00361	0	46	31				
TGFBRAP1	9392	broad.mit.edu	37	2	105892133	105892133	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:105892133C>T	ENST00000393359.2	-	8	1975	c.1549G>A	c.(1549-1551)Gtc>Atc	p.V517I	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.V517I			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	517					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						GAGTCCTGGACATCGCCATTC	0.403																																					Esophageal Squamous(183;794 2019 9730 21801 48859)	Esophageal Squamous(183;794 2019 9730 21801 48859)	uc002tcq.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1549-1551)GTC>ATC		transforming growth factor, beta receptor							125.0	118.0	120.0					2																	105892133		2203	4300	6503	SO:0001583	missense	9392				regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding	g.chr2:105892133C>T	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.1549G>A	2.37:g.105892133C>T	ENSP00000377027:p.Val517Ile					TGFBRAP1_uc010fjc.2_Missense_Mutation_p.V287I|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.V517I	p.V517I	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN			8	1633	-			517					A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	37	c.1549G>A	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.487246	0.01018	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.41758	0.99;0.99	5.61	0.207	0.15214	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 1 (1);	0.362571	0.29653	N	0.011550	T	0.12347	0.0300	N	0.01219	-0.95	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.24870	-1.0148	10	0.21014	T	0.42	-9.2056	5.7336	0.18053	0.0:0.3778:0.1445:0.4777	.	517	Q8WUH2	TGFA1_HUMAN	I	517	ENSP00000377027:V517I;ENSP00000258449:V517I	ENSP00000258449:V517I	V	-	1	0	TGFBRAP1	105258565	0.012000	0.17670	0.009000	0.14445	0.154000	0.21943	0.028000	0.13644	-0.204000	0.10235	-0.302000	0.09304	GTC		0.403	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257		8	80	0	0	0	0.004482	0	8	80				
SCTR	6344	broad.mit.edu	37	2	120219423	120219423	+	Splice_Site	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:120219423C>A	ENST00000019103.5	-	7	1057	c.790G>T	c.(790-792)Ggt>Tgt	p.G264C		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	264					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	AGAAACATACCCCATCCGAAT	0.532																																							uc002tma.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(790-792)GGT>TGT		secretin receptor precursor	Secretin(DB00021)						87.0	84.0	85.0					2																	120219423		2203	4300	6503	SO:0001630	splice_region_variant	6344				digestion|excretion	integral to plasma membrane	secretin receptor activity	g.chr2:120219423C>A		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.790+1G>T	2.37:g.120219423C>A						SCTR_uc002tlz.2_Missense_Mutation_p.G86C	p.G264C	NM_002980	NP_002971	P47872	SCTR_HUMAN			7	1016	-			264			Helical; Name=4; (Potential).		Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	37	c.790G>T	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251735	0.80135	.	.	ENSG00000080293	ENST00000019103	T	0.64991	-0.13	5.12	5.12	0.69794	GPCR, family 2-like (1);	0.000000	0.53938	D	0.000043	T	0.81574	0.4851	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83462	0.0054	9	.	.	.	.	17.7359	0.88392	0.0:1.0:0.0:0.0	.	264	P47872	SCTR_HUMAN	C	264	ENSP00000019103:G264C	.	G	-	1	0	SCTR	119935893	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	7.407000	0.80029	2.647000	0.89833	0.655000	0.94253	GGT		0.532	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2		Missense_Mutation	33	33	1	0	1.04594e-18	0.00623	1.3323e-18	33	33				
THSD7B	80731	broad.mit.edu	37	2	137814327	137814327	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:137814327C>G	ENST00000409968.1	+	3	655	c.477C>G	c.(475-477)tgC>tgG	p.C159W	THSD7B_ENST00000543459.1_Missense_Mutation_p.C18W|THSD7B_ENST00000413152.2_Missense_Mutation_p.C128W|THSD7B_ENST00000272643.3_Missense_Mutation_p.C159W			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	159	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.C159C(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATGAAATATGCGAACACTTTG	0.522																																							uc002tva.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(382-384)TGC>TGG		thrombospondin, type I, domain containing 7B							143.0	147.0	146.0					2																	137814327		2030	4184	6214	SO:0001583	missense	80731							g.chr2:137814327C>G			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.477C>G	2.37:g.137814327C>G	ENSP00000387145:p.Cys159Trp					THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Missense_Mutation_p.C18W	p.C128W	NM_001080427	NP_001073896				BRCA - Breast invasive adenocarcinoma(221;0.19)	2	384	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.384C>G		.	.	.	.	.	.	.	.	.	.	C	16.11	3.031212	0.54790	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.73047	-0.71;-0.71;-0.71;0.44	6.07	-5.34	0.02705	.	0.000000	0.85682	D	0.000000	T	0.80644	0.4662	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81938	-0.0704	10	0.87932	D	0	.	13.9438	0.64071	0.0:0.4385:0.0:0.5615	.	159;128	Q9C0I4;C9JKN6	THS7B_HUMAN;.	W	159;159;128;18	ENSP00000387145:C159W;ENSP00000272643:C159W;ENSP00000413841:C128W;ENSP00000443370:C18W	ENSP00000272643:C159W	C	+	3	2	THSD7B	137530797	0.028000	0.19301	0.881000	0.34555	0.880000	0.50808	-0.806000	0.04525	-0.925000	0.03775	-1.338000	0.01255	TGC		0.522	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		86	94	0	0	0	0.00361	0	86	94				
GALNT13	114805	broad.mit.edu	37	2	155098581	155098581	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:155098581C>T	ENST00000392825.3	+	5	917	c.350C>T	c.(349-351)aCa>aTa	p.T117I	GALNT13_ENST00000409237.1_Missense_Mutation_p.T117I	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	117	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CTTCCAAACACAAGTGTAGTC	0.353																																							uc002tyr.3		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(349-351)ACA>ATA		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							101.0	94.0	97.0					2																	155098581		2203	4300	6503	SO:0001583	missense	114805					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:155098581C>T	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.350C>T	2.37:g.155098581C>T	ENSP00000376570:p.Thr117Ile					GALNT13_uc002tyt.3_Missense_Mutation_p.T117I|GALNT13_uc010foc.1_5'UTR	p.T117I	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN			5	917	+			117			Lumenal (Potential).|Catalytic subdomain A.		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	c.350C>T	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723166	0.89298	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.53206	0.63;0.63	5.56	5.56	0.83823	.	0.048294	0.85682	D	0.000000	T	0.66096	0.2755	M	0.68317	2.08	0.80722	D	1	D;D	0.67145	0.996;0.962	P;P	0.62382	0.901;0.879	T	0.68390	-0.5421	10	0.72032	D	0.01	.	18.1371	0.89623	0.0:1.0:0.0:0.0	.	117;117	Q08ER7;Q8IUC8	.;GLT13_HUMAN	I	117	ENSP00000376570:T117I;ENSP00000387239:T117I	ENSP00000376570:T117I	T	+	2	0	GALNT13	154806827	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.621000	0.88768	0.579000	0.79373	ACA		0.353	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		13	18	0	0	0	0.001855	0	13	18				
KCNJ3	3760	broad.mit.edu	37	2	155555914	155555914	+	Silent	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:155555914C>A	ENST00000295101.2	+	1	1104	c.627C>A	c.(625-627)ctC>ctA	p.L209L	KCNJ3_ENST00000544049.1_Silent_p.L209L|AC061961.2_ENST00000443901.1_RNA	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	209					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	ACGGAAAACTCACGCTTATGT	0.592																																							uc002tyv.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(625-627)CTC>CTA		potassium inwardly-rectifying channel J3	Halothane(DB01159)						49.0	43.0	45.0					2																	155555914		2203	4300	6503	SO:0001819	synonymous_variant	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155555914C>A	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.627C>A	2.37:g.155555914C>A						KCNJ3_uc010zce.1_Silent_p.L209L	p.L209L	NM_002239	NP_002230	P48549	IRK3_HUMAN			1	822	+			209			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Silent	SNP	ENST00000295101.2	37	c.627C>A	CCDS2200.1																																																																																				0.592	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		13	19	1	0	3.27435e-08	0.00245	3.77651e-08	13	19				
PLA2R1	22925	broad.mit.edu	37	2	160898542	160898542	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:160898542C>A	ENST00000283243.7	-	3	867	c.661G>T	c.(661-663)Gat>Tat	p.D221Y	PLA2R1_ENST00000392771.1_Missense_Mutation_p.D221Y	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	221	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TTACTGGGATCAGGGCAAAAT	0.393																																							uc002ube.1		NA																	0				skin(2)|ovary(1)	3						c.(661-663)GAT>TAT		phospholipase A2 receptor 1 isoform 1 precursor							119.0	116.0	117.0					2																	160898542		2203	4300	6503	SO:0001583	missense	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160898542C>A	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.661G>T	2.37:g.160898542C>A	ENSP00000283243:p.Asp221Tyr					PLA2R1_uc010zcp.1_Missense_Mutation_p.D221Y|PLA2R1_uc002ubf.2_Missense_Mutation_p.D221Y	p.D221Y	NM_007366	NP_031392	Q13018	PLA2R_HUMAN			3	868	-			221			Extracellular (Potential).|Fibronectin type-II.		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	c.661G>T	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452880	0.63290	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.18016	2.24;2.24	5.59	4.7	0.59300	Fibronectin, type II, collagen-binding (2);Kringle-like fold (1);	0.094411	0.46758	D	0.000267	T	0.27134	0.0665	M	0.71206	2.165	0.38099	D	0.937207	P;D;D	0.65815	0.946;0.995;0.989	P;P;P	0.59703	0.672;0.742;0.862	T	0.28267	-1.0049	10	0.02654	T	1	.	8.2619	0.31790	0.0:0.7546:0.0:0.2454	.	221;221;221	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	Y	221	ENSP00000283243:D221Y;ENSP00000376524:D221Y	ENSP00000283243:D221Y	D	-	1	0	PLA2R1	160606788	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.897000	0.48664	2.793000	0.96121	0.655000	0.94253	GAT		0.393	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			53	42	1	0	2.01871e-26	0.00361	2.63875e-26	53	42				
BBS5	129880	broad.mit.edu	37	2	170356080	170356080	+	Missense_Mutation	SNP	G	G	C	rs142007921		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:170356080G>C	ENST00000295240.3	+	9	1142	c.766G>C	c.(766-768)Gtc>Ctc	p.V256L	BBS5_ENST00000392663.2_Missense_Mutation_p.V235L|BBS5_ENST00000554017.1_Missense_Mutation_p.V256L|RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.V256L	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	256					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ACTTCACAAAGTCTATTCTGC	0.333									Bardet-Biedl syndrome																														uc010zdh.1		NA																	0					0						c.(766-768)GTC>CTC		Bardet-Biedl syndrome 5							129.0	132.0	131.0					2																	170356080		2203	4300	6503	SO:0001583	missense	10324		Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle		g.chr2:170356080G>C	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.766G>C	2.37:g.170356080G>C	ENSP00000295240:p.Val256Leu					BBS5_uc002uet.2_Missense_Mutation_p.V256L|BBS5_uc010fpw.2_Missense_Mutation_p.V235L	p.V256L	NM_152384	NP_689597	O60662	KBTBA_HUMAN			9	824	+			Error:Variant_position_missing_in_O60662_after_alignment					D3DPC3|Q6PKN0	Missense_Mutation	SNP	ENST00000295240.3	37	c.766G>C	CCDS2233.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013962	0.54468	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	T;T;T;T	0.80214	-0.91;-0.91;-1.35;-0.91	5.74	3.96	0.45880	.	0.051831	0.85682	N	0.000000	T	0.78310	0.4263	L	0.53671	1.685	0.80722	D	1	B;B;B	0.32526	0.374;0.222;0.09	B;B;B	0.38225	0.268;0.086;0.14	T	0.75218	-0.3395	10	0.46703	T	0.11	-7.1421	11.9748	0.53085	0.0657:0.1219:0.8123:0.0	.	256;235;256	E9PBE3;Q8N3I7-2;Q8N3I7	.;.;BBS5_HUMAN	L	256;256;235;256	ENSP00000295240:V256L;ENSP00000452313:V256L;ENSP00000376431:V235L;ENSP00000424363:V256L	ENSP00000295240:V256L	V	+	1	0	BBS5;RP11-724O16.1	170064326	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	6.718000	0.74713	0.794000	0.33899	-0.972000	0.02603	GTC		0.333	BBS5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255265.2	NM_152384		27	65	0	0	0	0.00632	0	27	65				
TTN	7273	broad.mit.edu	37	2	179605651	179605651	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:179605651C>G	ENST00000591111.1	-	46	11582	c.11358G>C	c.(11356-11358)ttG>ttC	p.L3786F	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L3932F|TTN_ENST00000359218.5_Missense_Mutation_p.L3865F|TTN_ENST00000589042.1_Missense_Mutation_p.L4103F|TTN_ENST00000460472.2_Missense_Mutation_p.L3740F			Q8WZ42	TITIN_HUMAN	titin	33958					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTGACTGCTCAATTCATTGG	0.398																																							uc010zfh.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(11794-11796)TTG>TTC		titin isoform novex-2							105.0	103.0	104.0					2																	179605651		1896	4104	6000	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179605651C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11358G>C	2.37:g.179605651C>G	ENSP00000465570:p.Leu3786Phe					TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.L3865F|TTN_uc010zfj.1_Missense_Mutation_p.L3740F|TTN_uc002umz.1_Intron	p.L3932F	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	12020	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.11796G>C		.	.	.	.	.	.	.	.	.	.	C	10.77	1.442788	0.25987	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.65732	-0.17;-0.16;-0.15	4.84	2.08	0.27032	.	.	.	.	.	T	0.46347	0.1388	N	0.24115	0.695	0.09310	N	0.999999	B;B;B	0.16802	0.005;0.005;0.019	B;B;B	0.13407	0.009;0.009;0.009	T	0.41431	-0.9509	9	0.87932	D	0	.	8.3864	0.32503	0.0:0.6265:0.0:0.3735	.	3740;3865;3932	D3DPF9;E7EQE6;E7ET18	.;.;.	F	3740;3932;3865;3740	ENSP00000434586:L3740F;ENSP00000340554:L3932F;ENSP00000352154:L3865F	ENSP00000340554:L3932F	L	-	3	2	TTN	179313896	0.000000	0.05858	0.079000	0.20413	0.339000	0.28857	-0.003000	0.12901	0.334000	0.23590	0.655000	0.94253	TTG		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		21	91	0	0	0	0.008871	0	21	91				
TTN	7273	broad.mit.edu	37	2	179613632	179613632	+	Intron	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:179613632G>C	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.Q4499E|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATTCTCTTTGCTTTAATGAA	0.313																																							uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(13495-13497)CAA>GAA		titin isoform novex-3							101.0	98.0	99.0					2																	179613632		2202	4297	6499	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179613632G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4218C>G	2.37:g.179613632G>C						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.Q4499E	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13719	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.13495C>G		.	.	.	.	.	.	.	.	.	.	G	11.03	1.520194	0.27211	.	.	ENSG00000155657	ENST00000360870	T	0.57752	0.38	6.04	4.22	0.49857	.	.	.	.	.	T	0.36717	0.0977	N	0.24115	0.695	0.09310	N	0.999998	B	0.26547	0.152	B	0.25140	0.058	T	0.22521	-1.0214	9	0.48119	T	0.1	.	6.9955	0.24780	0.0686:0.1093:0.6627:0.1593	.	4499	Q8WZ42-6	.	E	4499	ENSP00000354117:Q4499E	ENSP00000354117:Q4499E	Q	-	1	0	TTN	179321877	0.005000	0.15991	0.008000	0.14137	0.948000	0.59901	1.194000	0.32174	1.551000	0.49450	0.563000	0.77884	CAA		0.313	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		3	73	0	0	0	0.004672	0	3	73				
CCDC141	285025	broad.mit.edu	37	2	179702304	179702304	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:179702304G>T	ENST00000420890.2	-	23	3759	c.3642C>A	c.(3640-3642)atC>atA	p.I1214I	CCDC141_ENST00000480419.1_5'UTR|CCDC141_ENST00000295723.5_Silent_p.I639I	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1214										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GAGGCAAGGAGATGTCATCAG	0.562																																							uc002unf.1		NA																	0				ovary(7)|pancreas(2)|skin(1)	10						c.(1915-1917)ATC>ATA		coiled-coil domain containing 141							88.0	84.0	85.0					2																	179702304		2203	4300	6503	SO:0001819	synonymous_variant	285025						protein binding	g.chr2:179702304G>T	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3642C>A	2.37:g.179702304G>T						CCDC141_uc002une.1_Silent_p.I89I	p.I639I	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)		13	1974	-			639					H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	ENST00000420890.2	37	c.1917C>A																																																																																					0.562	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		4	69	1	0	0.00024832	0.009096	0.000265229	4	69				
ZNF804A	91752	broad.mit.edu	37	2	185803303	185803303	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:185803303G>T	ENST00000302277.6	+	4	3774	c.3180G>T	c.(3178-3180)atG>atT	p.M1060I		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1060							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AGCCAAACATGCTGGCCAACA	0.468																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(3178-3180)ATG>ATT		zinc finger protein 804A							94.0	84.0	88.0					2																	185803303		2203	4300	6503	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185803303G>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3180G>T	2.37:g.185803303G>T	ENSP00000303252:p.Met1060Ile						p.M1060I	NM_194250	NP_919226	Q7Z570	Z804A_HUMAN			4	3774	+			1060					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.3180G>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	7.199	0.592993	0.13875	.	.	ENSG00000170396	ENST00000302277	T	0.05382	3.45	5.09	4.15	0.48705	.	0.533330	0.16783	N	0.199707	T	0.04543	0.0124	N	0.16478	0.41	0.26837	N	0.968469	B	0.11235	0.004	B	0.09377	0.004	T	0.35025	-0.9805	10	0.19147	T	0.46	-2.0E-4	12.4539	0.55693	0.0:0.1684:0.8316:0.0	.	1060	Q7Z570	Z804A_HUMAN	I	1060	ENSP00000303252:M1060I	ENSP00000303252:M1060I	M	+	3	0	ZNF804A	185511548	0.996000	0.38824	0.966000	0.40874	0.566000	0.35808	1.130000	0.31393	2.354000	0.79902	0.467000	0.42956	ATG		0.468	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		80	41	1	0	2.05912e-35	0.00361	2.75722e-35	80	41				
PLCL1	5334	broad.mit.edu	37	2	198950263	198950263	+	Silent	SNP	G	G	A	rs558973603		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:198950263G>A	ENST00000428675.1	+	2	2420	c.2022G>A	c.(2020-2022)ccG>ccA	p.P674P	PLCL1_ENST00000437704.2_Silent_p.P576P	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	674	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TTCAGACTCCGGGTCCAATGA	0.443																																							uc010fsp.2		NA																	0				ovary(1)|skin(1)	2						c.(2020-2022)CCG>CCA		RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	Quinacrine(DB01103)						54.0	56.0	55.0					2																	198950263		2203	4299	6502	SO:0001819	synonymous_variant	5334				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:198950263G>A	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2022G>A	2.37:g.198950263G>A						PLCL1_uc002uuv.3_Silent_p.P595P	p.P674P	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN			2	2313	+			674			PI-PLC Y-box.		Q3MJ90|Q53SD3|Q7Z3S3	Silent	SNP	ENST00000428675.1	37	c.2022G>A	CCDS2326.2																																																																																				0.443	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226		20	76	0	0	0	0.008871	0	20	76				
EEF1B2	1933	broad.mit.edu	37	2	207027266	207027266	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:207027266G>A	ENST00000392222.2	+	5	826	c.451G>A	c.(451-453)Gat>Aat	p.D151N	SNORA41_ENST00000384675.1_RNA|EEF1B2_ENST00000392221.1_Missense_Mutation_p.D151N|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000233190.6_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.D151N	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	151					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						ACCTTGGGATGATGAGACAGA	0.378																																							uc002vbf.1		NA																	0					0						c.(451-453)GAT>AAT		eukaryotic translation elongation factor 1 beta							124.0	131.0	129.0					2																	207027266		2203	4300	6503	SO:0001583	missense	1933					cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity	g.chr2:207027266G>A	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.451G>A	2.37:g.207027266G>A	ENSP00000376056:p.Asp151Asn					EEF1B2_uc002vbg.1_Missense_Mutation_p.D151N|EEF1B2_uc002vbh.1_Missense_Mutation_p.D151N	p.D151N	NM_001037663	NP_001032752	P24534	EF1B_HUMAN			6	609	+			151					A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	c.451G>A	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	G	34	5.367784	0.95900	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222	.	.	.	5.24	5.24	0.73138	Translation elongation factor EF1B/ribosomal protein S6 (1);Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange (3);	0.000000	0.85682	D	0.000000	D	0.87265	0.6134	H	0.94264	3.515	0.80722	D	1	D	0.67145	0.996	D	0.80764	0.994	D	0.90880	0.4753	9	0.87932	D	0	-11.5933	18.8215	0.92099	0.0:0.0:1.0:0.0	.	151	P24534	EF1B_HUMAN	N	151	.	ENSP00000236957:D151N	D	+	1	0	EEF1B2	206735511	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.622000	0.98378	2.450000	0.82876	0.655000	0.94253	GAT		0.378	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663		17	177	0	0	0	0.006122	0	17	177				
PTH2R	5746	broad.mit.edu	37	2	209302497	209302497	+	Missense_Mutation	SNP	G	G	A	rs267599176		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:209302497G>A	ENST00000272847.2	+	4	515	c.302G>A	c.(301-303)cGa>cAa	p.R101Q	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	101					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	GTTGCTTTCCGACACTGTAAC	0.388																																							uc002vdb.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(301-303)CGA>CAA		parathyroid hormone 2 receptor precursor							76.0	75.0	75.0					2																	209302497		2203	4300	6503	SO:0001583	missense	5746					integral to plasma membrane	parathyroid hormone receptor activity	g.chr2:209302497G>A	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.302G>A	2.37:g.209302497G>A	ENSP00000272847:p.Arg101Gln					PTH2R_uc010zjb.1_Missense_Mutation_p.R112Q	p.R101Q	NM_005048	NP_005039	P49190	PTH2R_HUMAN		Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	4	515	+			101			Extracellular (Potential).		Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	c.302G>A	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	G	32	5.146286	0.94603	.	.	ENSG00000144407	ENST00000272847	T	0.69435	-0.4	5.47	5.47	0.80525	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.42821	D	0.000653	D	0.86535	0.5956	M	0.93283	3.4	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	D	0.89324	0.3642	10	0.66056	D	0.02	.	17.185	0.86863	0.0:0.0:1.0:0.0	.	101	P49190	PTH2R_HUMAN	Q	101	ENSP00000272847:R101Q	ENSP00000272847:R101Q	R	+	2	0	PTH2R	209010742	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.663000	0.91134	2.729000	0.93468	0.467000	0.42956	CGA		0.388	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048		42	19	0	0	0	0.013114	0	42	19				
SPEG	10290	broad.mit.edu	37	2	220315959	220315959	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:220315959G>A	ENST00000312358.7	+	5	2347	c.2215G>A	c.(2215-2217)Gtg>Atg	p.V739M	SPEG_ENST00000396698.1_Missense_Mutation_p.V635M|SPEG_ENST00000396695.2_5'UTR|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	739	Ig-like 2.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGGGGCAGATGTGCTGCTCAA	0.617																																							uc010fwg.2		NA																	0				stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(2215-2217)GTG>ATG		SPEG complex locus							66.0	69.0	68.0					2																	220315959		2024	4161	6185	SO:0001583	missense	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220315959G>A	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2215G>A	2.37:g.220315959G>A	ENSP00000311684:p.Val739Met					SPEG_uc002vlm.2_RNA|SPEG_uc010fwh.1_Translation_Start_Site|SPEG_uc002vln.1_Translation_Start_Site|SPEG_uc002vlp.1_Translation_Start_Site	p.V739M	NM_005876	NP_005867	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	5	2215	+		Renal(207;0.0183)	739			Ig-like 2.		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	c.2215G>A	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.809851	0.70797	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000396698	T;T	0.77098	-1.07;-1.07	5.43	4.54	0.55810	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.196398	0.24983	N	0.034044	D	0.87645	0.6229	M	0.84326	2.69	0.80722	D	1	D	0.64830	0.994	D	0.66847	0.947	D	0.89096	0.3486	10	0.72032	D	0.01	.	14.2396	0.65948	0.0742:0.0:0.9258:0.0	.	739	Q15772	SPEG_HUMAN	M	739;739;635	ENSP00000311684:V739M;ENSP00000379926:V635M	ENSP00000265327:V739M	V	+	1	0	SPEG	220024203	1.000000	0.71417	0.709000	0.30452	0.887000	0.51463	6.275000	0.72594	2.556000	0.86216	0.655000	0.94253	GTG		0.617	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		6	106	0	0	0	0.001168	0	6	106				
CHPF	79586	broad.mit.edu	37	2	220404716	220404716	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:220404716G>A	ENST00000243776.6	-	4	1965	c.1717C>T	c.(1717-1719)Ctg>Ttg	p.L573L	CHPF_ENST00000535926.1_Silent_p.L411L	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	573					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CGCCGCTCCAGCTCTGCCACG	0.662																																							uc002vmc.3		NA																	0					0						c.(1717-1719)CTG>TTG		chondroitin polymerizing factor							29.0	33.0	32.0					2																	220404716		2202	4296	6498	SO:0001819	synonymous_variant	79586					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding	g.chr2:220404716G>A	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1717C>T	2.37:g.220404716G>A						CHPF_uc010zlh.1_Silent_p.L411L	p.L573L	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)	4	1944	-		Renal(207;0.0183)	573			Lumenal (Potential).		B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Silent	SNP	ENST00000243776.6	37	c.1717C>T	CCDS2443.1																																																																																				0.662	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536		42	25	0	0	0	0.00361	0	42	25				
MOGAT1	116255	broad.mit.edu	37	2	223559872	223559872	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:223559872G>T	ENST00000446656.3	+	5	718	c.718G>T	c.(718-720)Gaa>Taa	p.E240*	snoU13_ENST00000459212.1_RNA	NM_058165.2	NP_477513.2	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	240					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|cervix(1)|endometrium(1)|lung(5)|urinary_tract(1)	9		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		TGACAACCCTGAAGGATCATG	0.428																																					Ovarian(93;205 1446 2385 11581 25911)	Ovarian(93;205 1446 2385 11581 25911)	uc010fws.1		NA																	0				breast(1)	1						c.(718-720)GAA>TAA		monoacylglycerol O-acyltransferase 1							101.0	93.0	95.0					2																	223559872		1838	4085	5923	SO:0001587	stop_gained	116255				glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity	g.chr2:223559872G>T	AF384163	CCDS46524.1	2q36.2	2006-10-06	2004-05-28	2004-05-28	ENSG00000124003	ENSG00000124003			18210	protein-coding gene	gene with protein product		610268	"""diacylglycerol O-acyltransferase 2 like 1"""	DGAT2L1		14970677	Standard	NM_058165		Approved	DGAT2L, MGAT1	uc010fws.1	Q96PD6	OTTHUMG00000153394	ENST00000446656.3:c.718G>T	2.37:g.223559872G>T	ENSP00000406674:p.Glu240*					MOGAT1_uc010fwt.1_Nonsense_Mutation_p.E200*	p.E240*	NM_058165	NP_477513	Q96PD6	MOGT1_HUMAN		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)	5	766	+		Renal(207;0.0183)	240					Q6IEE5	Nonsense_Mutation	SNP	ENST00000446656.3	37	c.718G>T	CCDS46524.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734761	0.30774	.	.	ENSG00000124003	ENST00000446656	.	.	.	4.84	2.04	0.26737	.	0.450090	0.22804	N	0.055428	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-11.5387	6.8638	0.24082	0.5364:0.0:0.4636:0.0	.	.	.	.	X	240	.	ENSP00000406674:E240X	E	+	1	0	MOGAT1	223268116	0.014000	0.17966	0.138000	0.22173	0.027000	0.11550	0.229000	0.17833	0.238000	0.21222	0.551000	0.68910	GAA		0.428	MOGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331010.3	NM_058165		15	14	1	0	3.27435e-08	0.00245	3.77651e-08	15	14				
SPHKAP	80309	broad.mit.edu	37	2	228881270	228881270	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:228881270C>T	ENST00000392056.3	-	7	4346	c.4300G>A	c.(4300-4302)Gat>Aat	p.D1434N	SPHKAP_ENST00000344657.5_Missense_Mutation_p.D1434N	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1434						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCTCTCTGATCTGTTTCAATC	0.468																																							uc002vpq.2		NA																	0				skin(5)|ovary(4)|lung(1)	10						c.(4300-4302)GAT>AAT		sphingosine kinase type 1-interacting protein							64.0	66.0	66.0					2																	228881270		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228881270C>T		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4300G>A	2.37:g.228881270C>T	ENSP00000375909:p.Asp1434Asn					SPHKAP_uc002vpp.2_Missense_Mutation_p.D1434N|SPHKAP_uc010zlx.1_Missense_Mutation_p.D1434N	p.D1434N	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	4347	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	1434					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.4300G>A	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	34	5.377949	0.95945	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.20738	2.05;2.06	5.66	5.66	0.87406	.	0.093365	0.64402	D	0.000001	T	0.50701	0.1631	M	0.77616	2.38	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.983;0.965;0.997	T	0.51896	-0.8647	10	0.72032	D	0.01	.	18.7398	0.91769	0.0:1.0:0.0:0.0	.	465;1434;1434	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	N	1434	ENSP00000375909:D1434N;ENSP00000339886:D1434N	ENSP00000339886:D1434N	D	-	1	0	SPHKAP	228589514	1.000000	0.71417	0.979000	0.43373	0.994000	0.84299	5.343000	0.65976	2.656000	0.90262	0.655000	0.94253	GAT		0.468	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		38	29	0	0	0	0.003755	0	38	29				
DGKD	8527	broad.mit.edu	37	2	234343033	234343033	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:234343033C>T	ENST00000264057.2	+	4	368	c.356C>T	c.(355-357)aCt>aTt	p.T119I	DGKD_ENST00000409813.3_Missense_Mutation_p.T75I	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	119	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TAGGTCATAACTCCATGCAGG	0.418																																							uc002vui.1		NA																	0				central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5						c.(355-357)ACT>ATT		diacylglycerol kinase, delta 130kDa isoform 2	Phosphatidylserine(DB00144)						157.0	152.0	154.0					2																	234343033		2203	4300	6503	SO:0001583	missense	8527				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity	g.chr2:234343033C>T	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.356C>T	2.37:g.234343033C>T	ENSP00000264057:p.Thr119Ile					DGKD_uc002vuj.1_Missense_Mutation_p.T75I|DGKD_uc010fyh.1_5'UTR|DGKD_uc002vuk.1_5'UTR	p.T119I	NM_152879	NP_690618	Q16760	DGKD_HUMAN		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	4	368	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)	119			PH.		Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	c.356C>T	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930526	0.73327	.	.	ENSG00000077044	ENST00000264057;ENST00000427930;ENST00000447484;ENST00000409813	T;T;T;T	0.77098	-1.07;1.33;-1.07;-1.07	4.97	4.97	0.65823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.237839	0.34603	N	0.003831	D	0.90157	0.6924	M	0.89163	3.01	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.83275	0.996;0.961	D	0.91538	0.5247	10	0.72032	D	0.01	.	18.8103	0.92056	0.0:1.0:0.0:0.0	.	75;119	Q16760-2;Q16760	.;DGKD_HUMAN	I	119;55;89;75	ENSP00000264057:T119I;ENSP00000407938:T55I;ENSP00000395530:T89I;ENSP00000386455:T75I	ENSP00000264057:T119I	T	+	2	0	DGKD	234007772	1.000000	0.71417	0.988000	0.46212	0.597000	0.36814	7.205000	0.77881	2.762000	0.94881	0.563000	0.77884	ACT		0.418	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648		7	131	0	0	0	0.00308	0	7	131				
UGT1A7	54577	broad.mit.edu	37	2	234590805	234590805	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:234590805G>A	ENST00000373426.3	+	1	222	c.222G>A	c.(220-222)gtG>gtA	p.V74V	UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000373450.4_Intron	NM_019077.2	NP_061950.2	Q9HAW7	UD17_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A7	74					cellular glucuronidation (GO:0052695)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|excretion (GO:0007588)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	drug binding (GO:0008144)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|retinoic acid binding (GO:0001972)			NS(1)|endometrium(6)|kidney(5)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|prostate(1)|skin(1)	33		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)	ATTGCACAGTGAAGACTTACT	0.527																																							uc002vut.2		NA																	0				ovary(1)	1						c.(220-222)GTG>GTA		UDP glycosyltransferase 1 family, polypeptide A7							142.0	128.0	133.0					2																	234590805		2203	4300	6503	SO:0001819	synonymous_variant	54577				drug metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	drug binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|retinoic acid binding	g.chr2:234590805G>A	U39570	CCDS2506.1	2q37	2010-03-05	2005-07-20		ENSG00000244122	ENSG00000244122		"""UDP glucuronosyltransferases"""	12539	other	complex locus constituent		606432	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 11434514	Standard	NM_019077		Approved	UGT1G		Q9HAW7	OTTHUMG00000059004	ENST00000373426.3:c.222G>A	2.37:g.234590805G>A						UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Silent_p.V74V	p.V74V	NM_019077	NP_061950	Q9HAW7	UD17_HUMAN		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	1	222	+		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)	74					B8K293|O00473	Silent	SNP	ENST00000373426.3	37	c.222G>A	CCDS2506.1																																																																																				0.527	UGT1A7-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130614.1	NM_019077		24	181	0	0	0	0.00333	0	24	181				
COL6A3	1293	broad.mit.edu	37	2	238268032	238268032	+	Splice_Site	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:238268032C>T	ENST00000295550.4	-	18	6735		c.e18-1		COL6A3_ENST00000347401.3_Splice_Site|COL6A3_ENST00000472056.1_Splice_Site|COL6A3_ENST00000409809.1_Splice_Site|COL6A3_ENST00000346358.4_Splice_Site|COL6A3_ENST00000353578.4_Splice_Site	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCCGAGAGCCCTAGAAGGCAA	0.507																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.e18-1		alpha 3 type VI collagen isoform 1 precursor							116.0	126.0	123.0					2																	238268032		2203	4300	6503	SO:0001630	splice_region_variant	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238268032C>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6283-1G>A	2.37:g.238268032C>T						COL6A3_uc002vwo.2_Splice_Site_p.G1889_splice|COL6A3_uc010znj.1_Splice_Site_p.G1488_splice	p.G2095_splice	NM_004369	NP_004360	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	18	6568	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)						A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Splice_Site	SNP	ENST00000295550.4	37	c.6283_splice	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992602	0.74703	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3484	0.90329	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL6A3	237932771	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	6.905000	0.75714	2.327000	0.79052	0.655000	0.94253	.		0.507	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	Intron	24	140	0	0	0	0.003954	0	24	140				
PRLH	51052	broad.mit.edu	37	2	238475665	238475665	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:238475665C>T	ENST00000165524.1	+	2	111	c.111C>T	c.(109-111)atC>atT	p.I37I		NM_015893.1	NP_056977.1	P81277	PRRP_HUMAN	prolactin releasing hormone	37					autonomic nervous system development (GO:0048483)|energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|lipid metabolic process (GO:0006629)|reduction of food intake in response to dietary excess (GO:0002023)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	hormone activity (GO:0005179)			endometrium(1)|large_intestine(1)	2		Lung NSC(271;0.142)|all_lung(227;0.175)		Epithelial(121;8.28e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.03e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.19e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000329)|Lung(119;0.0106)|LUSC - Lung squamous cell carcinoma(224;0.0249)		CCCCTGACATCAATCCTGCCT	0.677																																							uc010znl.1		NA																	0					0						c.(109-111)ATC>ATT		prolactin releasing hormone precursor							78.0	61.0	66.0					2																	238475665		2203	4300	6503	SO:0001819	synonymous_variant	51052					extracellular region		g.chr2:238475665C>T	AB015419	CCDS2519.1	2q37.3	2013-02-28			ENSG00000071677	ENSG00000071677		"""Endogenous ligands"""	17945	protein-coding gene	gene with protein product		602663				9607765	Standard	NM_015893		Approved	PRH	uc010znl.2	P81277	OTTHUMG00000133296	ENST00000165524.1:c.111C>T	2.37:g.238475665C>T							p.I37I	NM_015893	NP_056977	P81277	PRRP_HUMAN		Epithelial(121;8.28e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.03e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.19e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000329)|Lung(119;0.0106)|LUSC - Lung squamous cell carcinoma(224;0.0249)	2	111	+		Lung NSC(271;0.142)|all_lung(227;0.175)	37						Silent	SNP	ENST00000165524.1	37	c.111C>T	CCDS2519.1																																																																																				0.677	PRLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257081.1	NM_015893		30	50	0	0	0	0.008361	0	30	50				
CAPN10	11132	broad.mit.edu	37	2	241528798	241528798	+	Silent	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:241528798A>T	ENST00000391984.2	+	2	376	c.180A>T	c.(178-180)ccA>ccT	p.P60P	CAPN10_ENST00000391982.2_Silent_p.P60P|CAPN10-AS1_ENST00000567819.1_RNA|CAPN10_ENST00000354082.4_Silent_p.P60P|CAPN10_ENST00000404753.3_Silent_p.P60P|CAPN10_ENST00000270364.7_Silent_p.P60P|CAPN10_ENST00000352879.4_Intron	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	60	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		CAGATGACCCACGGGAAGGGC	0.587																																							uc002vzk.1		NA																	0				ovary(3)|large_intestine(2)|lung(1)	6						c.(178-180)CCA>CCT		calpain 10 isoform a							91.0	102.0	98.0					2																	241528798		2203	4300	6503	SO:0001819	synonymous_variant	11132				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding	g.chr2:241528798A>T	AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.180A>T	2.37:g.241528798A>T						CAPN10_uc010zoh.1_Silent_p.P60P|CAPN10_uc002vzl.1_Silent_p.P60P|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_5'UTR|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Silent_p.P60P	p.P60P	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)	2	364	+		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	60			Calpain catalytic.		A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Silent	SNP	ENST00000391984.2	37	c.180A>T	CCDS42838.1																																																																																				0.587	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083		17	159	0	0	0	0.006122	0	17	159				
ANO7	50636	broad.mit.edu	37	2	242128153	242128153	+	Missense_Mutation	SNP	G	G	C	rs150079713	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr2:242128153G>C	ENST00000274979.8	+	1	230	c.127G>C	c.(127-129)Gag>Cag	p.E43Q	ANO7_ENST00000402430.3_Missense_Mutation_p.E43Q|ANO7_ENST00000402530.3_Missense_Mutation_p.E43Q	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	43					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CATGACCTCCGAGACCTCTTC	0.677																																							uc002wax.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(127-129)GAG>CAG		transmembrane protein 16G isoform NGEP long							45.0	47.0	47.0					2																	242128153		2203	4300	6503	SO:0001583	missense	50636					cell junction|chloride channel complex|cytosol	chloride channel activity	g.chr2:242128153G>C	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.127G>C	2.37:g.242128153G>C	ENSP00000274979:p.Glu43Gln					ANO7_uc002waw.2_Missense_Mutation_p.E43Q	p.E43Q	NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN			1	230	+			43			Cytoplasmic (Potential).		Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	c.127G>C	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252363	0.39797	.	.	ENSG00000146205	ENST00000274979;ENST00000402530;ENST00000402430	T;T;T	0.71817	-0.49;0.59;-0.6	3.65	3.65	0.41850	.	5.298590	0.01298	U	0.010223	T	0.80618	0.4657	L	0.44542	1.39	0.21105	N	0.999782	D;D	0.89917	0.998;1.0	P;D	0.79784	0.828;0.993	T	0.65664	-0.6113	10	0.30078	T	0.28	.	11.5792	0.50881	0.0:0.0:1.0:0.0	.	43;43	Q6IWH7;Q6IWH7-2	ANO7_HUMAN;.	Q	43	ENSP00000274979:E43Q;ENSP00000383985:E43Q;ENSP00000385418:E43Q	ENSP00000274979:E43Q	E	+	1	0	ANO7	241776826	0.002000	0.14202	0.738000	0.30950	0.701000	0.40568	1.058000	0.30504	1.988000	0.58038	0.563000	0.77884	GAG		0.677	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891		6	41	0	0	0	0.001168	0	6	41				
RRBP1	6238	broad.mit.edu	37	20	17622538	17622538	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:17622538C>T	ENST00000377813.1	-	5	2391	c.2088G>A	c.(2086-2088)gcG>gcA	p.A696A	RRBP1_ENST00000360807.4_Silent_p.A263A|RRBP1_ENST00000377807.2_Silent_p.A263A|RRBP1_ENST00000246043.4_Silent_p.A696A|RRBP1_ENST00000455029.2_Silent_p.A37A			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	696					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						GTTTCAGAATCGCCACAGGGT	0.547																																							uc002wpv.1		NA																	0				ovary(1)	1						c.(787-789)GCG>GCA		ribosome binding protein 1							138.0	129.0	132.0					20																	17622538		2203	4300	6503	SO:0001819	synonymous_variant	6238				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity	g.chr20:17622538C>T	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.2088G>A	20.37:g.17622538C>T						RRBP1_uc002wpu.2_Silent_p.A37A|RRBP1_uc002wpw.1_Silent_p.A263A|RRBP1_uc010gcl.1_Silent_p.A37A	p.A263A	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN			6	1143	-			696			Cytoplasmic (Potential).		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	ENST00000377813.1	37	c.789G>A																																																																																					0.547	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576		46	62	0	0	0	0.00361	0	46	62				
REM1	28954	broad.mit.edu	37	20	30065683	30065683	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:30065683G>A	ENST00000201979.2	+	3	686	c.393G>A	c.(391-393)gtG>gtA	p.V131V	DEFB124_ENST00000481595.1_5'Flank	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	131					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CCACACTGGTGGTCGTGGACA	0.567																																							uc002wwa.2		NA																	0				lung(2)|pancreas(2)	4						c.(391-393)GTG>GTA		RAS-like GTP-binding protein REM							96.0	74.0	81.0					20																	30065683		2203	4300	6503	SO:0001819	synonymous_variant	28954				small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity	g.chr20:30065683G>A	AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.393G>A	20.37:g.30065683G>A							p.V131V	NM_014012	NP_054731	O75628	REM1_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)		3	677	+	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		131					E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Silent	SNP	ENST00000201979.2	37	c.393G>A	CCDS13181.1																																																																																				0.567	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2	NM_014012		11	13	0	0	0	0.00245	0	11	13				
BCL2L1	598	broad.mit.edu	37	20	30309796	30309796	+	Missense_Mutation	SNP	C	C	G	rs138364013		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:30309796C>G	ENST00000307677.4	-	2	636	c.226G>C	c.(226-228)Gat>Cat	p.D76H	BCL2L1_ENST00000376062.2_Missense_Mutation_p.D76H|BCL2L1_ENST00000420653.1_Missense_Mutation_p.D76H|BCL2L1_ENST00000376055.4_Missense_Mutation_p.D76H	NM_138578.1	NP_612815.1	Q07817	B2CL1_HUMAN	BCL2-like 1	76					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process in bone marrow (GO:0071839)|cell proliferation (GO:0008283)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to alkaloid (GO:0071312)|cellular response to amino acid stimulus (GO:0071230)|cellular response to gamma radiation (GO:0071480)|cytokinesis (GO:0000910)|endocytosis (GO:0006897)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fertilization (GO:0009566)|germ cell development (GO:0007281)|growth (GO:0040007)|hepatocyte apoptotic process (GO:0097284)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male gonad development (GO:0008584)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|release of cytochrome c from mitochondria (GO:0001836)|response to cycloheximide (GO:0046898)|response to cytokine (GO:0034097)|spermatogenesis (GO:0007283)|suppression by virus of host apoptotic process (GO:0019050)	Bcl-2 family protein complex (GO:0097136)|cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synapse (GO:0045202)	BH3 domain binding (GO:0051434)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			TCCCGGGCATCCAAACTGCTG	0.622																																					Colon(51;693 1004 1401 20431 21026)	Colon(51;693 1004 1401 20431 21026)	uc002wwl.2		NA																	0				lung(1)|central_nervous_system(1)	2						c.(226-228)GAT>CAT		BCL2-like 1 isoform 1							71.0	68.0	69.0					20																	30309796		2203	4300	6503	SO:0001583	missense	598				induction of apoptosis by intracellular signals|negative regulation of establishment of protein localization in plasma membrane|negative regulation of survival gene product expression|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|release of cytochrome c from mitochondria|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nuclear membrane	BH3 domain binding|identical protein binding	g.chr20:30309796C>G	Z23115	CCDS13188.1, CCDS13189.1	20q11.21	2014-03-07			ENSG00000171552	ENSG00000171552		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	992	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 52"""	600039				8358789	Standard	NM_001191		Approved	BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, PPP1R52	uc002wwl.3	Q07817	OTTHUMG00000032192	ENST00000307677.4:c.226G>C	20.37:g.30309796C>G	ENSP00000302564:p.Asp76His					BCL2L1_uc002wwk.2_RNA|BCL2L1_uc002wwm.2_Missense_Mutation_p.D76H|BCL2L1_uc002wwn.2_Missense_Mutation_p.D76H|BCL2L1_uc002wwo.1_Missense_Mutation_p.D76H	p.D76H	NM_138578	NP_612815	Q07817	B2CL1_HUMAN	Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)		2	592	-	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		76					E1P5L6|Q5CZ89|Q5TE65|Q92976	Missense_Mutation	SNP	ENST00000307677.4	37	c.226G>C	CCDS13189.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730568	0.48939	.	.	ENSG00000171552	ENST00000376062;ENST00000376055;ENST00000307677;ENST00000420653;ENST00000450273;ENST00000420488;ENST00000456404;ENST00000422920;ENST00000439267	T;T;T;T;T;T;T;T;T	0.04156	3.69;3.69;3.69;3.69;3.69;3.69;3.69;3.69;3.69	5.64	5.64	0.86602	.	0.295082	0.33895	N	0.004445	T	0.03827	0.0108	N	0.08118	0	0.46901	D	0.999245	P;P	0.52061	0.95;0.583	B;B	0.40285	0.325;0.206	T	0.56956	-0.7893	10	0.44086	T	0.13	-9.4992	18.8715	0.92317	0.0:1.0:0.0:0.0	.	76;76	Q5TE63;Q07817	.;B2CL1_HUMAN	H	76	ENSP00000365230:D76H;ENSP00000365223:D76H;ENSP00000302564:D76H;ENSP00000405563:D76H;ENSP00000406203:D76H;ENSP00000390760:D76H;ENSP00000395545:D76H;ENSP00000411252:D76H;ENSP00000389688:D76H	ENSP00000302564:D76H	D	-	1	0	BCL2L1	29773457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.773000	0.47686	2.937000	0.99478	0.650000	0.86243	GAT		0.622	BCL2L1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078575.1	NM_138578		20	67	0	0	0	0.007413	0	20	67				
ACSS2	55902	broad.mit.edu	37	20	33500968	33500968	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:33500968C>T	ENST00000360596.2	+	3	655	c.444C>T	c.(442-444)ttC>ttT	p.F148F	ACSS2_ENST00000336325.4_Silent_p.F98F|ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000253382.5_Silent_p.F148F	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	148					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGTGTCAGTTCAGCAATGTTC	0.532																																							uc002xbd.2		NA																	0					0						c.(442-444)TTC>TTT		acyl-CoA synthetase short-chain family member 2	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						148.0	133.0	138.0					20																	33500968		2203	4300	6503	SO:0001819	synonymous_variant	55902				ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding	g.chr20:33500968C>T	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.444C>T	20.37:g.33500968C>T						ACSS2_uc002xbc.2_Silent_p.F53F|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Silent_p.F148F|ACSS2_uc002xbe.2_Intron|ACSS2_uc002xbf.2_Intron	p.F148F	NM_018677	NP_061147	Q9NR19	ACSA_HUMAN			3	565	+			148					A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Silent	SNP	ENST00000360596.2	37	c.444C>T	CCDS13243.1																																																																																				0.532	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677		14	81	0	0	0	0.001855	0	14	81				
CNBD2	140894	broad.mit.edu	37	20	34583046	34583046	+	Silent	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:34583046T>C	ENST00000373973.3	+	8	1115	c.942T>C	c.(940-942)gaT>gaC	p.D314D	CNBD2_ENST00000349339.1_Silent_p.D314D|CNBD2_ENST00000538900.1_Silent_p.D314D			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	314																	AGCTGATAGATGGCAGACCTC	0.597											OREG0025897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002xes.1		NA																	0					0						c.(940-942)GAT>GAC		SubName: Full=C20orf152 protein;							101.0	90.0	94.0					20																	34583046		2203	4300	6503	SO:0001819	synonymous_variant	140894							g.chr20:34583046T>C	AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.942T>C	20.37:g.34583046T>C			OREG0025897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	848	C20orf152_uc002xer.1_Silent_p.D314D|C20orf152_uc010gfp.1_RNA	p.D314D			Q96M20	CT152_HUMAN			8	1098	+	Breast(12;0.00631)		314					Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Silent	SNP	ENST00000373973.3	37	c.942T>C																																																																																					0.597	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2	NM_080834		19	50	0	0	0	0.010504	0	19	50				
B4GALT5	9334	broad.mit.edu	37	20	48260100	48260100	+	Missense_Mutation	SNP	C	C	T	rs367589949		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:48260100C>T	ENST00000371711.4	-	4	639	c.452G>A	c.(451-453)gGt>gAt	p.G151D		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	151					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CTTCCAGTGACCTCCGAGCTT	0.493																																							uc002xuu.3		NA																	0				ovary(1)	1						c.(451-453)GGT>GAT		UDP-Gal:betaGlcNAc beta 1,4-		C	ASP/GLY	0,4406		0,0,2203	181.0	156.0	165.0		452	5.5	1.0	20		165	1,8599	1.2+/-3.3	0,1,4299	no	missense	B4GALT5	NM_004776.3	94	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	151/389	48260100	1,13005	2203	4300	6503	SO:0001583	missense	9334				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding	g.chr20:48260100C>T	AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.452G>A	20.37:g.48260100C>T	ENSP00000360776:p.Gly151Asp						p.G151D	NM_004776	NP_004767	O43286	B4GT5_HUMAN	BRCA - Breast invasive adenocarcinoma(9;2.51e-06)		4	646	-			151			Lumenal (Potential).		E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	ENST00000371711.4	37	c.452G>A	CCDS13420.1	.	.	.	.	.	.	.	.	.	.	C	34	5.294799	0.95546	0.0	1.16E-4	ENSG00000158470	ENST00000371711	T	0.27402	1.67	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.70482	0.3229	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80982	-0.1139	10	0.87932	D	0	-17.263	19.3065	0.94164	0.0:1.0:0.0:0.0	.	151	O43286	B4GT5_HUMAN	D	151	ENSP00000360776:G151D	ENSP00000360776:G151D	G	-	2	0	B4GALT5	47693507	1.000000	0.71417	0.973000	0.42090	0.998000	0.95712	7.814000	0.86154	2.547000	0.85894	0.561000	0.74099	GGT		0.493	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776		19	81	0	0	0	0.010504	0	19	81				
COL20A1	57642	broad.mit.edu	37	20	61937232	61937232	+	Splice_Site	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:61937232G>A	ENST00000358894.6	+	5	437		c.e5-1		COL20A1_ENST00000326996.6_Splice_Site|COL20A1_ENST00000422202.1_Splice_Site|COL20A1_ENST00000435874.1_Splice_Site	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					TCTCCCTGCAGTTGAGGATCT	0.657																																							uc011aau.1		NA																	0				central_nervous_system(1)	1						c.e5-1		collagen, type XX, alpha 1							40.0	43.0	42.0					20																	61937232		1992	4166	6158	SO:0001630	splice_region_variant	57642				cell adhesion	collagen|extracellular space	structural molecule activity	g.chr20:61937232G>A	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.338-1G>A	20.37:g.61937232G>A						COL20A1_uc011aav.1_5'Flank	p.I113_splice	NM_020882	NP_065933	Q9P218	COKA1_HUMAN			5	438	+	all_cancers(38;1.39e-10)							Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Splice_Site	SNP	ENST00000358894.6	37	c.338_splice	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	G	8.827	0.938950	0.18281	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2963	0.60298	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL20A1	61407677	0.997000	0.39634	0.473000	0.27253	0.101000	0.19017	4.573000	0.60893	1.930000	0.55929	0.467000	0.42956	.		0.657	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	Intron	10	43	0	0	0	0.008291	0	10	43				
ZGPAT	84619	broad.mit.edu	37	20	62366802	62366802	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:62366802G>T	ENST00000328969.5	+	6	1470	c.1343G>T	c.(1342-1344)aGc>aTc	p.S448I	RP4-583P15.15_ENST00000490623.2_Missense_Mutation_p.A334S|ZGPAT_ENST00000355969.6_Missense_Mutation_p.S428I|RP4-583P15.14_ENST00000467211.1_5'Flank|ZGPAT_ENST00000357119.4_Missense_Mutation_p.S419I|ZGPAT_ENST00000369967.3_Missense_Mutation_p.S428I|LIME1_ENST00000309546.3_5'Flank|ZGPAT_ENST00000448100.2_Missense_Mutation_p.S428I	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	448					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					TACCATGCCAGCAAGAGTGCC	0.627																																							uc002ygk.2		NA																	0					0						c.(1342-1344)AGC>ATC		zinc finger, CCCH-type with G patch domain							26.0	30.0	28.0					20																	62366802		2197	4299	6496	SO:0001583	missense	84619				negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:62366802G>T	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.1343G>T	20.37:g.62366802G>T	ENSP00000332013:p.Ser448Ile					ZGPAT_uc002ygi.2_Missense_Mutation_p.S428I|ZGPAT_uc002ygj.2_Missense_Mutation_p.S428I|ZGPAT_uc010gkk.1_Missense_Mutation_p.S5I|ZGPAT_uc010gkl.1_Missense_Mutation_p.S428I|ZGPAT_uc002ygm.2_Missense_Mutation_p.S419I|ZGPAT_uc002ygn.3_RNA|LIME1_uc011abi.1_5'Flank|LIME1_uc002ygp.3_5'Flank	p.S448I	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN			6	1521	+	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)		448					E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	37	c.1343G>T	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577249	0.86645	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.25749	1.79;1.79;1.78;1.79;1.79	5.69	3.7	0.42460	.	0.134922	0.64402	D	0.000002	T	0.48447	0.1500	M	0.66939	2.045	0.48696	D	0.999695	D;D;D	0.71674	0.994;0.998;0.997	D;D;D	0.69307	0.949;0.919;0.963	T	0.52071	-0.8624	10	0.66056	D	0.02	-5.5993	15.8776	0.79178	0.0:0.257:0.743:0.0	.	419;448;428	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	I	428;428;419;428;448	ENSP00000391176:S428I;ENSP00000348242:S428I;ENSP00000349634:S419I;ENSP00000358984:S428I;ENSP00000332013:S448I	ENSP00000332013:S448I	S	+	2	0	ZGPAT	61837246	1.000000	0.71417	0.982000	0.44146	0.912000	0.54170	5.511000	0.67024	0.716000	0.32124	0.563000	0.77884	AGC		0.627	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484		9	15	1	0	7.48243e-07	0.006214	8.50487e-07	9	15				
CHAF1B	8208	broad.mit.edu	37	21	37775077	37775077	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr21:37775077C>T	ENST00000314103.5	+	8	836	c.685C>T	c.(685-687)Cac>Tac	p.H229Y		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	229					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						CCGGATGTTTCACGACGACAG	0.393																																							uc002yvj.2		NA																	0				ovary(1)|skin(1)	2						c.(685-687)CAC>TAC		chromatin assembly factor 1 subunit B							233.0	225.0	227.0					21																	37775077		2203	4300	6503	SO:0001583	missense	8208				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|cytoplasm	chromatin binding|histone binding|unfolded protein binding	g.chr21:37775077C>T	U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.685C>T	21.37:g.37775077C>T	ENSP00000315700:p.His229Tyr						p.H229Y	NM_005441	NP_005432	Q13112	CAF1B_HUMAN			8	823	+			229			WD 5.		Q99548	Missense_Mutation	SNP	ENST00000314103.5	37	c.685C>T	CCDS13644.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.015001	0.35511	.	.	ENSG00000159259	ENST00000314103	T	0.65364	-0.15	4.51	4.51	0.55191	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.103999	0.64402	D	0.000004	T	0.62514	0.2434	L	0.55990	1.75	0.80722	D	1	B	0.33964	0.434	B	0.38020	0.263	T	0.66874	-0.5813	10	0.54805	T	0.06	-18.6286	17.2481	0.87034	0.0:1.0:0.0:0.0	.	229	Q13112	CAF1B_HUMAN	Y	229	ENSP00000315700:H229Y	ENSP00000315700:H229Y	H	+	1	0	CHAF1B	36696947	1.000000	0.71417	0.875000	0.34327	0.264000	0.26372	7.053000	0.76641	2.233000	0.73108	0.456000	0.33151	CAC		0.393	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194616.2	NM_005441		39	200	0	0	0	0.013114	0	39	200				
ICOSLG	23308	broad.mit.edu	37	21	45651216	45651216	+	Missense_Mutation	SNP	G	G	A	rs200793282		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr21:45651216G>A	ENST00000407780.3	-	5	936	c.809C>T	c.(808-810)gCg>gTg	p.A270V	ICOSLG_ENST00000400379.3_Missense_Mutation_p.A270V|ICOSLG_ENST00000344330.4_Missense_Mutation_p.A270V|ICOSLG_ENST00000400377.3_Missense_Mutation_p.A153V	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand	270					B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		TATGGCCACCGCCACGACCAC	0.572																																							uc002zee.2		NA																	0					0						c.(808-810)GCG>GTG		inducible T-cell co-stimulator ligand precursor		G	VAL/ALA	0,4320		0,0,2160	83.0	92.0	89.0		809	-0.8	0.0	21		89	5,8495		0,5,4245	yes	missense	ICOSLG	NM_015259.4	64	0,5,6405	AA,AG,GG		0.0588,0.0,0.039	possibly-damaging	270/303	45651216	5,12815	2160	4250	6410	SO:0001583	missense	23308				B cell activation|defense response|hyperosmotic response|positive regulation of activated T cell proliferation|signal transduction|T cell activation|T cell costimulation		receptor binding	g.chr21:45651216G>A	AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.809C>T	21.37:g.45651216G>A	ENSP00000384432:p.Ala270Val					ICOSLG_uc011afc.1_Missense_Mutation_p.A180V|ICOSLG_uc002zef.2_Missense_Mutation_p.A153V|ICOSLG_uc010gpp.1_Missense_Mutation_p.A270V	p.A270V	NM_015259	NP_056074	O75144	ICOSL_HUMAN		Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)	5	943	-			270			Helical; (Potential).		A8MUZ1|Q9HD18|Q9NRQ1	Missense_Mutation	SNP	ENST00000407780.3	37	c.809C>T	CCDS42952.1	.	.	.	.	.	.	.	.	.	.	G	9.038	0.989033	0.18966	0.0	5.88E-4	ENSG00000160223	ENST00000344330;ENST00000407780;ENST00000400379;ENST00000400377	T;T;T;T	0.15256	5.27;5.27;4.99;2.44	2.28	-0.755	0.11061	.	1.058830	0.07418	N	0.893542	T	0.07369	0.0186	L	0.27053	0.805	0.09310	N	1	P;P;P	0.47106	0.89;0.89;0.89	B;B;B	0.31547	0.082;0.132;0.082	T	0.30851	-0.9964	10	0.12766	T	0.61	.	5.3509	0.16036	0.4582:0.0:0.5418:0.0	.	270;153;270	A0N0L8;A8MUZ1;O75144	.;.;ICOSL_HUMAN	V	270;270;270;153	ENSP00000339477:A270V;ENSP00000384432:A270V;ENSP00000383230:A270V;ENSP00000383228:A153V	ENSP00000339477:A270V	A	-	2	0	ICOSLG	44475644	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.054000	0.11826	-0.201000	0.10284	-0.150000	0.13652	GCG		0.572	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195838.1	NM_015259		24	52	0	0	0	0.00333	0	24	52				
COL6A2	1292	broad.mit.edu	37	21	47533965	47533965	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr21:47533965C>A	ENST00000300527.4	+	5	883	c.779C>A	c.(778-780)cCc>cAc	p.P260H	COL6A2_ENST00000357838.4_Missense_Mutation_p.P260H|COL6A2_ENST00000397763.1_Missense_Mutation_p.P260H|COL6A2_ENST00000409416.1_Missense_Mutation_p.P260H|COL6A2_ENST00000310645.5_Missense_Mutation_p.P260H	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	260	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCCTCTGGCCCCAAGGGCTAC	0.567																																							uc002zia.1		NA																	0				central_nervous_system(7)|ovary(1)	8						c.(778-780)CCC>CAC		alpha 2 type VI collagen isoform 2C2 precursor							103.0	82.0	89.0					21																	47533965		2203	4300	6503	SO:0001583	missense	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47533965C>A	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.779C>A	21.37:g.47533965C>A	ENSP00000300527:p.Pro260His					COL6A2_uc002zhy.1_Missense_Mutation_p.P260H|COL6A2_uc002zhz.1_Missense_Mutation_p.P260H|COL6A2_uc002zib.1_Intron	p.P260H	NM_001849	NP_001840	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	5	861	+	Breast(49;0.245)		260			Triple-helical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	c.779C>A	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.994203	0.54041	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19;-4.19	4.52	4.52	0.55395	.	0.056069	0.64402	D	0.000001	D	0.98172	0.9396	M	0.85945	2.785	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.993;0.982	D	0.98742	1.0717	10	0.52906	T	0.07	-18.0075	17.6285	0.88099	0.0:1.0:0.0:0.0	.	260;260;260	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	H	260	ENSP00000300527:P260H;ENSP00000350497:P260H;ENSP00000312529:P260H;ENSP00000387115:P260H;ENSP00000380870:P260H	ENSP00000300527:P260H	P	+	2	0	COL6A2	46358393	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	2.611000	0.46334	2.237000	0.73441	0.643000	0.83706	CCC		0.567	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			12	59	1	0	0.00316338	0.003163	0.00332064	12	59				
PCNT	5116	broad.mit.edu	37	21	47836669	47836669	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr21:47836669C>T	ENST00000359568.5	+	30	6944	c.6837C>T	c.(6835-6837)tcC>tcT	p.S2279S	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2279					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TGCTTTGTTCCCCAGGCGTGT	0.687																																							uc002zji.3		NA																	0				ovary(4)|breast(2)|pancreas(2)	8						c.(6835-6837)TCC>TCT		pericentrin							20.0	22.0	22.0					21																	47836669		2004	3964	5968	SO:0001819	synonymous_variant	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47836669C>T	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.6837C>T	21.37:g.47836669C>T						PCNT_uc002zjj.2_Silent_p.S2161S	p.S2279S	NM_006031	NP_006022	O95613	PCNT_HUMAN			30	6944	+	Breast(49;0.112)		2279					O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	c.6837C>T	CCDS33592.1																																																																																				0.687	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		22	36	0	0	0	0.002299	0	22	36				
PRAME	23532	broad.mit.edu	37	22	22892468	22892468	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:22892468C>T	ENST00000398741.1	-	5	939	c.633G>A	c.(631-633)aaG>aaA	p.K211K	PRAME_ENST00000398743.2_Silent_p.K211K|PRAME_ENST00000543184.1_Silent_p.K211K|PRAME_ENST00000424204.2_Silent_p.K195K|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000402697.1_Silent_p.K211K|PRAME_ENST00000405655.3_Silent_p.K211K|PRAME_ENST00000539862.1_Silent_p.K195K	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	211					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		TCTTCAGCTTCTTACAGCACA	0.433																																					Melanoma(73;1707 1838 15168 27201)	Melanoma(73;1707 1838 15168 27201)	uc002zwf.2		NA																	0				central_nervous_system(2)	2						c.(631-633)AAG>AAA		preferentially expressed antigen in melanoma							136.0	133.0	134.0					22																	22892468		2203	4300	6503	SO:0001819	synonymous_variant	23532				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding	g.chr22:22892468C>T	U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.633G>A	22.37:g.22892468C>T						LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Silent_p.K195K|PRAME_uc010gtr.2_Silent_p.K211K|PRAME_uc002zwg.2_Silent_p.K211K|PRAME_uc002zwh.2_Silent_p.K211K|PRAME_uc002zwi.2_Silent_p.K211K|PRAME_uc002zwj.2_Silent_p.K211K|PRAME_uc002zwk.2_Silent_p.K211K	p.K211K	NM_206956	NP_996839	P78395	PRAME_HUMAN		READ - Rectum adenocarcinoma(21;0.0649)	4	789	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)	211					B2R6Y7|O43481|Q8IXN8	Silent	SNP	ENST00000398741.1	37	c.633G>A	CCDS13801.1																																																																																				0.433	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321644.1	NM_206953		13	79	0	0	0	0.001368	0	13	79				
MYO18B	84700	broad.mit.edu	37	22	26343735	26343735	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:26343735G>C	ENST00000407587.2	+	36	5861	c.5692G>C	c.(5692-5694)Gat>Cat	p.D1898H	MYO18B_ENST00000536101.1_Missense_Mutation_p.D1897H|MYO18B_ENST00000335473.7_Missense_Mutation_p.D1897H			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1897	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GAAGCGCATCGATGAGGACCA	0.552																																							uc003abz.1		NA																	0				ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(5689-5691)GAT>CAT		myosin XVIIIB							71.0	73.0	72.0					22																	26343735		2089	4228	6317	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26343735G>C	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5692G>C	22.37:g.26343735G>C	ENSP00000386096:p.Asp1898His					MYO18B_uc003aca.1_Missense_Mutation_p.D1778H|MYO18B_uc010guy.1_Missense_Mutation_p.D1779H|MYO18B_uc010guz.1_Missense_Mutation_p.D1777H|MYO18B_uc011aka.1_Missense_Mutation_p.D1051H|MYO18B_uc011akb.1_Missense_Mutation_p.D1410H	p.D1897H	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN			36	5939	+			1897			Tail.|Potential.		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.5689G>C		.	.	.	.	.	.	.	.	.	.	G	17.54	3.414739	0.62511	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87412	-2.24;-2.24;-2.25	5.06	5.06	0.68205	.	0.310681	0.30028	N	0.010591	D	0.90889	0.7137	L	0.54323	1.7	0.43489	D	0.995724	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.971;0.989;0.993;0.995	D	0.91312	0.5075	10	0.87932	D	0	.	11.5772	0.50869	0.0877:0.0:0.9123:0.0	.	1410;1897;1898;1897	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	H	1897;1897;1898	ENSP00000441229:D1897H;ENSP00000334563:D1897H;ENSP00000386096:D1898H	ENSP00000334563:D1897H	D	+	1	0	MYO18B	24673735	1.000000	0.71417	0.106000	0.21319	0.672000	0.39443	7.274000	0.78538	2.360000	0.80028	0.655000	0.94253	GAT		0.552	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		11	27	0	0	0	0.001855	0	11	27				
DEPDC5	9681	broad.mit.edu	37	22	32193597	32193597	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:32193597A>T	ENST00000382112.3	+	12	849	c.779A>T	c.(778-780)cAg>cTg	p.Q260L	DEPDC5_ENST00000400242.3_Missense_Mutation_p.Q260L|DEPDC5_ENST00000266091.3_Missense_Mutation_p.Q260L|DEPDC5_ENST00000400249.2_Missense_Mutation_p.Q260L|DEPDC5_ENST00000382111.2_Missense_Mutation_p.Q260L|DEPDC5_ENST00000400246.1_Missense_Mutation_p.Q260L|DEPDC5_ENST00000535622.1_Missense_Mutation_p.Q260L|DEPDC5_ENST00000400248.2_Missense_Mutation_p.Q260L|DEPDC5_ENST00000382105.2_Missense_Mutation_p.Q260L|DEPDC5_ENST00000536766.1_Missense_Mutation_p.Q232L	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	260					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GTGGTGGTGCAGAATGAGAGA	0.413																																							uc003als.2		NA																	0				ovary(4)|central_nervous_system(3)|pancreas(1)	8						c.(778-780)CAG>CTG		DEP domain containing 5 isoform 1							92.0	89.0	90.0					22																	32193597		1879	4109	5988	SO:0001583	missense	9681				intracellular signal transduction			g.chr22:32193597A>T	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.779A>T	22.37:g.32193597A>T	ENSP00000371546:p.Gln260Leu					DEPDC5_uc011als.1_Missense_Mutation_p.Q260L|DEPDC5_uc011alu.1_Missense_Mutation_p.Q260L|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.Q260L|DEPDC5_uc003alr.1_Missense_Mutation_p.Q260L|DEPDC5_uc011alt.1_Missense_Mutation_p.Q232L	p.Q260L	NM_014662	NP_055477	O75140	DEPD5_HUMAN			13	921	+			260					A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	c.779A>T	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	A	18.67	3.673002	0.67928	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T;T	0.48201	1.37;1.38;0.82;1.77;1.77;1.75;1.37;1.77;1.75;1.77	5.05	5.05	0.67936	.	0.056069	0.64402	D	0.000001	T	0.55130	0.1901	M	0.75447	2.3	0.80722	D	1	P;B;B;B;P;B	0.36086	0.536;0.42;0.053;0.256;0.476;0.291	B;B;B;B;B;B	0.42030	0.373;0.09;0.199;0.345;0.299;0.2	T	0.61922	-0.6963	10	0.87932	D	0	.	13.9647	0.64202	1.0:0.0:0.0:0.0	.	260;232;260;260;260;260	B9EGN9;F5GYZ8;B4DH93;A8MPX9;O75140;O75140-2	.;.;.;.;DEPD5_HUMAN;.	L	260;232;260;260;260;260;260;260;260;260;260	ENSP00000440210:Q260L;ENSP00000441358:Q232L;ENSP00000383101:Q260L;ENSP00000266091:Q260L;ENSP00000383108:Q260L;ENSP00000383105:Q260L;ENSP00000371539:Q260L;ENSP00000371546:Q260L;ENSP00000371545:Q260L;ENSP00000383107:Q260L	ENSP00000266091:Q260L	Q	+	2	0	DEPDC5	30523597	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.097000	0.94193	1.921000	0.55644	0.443000	0.29094	CAG		0.413	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		14	42	0	0	0	0.003163	0	14	42				
TNRC6B	23112	broad.mit.edu	37	22	40658159	40658159	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:40658159G>A	ENST00000454349.2	+	4	650	c.439G>A	c.(439-441)Gag>Aag	p.E147K	TNRC6B_ENST00000301923.9_Missense_Mutation_p.E183K|TNRC6B_ENST00000402203.1_Missense_Mutation_p.E183K|TNRC6B_ENST00000335727.9_Missense_Mutation_p.E147K	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	147	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GCTGCAGAGTGAGAGTGGGAC	0.572																																							uc011aor.1		NA																	0					0						c.(439-441)GAG>AAG		trinucleotide repeat containing 6B isoform 1							25.0	28.0	27.0					22																	40658159		2130	4232	6362	SO:0001583	missense	23112				gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding	g.chr22:40658159G>A	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.439G>A	22.37:g.40658159G>A	ENSP00000401946:p.Glu147Lys					TNRC6B_uc003aym.2_Missense_Mutation_p.E183K|TNRC6B_uc003ayn.3_Missense_Mutation_p.E147K|TNRC6B_uc003ayo.2_5'Flank	p.E147K	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN			4	650	+			147					B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	c.439G>A	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171825	0.38315	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	T;T;T;T	0.30448	1.53;1.53;2.78;2.79	5.75	5.75	0.90469	.	0.547260	0.20397	N	0.093121	T	0.16342	0.0393	N	0.05383	-0.06	0.31997	N	0.603802	B;B;B	0.31383	0.321;0.275;0.275	B;B;B	0.23852	0.049;0.037;0.037	T	0.05305	-1.0893	10	0.06891	T	0.86	-5.4556	19.9525	0.97208	0.0:0.0:1.0:0.0	.	147;147;183	Q9UPQ9;Q9UPQ9-1;Q9UPQ9-2	TNR6B_HUMAN;.;.	K	183;183;147;147;147	ENSP00000306759:E183K;ENSP00000384795:E183K;ENSP00000401946:E147K;ENSP00000338371:E147K	ENSP00000306759:E183K	E	+	1	0	TNRC6B	38988105	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	3.683000	0.54663	2.720000	0.93068	0.455000	0.32223	GAG		0.572	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				4	13	0	0	0	0.009096	0	4	13				
XRCC6	2547	broad.mit.edu	37	22	42054269	42054269	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:42054269G>C	ENST00000359308.4	+	10	2090	c.1435G>C	c.(1435-1437)Gag>Cag	p.E479Q	XRCC6_ENST00000405878.1_Missense_Mutation_p.E479Q|XRCC6_ENST00000402580.3_Missense_Mutation_p.E438Q|XRCC6_ENST00000405506.1_Missense_Mutation_p.E429Q|XRCC6_ENST00000360079.3_Missense_Mutation_p.E479Q|XRCC6_ENST00000428575.2_Missense_Mutation_p.E346Q			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	479					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						TGACAGCTTTGAGAACCCCGT	0.428								Non-homologous end-joining																															uc003bao.1		NA																	0				skin(2)|ovary(1)|lung(1)|kidney(1)	5						c.(1435-1437)GAG>CAG	Direct_reversal_of_damage|NHEJ	ATP-dependent DNA helicase II, 70 kDa subunit							74.0	73.0	74.0					22																	42054269		2203	4300	6503	SO:0001583	missense	2547				DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding	g.chr22:42054269G>C	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1435G>C	22.37:g.42054269G>C	ENSP00000352257:p.Glu479Gln					XRCC6_uc003bap.1_Missense_Mutation_p.E438Q|XRCC6_uc011apc.1_Missense_Mutation_p.E429Q|XRCC6_uc003baq.1_Missense_Mutation_p.E479Q|XRCC6_uc003bar.1_Missense_Mutation_p.E479Q|XRCC6_uc003bas.1_Missense_Mutation_p.E429Q	p.E479Q	NM_001469	NP_001460	P12956	XRCC6_HUMAN			11	1505	+			479					B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	ENST00000359308.4	37	c.1435G>C	CCDS14021.1	.	.	.	.	.	.	.	.	.	.	g	28.3	4.910095	0.92107	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74	5.41	5.41	0.78517	Spen Paralogue and Orthologue SPOC, C-terminal-like (1);Ku70/Ku80 C-terminal arm (2);	0.000000	0.85682	D	0.000000	T	0.64382	0.2593	L	0.52126	1.63	0.80722	D	1	D;D;D;D	0.89917	0.989;0.999;1.0;0.996	D;D;D;D	0.97110	0.931;0.985;1.0;0.968	T	0.58869	-0.7560	10	0.30854	T	0.27	-31.8982	19.1922	0.93671	0.0:0.0:1.0:0.0	.	429;479;438;479	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	Q	479;438;346;479;479;479;429	ENSP00000353192:E479Q;ENSP00000384941:E438Q;ENSP00000403679:E346Q;ENSP00000352257:E479Q;ENSP00000384257:E479Q;ENSP00000384082:E429Q	ENSP00000352257:E479Q	E	+	1	0	XRCC6	40384215	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	9.246000	0.95438	2.530000	0.85305	0.461000	0.40582	GAG		0.428	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	NM_001469		8	83	0	0	0	0.006214	0	8	83				
EFCAB6	64800	broad.mit.edu	37	22	44022376	44022376	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:44022376A>C	ENST00000262726.7	-	20	2669	c.2416T>G	c.(2416-2418)Tgt>Ggt	p.C806G	EFCAB6_ENST00000396231.2_Missense_Mutation_p.C654G	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	806					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CTCTTCTCACACAAATTTTGA	0.453																																							uc003bdy.1		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7						c.(2416-2418)TGT>GGT		CAP-binding protein complex interacting protein							81.0	77.0	79.0					22																	44022376		2203	4300	6503	SO:0001583	missense	64800				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding	g.chr22:44022376A>C	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2416T>G	22.37:g.44022376A>C	ENSP00000262726:p.Cys806Gly					EFCAB6_uc003bdz.1_Missense_Mutation_p.C654G|EFCAB6_uc010gzi.1_Missense_Mutation_p.C654G|EFCAB6_uc010gzj.1_Missense_Mutation_p.C104G|EFCAB6_uc010gzk.1_RNA	p.C806G	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN			20	2631	-		Ovarian(80;0.0247)|all_neural(38;0.025)	806					A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	c.2416T>G	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	A	9.514	1.106608	0.20714	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.07908	3.15;3.15	4.84	3.8	0.43715	EF-hand-like domain (1);	0.481435	0.20193	N	0.097265	T	0.13457	0.0326	L	0.51422	1.61	0.34382	D	0.693259	D;P	0.58620	0.983;0.913	P;B	0.53649	0.731;0.424	T	0.23511	-1.0186	10	0.26408	T	0.33	-3.0883	8.302	0.32019	0.9079:0.0:0.0921:0.0	.	654;806	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	G	654;806	ENSP00000379533:C654G;ENSP00000262726:C806G	ENSP00000262726:C806G	C	-	1	0	EFCAB6	42353709	0.898000	0.30612	0.142000	0.22268	0.385000	0.30292	2.833000	0.48159	0.860000	0.35481	0.460000	0.39030	TGT		0.453	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		16	29	0	0	0	0.003163	0	16	29				
MAPK12	6300	broad.mit.edu	37	22	50693762	50693762	+	Silent	SNP	C	C	T	rs561024779		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:50693762C>T	ENST00000215659.8	-	11	1203	c.888G>A	c.(886-888)gcG>gcA	p.A296A	MAPK12_ENST00000395780.1_Silent_p.A206A|MAPK12_ENST00000497036.1_5'UTR	NM_002969.3	NP_002960.2	P53778	MK12_HUMAN	mitogen-activated protein kinase 12	296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle arrest (GO:0007050)|DNA damage induced protein phosphorylation (GO:0006975)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of peptidase activity (GO:0010952)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCGCTGCTCCGCGTCCAGCA	0.657													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12964	0.0		0.0	False		,,,				2504	0.0						uc003bkm.1		NA																	0					0						c.(886-888)GCG>GCA		mitogen-activated protein kinase 12							90.0	87.0	88.0					22																	50693762		2203	4299	6502	SO:0001819	synonymous_variant	6300				cell cycle arrest|DNA damage induced protein phosphorylation|muscle organ development|myoblast differentiation|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction	mitochondrion|nucleoplasm	ATP binding|magnesium ion binding|MAP kinase activity|protein binding	g.chr22:50693762C>T	U66243	CCDS14089.1	22q13.3	2012-05-08			ENSG00000188130	ENSG00000188130	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6874	protein-coding gene	gene with protein product		602399		SAPK3		9169156	Standard	NM_002969		Approved	ERK6, PRKM12, p38gamma, SAPK-3	uc003bkm.1	P53778	OTTHUMG00000030145	ENST00000215659.8:c.888G>A	22.37:g.50693762C>T						MAPK12_uc003bkn.2_Silent_p.A115A|MAPK12_uc003bko.2_Silent_p.A206A|MAPK12_uc003bkl.1_Silent_p.A286A|MAPK12_uc003bkp.2_Silent_p.A81A|MAPK12_uc003bkq.2_Silent_p.A115A	p.A296A	NM_002969	NP_002960	P53778	MK12_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	11	1039	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	296			Protein kinase.		Q14260|Q6IC53|Q99588|Q99672	Silent	SNP	ENST00000215659.8	37	c.888G>A	CCDS14089.1																																																																																				0.657	MAPK12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074999.2	NM_002969		18	129	0	0	0	0.008871	0	18	129				
GRM7	2917	broad.mit.edu	37	3	7503304	7503304	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:7503304C>T	ENST00000357716.4	+	7	1684	c.1410C>T	c.(1408-1410)aaC>aaT	p.N470N	GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000486284.1_Silent_p.N470N|GRM7_ENST00000402647.2_Silent_p.N470N|GRM7_ENST00000403881.1_Silent_p.N470N|GRM7_ENST00000389336.4_Silent_p.N470N	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	470					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TTAACAAGAACGGGGATGCAC	0.448																																							uc003bqm.2		NA																	0				ovary(4)|lung(3)	7						c.(1408-1410)AAC>AAT		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						157.0	143.0	148.0					3																	7503304		2203	4300	6503	SO:0001819	synonymous_variant	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7503304C>T	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1410C>T	3.37:g.7503304C>T						GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Silent_p.N470N|GRM7_uc003bql.2_Silent_p.N470N|GRM7_uc003bqn.1_Silent_p.N53N|GRM7_uc010hch.1_Translation_Start_Site	p.N470N	NM_000844	NP_000835	Q14831	GRM7_HUMAN			7	1684	+			470			Extracellular (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	ENST00000357716.4	37	c.1410C>T	CCDS43042.1																																																																																				0.448	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		5	102	0	0	0	0.001168	0	5	102				
RAD18	56852	broad.mit.edu	37	3	8977576	8977576	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:8977576C>G	ENST00000264926.2	-	7	984	c.868G>C	c.(868-870)Gat>Cat	p.D290H		NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	290					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		TGCAAAGCATCGCATTGGGCA	0.328								Rad6 pathway																															uc003brd.2		NA																	0				skin(3)|ovary(2)	5						c.(868-870)GAT>CAT	Rad6_pathway	postreplication repair protein hRAD18p							173.0	164.0	167.0					3																	8977576		2203	4300	6503	SO:0001583	missense	56852				DNA repair	nucleus|replication fork	damaged DNA binding|ligase activity|ubiquitin protein ligase binding|Y-form DNA binding|zinc ion binding	g.chr3:8977576C>G		CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.868G>C	3.37:g.8977576C>G	ENSP00000264926:p.Asp290His					RAD18_uc003bre.2_RNA	p.D290H	NM_020165	NP_064550	Q9NS91	RAD18_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.0552)	7	945	-			290					Q58F55|Q9NRT6	Missense_Mutation	SNP	ENST00000264926.2	37	c.868G>C	CCDS2571.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070066	0.76301	.	.	ENSG00000070950	ENST00000264926	T	0.68903	-0.36	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.82522	0.5055	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83580	0.0117	10	0.87932	D	0	-0.9359	18.7002	0.91618	0.0:1.0:0.0:0.0	.	290	Q9NS91	RAD18_HUMAN	H	290	ENSP00000264926:D290H	ENSP00000264926:D290H	D	-	1	0	RAD18	8952576	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	7.352000	0.79404	2.774000	0.95407	0.484000	0.47621	GAT		0.328	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207071.2	NM_020165		9	44	0	0	0	0.006214	0	9	44				
RFTN1	23180	broad.mit.edu	37	3	16411594	16411594	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:16411594C>G	ENST00000334133.4	-	6	1291	c.1019G>C	c.(1018-1020)gGa>gCa	p.G340A	RFTN1_ENST00000432519.1_Missense_Mutation_p.G304A|RFTN1_ENST00000483671.1_5'UTR	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	340					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						ATTCACTATTCCAAGGTAGAA	0.493																																							uc003cay.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1018-1020)GGA>GCA		raft-linking protein							128.0	118.0	121.0					3																	16411594		2203	4300	6503	SO:0001583	missense	23180					plasma membrane		g.chr3:16411594C>G	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.1019G>C	3.37:g.16411594C>G	ENSP00000334153:p.Gly340Ala					RFTN1_uc010hes.2_Missense_Mutation_p.G304A	p.G340A	NM_015150	NP_055965	Q14699	RFTN1_HUMAN			6	1301	-			340					Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	37	c.1019G>C	CCDS33712.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908551	0.52439	.	.	ENSG00000131378	ENST00000432519;ENST00000334133	T;T	0.32988	1.43;1.43	5.68	4.79	0.61399	.	0.168058	0.53938	D	0.000056	T	0.37679	0.1012	M	0.71581	2.175	0.51012	D	0.9999	D;P	0.55605	0.972;0.736	B;B	0.42771	0.397;0.275	T	0.40213	-0.9575	10	0.48119	T	0.1	-15.6331	16.523	0.84322	0.0:0.8691:0.1309:0.0	.	304;340	G3XAJ6;Q14699	.;RFTN1_HUMAN	A	304;340	ENSP00000403926:G304A;ENSP00000334153:G340A	ENSP00000334153:G340A	G	-	2	0	RFTN1	16386598	0.969000	0.33509	0.086000	0.20670	0.054000	0.15201	3.478000	0.53158	1.379000	0.46325	0.561000	0.74099	GGA		0.493	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150		13	55	0	0	0	0.001368	0	13	55				
KCNH8	131096	broad.mit.edu	37	3	19575181	19575181	+	Silent	SNP	C	C	A	rs138763434	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:19575181C>A	ENST00000328405.2	+	16	3180	c.2914C>A	c.(2914-2916)Cga>Aga	p.R972R		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	972	Ser-rich.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CAGCCCCCAACGAACTGGAGC	0.493																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	0				lung(4)|ovary(1)	5						c.(2914-2916)CGA>AGA		potassium voltage-gated channel, subfamily H,							103.0	104.0	103.0					3																	19575181		2203	4300	6503	SO:0001819	synonymous_variant	131096					integral to membrane	two-component sensor activity	g.chr3:19575181C>A	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2914C>A	3.37:g.19575181C>A						KCNH8_uc010hex.1_Silent_p.R433R	p.R972R	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN			16	3109	+			972			Ser-rich.|Cytoplasmic (Potential).		B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	37	c.2914C>A	CCDS2632.1																																																																																				0.493	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		17	65	1	0	2.94398e-08	0.007413	3.43152e-08	17	65				
NEK10	152110	broad.mit.edu	37	3	27161315	27161315	+	Silent	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:27161315T>A	ENST00000429845.2	-	36	3659	c.3297A>T	c.(3295-3297)acA>acT	p.T1099T	NEK10_ENST00000383770.3_Silent_p.T354T|NEK10_ENST00000295720.6_Silent_p.T411T|NEK10_ENST00000383771.4_Silent_p.T401T			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	1099					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGTAATCTGCTGTGAAAAAGT	0.423																																							uc010hfk.2		NA																	0				ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						c.(1231-1233)ACA>ACT		RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;							126.0	129.0	128.0					3																	27161315		2203	4300	6503	SO:0001819	synonymous_variant	152110						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr3:27161315T>A	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.3297A>T	3.37:g.27161315T>A						NEK10_uc010hfj.2_Silent_p.T354T	p.T411T			Q6ZWH5	NEK10_HUMAN			14	1462	-			1099					A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Silent	SNP	ENST00000429845.2	37	c.1233A>T																																																																																					0.423	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		10	59	0	0	0	0.008291	0	10	59				
NEK10	152110	broad.mit.edu	37	3	27243978	27243978	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:27243978G>T	ENST00000429845.2	-	25	2523	c.2161C>A	c.(2161-2163)Cag>Aag	p.Q721K	NEK10_ENST00000383770.3_Missense_Mutation_p.Q33K|NEK10_ENST00000357467.2_Missense_Mutation_p.Q118K|NEK10_ENST00000295720.6_Missense_Mutation_p.Q33K|NEK10_ENST00000383771.4_Missense_Mutation_p.Q33K			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	721					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GTCGCCATCTGATAAAGGATG	0.493																																							uc010hfk.2		NA																	0				ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						c.(97-99)CAG>AAG		RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;							93.0	80.0	85.0					3																	27243978		2203	4300	6503	SO:0001583	missense	152110						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr3:27243978G>T	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2161C>A	3.37:g.27243978G>T	ENSP00000395849:p.Gln721Lys					NEK10_uc003cds.1_Missense_Mutation_p.Q118K|NEK10_uc010hfj.2_Missense_Mutation_p.Q33K	p.Q33K			Q6ZWH5	NEK10_HUMAN			3	326	-			721					A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	ENST00000429845.2	37	c.97C>A		.	.	.	.	.	.	.	.	.	.	G	19.65	3.866834	0.72065	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000383770;ENST00000357467	T;T;T;T	0.49432	0.78;0.78;0.78;1.09	5.72	5.72	0.89469	.	.	.	.	.	T	0.47116	0.1428	.	.	.	0.36683	D	0.879159	P;P;P	0.40660	0.726;0.57;0.475	B;B;B	0.40825	0.341;0.341;0.253	T	0.59048	-0.7527	8	0.72032	D	0.01	.	15.0286	0.71687	0.0:0.1419:0.8581:0.0	.	33;33;118	Q6ZWH5-5;Q6ZWH5-7;Q8N774	.;.;.	K	33;33;33;118	ENSP00000295720:Q33K;ENSP00000373281:Q33K;ENSP00000373280:Q33K;ENSP00000350059:Q118K	ENSP00000295720:Q33K	Q	-	1	0	NEK10	27218982	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.998000	0.76277	2.705000	0.92388	0.591000	0.81541	CAG		0.493	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		6	35	1	0	0.00198382	0.001984	0.00208643	6	35				
NEK10	152110	broad.mit.edu	37	3	27243984	27243985	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:27243984_27243985GG>AA	ENST00000429845.2	-	25	2516_2517	c.2154_2155CC>TT	c.(2152-2157)atCCtt>atTTtt	p.L719F	NEK10_ENST00000383770.3_Missense_Mutation_p.L31F|NEK10_ENST00000357467.2_Missense_Mutation_p.L116F|NEK10_ENST00000295720.6_Missense_Mutation_p.L31F|NEK10_ENST00000383771.4_Missense_Mutation_p.L31F			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	719					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						ATCTGATAAAGGATGCAGCCTA	0.49																																							uc010hfk.2		NA																	0				ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						c.(88-93)ATCCTT>ATTTTT		RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;																																				SO:0001583	missense	152110						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr3:27243984_27243985GG>AA	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2154_2155delinsAA	3.37:g.27243984_27243985delinsAA	ENSP00000395849:p.Leu719Phe					NEK10_uc003cds.1_Missense_Mutation_p.L116F|NEK10_uc010hfj.2_Missense_Mutation_p.L31F	p.L31F			Q6ZWH5	NEK10_HUMAN			3	319_320	-			719					A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	DNP	ENST00000429845.2	37	c.90_91CC>TT																																																																																					0.490	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		6	36	0	0	0	0.004672	0	6	36				
SLC4A7	9497	broad.mit.edu	37	3	27473044	27473044	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:27473044T>C	ENST00000295736.5	-	7	938	c.868A>G	c.(868-870)Aga>Gga	p.R290G	SLC4A7_ENST00000446700.1_Missense_Mutation_p.R282G|SLC4A7_ENST00000445684.1_Missense_Mutation_p.R286G|SLC4A7_ENST00000435667.2_Intron|SLC4A7_ENST00000428386.1_Intron|SLC4A7_ENST00000455077.1_Intron|SLC4A7_ENST00000440156.1_Missense_Mutation_p.R286G|SLC4A7_ENST00000425128.2_Missense_Mutation_p.R282G|SLC4A7_ENST00000437179.1_Intron|SLC4A7_ENST00000388777.4_5'UTR|SLC4A7_ENST00000454389.1_Missense_Mutation_p.R299G	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	290					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	GTTCCAGCTCTTGAAGAAGGA	0.527																																							uc003cdv.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(868-870)AGA>GGA		solute carrier family 4, sodium bicarbonate							88.0	96.0	93.0					3																	27473044		2203	4300	6503	SO:0001583	missense	9497					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity	g.chr3:27473044T>C	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.868A>G	3.37:g.27473044T>C	ENSP00000295736:p.Arg290Gly					SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011aww.1_Missense_Mutation_p.R299G|SLC4A7_uc011awx.1_Missense_Mutation_p.R286G|SLC4A7_uc011awy.1_Missense_Mutation_p.R282G|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Missense_Mutation_p.R286G|SLC4A7_uc010hfm.2_Intron|SLC4A7_uc003cdw.2_Intron	p.R290G	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN			7	939	-			290			Extracellular (Potential).		A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	c.868A>G	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	T	17.50	3.405640	0.62288	.	.	ENSG00000033867	ENST00000295736;ENST00000454389;ENST00000440156;ENST00000446700;ENST00000445684;ENST00000425128	T;T;T;T;T;T	0.78707	-1.11;-1.12;-1.2;-1.2;-1.2;0.31	5.98	4.82	0.62117	Bicarbonate transporter, cytoplasmic (1);	0.393637	0.25166	N	0.032634	T	0.67748	0.2926	L	0.34521	1.04	0.44261	D	0.997112	P;P;P;P;B	0.34462	0.454;0.454;0.454;0.454;0.245	B;B;B;B;B	0.34931	0.192;0.192;0.192;0.192;0.138	T	0.62784	-0.6781	10	0.27082	T	0.32	.	12.7199	0.57136	0.0:0.0:0.1376:0.8624	.	286;282;286;299;290	E9PFN4;E9PGC1;B5M453;E9PDL9;Q9Y6M7	.;.;.;.;S4A7_HUMAN	G	290;299;286;282;286;282	ENSP00000295736:R290G;ENSP00000390394:R299G;ENSP00000414797:R286G;ENSP00000406605:R282G;ENSP00000406804:R286G;ENSP00000401949:R282G	ENSP00000295736:R290G	R	-	1	2	SLC4A7	27448048	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.127000	0.57944	1.075000	0.40932	0.482000	0.46254	AGA		0.527	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615		14	45	0	0	0	0.003163	0	14	45				
TRANK1	9881	broad.mit.edu	37	3	36893753	36893753	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:36893753C>T	ENST00000429976.2	-	13	4748	c.4501G>A	c.(4501-4503)Ggc>Agc	p.G1501S	TRANK1_ENST00000463984.1_5'Flank|TRANK1_ENST00000301807.6_Missense_Mutation_p.G951S|TRANK1_ENST00000428977.2_Missense_Mutation_p.G951S	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1501							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TCAAAGAGGCCAGAATCCCTT	0.438																																							uc003cgj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2851-2853)GGC>AGC		lupus brain antigen 1							62.0	58.0	59.0					3																	36893753		1869	4115	5984	SO:0001583	missense	9881				DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr3:36893753C>T	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4501G>A	3.37:g.36893753C>T	ENSP00000416168:p.Gly1501Ser						p.G951S	NM_014831	NP_055646	O15050	TRNK1_HUMAN			4	3153	-			1501					Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	c.2851G>A	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267521	0.80469	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.81247	-1.47;-1.47;-1.47	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000011	D	0.83188	0.5200	N	0.19112	0.55	0.53005	D	0.99996	D	0.76494	0.999	D	0.70487	0.969	T	0.83136	-0.0111	10	0.40728	T	0.16	.	19.7666	0.96346	0.0:1.0:0.0:0.0	.	1501	O15050	TRNK1_HUMAN	S	951;1501;951	ENSP00000416826:G951S;ENSP00000416168:G1501S;ENSP00000301807:G951S	ENSP00000301807:G951S	G	-	1	0	TRANK1	36868757	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.568000	0.67385	2.764000	0.94973	0.650000	0.86243	GGC		0.438	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831		9	19	0	0	0	0.004482	0	9	19				
TRANK1	9881	broad.mit.edu	37	3	36896851	36896851	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:36896851G>A	ENST00000429976.2	-	12	4477	c.4230C>T	c.(4228-4230)atC>atT	p.I1410I	TRANK1_ENST00000301807.6_Silent_p.I860I|TRANK1_ENST00000428977.2_Silent_p.I860I	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1410							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TGGGGTCATTGATGCATTTCA	0.557																																							uc003cgj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2578-2580)ATC>ATT		lupus brain antigen 1							134.0	133.0	133.0					3																	36896851		2085	4222	6307	SO:0001819	synonymous_variant	9881				DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr3:36896851G>A	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4230C>T	3.37:g.36896851G>A							p.I860I	NM_014831	NP_055646	O15050	TRNK1_HUMAN			3	2882	-			1410					Q8N8K0	Silent	SNP	ENST00000429976.2	37	c.2580C>T	CCDS46789.2																																																																																				0.557	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831		32	93	0	0	0	0.009535	0	32	93				
CX3CR1	1524	broad.mit.edu	37	3	39306967	39306967	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:39306967T>A	ENST00000541347.1	-	2	1273	c.1034A>T	c.(1033-1035)cAc>cTc	p.H345L	CX3CR1_ENST00000399220.2_Missense_Mutation_p.H345L|CX3CR1_ENST00000358309.3_Missense_Mutation_p.H377L|CX3CR1_ENST00000542107.1_Missense_Mutation_p.H345L	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	345					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		ATCACTCGTGTGGTAAGTAAA	0.498																																							uc003cjl.2		NA																	0				lung(3)	3						c.(1033-1035)CAC>CTC		chemokine (C-X3-C motif) receptor 1							159.0	151.0	154.0					3																	39306967		1965	4163	6128	SO:0001583	missense	1524				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity	g.chr3:39306967T>A	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.1034A>T	3.37:g.39306967T>A	ENSP00000439140:p.His345Leu						p.H345L	NM_001337	NP_001328	P49238	CX3C1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)	2	1126	-			345			Cytoplasmic (Potential).		A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	ENST00000541347.1	37	c.1034A>T	CCDS43069.1	.	.	.	.	.	.	.	.	.	.	T	12.19	1.862684	0.32884	.	.	ENSG00000168329	ENST00000399220;ENST00000538756;ENST00000358309;ENST00000541347;ENST00000542107	T;T;T;T	0.64618	-0.09;-0.11;-0.09;-0.09	5.7	-1.88	0.07713	.	1.832040	0.02265	N	0.067914	T	0.52370	0.1730	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.45512	-0.9256	10	0.72032	D	0.01	.	4.6031	0.12363	0.3168:0.1362:0.0:0.5469	.	345	P49238	CX3C1_HUMAN	L	345;353;377;345;345	ENSP00000382166:H345L;ENSP00000351059:H377L;ENSP00000439140:H345L;ENSP00000444928:H345L	ENSP00000351059:H377L	H	-	2	0	CX3CR1	39281971	0.052000	0.20516	0.612000	0.29024	0.622000	0.37654	0.012000	0.13287	0.086000	0.17137	0.533000	0.62120	CAC		0.498	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343613.1	NM_001337		30	91	0	0	0	0.012213	0	30	91				
LTF	4057	broad.mit.edu	37	3	46496868	46496868	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:46496868C>T	ENST00000231751.4	-	5	859	c.564G>A	c.(562-564)ctG>ctA	p.L188L	LTF_ENST00000426532.2_Silent_p.L144L|LTF_ENST00000417439.1_Silent_p.L188L	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	188	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		ACAGGCGACACAGGTTGGGGA	0.552																																							uc003cpq.2		NA																	0				central_nervous_system(2)|ovary(1)|lung(1)	4						c.(562-564)CTG>CTA		lactotransferrin precursor	Pefloxacin(DB00487)						137.0	112.0	120.0					3																	46496868		2203	4300	6503	SO:0001819	synonymous_variant	4057				cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity	g.chr3:46496868C>T		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.564G>A	3.37:g.46496868C>T						LTF_uc003fzr.2_Silent_p.L144L|LTF_uc010hjh.2_Silent_p.L188L|LTF_uc003cpr.2_Silent_p.L175L	p.L188L	NM_002343	NP_002334	P02788	TRFL_HUMAN		all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	5	602	-			188			Transferrin-like 1.		A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Silent	SNP	ENST00000231751.4	37	c.564G>A	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	C	6.059	0.379129	0.11466	.	.	ENSG00000012223	ENST00000443743	.	.	.	4.79	1.79	0.24919	.	.	.	.	.	T	0.39091	0.1065	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.05338	-1.0891	5	0.11794	T	0.64	-16.1419	8.3225	0.32136	0.0:0.6205:0.2937:0.0858	.	.	.	.	Y	121	.	ENSP00000393737:C121Y	C	-	2	0	LTF	46471872	1.000000	0.71417	0.988000	0.46212	0.567000	0.35839	0.925000	0.28791	0.561000	0.29186	-0.137000	0.14449	TGT		0.552	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343		12	28	0	0	0	0.010729	0	12	28				
SETD2	29072	broad.mit.edu	37	3	47088029	47088029	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:47088029G>C	ENST00000409792.3	-	16	7088	c.7046C>G	c.(7045-7047)gCc>gGc	p.A2349G		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2349	Gln-rich.|Low charge region.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CACTGCTGCGGCTGGCTGTAC	0.463			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(7045-7047)GCC>GGC		SET domain containing 2							62.0	64.0	63.0					3																	47088029		2203	4300	6503	SO:0001583	missense	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47088029G>C	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7046C>G	3.37:g.47088029G>C	ENSP00000386759:p.Ala2349Gly					SETD2_uc003cqv.2_Missense_Mutation_p.A2416G|SETD2_uc003cqr.2_5'UTR	p.A2349G	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	16	7099	-		Acute lymphoblastic leukemia(5;0.0169)	2349			Gln-rich.|Low charge region.		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	c.7046C>G	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	9.687	1.150957	0.21371	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.88277	-2.36	5.87	5.87	0.94306	.	0.912039	0.09313	N	0.819384	T	0.76622	0.4013	N	0.02539	-0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.56890	-0.7904	10	0.16420	T	0.52	.	15.6633	0.77206	0.0:0.1364:0.8636:0.0	.	2349;2349	F2Z317;Q9BYW2	.;SETD2_HUMAN	G	2349	ENSP00000386759:A2349G	ENSP00000386759:A2349G	A	-	2	0	SETD2	47063033	0.476000	0.25901	0.013000	0.15412	0.910000	0.53928	4.094000	0.57721	2.774000	0.95407	0.650000	0.86243	GCC		0.463	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		9	36	0	0	0	0.006214	0	9	36				
SCAP	22937	broad.mit.edu	37	3	47458687	47458687	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:47458687G>A	ENST00000265565.5	-	18	3393	c.2981C>T	c.(2980-2982)gCc>gTc	p.A994V	SCAP_ENST00000545718.1_Missense_Mutation_p.A601V|SCAP_ENST00000441517.2_Missense_Mutation_p.A738V	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	994	Interaction with SREBF2. {ECO:0000250}.			A -> S (in Ref. 6; BAC11673). {ECO:0000305}.	aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CCCTTCAATGGCGTCCCACAC	0.632																																					Pancreas(149;978 1908 29304 37806 46700)	Pancreas(149;978 1908 29304 37806 46700)	uc003crh.1		NA																	0				ovary(1)	1						c.(2980-2982)GCC>GTC		SREBF chaperone protein							81.0	65.0	70.0					3																	47458687		2203	4300	6503	SO:0001583	missense	22937				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding	g.chr3:47458687G>A	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.2981C>T	3.37:g.47458687G>A	ENSP00000265565:p.Ala994Val					SCAP_uc011baz.1_Missense_Mutation_p.A738V|SCAP_uc003crg.2_Missense_Mutation_p.A601V	p.A994V	NM_012235	NP_036367	Q12770	SCAP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)	18	3236	-			994	A -> S (in Ref. 6; BAC11673).		Interaction with SREBF2 (By similarity).|Cytoplasmic (By similarity).|WD 2.		Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	37	c.2981C>T	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973269	0.92919	.	.	ENSG00000114650	ENST00000339815;ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.39997	1.71;2.37;1.05	4.74	4.74	0.60224	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.115945	0.64402	D	0.000019	T	0.39036	0.1063	L	0.29908	0.895	0.80722	D	1	D;P	0.56521	0.976;0.753	P;B	0.47251	0.542;0.275	T	0.13818	-1.0495	10	0.32370	T	0.25	-31.5839	17.5002	0.87728	0.0:0.0:1.0:0.0	.	738;994	F8W921;Q12770	.;SCAP_HUMAN	V	486;620;994;738;601	ENSP00000265565:A994V;ENSP00000416847:A738V;ENSP00000438956:A601V	ENSP00000265565:A994V	A	-	2	0	SCAP	47433691	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.174000	0.77620	2.466000	0.83321	0.561000	0.74099	GCC		0.632	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235		6	25	0	0	0	0.001168	0	6	25				
CELSR3	1951	broad.mit.edu	37	3	48678894	48678894	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:48678894C>T	ENST00000164024.4	-	33	9168	c.8888G>A	c.(8887-8889)tGt>tAt	p.C2963Y	MIR4793_ENST00000577502.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.C2968Y	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2963					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTGCAGAGCACAGGGGGCTGC	0.622																																							uc003cul.2		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(8887-8889)TGT>TAT		cadherin EGF LAG seven-pass G-type receptor 3							48.0	56.0	53.0					3																	48678894		2203	4297	6500	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48678894C>T	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.8888G>A	3.37:g.48678894C>T	ENSP00000164024:p.Cys2963Tyr					CELSR3_uc003cuf.1_Missense_Mutation_p.C3061Y|CELSR3_uc010hkf.2_Missense_Mutation_p.C253Y|CELSR3_uc010hkg.2_Missense_Mutation_p.C946Y	p.C2963Y	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	33	9169	-			2963			Cytoplasmic (Potential).		O75092	Missense_Mutation	SNP	ENST00000164024.4	37	c.8888G>A	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129005	0.56721	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.70282	-0.47;-0.47	5.22	5.22	0.72569	.	.	.	.	.	T	0.74612	0.3739	L	0.44542	1.39	0.39720	D	0.971451	P;B;D	0.67145	0.547;0.412;0.996	B;B;P	0.59171	0.173;0.084;0.853	T	0.77360	-0.2617	9	0.59425	D	0.04	.	12.1747	0.54178	0.0:0.9215:0.0:0.0785	.	2968;2963;3061	Q9NYQ7-2;Q9NYQ7;Q5Y190	.;CELR3_HUMAN;.	Y	2963;2968	ENSP00000164024:C2963Y;ENSP00000445694:C2968Y	ENSP00000164024:C2963Y	C	-	2	0	CELSR3	48653898	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.542000	0.53625	2.436000	0.82500	0.514000	0.50259	TGT		0.622	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		11	56	0	0	0	0.001855	0	11	56				
ABHD14B	84836	broad.mit.edu	37	3	52004084	52004084	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:52004084G>A	ENST00000483233.1	-	4	834	c.328C>T	c.(328-330)Cca>Tca	p.P110S	PCBP4_ENST00000395013.3_5'Flank|ABHD14B_ENST00000525795.1_Missense_Mutation_p.P110S|ABHD14B_ENST00000487005.1_5'UTR|PCBP4_ENST00000461554.1_5'Flank|ABHD14B_ENST00000315877.10_Missense_Mutation_p.P108S|RP11-155D18.14_ENST00000489595.2_Intron|PCBP4_ENST00000484633.1_5'Flank|PCBP4_ENST00000428823.2_5'Flank|PCBP4_ENST00000355852.2_5'Flank|RP11-155D18.12_ENST00000488257.1_RNA|ABHD14B_ENST00000395008.2_Missense_Mutation_p.P110S|ABHD14B_ENST00000361143.5_Missense_Mutation_p.P110S|ABHD14B_ENST00000461108.1_Missense_Mutation_p.P110S			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	110					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		CTCAGTGATGGACTGATCACA	0.647																																							uc003dcm.2		NA																	0					0						c.(328-330)CCA>TCA		abhydrolase domain containing 14B							54.0	54.0	54.0					3																	52004084		2203	4300	6503	SO:0001583	missense	84836					cytoplasm|nucleus	hydrolase activity	g.chr3:52004084G>A	AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.328C>T	3.37:g.52004084G>A	ENSP00000420065:p.Pro110Ser					PCBP4_uc003dch.1_5'Flank|PCBP4_uc003dci.1_5'Flank|PCBP4_uc003dcj.1_5'Flank|PCBP4_uc003dck.1_5'Flank|ABHD14B_uc010hly.2_Intron|ABHD14B_uc011bdy.1_Missense_Mutation_p.P110S|ABHD14B_uc003dcn.2_Missense_Mutation_p.P110S|ABHD14B_uc011bdz.1_Missense_Mutation_p.P110S	p.P110S	NM_032750	NP_116139	Q96IU4	ABHEB_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)	3	1216	-			110					Q86VK8|Q8N8W5	Missense_Mutation	SNP	ENST00000483233.1	37	c.328C>T	CCDS2842.1	.	.	.	.	.	.	.	.	.	.	G	33	5.249688	0.95305	.	.	ENSG00000114779	ENST00000483233;ENST00000315877;ENST00000395008;ENST00000361143;ENST00000461108;ENST00000525795	T;T;T;T;T;T	0.66280	2.03;2.03;2.03;2.03;-0.2;2.03	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.76328	0.3972	L	0.56396	1.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70938	-0.4736	10	0.25106	T	0.35	-13.714	19.1914	0.93667	0.0:0.0:1.0:0.0	.	110;110	B4DQI4;Q96IU4	.;ABHEB_HUMAN	S	110;108;110;110;110;110	ENSP00000420065:P110S;ENSP00000318248:P108S;ENSP00000378455:P110S;ENSP00000354841:P110S;ENSP00000417564:P110S;ENSP00000433388:P110S	ENSP00000318248:P108S	P	-	1	0	ABHD14B	51979124	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	9.487000	0.97945	2.626000	0.88956	0.655000	0.94253	CCA		0.647	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349673.1	NM_032750		14	33	0	0	0	0.001855	0	14	33				
CACNA1D	776	broad.mit.edu	37	3	53810922	53810922	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:53810922T>A	ENST00000350061.5	+	37	5037	c.4526T>A	c.(4525-4527)cTt>cAt	p.L1509H	CACNA1D_ENST00000288139.4_Missense_Mutation_p.L1529H|CACNA1D_ENST00000540742.1_Missense_Mutation_p.L401H|CACNA1D_ENST00000422281.2_Missense_Mutation_p.L1494H	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1509					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTCACTCTGCTTCGACGCATC	0.522																																							uc003dgv.3		NA																	0				ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11						c.(4525-4527)CTT>CAT		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						141.0	118.0	125.0					3																	53810922		2203	4300	6503	SO:0001583	missense	776				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr3:53810922T>A	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4526T>A	3.37:g.53810922T>A	ENSP00000288133:p.Leu1509His					CACNA1D_uc003dgu.3_Missense_Mutation_p.L1529H|CACNA1D_uc003dgy.3_Missense_Mutation_p.L1494H|CACNA1D_uc003dgw.3_Missense_Mutation_p.L1176H|CACNA1D_uc003dgx.1_Missense_Mutation_p.L685H	p.L1509H	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	37	4689	+			1509			Cytoplasmic (Potential).		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	c.4526T>A	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.756163	0.89843	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000540742	D;D;D;T;T	0.97941	-4.58;-4.62;-4.58;2.39;2.39	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000014	D	0.99067	0.9680	M	0.94142	3.5	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0	D	0.99425	1.0934	10	0.87932	D	0	.	15.4778	0.75497	0.0:0.0:0.0:1.0	.	1494;401;1202;1509;1529	B0FYA3;F5H313;Q59GD8;Q01668;Q01668-2	.;.;.;CAC1D_HUMAN;.	H	1509;1529;1494;1202;401	ENSP00000288133:L1509H;ENSP00000288139:L1529H;ENSP00000409174:L1494H;ENSP00000418014:L1202H;ENSP00000438229:L401H	ENSP00000288139:L1529H	L	+	2	0	CACNA1D	53785962	1.000000	0.71417	0.988000	0.46212	0.965000	0.64279	8.040000	0.89188	2.053000	0.61076	0.460000	0.39030	CTT		0.522	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		11	25	0	0	0	0.001368	0	11	25				
CCDC66	285331	broad.mit.edu	37	3	56627757	56627757	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:56627757G>A	ENST00000394672.3	+	9	1377	c.1307G>A	c.(1306-1308)aGt>aAt	p.S436N	CCDC66_ENST00000436465.2_Missense_Mutation_p.S436N|CCDC66_ENST00000326595.7_Missense_Mutation_p.S402N	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	436					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		ATGGCAAACAGTAAGAAAACA	0.378																																							uc003dhz.2		NA																	0				breast(1)	1						c.(1306-1308)AGT>AAT		coiled-coil domain containing 66 isoform 1							96.0	87.0	90.0					3																	56627757		2203	4300	6503	SO:0001583	missense	285331							g.chr3:56627757G>A	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1307G>A	3.37:g.56627757G>A	ENSP00000378167:p.Ser436Asn					CCDC66_uc003dhy.2_Missense_Mutation_p.S72N|CCDC66_uc003dhu.2_Missense_Mutation_p.S402N|CCDC66_uc003dhx.2_RNA	p.S436N	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)	9	1394	+			436					B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	37	c.1307G>A	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	G	6.114	0.389359	0.11581	.	.	ENSG00000180376	ENST00000422222;ENST00000394672;ENST00000326595;ENST00000436465	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	6.16	-3.48	0.04739	.	0.755272	0.13543	N	0.380052	T	0.24122	0.0584	L	0.34521	1.04	0.09310	N	0.999998	B	0.14438	0.01	B	0.09377	0.004	T	0.17137	-1.0379	10	0.16896	T	0.51	-0.2496	1.0493	0.01576	0.2519:0.1991:0.3632:0.1858	.	436	A2RUB6	CCD66_HUMAN	N	392;436;402;436	ENSP00000401451:S392N;ENSP00000378167:S436N;ENSP00000326050:S402N;ENSP00000404320:S436N	ENSP00000326050:S402N	S	+	2	0	CCDC66	56602797	0.050000	0.20438	0.005000	0.12908	0.304000	0.27724	0.154000	0.16343	-0.313000	0.08728	-0.355000	0.07637	AGT		0.378	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506		6	31	0	0	0	0.001168	0	6	31				
EPHA3	2042	broad.mit.edu	37	3	89468424	89468424	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:89468424A>G	ENST00000336596.2	+	11	2183	c.1958A>G	c.(1957-1959)aAg>aGg	p.K653R	EPHA3_ENST00000494014.1_Missense_Mutation_p.K653R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	653	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTGGCCATTAAGACCCTGAAA	0.428										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	0				lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(1957-1959)AAG>AGG		ephrin receptor EphA3 isoform a precursor							94.0	91.0	92.0					3																	89468424		2203	4300	6503	SO:0001583	missense	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89468424A>G	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1958A>G	3.37:g.89468424A>G	ENSP00000337451:p.Lys653Arg	TSP Lung(6;0.00050)				EPHA3_uc010hon.1_RNA	p.K653R	NM_005233	NP_005224	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	11	2183	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	653			Cytoplasmic (Potential).|Protein kinase.	ATP (By similarity).	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	c.1958A>G	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.434614	0.62955	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.85484	-1.99;-1.99	5.56	5.56	0.83823	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94387	0.8195	M	0.94142	3.5	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	D	0.95831	0.8858	9	.	.	.	.	15.7223	0.77721	1.0:0.0:0.0:0.0	.	653	P29320	EPHA3_HUMAN	R	653	ENSP00000337451:K653R;ENSP00000419190:K653R	.	K	+	2	0	EPHA3	89551114	1.000000	0.71417	1.000000	0.80357	0.118000	0.20060	9.339000	0.96797	2.113000	0.64589	0.460000	0.39030	AAG		0.428	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		7	30	0	0	0	0.001984	0	7	30				
EPHA3	2042	broad.mit.edu	37	3	89498443	89498443	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:89498443C>G	ENST00000336596.2	+	14	2640	c.2415C>G	c.(2413-2415)agC>agG	p.S805R	EPHA3_ENST00000494014.1_Missense_Mutation_p.S805R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	805	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CGTCAGCCAGCGATGTATGGA	0.438										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	0				lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(2413-2415)AGC>AGG		ephrin receptor EphA3 isoform a precursor							242.0	225.0	230.0					3																	89498443		2203	4300	6503	SO:0001583	missense	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89498443C>G	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2415C>G	3.37:g.89498443C>G	ENSP00000337451:p.Ser805Arg	TSP Lung(6;0.00050)				EPHA3_uc010hon.1_RNA	p.S805R	NM_005233	NP_005224	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	14	2640	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	805			Cytoplasmic (Potential).|Protein kinase.		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	c.2415C>G	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.025974	0.54683	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.89415	-2.51;-2.51	5.34	0.255	0.15561	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95503	0.8539	H	0.96943	3.91	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94280	0.7519	9	.	.	.	.	10.4719	0.44642	0.0:0.4111:0.0:0.5889	.	805	P29320	EPHA3_HUMAN	R	805	ENSP00000337451:S805R;ENSP00000419190:S805R	.	S	+	3	2	EPHA3	89581133	0.978000	0.34361	0.973000	0.42090	0.798000	0.45092	0.137000	0.15995	-0.028000	0.13850	-0.345000	0.07892	AGC		0.438	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		13	60	0	0	0	0.00245	0	13	60				
DCBLD2	131566	broad.mit.edu	37	3	98520492	98520492	+	Splice_Site	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:98520492T>G	ENST00000326840.6	-	14	2034	c.1672A>C	c.(1672-1674)Aag>Cag	p.K558Q	DCBLD2_ENST00000326857.9_Splice_Site_p.K558Q	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	558					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						GTTTTTTTCTTTCTGGAAAAA	0.468																																							uc003dtd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1672-1674)AAG>CAG		discoidin, CUB and LCCL domain containing 2							47.0	49.0	48.0					3																	98520492		1847	4089	5936	SO:0001630	splice_region_variant	131566				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane		g.chr3:98520492T>G		CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.1671-1A>C	3.37:g.98520492T>G						DCBLD2_uc003dte.2_Missense_Mutation_p.K558Q	p.K558Q	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN			14	2035	-			558			Cytoplasmic (Potential).		B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	ENST00000326840.6	37	c.1672A>C	CCDS46878.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.613422	0.87359	.	.	ENSG00000057019	ENST00000326840;ENST00000326857	D;D	0.94793	-3.51;-3.52	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.96231	0.8771	L	0.59436	1.845	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.922	D	0.96344	0.9253	10	0.59425	D	0.04	-20.4221	13.6816	0.62489	0.0:0.0:0.0:1.0	.	558;558	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	Q	558	ENSP00000321573:K558Q;ENSP00000321646:K558Q	ENSP00000321573:K558Q	K	-	1	0	DCBLD2	100003182	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.224000	0.65288	2.178000	0.69098	0.533000	0.62120	AAG		0.468	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927	Missense_Mutation	3	10	0	0	0	0.009096	0	3	10				
DCBLD2	131566	broad.mit.edu	37	3	98538181	98538181	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:98538181C>G	ENST00000326840.6	-	8	1314	c.952G>C	c.(952-954)Gac>Cac	p.D318H	DCBLD2_ENST00000326857.9_Missense_Mutation_p.D318H|DCBLD2_ENST00000469648.1_5'Flank	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	318	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						CCTGTGTGGTCAGTCCACTCC	0.483																																							uc003dtd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(952-954)GAC>CAC		discoidin, CUB and LCCL domain containing 2							99.0	87.0	91.0					3																	98538181		1917	4125	6042	SO:0001583	missense	131566				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane		g.chr3:98538181C>G		CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.952G>C	3.37:g.98538181C>G	ENSP00000321573:p.Asp318His					DCBLD2_uc003dte.2_Missense_Mutation_p.D318H	p.D318H	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN			8	1315	-			318			Extracellular (Potential).|F5/8 type C.		B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	ENST00000326840.6	37	c.952G>C	CCDS46878.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.817519	0.70912	.	.	ENSG00000057019	ENST00000326840;ENST00000404023;ENST00000326857	D;D	0.98234	-4.81;-4.81	5.25	5.25	0.73442	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.190550	0.53938	D	0.000049	D	0.98639	0.9544	M	0.70595	2.14	0.44762	D	0.997766	D;D	0.71674	0.988;0.998	P;D	0.70935	0.838;0.971	D	0.98880	1.0769	10	0.45353	T	0.12	-27.3235	16.6977	0.85340	0.0:1.0:0.0:0.0	.	318;318	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	H	318;271;318	ENSP00000321573:D318H;ENSP00000321646:D318H	ENSP00000321573:D318H	D	-	1	0	DCBLD2	100020871	0.998000	0.40836	0.997000	0.53966	0.796000	0.44982	2.049000	0.41288	2.616000	0.88540	0.585000	0.79938	GAC		0.483	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927		8	40	0	0	0	0.006214	0	8	40				
IMPG2	50939	broad.mit.edu	37	3	100951668	100951668	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:100951668C>G	ENST00000193391.7	-	15	3377	c.3190G>C	c.(3190-3192)Gat>Cat	p.D1064H		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	1064	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CACTTTCCATCATTCAAGCAG	0.458																																							uc003duq.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(3190-3192)GAT>CAT		interphotoreceptor matrix proteoglycan 2							94.0	80.0	85.0					3																	100951668		2203	4300	6503	SO:0001583	missense	50939				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity	g.chr3:100951668C>G	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.3190G>C	3.37:g.100951668C>G	ENSP00000193391:p.Asp1064His					IMPG2_uc011bhe.1_Missense_Mutation_p.D927H|IMPG2_uc010hpj.1_RNA	p.D1064H	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN			15	3393	-			1064			Extracellular (Potential).|EGF-like 2.		A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	c.3190G>C	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.988108	0.93106	.	.	ENSG00000081148	ENST00000193391;ENST00000417518	T	0.26660	1.72	5.88	5.88	0.94601	Epidermal growth factor-like, type 3 (1);	0.072181	0.56097	D	0.000022	T	0.50837	0.1639	M	0.79258	2.445	0.80722	D	1	P;P	0.50443	0.935;0.935	P;P	0.56916	0.809;0.809	T	0.47071	-0.9145	10	0.54805	T	0.06	-16.2127	20.2405	0.98372	0.0:1.0:0.0:0.0	.	1064;1064	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	H	1064;24	ENSP00000193391:D1064H	ENSP00000193391:D1064H	D	-	1	0	IMPG2	102434358	1.000000	0.71417	0.988000	0.46212	0.957000	0.61999	5.779000	0.68948	2.797000	0.96272	0.561000	0.74099	GAT		0.458	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3			16	35	0	0	0	0.004007	0	16	35				
CCDC54	84692	broad.mit.edu	37	3	107096565	107096565	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:107096565G>A	ENST00000261058.1	+	1	378	c.131G>A	c.(130-132)gGa>gAa	p.G44E		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	44										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						GATTCAACTGGATATCCCACT	0.398																																							uc003dwi.1		NA																	0					0						c.(130-132)GGA>GAA		coiled-coil domain containing 54							145.0	144.0	144.0					3																	107096565		2203	4300	6503	SO:0001583	missense	84692							g.chr3:107096565G>A	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.131G>A	3.37:g.107096565G>A	ENSP00000261058:p.Gly44Glu						p.G44E	NM_032600	NP_115989	Q8NEL0	CCD54_HUMAN			1	378	+			44					Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	c.131G>A	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	G	1.283	-0.609772	0.03690	.	.	ENSG00000138483	ENST00000261058	T	0.41758	0.99	5.17	2.24	0.28232	.	1.499290	0.04582	N	0.395135	T	0.21062	0.0507	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.22941	-1.0202	10	0.07325	T	0.83	1.1018	5.2219	0.15373	0.181:0.0:0.658:0.161	.	44	Q8NEL0	CCD54_HUMAN	E	44	ENSP00000261058:G44E	ENSP00000261058:G44E	G	+	2	0	CCDC54	108579255	0.003000	0.15002	0.000000	0.03702	0.018000	0.09664	1.293000	0.33353	0.513000	0.28278	0.460000	0.39030	GGA		0.398	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600		27	53	0	0	0	0.008361	0	27	53				
DPPA4	55211	broad.mit.edu	37	3	109049546	109049546	+	Silent	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:109049546C>A	ENST00000335658.6	-	5	558	c.504G>T	c.(502-504)gtG>gtT	p.V168V	DPPA4_ENST00000478791.1_5'UTR	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	168					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						GAGGAAGAGCCACTTCAGGAG	0.498																																							uc003dxq.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(502-504)GTG>GTT		developmental pluripotency associated 4							80.0	86.0	84.0					3																	109049546		2203	4300	6503	SO:0001819	synonymous_variant	55211					nucleus	protein binding	g.chr3:109049546C>A	AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.504G>T	3.37:g.109049546C>A						DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Silent_p.V168V	p.V168V	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN			5	559	-			168					A8K4M7|Q9H9N5|Q9NVI6	Silent	SNP	ENST00000335658.6	37	c.504G>T	CCDS33814.1																																																																																				0.498	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353897.1	NM_018189		20	65	1	0	4.35082e-09	0.010504	5.12575e-09	20	65				
PVRL3	25945	broad.mit.edu	37	3	110831156	110831156	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:110831156T>A	ENST00000485303.1	+	2	715	c.440T>A	c.(439-441)aTc>aAc	p.I147N	PVRL3_ENST00000493615.1_Missense_Mutation_p.I124N|PVRL3_ENST00000319792.3_Missense_Mutation_p.I147N|PVRL3_ENST00000488016.1_3'UTR	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	147	Ig-like V-type.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						GGAAAATACATCTGCAAAGCT	0.373																																							uc003dxt.1		NA																	0				upper_aerodigestive_tract(2)	2						c.(439-441)ATC>AAC		poliovirus receptor-related 3 precursor							119.0	118.0	119.0					3																	110831156		2203	4300	6503	SO:0001583	missense	25945				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity	g.chr3:110831156T>A	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.440T>A	3.37:g.110831156T>A	ENSP00000418070:p.Ile147Asn					PVRL3_uc003dxu.1_Missense_Mutation_p.I124N	p.I147N	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN			2	440	+			147			Extracellular (Potential).|Ig-like V-type.		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	37	c.440T>A	CCDS2957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.51|16.51	3.143008|3.143008	0.57044|0.57044	.|.	.|.	ENSG00000177707|ENSG00000177707	ENST00000486596|ENST00000461477;ENST00000485303;ENST00000319792;ENST00000493615;ENST00000481766	.|T;T;T;T;T	.|0.64618	.|-0.11;-0.11;-0.11;-0.11;-0.11	5.43|5.43	4.27|4.27	0.50696|0.50696	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.321317	.|0.36665	.|N	.|0.002475	T|T	0.72317|0.72317	0.3445|0.3445	M|M	0.70595|0.70595	2.14|2.14	0.34276|0.34276	D|D	0.681622|0.681622	.|D;D	.|0.60575	.|0.966;0.988	.|P;P	.|0.59357	.|0.745;0.856	T|T	0.81019|0.81019	-0.1122|-0.1122	5|10	.|0.87932	.|D	.|0	.|.	9.6668|9.6668	0.39990|0.39990	0.0:0.0829:0.0:0.9171|0.0:0.0829:0.0:0.9171	.|.	.|124;147	.|E9PFR0;Q9NQS3	.|.;PVRL3_HUMAN	Q|N	146|100;147;147;124;132	.|ENSP00000418327:I100N;ENSP00000418070:I147N;ENSP00000321514:I147N;ENSP00000420579:I124N;ENSP00000420479:I132N	.|ENSP00000321514:I147N	H|I	+|+	3|2	2|0	PVRL3|PVRL3	112313846|112313846	1.000000|1.000000	0.71417|0.71417	0.940000|0.940000	0.37924|0.37924	0.872000|0.872000	0.50106|0.50106	3.969000|3.969000	0.56816|0.56816	1.005000|1.005000	0.39183|0.39183	-0.250000|-0.250000	0.11733|0.11733	CAT|ATC		0.373	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480		16	24	0	0	0	0.007413	0	16	24				
POLQ	10721	broad.mit.edu	37	3	121202241	121202241	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:121202241C>G	ENST00000264233.5	-	18	6090	c.5962G>C	c.(5962-5964)Gat>Cat	p.D1988H		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1988					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		ACCTTAGGATCTTCATAACTT	0.299								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	0				ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(5962-5964)GAT>CAT	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							51.0	53.0	52.0					3																	121202241		2203	4300	6503	SO:0001583	missense	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121202241C>G	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.5962G>C	3.37:g.121202241C>G	ENSP00000264233:p.Asp1988His					POLQ_uc003eed.2_Missense_Mutation_p.D1160H	p.D1988H	NM_199420	NP_955452	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	18	6091	-			1988					O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	c.5962G>C	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210781	0.79240	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.61627	0.09	5.25	5.25	0.73442	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.77226	0.4099	M	0.75264	2.295	0.49687	D	0.999818	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.80058	-0.1541	10	0.87932	D	0	.	18.8564	0.92254	0.0:1.0:0.0:0.0	.	1988;1160	O75417;O75417-2	DPOLQ_HUMAN;.	H	1611;1988;2124	ENSP00000264233:D1988H	ENSP00000264233:D1988H	D	-	1	0	POLQ	122684931	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	6.764000	0.74960	2.444000	0.82710	0.455000	0.32223	GAT		0.299	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		4	22	0	0	0	0.009096	0	4	22				
MYLK	4638	broad.mit.edu	37	3	123357040	123357040	+	Splice_Site	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:123357040C>T	ENST00000475616.1	-	26	4838	c.4839G>A	c.(4837-4839)gaG>gaA	p.E1613E	MYLK_ENST00000360304.3_Splice_Site_p.E1613E|MYLK-AS1_ENST00000485162.1_RNA|MYLK_ENST00000346322.5_Splice_Site_p.E1544E|MYLK_ENST00000359169.1_Splice_Site_p.E1613E|MYLK_ENST00000354792.5_Splice_Site_p.E413E|MYLK_ENST00000360772.3_Splice_Site_p.E1613E			Q15746	MYLK_HUMAN	myosin light chain kinase	1613	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ACCCCGCATTCTCTGAAACCA	0.552																																							uc003ego.2		NA																	0				ovary(6)|skin(2)|stomach(1)	9						c.(4837-4839)GAG>GAA		myosin light chain kinase isoform 1							56.0	58.0	57.0					3																	123357040		2203	4300	6503	SO:0001630	splice_region_variant	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123357040C>T	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4838-1G>A	3.37:g.123357040C>T						MYLK_uc010hrr.2_Silent_p.E48E|MYLK_uc011bjv.1_Silent_p.E413E|MYLK_uc011bjw.1_Silent_p.E1613E|MYLK_uc003egp.2_Silent_p.E1544E|MYLK_uc003egq.2_Silent_p.E1613E|MYLK_uc003egr.2_Silent_p.E1544E|MYLK_uc003egs.2_Silent_p.E1437E	p.E1613E	NM_053025	NP_444253	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	29	5121	-		Lung NSC(201;0.0496)	1613			Protein kinase.		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	ENST00000475616.1	37	c.4839G>A	CCDS46896.1																																																																																				0.552	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	Silent	8	42	0	0	0	0.00308	0	8	42				
TMCC1	23023	broad.mit.edu	37	3	129389241	129389241	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:129389241C>A	ENST00000393238.3	-	4	1783	c.1443G>T	c.(1441-1443)gaG>gaT	p.E481D	TMCC1_ENST00000432054.2_Missense_Mutation_p.E157D|TMCC1_ENST00000329333.5_Missense_Mutation_p.E302D|TMCC1_ENST00000426664.2_Missense_Mutation_p.E367D	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	481						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CCTTGAGAGTCTCAAAGGATT	0.428																																							uc003emz.3		NA																	0				skin(1)	1						c.(1441-1443)GAG>GAT		transmembrane and coiled-coil domain family 1							111.0	114.0	113.0					3																	129389241		2203	4300	6503	SO:0001583	missense	23023					integral to membrane		g.chr3:129389241C>A	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1443G>T	3.37:g.129389241C>A	ENSP00000376930:p.Glu481Asp					TMCC1_uc003emy.3_Missense_Mutation_p.E157D|TMCC1_uc011blc.1_Missense_Mutation_p.E302D|TMCC1_uc010htg.2_Missense_Mutation_p.E367D	p.E481D	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN			5	1944	-			481			Potential.		A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	c.1443G>T	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.582186	0.28180	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.35	2.55	0.30701	.	0.043394	0.85682	D	0.000000	T	0.29190	0.0726	L	0.27944	0.81	0.35473	D	0.797504	B;B	0.16396	0.017;0.008	B;B	0.29785	0.107;0.013	T	0.23154	-1.0196	10	0.23302	T	0.38	-8.157	9.3188	0.37950	0.0:0.648:0.0:0.352	.	302;481	B4DE04;O94876	.;TMCC1_HUMAN	D	157;481;367;302	ENSP00000404711:E157D;ENSP00000376930:E481D;ENSP00000389892:E367D;ENSP00000327349:E302D	ENSP00000327349:E302D	E	-	3	2	TMCC1	130871931	0.796000	0.28864	1.000000	0.80357	0.990000	0.78478	0.295000	0.19065	0.754000	0.32968	0.591000	0.81541	GAG		0.428	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008		44	63	1	0	2.47872e-24	0.010771	3.21707e-24	44	63				
RAB6B	51560	broad.mit.edu	37	3	133557009	133557009	+	Splice_Site	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:133557009C>A	ENST00000285208.4	-	6	845		c.e6+1		RAB6B_ENST00000469959.1_Intron|RAB6B_ENST00000486858.1_Splice_Site|RAB6B_ENST00000543906.1_Splice_Site	NM_016577.3	NP_057661.3	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family						GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	11						TGTGTCCTCACCTGCTTCACG	0.627																																							uc003epy.2		NA																	0				pancreas(1)	1						c.e6+1		RAB6B, member RAS oncogene family							131.0	120.0	124.0					3																	133557009		2203	4300	6503	SO:0001630	splice_region_variant	51560				protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding	g.chr3:133557009C>A	AF166492	CCDS3082.1	3q22.1	2008-05-15			ENSG00000154917	ENSG00000154917		"""RAB, member RAS oncogene"""	14902	protein-coding gene	gene with protein product		615852					Standard	NM_016577		Approved		uc003epy.3	Q9NRW1	OTTHUMG00000159749	ENST00000285208.4:c.495+1G>T	3.37:g.133557009C>A						RAB6B_uc011blu.1_Splice_Site_p.Q152_splice	p.Q165_splice	NM_016577	NP_057661	Q9NRW1	RAB6B_HUMAN			6	876	-								B2R5Z9|B7Z337|D3DND3|Q92929	Splice_Site	SNP	ENST00000285208.4	37	c.495_splice	CCDS3082.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611308	0.87258	.	.	ENSG00000154917	ENST00000285208;ENST00000543906;ENST00000486858	.	.	.	4.47	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4243	0.83809	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RAB6B	135039699	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.013000	0.76373	2.490000	0.84030	0.655000	0.94253	.		0.627	RAB6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357152.1		Intron	45	88	1	0	2.77807e-22	0.013114	3.5718e-22	45	88				
ATR	545	broad.mit.edu	37	3	142274977	142274977	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:142274977T>C	ENST00000350721.4	-	10	2204	c.2083A>G	c.(2083-2085)Aaa>Gaa	p.K695E	ATR_ENST00000383101.3_Missense_Mutation_p.K631E	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	695					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TCTTTGACTTTATCTCTGGGG	0.328								Other conserved DNA damage response genes																															uc003eux.3		NA																	0				lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						c.(2083-2085)AAA>GAA	Other_conserved_DNA_damage_response_genes	ataxia telangiectasia and Rad3 related protein							71.0	73.0	73.0					3																	142274977		2203	4300	6503	SO:0001583	missense	545				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity	g.chr3:142274977T>C	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.2083A>G	3.37:g.142274977T>C	ENSP00000343741:p.Lys695Glu						p.K695E	NM_001184	NP_001175	Q13535	ATR_HUMAN			10	2205	-			695					Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	c.2083A>G	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	13.47	2.246417	0.39697	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.65178	-0.14;-0.14	4.82	4.82	0.62117	Armadillo-like helical (1);Armadillo-type fold (1);	0.390725	0.24957	N	0.034242	T	0.41719	0.1171	N	0.14661	0.345	0.80722	D	1	B	0.17038	0.02	B	0.16722	0.016	T	0.28870	-1.0030	10	0.14252	T	0.57	-17.4143	11.0942	0.48134	0.0:0.0:0.2612:0.7388	.	695	Q13535	ATR_HUMAN	E	695;631	ENSP00000343741:K695E;ENSP00000372581:K631E	ENSP00000343741:K695E	K	-	1	0	ATR	143757667	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.055000	0.41345	2.142000	0.66516	0.477000	0.44152	AAA		0.328	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184		15	31	0	0	0	0.006122	0	15	31				
ZIC1	7545	broad.mit.edu	37	3	147128441	147128441	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:147128441T>A	ENST00000282928.4	+	1	1271	c.542T>A	c.(541-543)gTg>gAg	p.V181E		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	181					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						TACGGCCAGGTGACCAGCCCG	0.687																																							uc003ewe.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(541-543)GTG>GAG		zinc finger protein of the cerebellum 1							37.0	40.0	39.0					3																	147128441		2202	4299	6501	SO:0001583	missense	7545				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:147128441T>A	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.542T>A	3.37:g.147128441T>A	ENSP00000282928:p.Val181Glu						p.V181E	NM_003412	NP_003403	Q15915	ZIC1_HUMAN			1	1261	+			181					Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	c.542T>A	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019886	0.75275	.	.	ENSG00000152977	ENST00000282928	T	0.61274	0.12	3.31	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.71048	0.3294	M	0.71206	2.165	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	T	0.75059	-0.3451	10	0.72032	D	0.01	.	12.1208	0.53889	0.0:0.0:0.0:1.0	.	181	Q15915	ZIC1_HUMAN	E	181	ENSP00000282928:V181E	ENSP00000282928:V181E	V	+	2	0	ZIC1	148611131	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.194000	0.77789	1.506000	0.48736	0.448000	0.29417	GTG		0.687	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412		6	28	0	0	0	0.001984	0	6	28				
SLITRK3	22865	broad.mit.edu	37	3	164908564	164908564	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:164908564G>T	ENST00000475390.1	-	2	498	c.55C>A	c.(55-57)Ctt>Att	p.L19I	SLITRK3_ENST00000241274.3_Missense_Mutation_p.L19I			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	19					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.L19I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GTGCTTAGAAGAATTATCCAC	0.418										HNSCC(40;0.11)																													uc003fej.3		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(6)|skin(3)|pancreas(1)	10						c.(55-57)CTT>ATT		slit and trk like 3 protein precursor							91.0	84.0	87.0					3																	164908564		2202	4300	6502	SO:0001583	missense	22865					integral to membrane		g.chr3:164908564G>T	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.55C>A	3.37:g.164908564G>T	ENSP00000420091:p.Leu19Ile	HNSCC(40;0.11)				SLITRK3_uc003fek.2_Missense_Mutation_p.L19I	p.L19I	NM_014926	NP_055741	O94933	SLIK3_HUMAN			2	499	-			19					Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.55C>A	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154407	0.57259	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.70749	0.5;0.5;-0.51	6.01	6.01	0.97437	.	0.000000	0.34133	N	0.004231	T	0.79839	0.4515	L	0.41492	1.28	0.39453	D	0.967436	D	0.63880	0.993	D	0.67548	0.952	T	0.79303	-0.1859	10	0.52906	T	0.07	-16.3635	20.5182	0.99214	0.0:0.0:1.0:0.0	.	19	O94933	SLIK3_HUMAN	I	19	ENSP00000420091:L19I;ENSP00000241274:L19I;ENSP00000419611:L19I	ENSP00000241274:L19I	L	-	1	0	SLITRK3	166391258	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.161000	0.77505	2.860000	0.98153	0.655000	0.94253	CTT		0.418	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		10	25	1	0	4.68919e-08	0.008291	5.39699e-08	10	25				
ZBBX	79740	broad.mit.edu	37	3	167000157	167000157	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:167000157G>T	ENST00000392766.2	-	19	2346	c.2006C>A	c.(2005-2007)gCt>gAt	p.A669D	ZBBX_ENST00000455345.2_Missense_Mutation_p.A708D|ZBBX_ENST00000392764.1_Missense_Mutation_p.A640D|ZBBX_ENST00000392767.2_Missense_Mutation_p.A669D|ZBBX_ENST00000307529.5_Missense_Mutation_p.A708D	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	669	Ser-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TTCAGAAGCAGCTCTAGATGA	0.373																																							uc003fep.2		NA																	0				ovary(2)	2						c.(2005-2007)GCT>GAT		zinc finger, B-box domain containing							122.0	115.0	117.0					3																	167000157		1846	4095	5941	SO:0001583	missense	79740					intracellular	zinc ion binding	g.chr3:167000157G>T	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2006C>A	3.37:g.167000157G>T	ENSP00000376519:p.Ala669Asp					ZBBX_uc011bpc.1_Missense_Mutation_p.A708D|ZBBX_uc003feq.2_Missense_Mutation_p.A640D	p.A669D	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN			19	2329	-			669			Ser-rich.		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.2006C>A	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712500	0.48517	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.28895	1.78;1.78;1.89;1.89;1.59	5.28	5.28	0.74379	.	0.575979	0.17526	N	0.171045	T	0.41949	0.1181	L	0.48642	1.525	0.33526	D	0.59299	P;P	0.50272	0.933;0.89	P;B	0.51806	0.68;0.36	T	0.55805	-0.8083	10	0.87932	D	0	-4.9183	16.4252	0.83812	0.0:0.0:1.0:0.0	.	708;669	A8MT70-2;A8MT70	.;ZBBX_HUMAN	D	669;669;708;708;640	ENSP00000376519:A669D;ENSP00000376520:A669D;ENSP00000390232:A708D;ENSP00000305065:A708D;ENSP00000376517:A640D	ENSP00000305065:A708D	A	-	2	0	ZBBX	168482851	1.000000	0.71417	0.993000	0.49108	0.228000	0.25075	4.699000	0.61796	2.463000	0.83235	0.650000	0.86243	GCT		0.373	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		16	67	1	0	6.31663e-08	0.003163	7.25487e-08	16	67				
TTC14	151613	broad.mit.edu	37	3	180328193	180328193	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:180328193G>C	ENST00000296015.4	+	12	2308	c.2176G>C	c.(2176-2178)Gtt>Ctt	p.V726L	TTC14_ENST00000382584.4_Intron|TTC14_ENST00000412756.2_3'UTR	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	726							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CAAAACAGAGGTTCCAGAAGA	0.343																																							uc003fkk.2		NA																	0				ovary(1)	1						c.(2176-2178)GTT>CTT		tetratricopeptide repeat domain 14 isoform a							73.0	75.0	74.0					3																	180328193		2203	4300	6503	SO:0001583	missense	151613						RNA binding	g.chr3:180328193G>C	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.2176G>C	3.37:g.180328193G>C	ENSP00000296015:p.Val726Leu					TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	p.V726L	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		12	2308	+	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		726					G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	c.2176G>C	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	G	2.488	-0.318048	0.05386	.	.	ENSG00000163728	ENST00000296015	T	0.17213	2.29	6.17	-1.45	0.08828	.	2.292510	0.01327	N	0.011136	T	0.09642	0.0237	N	0.14661	0.345	0.42644	D	0.993429	B	0.22683	0.073	B	0.23275	0.045	T	0.20107	-1.0285	10	0.28530	T	0.3	0.2971	2.5364	0.04715	0.2348:0.2059:0.4532:0.1061	.	726	Q96N46	TTC14_HUMAN	L	726	ENSP00000296015:V726L	ENSP00000296015:V726L	V	+	1	0	TTC14	181810887	0.748000	0.28294	0.074000	0.20217	0.058000	0.15608	0.868000	0.27982	-0.265000	0.09352	-0.150000	0.13652	GTT		0.343	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462		12	65	0	0	0	0.001368	0	12	65				
DGKG	1608	broad.mit.edu	37	3	186015891	186015891	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:186015891G>A	ENST00000265022.3	-	4	811	c.272C>T	c.(271-273)cCg>cTg	p.P91L	DGKG_ENST00000544847.1_Missense_Mutation_p.P91L|DGKG_ENST00000382164.4_Missense_Mutation_p.P91L|DGKG_ENST00000344484.4_Missense_Mutation_p.P91L	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	91					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TCCCTCCGTCGGGTGGTCAGA	0.612																																							uc003fqa.2		NA																	0				breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(271-273)CCG>CTG		diacylglycerol kinase gamma isoform 1	Phosphatidylserine(DB00144)						111.0	106.0	108.0					3																	186015891		2203	4300	6503	SO:0001583	missense	1608				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity	g.chr3:186015891G>A	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.272C>T	3.37:g.186015891G>A	ENSP00000265022:p.Pro91Leu					DGKG_uc003fqb.2_Missense_Mutation_p.P91L|DGKG_uc003fqc.2_Missense_Mutation_p.P91L|DGKG_uc011brx.1_Missense_Mutation_p.P91L	p.P91L	NM_001346	NP_001337	P49619	DGKG_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	4	809	-	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		91					B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	37	c.272C>T	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	G	7.436	0.639727	0.14386	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	4.76	2.8	0.32819	.	0.664334	0.14498	N	0.315913	T	0.28001	0.0690	L	0.44542	1.39	0.38509	D	0.94843	B;B;B;B	0.12013	0.0;0.0;0.005;0.003	B;B;B;B	0.08055	0.001;0.001;0.003;0.001	T	0.08700	-1.0709	10	0.11182	T	0.66	.	5.0862	0.14682	0.1057:0.0:0.6888:0.2055	.	91;91;91;91	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	L	91;91;91;91;94	ENSP00000265022:P91L;ENSP00000339777:P91L;ENSP00000371599:P91L;ENSP00000440507:P91L	ENSP00000265022:P91L	P	-	2	0	DGKG	187498585	0.996000	0.38824	0.581000	0.28614	0.107000	0.19398	2.324000	0.43831	1.323000	0.45263	0.561000	0.74099	CCG		0.612	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3			34	89	0	0	0	0.002836	0	34	89				
TBCCD1	55171	broad.mit.edu	37	3	186274291	186274291	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:186274291G>C	ENST00000424280.1	-	4	1245	c.766C>G	c.(766-768)Ctg>Gtg	p.L256V	TBCCD1_ENST00000446782.1_Missense_Mutation_p.L160V|TBCCD1_ENST00000479590.1_5'Flank|TBCCD1_ENST00000338733.5_Missense_Mutation_p.L256V	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	256					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		CAGGTTTCCAGTTTGTAGAAA	0.443																																							uc003fqg.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(766-768)CTG>GTG		TBCC domain containing 1							61.0	61.0	61.0					3																	186274291		2203	4300	6503	SO:0001583	missense	55171				cell morphogenesis|maintenance of centrosome location|maintenance of Golgi location|regulation of cell migration|regulation of cell shape	spindle pole centrosome	binding	g.chr3:186274291G>C	BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.766C>G	3.37:g.186274291G>C	ENSP00000411253:p.Leu256Val					TBCCD1_uc011bry.1_Missense_Mutation_p.L256V|TBCCD1_uc003fqh.2_Missense_Mutation_p.L160V	p.L256V	NM_018138	NP_060608	Q9NVR7	TBCC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)	4	895	-	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		256					B3KW69|D3DNU6|G5E9J4	Missense_Mutation	SNP	ENST00000424280.1	37	c.766C>G	CCDS3276.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319386	0.60524	.	.	ENSG00000113838	ENST00000424280;ENST00000338733;ENST00000446782	D;D;D	0.88201	-2.31;-2.31;-2.35	5.65	4.78	0.61160	.	0.076358	0.56097	D	0.000035	D	0.91425	0.7294	M	0.64997	1.995	0.40778	D	0.983148	D;D	0.71674	0.998;0.993	D;P	0.69142	0.962;0.887	D	0.89696	0.3901	10	0.29301	T	0.29	-8.9984	8.4594	0.32919	0.1687:0.0:0.8313:0.0	.	160;256	G5E9J4;Q9NVR7	.;TBCC1_HUMAN	V	256;256;160	ENSP00000411253:L256V;ENSP00000341652:L256V;ENSP00000397091:L160V	ENSP00000341652:L256V	L	-	1	2	TBCCD1	187756985	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.086000	0.57664	1.632000	0.50472	0.655000	0.94253	CTG		0.443	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	NM_018138		8	52	0	0	0	0.00308	0	8	52				
KNG1	3827	broad.mit.edu	37	3	186450463	186450463	+	Splice_Site	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:186450463G>A	ENST00000265023.4	+	7	1142	c.930G>A	c.(928-930)caG>caA	p.Q310Q	RP11-573D15.8_ENST00000354642.2_RNA|KNG1_ENST00000447445.1_Splice_Site_p.Q274Q|RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000287611.2_Splice_Site_p.Q310Q	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	310	Cystatin kininogen-type 3. {ECO:0000255|PROSITE-ProRule:PRU00979}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		CAAGAGTACAGGTGTGTAAAC	0.388																																							uc011bsa.1		NA																	0				skin(1)	1						c.(928-930)CAG>CAA		kininogen 1 isoform 1	Ouabain(DB01092)						80.0	80.0	80.0					3																	186450463		2203	4300	6503	SO:0001630	splice_region_variant	3827				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding	g.chr3:186450463G>A		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.930+1G>A	3.37:g.186450463G>A						KNG1_uc003fqr.2_Silent_p.Q310Q	p.Q310Q	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	7	1142	+	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		310			Cystatin 3.		A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Silent	SNP	ENST00000265023.4	37	c.930G>A	CCDS43183.1																																																																																				0.388	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	Silent	26	57	0	0	0	0.003954	0	26	57				
KNG1	3827	broad.mit.edu	37	3	186459574	186459574	+	Silent	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:186459574T>C	ENST00000265023.4	+	10	1601	c.1389T>C	c.(1387-1389)caT>caC	p.H463H	RP11-573D15.8_ENST00000354642.2_RNA|KNG1_ENST00000447445.1_Intron|RP11-573D15.8_ENST00000599314.1_RNA|RP11-573D15.8_ENST00000596329.1_RNA|KNG1_ENST00000287611.2_Intron|RP11-573D15.8_ENST00000609726.1_RNA|RP11-573D15.8_ENST00000609652.1_RNA|RP11-573D15.8_ENST00000596632.1_RNA	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	463	His-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		GCCTTGGCCATGGACACGAAC	0.478																																							uc011bsa.1		NA																	0				skin(1)	1						c.(1387-1389)CAT>CAC		kininogen 1 isoform 1	Ouabain(DB01092)						74.0	70.0	71.0					3																	186459574		2073	4221	6294	SO:0001819	synonymous_variant	3827				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding	g.chr3:186459574T>C		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1389T>C	3.37:g.186459574T>C						KNG1_uc003fqr.2_Intron	p.H463H	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	10	1601	+	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		463			|His-rich.		A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Silent	SNP	ENST00000265023.4	37	c.1389T>C	CCDS43183.1																																																																																				0.478	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416		8	20	0	0	0	0.006214	0	8	20				
ZNF595	152687	broad.mit.edu	37	4	60018	60018	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:60018G>A	ENST00000509152.2	+	3	383	c.198G>A	c.(196-198)aaG>aaA	p.K66K	ZNF595_ENST00000526473.2_Silent_p.K66K|ZNF595_ENST00000339368.6_3'UTR			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GCAATTTGAAGATACATGAGA	0.453																																							uc003fzv.1		NA																	0					0						c.(196-198)AAG>AAA		zinc finger protein 595							119.0	127.0	124.0					4																	60018		2180	4296	6476	SO:0001819	synonymous_variant	152687				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr4:60018G>A	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.198G>A	4.37:g.60018G>A						ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Silent_p.K66K|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	p.K66K	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)	3	354	+		all_cancers(4;0.0738)|all_epithelial(65;0.139)	66						Silent	SNP	ENST00000509152.2	37	c.198G>A																																																																																					0.453	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000357817.2	NM_182524		7	132	0	0	0	0.008291	0	7	132				
TMEM175	84286	broad.mit.edu	37	4	944993	944993	+	Splice_Site	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:944993A>T	ENST00000264771.4	+	5	475		c.e5-1		TMEM175_ENST00000508204.1_Splice_Site|TMEM175_ENST00000515740.1_Splice_Site|TMEM175_ENST00000504180.1_Splice_Site	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175							integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			TAAATGGTTTAGGTTGTTCCA	0.403																																							uc003gbq.2		NA																	0					0						c.e5-2		transmembrane protein 175							284.0	256.0	265.0					4																	944993		2203	4300	6503	SO:0001630	splice_region_variant	84286					integral to membrane		g.chr4:944993A>T	BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.291-1A>T	4.37:g.944993A>T						TMEM175_uc010ibl.1_Splice_Site_p.R97_splice|TMEM175_uc003gbp.1_Splice_Site_p.R15_splice|TMEM175_uc003gbr.2_Splice_Site_p.R15_splice|TMEM175_uc003gbu.2_Splice_Site_p.R15_splice|TMEM175_uc003gbs.2_Splice_Site|TMEM175_uc003gbt.2_Splice_Site|TMEM175_uc003gbv.2_Splice_Site|TMEM175_uc010ibm.2_5'Flank	p.R97_splice	NM_032326	NP_115702	Q9BSA9	TM175_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		5	389	+								D3DVN4|Q8ND13	Splice_Site	SNP	ENST00000264771.4	37	c.291_splice	CCDS3341.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.893492	0.33442	.	.	ENSG00000127419	ENST00000507319;ENST00000264771;ENST00000514453;ENST00000515492;ENST00000359768;ENST00000509508;ENST00000508204;ENST00000510493;ENST00000514546	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7073	0.45962	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM175	934993	1.000000	0.71417	0.238000	0.24106	0.487000	0.33371	7.995000	0.88328	1.803000	0.52742	0.472000	0.43445	.		0.403	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239193.2	NM_032326	Intron	22	60	0	0	0	0.012319	0	22	60				
TMEM175	84286	broad.mit.edu	37	4	952199	952199	+	Missense_Mutation	SNP	G	G	A	rs371988711		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:952199G>A	ENST00000264771.4	+	11	1615	c.1430G>A	c.(1429-1431)cGg>cAg	p.R477Q	TMEM175_ENST00000508204.1_Missense_Mutation_p.R395Q|TMEM175_ENST00000515740.1_Missense_Mutation_p.R361Q	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	477						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CGGGTCCTGCGGGGCCTCGCC	0.726																																							uc003gbq.2		NA																	0					0						c.(1429-1431)CGG>CAG		transmembrane protein 175		G	GLN/ARG	1,4387		0,1,2193	16.0	18.0	17.0		1430	-0.0	0.0	4		17	0,8572		0,0,4286	no	missense	TMEM175	NM_032326.2	43	0,1,6479	AA,AG,GG		0.0,0.0228,0.0077	benign	477/505	952199	1,12959	2194	4286	6480	SO:0001583	missense	84286					integral to membrane		g.chr4:952199G>A	BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.1430G>A	4.37:g.952199G>A	ENSP00000264771:p.Arg477Gln					TMEM175_uc003gbr.2_Missense_Mutation_p.R395Q|TMEM175_uc003gbu.2_Missense_Mutation_p.R395Q|TMEM175_uc003gbs.2_Missense_Mutation_p.R360Q|TMEM175_uc003gbt.2_Missense_Mutation_p.R360Q|TMEM175_uc003gbv.2_Missense_Mutation_p.R360Q|TMEM175_uc010ibm.2_Missense_Mutation_p.R293Q	p.R477Q	NM_032326	NP_115702	Q9BSA9	TM175_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		11	1528	+			477					D3DVN4|Q8ND13	Missense_Mutation	SNP	ENST00000264771.4	37	c.1430G>A	CCDS3341.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.264108	0.23136	2.28E-4	0.0	ENSG00000127419	ENST00000264771;ENST00000515740;ENST00000508204	T;T;T	0.42513	1.56;1.57;0.97	4.04	-0.0214	0.13951	.	0.985729	0.08252	N	0.974506	T	0.30008	0.0751	L	0.51422	1.61	0.09310	N	1	B;B	0.15473	0.013;0.013	B;B	0.06405	0.002;0.002	T	0.29181	-1.0020	10	0.27082	T	0.32	-3.1103	0.8591	0.01189	0.2927:0.1594:0.3852:0.1627	.	395;477	D3DVN5;Q9BSA9	.;TM175_HUMAN	Q	477;361;395	ENSP00000264771:R477Q;ENSP00000427039:R361Q;ENSP00000423669:R395Q	ENSP00000264771:R477Q	R	+	2	0	TMEM175	942199	0.001000	0.12720	0.007000	0.13788	0.005000	0.04900	0.537000	0.23144	0.130000	0.18549	-0.327000	0.08410	CGG		0.726	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239193.2	NM_032326		13	25	0	0	0	0.001368	0	13	25				
UVSSA	57654	broad.mit.edu	37	4	1343515	1343515	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:1343515C>T	ENST00000389851.4	+	3	749	c.302C>T	c.(301-303)cCc>cTc	p.P101L	UVSSA_ENST00000507531.1_Missense_Mutation_p.P101L|UVSSA_ENST00000511216.1_Missense_Mutation_p.P101L	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	101	VHS-like.				protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CCTCTGCCGCCCCCCAGGGAG	0.637																																							uc003gde.3		NA																	0					0						c.(301-303)CCC>CTC		hypothetical protein LOC57654							30.0	33.0	32.0					4																	1343515		2202	4300	6502	SO:0001583	missense	57654							g.chr4:1343515C>T	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.302C>T	4.37:g.1343515C>T	ENSP00000374501:p.Pro101Leu						p.P101L	NM_020894	NP_065945	Q2YD98	K1530_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0138)		3	749	+			101					A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	ENST00000389851.4	37	c.302C>T	CCDS33938.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.122037	0.77436	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531	T;T;T	0.19806	2.12;2.12;2.12	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.55081	0.1898	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65639	-0.6119	10	0.87932	D	0	.	18.2549	0.90016	0.0:1.0:0.0:0.0	.	101	Q2YD98	K1530_HUMAN	L	101	ENSP00000425130:P101L;ENSP00000374501:P101L;ENSP00000421741:P101L	ENSP00000374501:P101L	P	+	2	0	KIAA1530	1333515	1.000000	0.71417	0.991000	0.47740	0.349000	0.29174	7.122000	0.77169	2.315000	0.78130	0.655000	0.94253	CCC		0.637	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894		19	35	0	0	0	0.008871	0	19	35				
NOP14	8602	broad.mit.edu	37	4	2945798	2945798	+	Splice_Site	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:2945798A>T	ENST00000314262.6	-	13	1940		c.e13+1		NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000502735.1_Splice_Site|NOP14-AS1_ENST00000512712.2_RNA|NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000507120.1_5'Flank|NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000507702.1_RNA|NOP14_ENST00000416614.2_Splice_Site|NOP14_ENST00000398071.4_Splice_Site	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						AAATCAACTCACCTTGGCTTG	0.353																																							uc003ggj.1		NA																	0				pancreas(1)	1						c.e13+1		probable nucleolar complex protein 14							51.0	55.0	54.0					4																	2945798		2203	4300	6503	SO:0001630	splice_region_variant	8602				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding	g.chr4:2945798A>T	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1891+1T>A	4.37:g.2945798A>T						C4orf10_uc003gge.1_Intron|C4orf10_uc003ggh.2_Intron|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Splice_Site_p.G377_splice|NOP14_uc003ggk.3_Splice_Site_p.G631_splice|NOP14_uc003ggl.2_Splice_Site_p.G631_splice	p.G631_splice	NM_003703	NP_003694	P78316	NOP14_HUMAN			13	1963	-								D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Splice_Site	SNP	ENST00000314262.6	37	c.1891_splice	CCDS33945.1	.	.	.	.	.	.	.	.	.	.	A	12.36	1.915609	0.33815	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9238	0.70859	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOP14	2915596	1.000000	0.71417	0.987000	0.45799	0.088000	0.18126	7.977000	0.88081	1.924000	0.55735	0.459000	0.35465	.		0.353	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703	Intron	15	29	0	0	0	0.00245	0	15	29				
WDR1	9948	broad.mit.edu	37	4	10079485	10079485	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:10079485C>A	ENST00000499869.2	-	13	1654	c.1461G>T	c.(1459-1461)gaG>gaT	p.E487D	WDR1_ENST00000382451.2_Missense_Mutation_p.E347D|MIR3138_ENST00000585238.1_RNA|WDR1_ENST00000502702.1_Missense_Mutation_p.E347D|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000382452.2_Missense_Mutation_p.E487D			O75083	WDR1_HUMAN	WD repeat domain 1	487					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GGCCCTTGGCCTCTAGGAGCT	0.647																																							uc003gmf.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1459-1461)GAG>GAT		WD repeat-containing protein 1 isoform 1							35.0	41.0	39.0					4																	10079485		2165	4257	6422	SO:0001583	missense	9948				platelet activation|platelet degranulation|sensory perception of sound	cytoskeleton|cytosol|extracellular region	actin binding	g.chr4:10079485C>A	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1461G>T	4.37:g.10079485C>A	ENSP00000427687:p.Glu487Asp					WDR1_uc003gmg.2_Missense_Mutation_p.E347D|WDR1_uc010idm.2_RNA	p.E487D	NM_017491	NP_059830	O75083	WDR1_HUMAN		STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)	13	1744	-			487			WD 9.		A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	ENST00000499869.2	37	c.1461G>T	CCDS54740.1	.	.	.	.	.	.	.	.	.	.	C	5.653	0.305148	0.10678	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000502702;ENST00000439733	T;T;T;T	0.50813	0.73;0.73;1.12;1.12	5.52	3.77	0.43336	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.225560	0.44483	D	0.000459	T	0.27349	0.0671	N	0.16743	0.435	0.47476	D	0.999438	B;B	0.14438	0.01;0.003	B;B	0.13407	0.009;0.003	T	0.10894	-1.0610	10	0.38643	T	0.18	-51.101	6.0892	0.19985	0.0:0.7161:0.0:0.2839	.	347;487	O75083-3;O75083	.;WDR1_HUMAN	D	487;487;347;347;322	ENSP00000427687:E487D;ENSP00000371890:E487D;ENSP00000371889:E347D;ENSP00000426725:E347D	ENSP00000371889:E347D	E	-	3	2	WDR1	9688583	0.997000	0.39634	1.000000	0.80357	0.085000	0.17905	0.395000	0.20850	2.595000	0.87683	0.655000	0.94253	GAG		0.647	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1			8	12	1	0	1.76689e-08	0.006214	2.06828e-08	8	12				
SLIT2	9353	broad.mit.edu	37	4	20535276	20535276	+	Silent	SNP	G	G	A	rs373575007		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:20535276G>A	ENST00000504154.1	+	18	2022	c.1770G>A	c.(1768-1770)acG>acA	p.T590T	SLIT2_ENST00000503823.1_Silent_p.T582T|SLIT2_ENST00000503837.1_Silent_p.T586T|SLIT2_ENST00000273739.5_Silent_p.T594T	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	590					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TACTTCTTACGAGTAATCGTT	0.348																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(1768-1770)ACG>ACA		slit homolog 2 precursor		G		1,4405	2.1+/-5.4	0,1,2202	145.0	146.0	146.0		1770	-10.5	0.4	4		146	0,8600		0,0,4300	no	coding-synonymous	SLIT2	NM_004787.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		590/1530	20535276	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20535276G>A	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1770G>A	4.37:g.20535276G>A						SLIT2_uc003gps.1_Silent_p.T582T	p.T590T	NM_004787	NP_004778	O94813	SLIT2_HUMAN			18	1974	+			590			LRR 14.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	c.1770G>A	CCDS3426.1																																																																																				0.348	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			19	61	0	0	0	0.008871	0	19	61				
RBPJ	3516	broad.mit.edu	37	4	26432131	26432131	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:26432131G>C	ENST00000361572.6	+	10	1368	c.1174G>C	c.(1174-1176)Gaa>Caa	p.E392Q	RBPJ_ENST00000342295.1_Missense_Mutation_p.E392Q|RBPJ_ENST00000504907.1_Intron|RBPJ_ENST00000348160.4_Missense_Mutation_p.E379Q|RBPJ_ENST00000345843.3_Missense_Mutation_p.E377Q|RBPJ_ENST00000355476.3_Missense_Mutation_p.E378Q|RBPJ_ENST00000342320.4_Missense_Mutation_p.E378Q|RBPJ_ENST00000507561.1_Missense_Mutation_p.E357Q			Q06330	SUH_HUMAN	recombination signal binding protein for immunoglobulin kappa J region	392	IPT/TIG.				angiogenesis (GO:0001525)|arterial endothelial cell fate commitment (GO:0060844)|atrioventricular canal development (GO:0036302)|auditory receptor cell fate commitment (GO:0009912)|B cell differentiation (GO:0030183)|blood vessel endothelial cell fate specification (GO:0097101)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac left ventricle morphogenesis (GO:0003214)|Clara cell differentiation (GO:0060486)|defense response to bacterium (GO:0042742)|DNA recombination (GO:0006310)|dorsal aorta morphogenesis (GO:0035912)|endocardium morphogenesis (GO:0003160)|epidermal cell fate specification (GO:0009957)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|gene expression (GO:0010467)|hair follicle maturation (GO:0048820)|humoral immune response (GO:0006959)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901297)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of ephrin receptor signaling pathway (GO:1901189)|positive regulation of ERBB signaling pathway (GO:1901186)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription of Notch receptor target (GO:0007221)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|sebaceous gland development (GO:0048733)|secondary heart field specification (GO:0003139)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|recombinase activity (GO:0000150)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)	15		Breast(46;0.0503)				TGTAGAAGCTGAAACTATGTA	0.428																																							uc003grx.1		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1174-1176)GAA>CAA		recombining binding protein suppressor of							108.0	97.0	100.0					4																	26432131		2203	4300	6503	SO:0001583	missense	3516				DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity	g.chr4:26432131G>C	L07872	CCDS3436.1, CCDS3437.1, CCDS33969.1, CCDS43219.1	4p15.2	2013-10-18	2007-02-26	2007-02-26	ENSG00000168214	ENSG00000168214			5724	protein-coding gene	gene with protein product	"""suppressor of hairless homolog (Drosophila)"""	147183	"""recombining binding protein suppressor of hairless (Drosophila)"""	IGKJRB1, RBPSUH		8406481, 9290259	Standard	NM_005349		Approved	SUH, IGKJRB, RBPJK, KBF2, RBP-J, CBF1	uc003gsb.2	Q06330	OTTHUMG00000097793	ENST00000361572.6:c.1174G>C	4.37:g.26432131G>C	ENSP00000354528:p.Glu392Gln					RBPJ_uc003gry.1_Missense_Mutation_p.E377Q|RBPJ_uc003grz.1_Missense_Mutation_p.E392Q|RBPJ_uc003gsa.1_Missense_Mutation_p.E378Q|RBPJ_uc003gsb.1_Missense_Mutation_p.E379Q|RBPJ_uc003gsc.1_Intron|uc003gsd.2_5'Flank	p.E392Q	NM_005349	NP_005340	Q06330	SUH_HUMAN			11	1410	+		Breast(46;0.0503)	392			IPT/TIG.		B4DY22|Q5XKH9|Q6P1N3	Missense_Mutation	SNP	ENST00000361572.6	37	c.1174G>C	CCDS3437.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257203	0.59321	.	.	ENSG00000168214	ENST00000345843;ENST00000342295;ENST00000361572;ENST00000348160;ENST00000355476;ENST00000507561;ENST00000342320;ENST00000504423	T;T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19	5.62	5.62	0.85841	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.093959	0.64402	D	0.000001	T	0.30696	0.0773	M	0.67517	2.055	0.80722	D	1	P;P;P;P	0.49696	0.877;0.851;0.851;0.927	B;B;B;B	0.43052	0.406;0.284;0.284;0.406	T	0.05886	-1.0858	10	0.49607	T	0.09	-15.6664	19.653	0.95825	0.0:0.0:1.0:0.0	.	379;378;377;392	B4DY22;Q06330-6;Q06330-4;Q06330	.;.;.;SUH_HUMAN	Q	377;392;392;379;378;357;378;78	ENSP00000305815:E377Q;ENSP00000345206:E392Q;ENSP00000354528:E392Q;ENSP00000339699:E379Q;ENSP00000347659:E378Q;ENSP00000423907:E357Q;ENSP00000340124:E378Q;ENSP00000421804:E78Q	ENSP00000345206:E392Q	E	+	1	0	RBPJ	26041229	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	9.378000	0.97191	2.658000	0.90341	0.655000	0.94253	GAA		0.428	RBPJ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215046.2	NM_015874		7	49	0	0	0	0.004482	0	7	49				
CCKAR	886	broad.mit.edu	37	4	26490979	26490979	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:26490979G>A	ENST00000295589.3	-	2	434	c.240C>T	c.(238-240)ctC>ctT	p.L80L		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	80					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	CCAGGGAGAGGAGGAAGATGT	0.547																																							uc003gse.1		NA																	0				lung(3)|pancreas(1)	4						c.(238-240)CTC>CTT		cholecystokinin A receptor	Ceruletide(DB00403)						177.0	147.0	157.0					4																	26490979		2203	4300	6503	SO:0001819	synonymous_variant	886				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity	g.chr4:26490979G>A	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.240C>T	4.37:g.26490979G>A							p.L80L	NM_000730	NP_000721	P32238	CCKAR_HUMAN			2	393	-		Breast(46;0.0503)	80			Helical; Name=2; (Potential).		B2R9Z5	Silent	SNP	ENST00000295589.3	37	c.240C>T	CCDS3438.1																																																																																				0.547	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2			11	48	0	0	0	0.008291	0	11	48				
KLHL5	51088	broad.mit.edu	37	4	39105076	39105076	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:39105076C>T	ENST00000504108.1	+	7	1891	c.1608C>T	c.(1606-1608)ccC>ccT	p.P536P	KLHL5_ENST00000261426.5_Silent_p.P475P|KLHL5_ENST00000508137.2_Silent_p.P349P|KLHL5_ENST00000261425.3_Silent_p.P490P|KLHL5_ENST00000359687.2_Silent_p.P536P|KLHL5_ENST00000381930.3_Silent_p.P536P	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5	536						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						GCTACAACCCCAAAACAAAAA	0.443																																							uc003gts.2		NA																	0				ovary(1)	1						c.(1606-1608)CCC>CCT		kelch-like 5 isoform 1							138.0	130.0	133.0					4																	39105076		2203	4300	6503	SO:0001819	synonymous_variant	51088					cytoplasm|cytoskeleton	actin binding	g.chr4:39105076C>T	AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.1608C>T	4.37:g.39105076C>T						KLHL5_uc003gtp.2_Silent_p.P490P|KLHL5_uc003gtq.2_Silent_p.P349P|KLHL5_uc003gtr.1_Silent_p.P536P|KLHL5_uc003gtt.2_Silent_p.P475P	p.P536P	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN			7	1683	+			536			Kelch 2.		A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Silent	SNP	ENST00000504108.1	37	c.1608C>T	CCDS33974.1	.	.	.	.	.	.	.	.	.	.	C	9.420	1.082758	0.20309	.	.	ENSG00000109790	ENST00000515612	.	.	.	5.66	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6941	0.51534	0.0:0.8468:0.0:0.1532	.	.	.	.	X	48	.	.	Q	+	1	0	KLHL5	38781471	0.981000	0.34729	1.000000	0.80357	0.998000	0.95712	0.142000	0.16096	1.541000	0.49316	0.655000	0.94253	CAA		0.443	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1			13	93	0	0	0	0.004007	0	13	93				
UGDH	7358	broad.mit.edu	37	4	39512080	39512080	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:39512080G>C	ENST00000316423.6	-	5	898	c.556C>G	c.(556-558)Cca>Gca	p.P186A	UGDH_ENST00000507089.1_Missense_Mutation_p.P89A|UGDH_ENST00000515398.1_5'Flank|UGDH_ENST00000506179.1_Missense_Mutation_p.P186A|UGDH_ENST00000501493.2_Missense_Mutation_p.P119A	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	186					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)			breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						TGGCCCTCTGGAGTTTCATCC	0.517																																							uc003guk.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(556-558)CCA>GCA		UDP-glucose dehydrogenase	NADH(DB00157)						129.0	121.0	124.0					4																	39512080		2203	4300	6503	SO:0001583	missense	7358				glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity	g.chr4:39512080G>C	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.556C>G	4.37:g.39512080G>C	ENSP00000319501:p.Pro186Ala					UGDH_uc011byp.1_Missense_Mutation_p.P89A|UGDH_uc003gul.1_Missense_Mutation_p.P119A	p.P186A	NM_003359	NP_003350	O60701	UGDH_HUMAN			5	872	-			186					B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	37	c.556C>G	CCDS3455.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.200592	0.38905	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000507089	T;T;T;T	0.76709	-0.95;-1.04;-0.95;-0.95	5.81	5.81	0.92471	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.095978	0.64402	D	0.000001	T	0.61652	0.2364	N	0.04373	-0.215	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.56165	-0.8024	10	0.37606	T	0.19	-6.0731	19.0677	0.93119	0.0:0.0:1.0:0.0	.	119;186	B3KUU2;O60701	.;UGDH_HUMAN	A	186;119;186;89	ENSP00000319501:P186A;ENSP00000422909:P119A;ENSP00000421757:P186A;ENSP00000426560:P89A	ENSP00000319501:P186A	P	-	1	0	UGDH	39188475	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.868000	0.56055	2.747000	0.94245	0.650000	0.86243	CCA		0.517	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359		13	95	0	0	0	0.001855	0	13	95				
GABRA4	2557	broad.mit.edu	37	4	46967176	46967176	+	Silent	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:46967176A>G	ENST00000264318.3	-	8	1927	c.945T>C	c.(943-945)taT>taC	p.Y315Y		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	315					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGGCGGTAGCATAGGACACTT	0.438																																					Ovarian(6;283 369 8234 12290 33402)	Ovarian(6;283 369 8234 12290 33402)	uc003gxg.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4						c.(943-945)TAT>TAC		gamma-aminobutyric acid A receptor, alpha 4	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						166.0	135.0	146.0					4																	46967176		2203	4300	6503	SO:0001819	synonymous_variant	2557				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46967176A>G		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.945T>C	4.37:g.46967176A>G							p.Y315Y	NM_000809	NP_000800	P48169	GBRA4_HUMAN			8	1084	-			315					Q8IYR7	Silent	SNP	ENST00000264318.3	37	c.945T>C	CCDS3473.1																																																																																				0.438	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1			26	61	0	0	0	0.003954	0	26	61				
GABRB1	2560	broad.mit.edu	37	4	47033973	47033973	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:47033973G>T	ENST00000295454.3	+	2	415	c.123G>T	c.(121-123)gtG>gtT	p.V41V	GABRB1_ENST00000509366.1_3'UTR|GABRB1_ENST00000538619.1_5'UTR	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	41					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAGAGACAGTGGACAGATTGC	0.448																																							uc003gxh.2		NA																	0				ovary(2)	2						c.(121-123)GTG>GTT		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						210.0	206.0	207.0					4																	47033973		2203	4300	6503	SO:0001819	synonymous_variant	2560				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:47033973G>T		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.123G>T	4.37:g.47033973G>T						GABRB1_uc011bze.1_5'UTR|GABRB1_uc011bzd.1_Silent_p.V41V|GABRB1_uc010igg.2_RNA	p.V41V	NM_000812	NP_000803	P18505	GBRB1_HUMAN			2	497	+			41			Extracellular (Probable).		B2R6U7|D6REL3|Q16166|Q8TBK3	Silent	SNP	ENST00000295454.3	37	c.123G>T	CCDS3474.1																																																																																				0.448	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1			56	166	1	0	9.53978e-28	0.00361	1.25295e-27	56	166				
FRYL	285527	broad.mit.edu	37	4	48542798	48542798	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:48542798C>G	ENST00000503238.1	-	43	5866	c.5867G>C	c.(5866-5868)cGg>cCg	p.R1956P	FRYL_ENST00000537810.1_Missense_Mutation_p.R1956P|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Missense_Mutation_p.R1956P|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1956					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TGTGTTACTCCGCCGCCGGTC	0.418																																							uc003gyh.1		NA																	0				skin(1)	1						c.(5866-5868)CGG>CCG		furry-like							101.0	99.0	99.0					4																	48542798		1903	4116	6019	SO:0001583	missense	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48542798C>G	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.5867G>C	4.37:g.48542798C>G	ENSP00000426064:p.Arg1956Pro					FRYL_uc003gyg.1_Missense_Mutation_p.R652P|FRYL_uc003gyi.1_Missense_Mutation_p.R844P|FRYL_uc003gyj.1_Missense_Mutation_p.R251P	p.R1956P	NM_015030	NP_055845	O94915	FRYL_HUMAN			46	6472	-			1956					O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	c.5867G>C	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768773	0.90020	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810	T;T;T	0.33216	1.42;1.42;1.42	6.16	6.16	0.99307	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60090	0.2242	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.995;0.999;1.0	T	0.57225	-0.7848	10	0.59425	D	0.04	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	786;1956;1956	Q6ZR29;O94915;F5GX82	.;FRYL_HUMAN;.	P	1956	ENSP00000426064:R1956P;ENSP00000351113:R1956P;ENSP00000441114:R1956P	ENSP00000351113:R1956P	R	-	2	0	FRYL	48237555	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.226000	0.78060	2.937000	0.99478	0.650000	0.86243	CGG		0.418	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			18	38	0	0	0	0.007413	0	18	38				
UGT2B11	10720	broad.mit.edu	37	4	70074182	70074182	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:70074182G>C	ENST00000446444.1	-	3	897	c.889C>G	c.(889-891)Cag>Gag	p.Q297E	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	297					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						CCAGAGCTCTGTACAAACTCC	0.403																																							uc003heh.2		NA																	0				ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						c.(889-891)CAG>GAG		UDP glucuronosyltransferase 2 family,							126.0	130.0	129.0					4																	70074182		2203	4296	6499	SO:0001583	missense	10720				estrogen metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70074182G>C	AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.889C>G	4.37:g.70074182G>C	ENSP00000387683:p.Gln297Glu					uc003hei.1_Intron	p.Q297E	NM_001073	NP_001064	O75310	UDB11_HUMAN			3	898	-			297					Q3KNV9	Missense_Mutation	SNP	ENST00000446444.1	37	c.889C>G	CCDS3527.1	.	.	.	.	.	.	.	.	.	.	-	4.351	0.064686	0.08388	.	.	ENSG00000213759	ENST00000446444	T	0.60797	0.16	1.96	1.96	0.26148	.	0.086077	0.48767	U	0.000179	T	0.52725	0.1752	M	0.72624	2.21	0.23238	N	0.998065	B	0.21520	0.057	B	0.27262	0.078	T	0.53027	-0.8496	10	0.62326	D	0.03	.	6.4306	0.21794	0.0:0.3109:0.6891:0.0	.	297	O75310	UDB11_HUMAN	E	297	ENSP00000387683:Q297E	ENSP00000387683:Q297E	Q	-	1	0	UGT2B11	70108771	0.986000	0.35501	0.915000	0.36163	0.050000	0.14768	1.851000	0.39338	1.087000	0.41251	0.184000	0.17185	CAG		0.403	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251551.2	NM_001073		29	142	0	0	0	0.002836	0	29	142				
NKX6-1	4825	broad.mit.edu	37	4	85419026	85419026	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:85419026G>C	ENST00000295886.4	-	1	577	c.356C>G	c.(355-357)tCg>tGg	p.S119W	NKX6-1_ENST00000515820.2_5'Flank	NM_006168.2	NP_006159.2	P78426	NKX61_HUMAN	NK6 homeobox 1	119	Poly-Ser.|Repressor domain. {ECO:0000250}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|cellular response to peptide hormone stimulus (GO:0071375)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|negative regulation of glial cell differentiation (GO:0045686)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|organ morphogenesis (GO:0009887)|pancreas development (GO:0031016)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of insulin secretion (GO:0032024)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of axon extension (GO:0030516)|regulation of neuron migration (GO:2001222)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to drug (GO:0042493)|response to nicotine (GO:0035094)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	15		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.0013)		accggagggcgaggcggaggG	0.761																																							uc003hpa.1		NA																	0					0						c.(355-357)TCG>TGG		NK6 transcription factor related, locus 1							5.0	8.0	7.0					4																	85419026		2029	4022	6051	SO:0001583	missense	4825				detection of glucose|negative regulation of transcription from RNA polymerase II promoter|organ morphogenesis|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|type B pancreatic cell maturation	nucleus		g.chr4:85419026G>C	AH007313	CCDS3607.1	4q21.33	2012-03-09	2007-07-09	2002-10-04	ENSG00000163623	ENSG00000163623		"""Homeoboxes / ANTP class : NKL subclass"""	7839	protein-coding gene	gene with protein product		602563	"""NK homeobox (Drosophila), family 6, A"", ""NK6 transcription factor related, locus 1 (Drosophila)"""	NKX6A		9119408	Standard	NM_006168		Approved	Nkx6.1	uc003hpa.1	P78426	OTTHUMG00000130426	ENST00000295886.4:c.356C>G	4.37:g.85419026G>C	ENSP00000295886:p.Ser119Trp						p.S119W	NM_006168	NP_006159	P78426	NKX61_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.0013)	1	362	-		Hepatocellular(203;0.114)	119			Poly-Ser.|Repressor domain (By similarity).			Missense_Mutation	SNP	ENST00000295886.4	37	c.356C>G	CCDS3607.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.376157	0.42105	.	.	ENSG00000163623	ENST00000295886	D	0.91792	-2.91	3.98	3.98	0.46160	.	0.000000	0.38217	N	0.001768	D	0.84687	0.5527	N	0.08118	0	0.58432	D	0.999993	D	0.57899	0.981	P	0.48654	0.585	D	0.84909	0.0847	10	0.45353	T	0.12	-15.164	9.4734	0.38856	0.1047:0.0:0.8953:0.0	.	119	P78426	NKX61_HUMAN	W	119	ENSP00000295886:S119W	ENSP00000295886:S119W	S	-	2	0	NKX6-1	85638050	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	2.374000	0.44274	2.058000	0.61347	0.484000	0.47621	TCG		0.761	NKX6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252814.2	NM_006168		3	10	0	0	0	0.004672	0	3	10				
WDFY3	23001	broad.mit.edu	37	4	85687123	85687123	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:85687123C>T	ENST00000295888.4	-	32	5435	c.5028G>A	c.(5026-5028)gaG>gaA	p.E1676E	WDFY3_ENST00000322366.6_Silent_p.E1676E	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1676					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GTAAGTGTTCCTCCATAAACA	0.368																																							uc003hpd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(5026-5028)GAG>GAA		WD repeat and FYVE domain containing 3 isoform							146.0	139.0	141.0					4																	85687123		2203	4300	6503	SO:0001819	synonymous_variant	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85687123C>T	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5028G>A	4.37:g.85687123C>T							p.E1676E	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	32	5436	-		Hepatocellular(203;0.114)	1676					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	c.5028G>A	CCDS3609.1																																																																																				0.368	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		28	39	0	0	0	0.010818	0	28	39				
GPRIN3	285513	broad.mit.edu	37	4	90170789	90170789	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:90170789G>A	ENST00000609438.1	-	2	991	c.473C>T	c.(472-474)tCa>tTa	p.S158L	GPRIN3_ENST00000333209.4_Missense_Mutation_p.S158L	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	158										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GGTTCTCTGTGATCTCATCAG	0.517																																							uc003hsm.1		NA																	0				ovary(3)	3						c.(472-474)TCA>TTA		G protein-regulated inducer of neurite outgrowth							153.0	148.0	149.0					4																	90170789		2203	4300	6503	SO:0001583	missense	285513							g.chr4:90170789G>A	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.473C>T	4.37:g.90170789G>A	ENSP00000476603:p.Ser158Leu						p.S158L	NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)	2	992	-		Hepatocellular(203;0.114)	158					Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	c.473C>T	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709779	0.30322	.	.	ENSG00000185477	ENST00000333209	T	0.12361	2.69	4.98	3.21	0.36854	.	0.321368	0.17421	N	0.174821	T	0.10252	0.0251	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.18561	0.022	T	0.22906	-1.0203	10	0.56958	D	0.05	-0.3853	7.5628	0.27862	0.0838:0.0:0.7527:0.1635	.	158	Q6ZVF9	GRIN3_HUMAN	L	158	ENSP00000328672:S158L	ENSP00000328672:S158L	S	-	2	0	GPRIN3	90389812	0.018000	0.18449	0.001000	0.08648	0.007000	0.05969	2.066000	0.41452	0.756000	0.33013	-0.142000	0.14014	TCA		0.517	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281		23	106	0	0	0	0.00278	0	23	106				
ATOH1	474	broad.mit.edu	37	4	94750827	94750827	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:94750827C>A	ENST00000306011.3	+	1	786	c.750C>A	c.(748-750)aaC>aaA	p.N250K		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	250					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		GCGCGGGCAACGCGACCGCAG	0.726																																							uc003hta.1		NA																	0					0						c.(748-750)AAC>AAA		atonal homolog 1																																				SO:0001583	missense	474				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity	g.chr4:94750827C>A	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.750C>A	4.37:g.94750827C>A	ENSP00000302216:p.Asn250Lys						p.N250K	NM_005172	NP_005163	Q92858	ATOH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)	1	750	+		Hepatocellular(203;0.114)	250					Q14CT9	Missense_Mutation	SNP	ENST00000306011.3	37	c.750C>A	CCDS3638.1	.	.	.	.	.	.	.	.	.	.	C	1.051	-0.675943	0.03378	.	.	ENSG00000172238	ENST00000306011	D	0.97209	-4.29	3.96	-7.59	0.01308	.	0.746621	0.12159	N	0.494203	D	0.86810	0.6022	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.77996	-0.2377	10	0.33940	T	0.23	-3.1438	1.7497	0.02970	0.1915:0.3336:0.2967:0.1783	.	250	Q92858	ATOH1_HUMAN	K	250	ENSP00000302216:N250K	ENSP00000302216:N250K	N	+	3	2	ATOH1	94969850	0.000000	0.05858	0.001000	0.08648	0.115000	0.19883	-1.850000	0.01670	-1.494000	0.01833	-0.362000	0.07510	AAC		0.726	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253585.1	NM_005172		15	12	1	0	0.000219431	0.00245	0.000235749	15	12				
DKK2	27123	broad.mit.edu	37	4	107845337	107845337	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:107845337C>A	ENST00000285311.3	-	4	1259	c.554G>T	c.(553-555)cGa>cTa	p.R185L	DKK2_ENST00000510463.1_Missense_Mutation_p.R139L|DKK2_ENST00000513208.1_Missense_Mutation_p.R85L	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	185	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		GTCTGATGATCGTAGGCAGGG	0.453																																							uc003hyi.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(553-555)CGA>CTA		dickkopf homolog 2 precursor							90.0	86.0	87.0					4																	107845337		2203	4300	6503	SO:0001583	missense	27123				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space		g.chr4:107845337C>A	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.554G>T	4.37:g.107845337C>A	ENSP00000285311:p.Arg185Leu					DKK2_uc003hyj.1_3'UTR	p.R185L	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)	4	1259	-		Hepatocellular(203;0.217)	185			DKK-type Cys-2.		A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	c.554G>T	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	C	33	5.239851	0.95240	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.54675	0.56;0.59;0.61	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.74612	0.3739	M	0.78456	2.415	0.80722	D	1	D	0.63880	0.993	D	0.71184	0.972	T	0.76724	-0.2854	10	0.72032	D	0.01	-2.2292	19.6876	0.95986	0.0:1.0:0.0:0.0	.	185	Q9UBU2	DKK2_HUMAN	L	185;85;139	ENSP00000285311:R185L;ENSP00000421255:R85L;ENSP00000423797:R139L	ENSP00000285311:R185L	R	-	2	0	DKK2	108064786	1.000000	0.71417	0.830000	0.32933	0.992000	0.81027	7.487000	0.81328	2.657000	0.90304	0.585000	0.79938	CGA		0.453	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4			19	31	1	0	5.35267e-07	0.007413	6.10938e-07	19	31				
ZGRF1	55345	broad.mit.edu	37	4	113475105	113475105	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:113475105C>A	ENST00000505019.1	-	22	5357	c.5232G>T	c.(5230-5232)caG>caT	p.Q1744H		NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1744						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		GTTCTTTTAACTGTTCACTTT	0.348																																							uc003iau.2		NA																	0					0						c.(5230-5232)CAG>CAT		prematurely terminated mRNA decay factor-like							145.0	143.0	144.0					4																	113475105		2203	4300	6503	SO:0001583	missense	55345					integral to membrane	zinc ion binding	g.chr4:113475105C>A																												ENST00000505019.1:c.5232G>T	4.37:g.113475105C>A	ENSP00000424737:p.Gln1744His					C4orf21_uc003iav.2_RNA|C4orf21_uc003iat.2_Missense_Mutation_p.Q202H	p.Q1744H	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000676)	22	5443	-		Ovarian(17;0.156)	566					B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	37	c.5232G>T		.	.	.	.	.	.	.	.	.	.	C	11.30	1.599154	0.28534	.	.	ENSG00000138658	ENST00000505019	D	0.83250	-1.7	5.75	-5.55	0.02536	.	0.296755	0.30159	N	0.010269	T	0.71384	0.3333	M	0.66939	2.045	0.20403	N	0.999903	B;B	0.31879	0.344;0.007	B;B	0.24541	0.054;0.011	T	0.59257	-0.7488	10	0.46703	T	0.11	-5.4685	5.6841	0.17792	0.0999:0.4528:0.1025:0.3447	.	1744;202	G5EA02;B3KQX2	.;.	H	1744	ENSP00000424737:Q1744H	ENSP00000404365:Q642H	Q	-	3	2	C4orf21	113694554	0.000000	0.05858	0.000000	0.03702	0.959000	0.62525	-0.672000	0.05244	-1.155000	0.02822	-0.440000	0.05779	CAG		0.348	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1			14	52	1	0	1.99824e-07	0.00499	2.28548e-07	14	52				
ZGRF1	55345	broad.mit.edu	37	4	113540608	113540608	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:113540608G>A	ENST00000505019.1	-	6	715	c.590C>T	c.(589-591)tCt>tTt	p.S197F	C4orf21_ENST00000309071.5_Missense_Mutation_p.S197F|C4orf21_ENST00000445203.2_Missense_Mutation_p.S166F	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		197						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		GAAGGATGGAGAAAAAACCGA	0.383																																							uc003iau.2		NA																	0					0						c.(589-591)TCT>TTT		prematurely terminated mRNA decay factor-like							44.0	49.0	47.0					4																	113540608		2203	4300	6503	SO:0001583	missense	55345					integral to membrane	zinc ion binding	g.chr4:113540608G>A																												ENST00000505019.1:c.590C>T	4.37:g.113540608G>A	ENSP00000424737:p.Ser197Phe					C4orf21_uc003iaw.2_Missense_Mutation_p.S197F	p.S197F	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000676)	6	801	-		Ovarian(17;0.156)	Error:Variant_position_missing_in_Q6ZU11_after_alignment					B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	37	c.590C>T		.	.	.	.	.	.	.	.	.	.	G	17.64	3.440011	0.63067	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	D;T;T	0.86297	-2.1;1.44;0.96	5.05	4.18	0.49190	.	0.256190	0.27896	N	0.017410	D	0.89894	0.6847	M	0.72894	2.215	0.09310	N	1	D;D	0.76494	0.999;0.971	P;P	0.60789	0.879;0.875	T	0.81095	-0.1088	10	0.15066	T	0.55	0.4373	11.0149	0.47682	0.0:0.1402:0.7142:0.1455	.	197;197	Q86YA3;G5EA02	CD021_HUMAN;.	F	197;197;166	ENSP00000424737:S197F;ENSP00000309095:S197F;ENSP00000390505:S166F	ENSP00000309095:S197F	S	-	2	0	C4orf21	113760057	0.030000	0.19436	0.035000	0.18076	0.365000	0.29674	2.256000	0.43231	1.062000	0.40625	0.591000	0.81541	TCT		0.383	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1			7	16	0	0	0	0.001984	0	7	16				
NDST4	64579	broad.mit.edu	37	4	115858642	115858642	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:115858642G>C	ENST00000264363.2	-	5	1917	c.1239C>G	c.(1237-1239)atC>atG	p.I413M		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	413	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AGCCCATGTTGATTGGTATTC	0.443																																							uc003ibu.2		NA																	0				skin(3)|ovary(1)	4						c.(1237-1239)ATC>ATG		heparan sulfate N-deacetylase/N-sulfotransferase							107.0	90.0	95.0					4																	115858642		2203	4300	6503	SO:0001583	missense	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115858642G>C	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1239C>G	4.37:g.115858642G>C	ENSP00000264363:p.Ile413Met					NDST4_uc010imw.2_RNA	p.I413M	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	5	1918	-		Ovarian(17;0.156)	413			Lumenal (Potential).|Heparan sulfate N-deacetylase 4.		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	c.1239C>G	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.564216	0.45694	.	.	ENSG00000138653	ENST00000264363	T	0.36520	1.25	5.47	4.62	0.57501	.	0.463794	0.25783	N	0.028323	T	0.35364	0.0929	L	0.29908	0.895	0.24012	N	0.996172	B	0.25850	0.136	P	0.46825	0.528	T	0.39418	-0.9615	10	0.62326	D	0.03	.	2.1192	0.03722	0.1367:0.1415:0.4382:0.2836	.	413	Q9H3R1	NDST4_HUMAN	M	413	ENSP00000264363:I413M	ENSP00000264363:I413M	I	-	3	3	NDST4	116078091	0.086000	0.21541	0.944000	0.38274	0.981000	0.71138	0.395000	0.20850	2.704000	0.92352	0.655000	0.94253	ATC		0.443	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		4	29	0	0	0	0.009096	0	4	29				
SYNPO2	171024	broad.mit.edu	37	4	119944633	119944633	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:119944633G>A	ENST00000429713.2	+	2	336	c.154G>A	c.(154-156)Gaa>Aaa	p.E52K	SYNPO2_ENST00000448416.2_Missense_Mutation_p.E52K|SYNPO2_ENST00000307142.4_Missense_Mutation_p.E52K|SYNPO2_ENST00000434046.2_Missense_Mutation_p.E52K	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	52	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGAGGGAGATGAAGTGGTTTC	0.423																																							uc003icm.3		NA																	0				ovary(2)	2						c.(154-156)GAA>AAA		synaptopodin 2 isoform b							127.0	103.0	111.0					4																	119944633		2203	4300	6503	SO:0001583	missense	171024					nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding	g.chr4:119944633G>A	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.154G>A	4.37:g.119944633G>A	ENSP00000395143:p.Glu52Lys					SYNPO2_uc010ina.2_Missense_Mutation_p.E52K|SYNPO2_uc010inb.2_Missense_Mutation_p.E52K|SYNPO2_uc011cgh.1_Missense_Mutation_p.E52K|SYNPO2_uc010inc.2_5'UTR	p.E52K	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN			2	350	+			52			PDZ.		B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	c.154G>A	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	G	35	5.516194	0.96402	.	.	ENSG00000172403	ENST00000307142;ENST00000448416;ENST00000429713;ENST00000434046	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.66	5.66	0.87406	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000005	T	0.44726	0.1307	L	0.39898	1.24	0.51482	D	0.999924	D;D;D;D	0.89917	1.0;0.988;1.0;1.0	D;D;D;D	0.83275	0.993;0.971;0.996;0.993	T	0.26916	-1.0089	10	0.62326	D	0.03	-22.3694	17.9264	0.88985	0.0:0.0:1.0:0.0	.	52;52;52;52	B4E258;Q9UMS6-2;E9PEM2;Q9UMS6	.;.;.;SYNP2_HUMAN	K	52	ENSP00000306015:E52K;ENSP00000412623:E52K;ENSP00000395143:E52K;ENSP00000390965:E52K	ENSP00000306015:E52K	E	+	1	0	SYNPO2	120164081	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.463000	0.97652	2.654000	0.90174	0.650000	0.86243	GAA		0.423	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			9	21	0	0	0	0.004482	0	9	21				
ANKRD50	57182	broad.mit.edu	37	4	125591188	125591188	+	Missense_Mutation	SNP	T	T	C	rs200654829		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:125591188T>C	ENST00000504087.1	-	4	4281	c.3244A>G	c.(3244-3246)Atg>Gtg	p.M1082V	ANKRD50_ENST00000515641.1_Missense_Mutation_p.M903V	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1082										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GCAACACGCATAGCAGTGCGT	0.423																																							uc003ifg.3		NA																	0				central_nervous_system(1)	1						c.(3244-3246)ATG>GTG		ankyrin repeat domain 50		T	VAL/MET,VAL/MET	0,4406		0,0,2203	92.0	91.0	91.0		2707,3244	4.3	1.0	4		91	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ANKRD50	NM_001167882.1,NM_020337.2	21,21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign	903/1251,1082/1430	125591188	1,13005	2203	4300	6503	SO:0001583	missense	57182							g.chr4:125591188T>C	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3244A>G	4.37:g.125591188T>C	ENSP00000425658:p.Met1082Val					ANKRD50_uc011cgo.1_Missense_Mutation_p.M903V|ANKRD50_uc010inw.2_Missense_Mutation_p.M1082V	p.M1082V	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN			3	3510	-			1082			ANK 19.		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	c.3244A>G	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	T	11.09	1.535768	0.27475	0.0	1.16E-4	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.63744	-0.06;-0.06	5.51	4.33	0.51752	Ankyrin repeat-containing domain (4);	0.079637	0.85682	N	0.000000	T	0.47619	0.1455	N	0.20357	0.565	0.47511	D	0.999442	B	0.18310	0.027	B	0.24701	0.055	T	0.41142	-0.9525	10	0.48119	T	0.1	.	11.3091	0.49353	0.0:0.0707:0.0:0.9293	.	1082	Q9ULJ7	ANR50_HUMAN	V	1082;903	ENSP00000425658:M1082V;ENSP00000425355:M903V	ENSP00000425658:M1082V	M	-	1	0	ANKRD50	125810638	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.333000	0.79214	1.104000	0.41587	0.459000	0.35465	ATG		0.423	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337		11	44	0	0	0	0.008291	0	11	44				
FAT4	79633	broad.mit.edu	37	4	126242530	126242530	+	Missense_Mutation	SNP	G	G	T	rs572010193		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:126242530G>T	ENST00000394329.3	+	1	4977	c.4964G>T	c.(4963-4965)aGc>aTc	p.S1655I		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1655	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GAAGCAGCTAGCCCCAGAGGA	0.428																																							uc003ifj.3		NA																	0				ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(4963-4965)AGC>ATC		FAT tumor suppressor homolog 4 precursor							83.0	84.0	84.0					4																	126242530		1848	4081	5929	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126242530G>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4964G>T	4.37:g.126242530G>T	ENSP00000377862:p.Ser1655Ile						p.S1655I	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN			1	4964	+			1655			Cadherin 16.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.4964G>T	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482201	0.63962	.	.	ENSG00000196159	ENST00000394329	T	0.38887	1.11	4.49	4.49	0.54785	Cadherin (3);Cadherin-like (1);	0.000000	0.40469	U	0.001081	T	0.63498	0.2516	M	0.68317	2.08	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.68172	-0.5479	10	0.72032	D	0.01	.	17.3959	0.87445	0.0:0.0:1.0:0.0	.	1655	Q6V0I7	FAT4_HUMAN	I	1655	ENSP00000377862:S1655I	ENSP00000377862:S1655I	S	+	2	0	FAT4	126461980	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.420000	0.80191	2.345000	0.79718	0.650000	0.86243	AGC		0.428	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		7	57	1	0	8.12818e-05	0.001984	8.76694e-05	7	57				
SLC25A31	83447	broad.mit.edu	37	4	128651878	128651878	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:128651878G>A	ENST00000281154.4	+	1	346	c.178G>A	c.(178-180)Gag>Aag	p.E60K		NM_031291.2	NP_112581.1	Q9H0C2	ADT4_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31	60					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|nucleus (GO:0005634)	transporter activity (GO:0005215)			NS(1)|breast(1)|large_intestine(10)|lung(8)|skin(2)	22						GATCAGCCCCGAGGCGCGGTA	0.697																																							uc003ifl.2		NA																	0					0						c.(178-180)GAG>AAG		solute carrier family 25 (mitochondrial carrier;							38.0	36.0	37.0					4																	128651878		2203	4299	6502	SO:0001583	missense	83447				transmembrane transport	cilium|flagellum|integral to membrane|mitochondrial inner membrane	binding|transporter activity	g.chr4:128651878G>A	AL136857	CCDS3733.1	4q28	2013-05-22			ENSG00000151475	ENSG00000151475		"""Solute carriers"""	25319	protein-coding gene	gene with protein product		610796				15670820	Standard	NM_031291		Approved	DKFZP434N1235, ANT4	uc003ifl.3	Q9H0C2	OTTHUMG00000133300	ENST00000281154.4:c.178G>A	4.37:g.128651878G>A	ENSP00000281154:p.Glu60Lys						p.E60K	NM_031291	NP_112581	Q9H0C2	ADT4_HUMAN			1	324	+			60			Solcar 1.			Missense_Mutation	SNP	ENST00000281154.4	37	c.178G>A	CCDS3733.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378619	0.42207	.	.	ENSG00000151475	ENST00000281154	T	0.78816	-1.21	4.84	4.84	0.62591	Mitochondrial carrier domain (2);	0.000000	0.48767	D	0.000177	T	0.70168	0.3193	L	0.37466	1.105	0.43476	D	0.995697	B	0.19200	0.034	B	0.11329	0.006	T	0.68375	-0.5425	10	0.62326	D	0.03	-23.0813	15.3325	0.74226	0.0:0.0:1.0:0.0	.	60	Q9H0C2	ADT4_HUMAN	K	60	ENSP00000281154:E60K	ENSP00000281154:E60K	E	+	1	0	SLC25A31	128871328	1.000000	0.71417	0.079000	0.20413	0.001000	0.01503	7.733000	0.84916	2.677000	0.91161	0.655000	0.94253	GAG		0.697	SLC25A31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257094.2	NM_031291		6	31	0	0	0	0.001984	0	6	31				
GAB1	2549	broad.mit.edu	37	4	144359702	144359702	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:144359702C>T	ENST00000262994.4	+	4	1446	c.1144C>T	c.(1144-1146)Cct>Tct	p.P382S	GAB1_ENST00000262995.4_Missense_Mutation_p.P382S|GAB1_ENST00000505913.1_Missense_Mutation_p.P279S	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	382					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					AGGGATGTCGCCTTCACGTAG	0.443																																							uc003ije.2		NA																	0				breast(2)|lung(1)|skin(1)	4						c.(1144-1146)CCT>TCT		GRB2-associated binding protein 1 isoform b							124.0	107.0	113.0					4																	144359702		2203	4300	6503	SO:0001583	missense	2549				cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity	g.chr4:144359702C>T	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1144C>T	4.37:g.144359702C>T	ENSP00000262994:p.Pro382Ser					GAB1_uc003ijd.2_Missense_Mutation_p.P382S|GAB1_uc011chq.1_Missense_Mutation_p.P279S	p.P382S	NM_002039	NP_002030	Q13480	GAB1_HUMAN			4	1503	+	all_hematologic(180;0.158)		382					A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	37	c.1144C>T	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.380184	0.24944	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000505913	T;T;T	0.38722	1.12;1.12;1.12	5.49	4.63	0.57726	.	0.295051	0.39475	N	0.001355	T	0.38268	0.1034	L	0.44542	1.39	0.38746	D	0.953991	B;P	0.42296	0.278;0.775	B;B	0.39660	0.057;0.306	T	0.44982	-0.9292	10	0.72032	D	0.01	-3.9572	14.4861	0.67619	0.0:0.7203:0.2797:0.0	.	382;382	Q13480;Q13480-2	GAB1_HUMAN;.	S	382;382;279	ENSP00000262995:P382S;ENSP00000262994:P382S;ENSP00000424554:P279S	ENSP00000262994:P382S	P	+	1	0	GAB1	144579152	0.971000	0.33674	0.012000	0.15200	0.203000	0.24098	2.391000	0.44424	1.265000	0.44215	0.655000	0.94253	CCT		0.443	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039		11	51	0	0	0	0.008291	0	11	51				
NR3C2	4306	broad.mit.edu	37	4	149002645	149002645	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:149002645C>T	ENST00000358102.3	-	9	3167	c.2805G>A	c.(2803-2805)gtG>gtA	p.V935V	NR3C2_ENST00000511528.1_Silent_p.V939V|NR3C2_ENST00000512865.1_Silent_p.V818V|NR3C2_ENST00000344721.4_Silent_p.V935V|NR3C2_ENST00000355292.3_Silent_p.V939V	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	935	Steroid-binding.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GCAGGTCGCTCACCAGCTGTA	0.567																																					Melanoma(27;428 957 40335 51025 51111)	Melanoma(27;428 957 40335 51025 51111)	uc003ilj.3		NA																	0				large_intestine(1)	1						c.(2803-2805)GTG>GTA		nuclear receptor subfamily 3, group C, member 2	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)						46.0	45.0	46.0					4																	149002645		2203	4300	6503	SO:0001819	synonymous_variant	4306				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr4:149002645C>T	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2805G>A	4.37:g.149002645C>T						NR3C2_uc003ilk.3_Silent_p.V818V|NR3C2_uc010iph.2_RNA	p.V935V	NM_000901	NP_000892	P08235	MCR_HUMAN		GBM - Glioblastoma multiforme(119;0.0614)	9	3139	-	all_hematologic(180;0.151)		935			Steroid-binding.		B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	ENST00000358102.3	37	c.2805G>A	CCDS3772.1																																																																																				0.567	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1			5	20	0	0	0	0.001168	0	5	20				
FGA	2243	broad.mit.edu	37	4	155507040	155507040	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:155507040G>T	ENST00000302053.3	-	5	1619	c.1541C>A	c.(1540-1542)cCt>cAt	p.P514H	FGA_ENST00000403106.3_Missense_Mutation_p.P514H	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	514					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AGCTTCATCAGGGTGCCTATG	0.502																																					NSCLC(143;340 1922 20892 22370 48145)	NSCLC(143;340 1922 20892 22370 48145)	uc003iod.1		NA																	0				ovary(2)|breast(1)	3	GRCh37	CD035514	FGA	D		c.(1540-1542)CCT>CAT		fibrinogen, alpha polypeptide isoform alpha-E	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)						99.0	97.0	97.0					4																	155507040		2203	4300	6503	SO:0001583	missense	2243				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155507040G>T		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1541C>A	4.37:g.155507040G>T	ENSP00000306361:p.Pro514His					FGA_uc003ioe.1_Missense_Mutation_p.P514H|FGA_uc003iof.1_Intron	p.P514H	NM_000508	NP_000499	P02671	FIBA_HUMAN			5	1599	-	all_hematologic(180;0.215)	Renal(120;0.0458)	514			By similarity.		A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	c.1541C>A	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947384	0.53186	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.59772	0.24;2.35	5.65	3.85	0.44370	.	.	.	.	.	T	0.70979	0.3286	M	0.65975	2.015	0.09310	N	1	B;D	0.76494	0.441;0.999	B;P	0.61800	0.105;0.894	T	0.63088	-0.6715	9	0.66056	D	0.02	.	13.4266	0.61028	0.0:0.0:0.6989:0.3011	.	514;514	P02671-2;P02671	.;FIBA_HUMAN	H	514	ENSP00000306361:P514H;ENSP00000385981:P514H	ENSP00000306361:P514H	P	-	2	0	FGA	155726490	0.398000	0.25279	0.002000	0.10522	0.019000	0.09904	2.126000	0.42026	0.846000	0.35142	0.655000	0.94253	CCT		0.502	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508		22	61	1	0	2.21704e-12	0.00278	2.69281e-12	22	61				
GUCY1A3	2982	broad.mit.edu	37	4	156638369	156638369	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:156638369C>A	ENST00000296518.7	+	8	1840	c.1631C>A	c.(1630-1632)aCt>aAt	p.T544N	GUCY1A3_ENST00000506455.1_Missense_Mutation_p.T544N|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.T544N|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.T544N|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.T544N|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.T544N|GUCY1A3_ENST00000393832.3_Missense_Mutation_p.T286N			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	544	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GAGAGTGATACTCATGCTGTT	0.433																																							uc003iov.2		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(1630-1632)ACT>AAT		guanylate cyclase 1, soluble, alpha 3 isoform A							155.0	145.0	148.0					4																	156638369		2203	4300	6503	SO:0001583	missense	2982				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity	g.chr4:156638369C>A		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1631C>A	4.37:g.156638369C>A	ENSP00000296518:p.Thr544Asn					GUCY1A3_uc010iqc.2_Missense_Mutation_p.T544N|GUCY1A3_uc003iow.2_Missense_Mutation_p.T544N|GUCY1A3_uc010iqd.2_Missense_Mutation_p.T543N|GUCY1A3_uc003iox.2_Missense_Mutation_p.T544N|GUCY1A3_uc003ioz.2_Missense_Mutation_p.T309N|GUCY1A3_uc003ioy.2_Missense_Mutation_p.T544N|GUCY1A3_uc010iqe.2_Missense_Mutation_p.T309N|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_Missense_Mutation_p.T544N	p.T544N	NM_000856	NP_000847	Q02108	GCYA3_HUMAN		COAD - Colon adenocarcinoma(41;0.17)	9	2167	+	all_hematologic(180;0.24)	Renal(120;0.0854)	544			Guanylate cyclase.		D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	c.1631C>A	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.675451	0.47781	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000393832;ENST00000296518;ENST00000513574	D;D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	5.64	4.79	0.61399	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000004	T	0.74458	0.3719	N	0.25201	0.72	0.53005	D	0.999967	B;B	0.14438	0.01;0.01	B;B	0.25506	0.061;0.061	T	0.67503	-0.5654	10	0.24483	T	0.36	.	15.8862	0.79251	0.1365:0.8634:0.0:0.0	.	544;544	B3KU69;Q02108	.;GCYA3_HUMAN	N	544;544;544;544;286;544;544	ENSP00000424361:T544N;ENSP00000421493:T544N;ENSP00000426968:T544N;ENSP00000412201:T544N;ENSP00000377418:T286N;ENSP00000296518:T544N;ENSP00000426040:T544N	ENSP00000296518:T544N	T	+	2	0	GUCY1A3	156857819	0.993000	0.37304	0.992000	0.48379	0.993000	0.82548	3.111000	0.50360	1.350000	0.45770	0.655000	0.94253	ACT		0.433	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			12	33	1	0	6.40141e-05	0.010729	6.93171e-05	12	33				
RXFP1	59350	broad.mit.edu	37	4	159568066	159568066	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:159568066C>G	ENST00000307765.5	+	16	1720	c.1469C>G	c.(1468-1470)tCt>tGt	p.S490C	RXFP1_ENST00000448688.2_Missense_Mutation_p.S385C|RXFP1_ENST00000460056.2_Missense_Mutation_p.S409C|RXFP1_ENST00000470033.1_Missense_Mutation_p.S457C|RXFP1_ENST00000343542.5_Missense_Mutation_p.S442C	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	490					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CTTGTAGGATCTTTGGCCATT	0.398																																							uc003ipz.2		NA																	0					0						c.(1468-1470)TCT>TGT		relaxin/insulin-like family peptide receptor 1							139.0	129.0	132.0					4																	159568066		1918	4141	6059	SO:0001583	missense	59350					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding	g.chr4:159568066C>G	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1469C>G	4.37:g.159568066C>G	ENSP00000303248:p.Ser490Cys					RXFP1_uc011cja.1_Missense_Mutation_p.S385C|RXFP1_uc010iqo.2_Missense_Mutation_p.S442C|RXFP1_uc011cjb.1_Missense_Mutation_p.S388C|RXFP1_uc010iqk.2_Missense_Mutation_p.S358C|RXFP1_uc011cjc.1_Missense_Mutation_p.S409C|RXFP1_uc011cjd.1_Missense_Mutation_p.S409C|RXFP1_uc010iql.2_Missense_Mutation_p.S334C|RXFP1_uc011cje.1_Missense_Mutation_p.S517C|RXFP1_uc010iqm.2_Missense_Mutation_p.S457C|RXFP1_uc011cjf.1_Missense_Mutation_p.S359C|RXFP1_uc010iqn.2_Missense_Mutation_p.S435C	p.S490C	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN		COAD - Colon adenocarcinoma(41;0.0219)	16	1551	+	all_hematologic(180;0.24)	Renal(120;0.0854)	490			Helical; Name=3; (Potential).		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	37	c.1469C>G	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404381	0.42613	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.74	4.9	0.64082	GPCR, rhodopsin-like superfamily (1);	0.050008	0.85682	D	0.000000	T	0.41488	0.1161	M	0.72894	2.215	0.54753	D	0.99998	B;B;B;B;B;B;B;B	0.09022	0.002;0.002;0.001;0.001;0.001;0.0;0.002;0.002	B;B;B;B;B;B;B;B	0.18263	0.014;0.021;0.001;0.005;0.001;0.001;0.014;0.012	T	0.36016	-0.9765	10	0.66056	D	0.02	.	14.9237	0.70859	0.0:0.9312:0.0:0.0688	.	501;517;385;442;457;409;360;490	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	C	409;490;385;442;457;360	ENSP00000423306:S409C;ENSP00000303248:S490C;ENSP00000414885:S385C;ENSP00000345889:S442C;ENSP00000420712:S457C	ENSP00000303248:S490C	S	+	2	0	RXFP1	159787516	1.000000	0.71417	0.028000	0.17463	0.736000	0.42039	6.015000	0.70791	1.421000	0.47157	0.650000	0.86243	TCT		0.398	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634		8	28	0	0	0	0.00308	0	8	28				
NAF1	92345	broad.mit.edu	37	4	164050300	164050300	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:164050300G>A	ENST00000274054.2	-	8	1427	c.1234C>T	c.(1234-1236)Cag>Tag	p.Q412*	NAF1_ENST00000422287.2_Intron|NAF1_ENST00000509434.1_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	412					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Q412*(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				TTTTGTCTCTGAGAAGGAAAT	0.502																																							uc003iqj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(1234-1236)CAG>TAG		nuclear assembly factor 1 homolog isoform a							71.0	79.0	76.0					4																	164050300		2203	4300	6503	SO:0001587	stop_gained	92345				rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding	g.chr4:164050300G>A		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1234C>T	4.37:g.164050300G>A	ENSP00000274054:p.Gln412*					NAF1_uc010iqw.1_Intron	p.Q412*	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN			8	1428	-	all_hematologic(180;0.166)	Prostate(90;0.109)	412					D3DP28|E9PAZ2	Nonsense_Mutation	SNP	ENST00000274054.2	37	c.1234C>T	CCDS3803.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370799	0.61624	.	.	ENSG00000145414	ENST00000274054	.	.	.	4.35	4.35	0.52113	.	0.811860	0.11301	N	0.578181	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-6.7022	13.097	0.59197	0.0:0.0:1.0:0.0	.	.	.	.	X	412	.	ENSP00000274054:Q412X	Q	-	1	0	NAF1	164269750	0.926000	0.31397	0.619000	0.29118	0.154000	0.21943	4.726000	0.61986	2.349000	0.79799	0.591000	0.81541	CAG		0.502	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386		9	25	0	0	0	0.004482	0	9	25				
DDX60L	91351	broad.mit.edu	37	4	169362539	169362539	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:169362539G>C	ENST00000511577.1	-	10	1490	c.1243C>G	c.(1243-1245)Ctg>Gtg	p.L415V	DDX60L_ENST00000260184.7_Missense_Mutation_p.L415V|DDX60L_ENST00000505890.1_Missense_Mutation_p.L415V			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	415							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		GTTGTTCTCAGAGGAAAAGAC	0.368																																							uc003irq.3		NA																	0				ovary(1)	1						c.(1243-1245)CTG>GTG		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like							107.0	103.0	104.0					4																	169362539		1838	4080	5918	SO:0001583	missense	91351						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr4:169362539G>C	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.1243C>G	4.37:g.169362539G>C	ENSP00000422423:p.Leu415Val					DDX60L_uc003irr.1_Missense_Mutation_p.L415V|DDX60L_uc003irs.1_Missense_Mutation_p.L142V	p.L415V	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN		GBM - Glioblastoma multiforme(119;0.175)	10	1464	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)	415					Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37	c.1243C>G		.	.	.	.	.	.	.	.	.	.	G	1.966	-0.437611	0.04636	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.17528	2.3;2.3;2.27;2.87	3.1	-1.73	0.08081	.	0.296587	0.17737	U	0.163686	T	0.07863	0.0197	N	0.21617	0.685	0.09310	N	1	B;B;B	0.29301	0.152;0.241;0.152	B;B;B	0.25987	0.065;0.065;0.065	T	0.28808	-1.0032	10	0.25751	T	0.34	.	3.9237	0.09254	0.3827:0.1806:0.4367:0.0	.	415;415;415	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	V	415;415;415;143	ENSP00000260184:L415V;ENSP00000422423:L415V;ENSP00000422202:L415V;ENSP00000421026:L143V	ENSP00000260184:L415V	L	-	1	2	DDX60L	169599114	0.842000	0.29525	0.027000	0.17364	0.013000	0.08279	-0.401000	0.07232	-0.984000	0.03507	-0.802000	0.03209	CTG		0.368	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967		22	48	0	0	0	0.012319	0	22	48				
PDLIM3	27295	broad.mit.edu	37	4	186425632	186425632	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:186425632A>G	ENST00000284770.5	-	7	975	c.902T>C	c.(901-903)aTa>aCa	p.I301T	PDLIM3_ENST00000284767.5_3'UTR|PDLIM3_ENST00000284771.6_Missense_Mutation_p.I253T	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	301	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		AACTTACACTATGCCACTCCC	0.493																																							uc003ixw.3		NA																	0				ovary(2)	2						c.(901-903)ATA>ACA		PDZ and LIM domain protein 3 isoform a							76.0	68.0	71.0					4																	186425632		2203	4300	6503	SO:0001583	missense	27295					sarcomere	zinc ion binding	g.chr4:186425632A>G	AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.902T>C	4.37:g.186425632A>G	ENSP00000284770:p.Ile301Thr					PDLIM3_uc003ixx.3_Missense_Mutation_p.I253T|PDLIM3_uc010isi.2_RNA	p.I301T	NM_014476	NP_055291	Q53GG5	PDLI3_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)	7	1026	-		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)	301			LIM zinc-binding.		B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Missense_Mutation	SNP	ENST00000284770.5	37	c.902T>C	CCDS3844.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.886846	0.91814	.	.	ENSG00000154553	ENST00000284770;ENST00000284771	D;D	0.91945	-2.94;-2.94	5.53	5.53	0.82687	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.97508	0.9184	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98903	1.0777	10	0.87932	D	0	.	15.9669	0.79979	1.0:0.0:0.0:0.0	.	253;301	Q53GG5-2;Q53GG5	.;PDLI3_HUMAN	T	301;253	ENSP00000284770:I301T;ENSP00000284771:I253T	ENSP00000284770:I301T	I	-	2	0	PDLIM3	186662626	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	9.287000	0.95975	2.236000	0.73375	0.533000	0.62120	ATA		0.493	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360499.2	NM_014476		9	28	0	0	0	0.006214	0	9	28				
ADAMTS16	170690	broad.mit.edu	37	5	5146374	5146374	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:5146374G>A	ENST00000274181.7	+	3	445	c.307G>A	c.(307-309)Ggc>Agc	p.G103S	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.G103S|CTD-2297D10.1_ENST00000514848.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	103					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TCGGCTGAAAGGCTCCAGGCA	0.557																																							uc003jdl.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(307-309)GGC>AGC		ADAM metallopeptidase with thrombospondin type 1							71.0	73.0	73.0					5																	5146374		2014	4175	6189	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5146374G>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.307G>A	5.37:g.5146374G>A	ENSP00000274181:p.Gly103Ser					ADAMTS16_uc003jdk.1_Missense_Mutation_p.G103S|ADAMTS16_uc003jdj.1_Missense_Mutation_p.G103S	p.G103S	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN			3	445	+			103					C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.307G>A	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818458	0.90790	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.05649	3.41;3.41	5.55	5.55	0.83447	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.32763	0.0840	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.991	D;D;D	0.91635	0.999;0.975;0.968	T	0.07214	-1.0784	10	0.52906	T	0.07	.	18.6279	0.91347	0.0:0.0:1.0:0.0	.	103;103;103	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	S	103	ENSP00000274181:G103S;ENSP00000421631:G103S	ENSP00000274181:G103S	G	+	1	0	ADAMTS16	5199374	1.000000	0.71417	0.178000	0.23040	0.837000	0.47467	7.550000	0.82173	2.767000	0.95098	0.563000	0.77884	GGC		0.557	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		15	36	0	0	0	0.00278	0	15	36				
ADCY2	108	broad.mit.edu	37	5	7804778	7804778	+	Missense_Mutation	SNP	C	C	G	rs375968791		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:7804778C>G	ENST00000338316.4	+	22	2945	c.2856C>G	c.(2854-2856)agC>agG	p.S952R	ADCY2_ENST00000537121.1_Missense_Mutation_p.S772R	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	952					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CAGGTCTGAGCGCTGTGCCCA	0.527																																							uc003jdz.1		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(2854-2856)AGC>AGG		adenylate cyclase 2							79.0	71.0	74.0					5																	7804778		2203	4300	6503	SO:0001583	missense	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7804778C>G	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2856C>G	5.37:g.7804778C>G	ENSP00000342952:p.Ser952Arg					ADCY2_uc011cmo.1_Missense_Mutation_p.S772R|ADCY2_uc010itm.1_Missense_Mutation_p.S148R	p.S952R	NM_020546	NP_065433	Q08462	ADCY2_HUMAN			22	2923	+			952			Cytoplasmic (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	c.2856C>G	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083055	0.36758	.	.	ENSG00000078295	ENST00000338316;ENST00000382532;ENST00000541993;ENST00000537121	T;T	0.29917	1.55;1.55	4.72	-3.74	0.04385	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.047679	0.85682	D	0.000000	T	0.20170	0.0485	N	0.12887	0.27	0.41143	D	0.985972	P;B	0.49559	0.925;0.09	P;B	0.48400	0.576;0.069	T	0.02424	-1.1161	10	0.45353	T	0.12	.	13.7127	0.62678	0.0:0.1639:0.0:0.8361	.	772;952	B7Z2C1;Q08462	.;ADCY2_HUMAN	R	952;105;785;772	ENSP00000342952:S952R;ENSP00000444803:S772R	ENSP00000342952:S952R	S	+	3	2	ADCY2	7857778	0.357000	0.24938	0.932000	0.37286	0.958000	0.62258	-0.308000	0.08156	-0.652000	0.05408	-0.424000	0.05967	AGC		0.527	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		8	46	0	0	0	0.00308	0	8	46				
MTRR	4552	broad.mit.edu	37	5	7870910	7870910	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:7870910G>T	ENST00000264668.2	+	2	114	c.84G>T	c.(82-84)atG>atT	p.M28I	FASTKD3_ENST00000264669.5_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000440940.2_Start_Codon_SNP_p.M1I|FASTKD3_ENST00000513658.1_5'Flank|MTRR_ENST00000341013.6_Start_Codon_SNP_p.M1I	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	28					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)	p.M28I(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TTGAAGTGATGAGGAGGTTTC	0.403																																							uc003jed.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(82-84)ATG>ATT		methionine synthase reductase isoform 2	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)						124.0	113.0	117.0					5																	7870910		2203	4300	6503	SO:0001583	missense	4552				methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding	g.chr5:7870910G>T	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.84G>T	5.37:g.7870910G>T	ENSP00000264668:p.Met28Ile					FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jeb.2_5'Flank|FASTKD3_uc003jec.2_5'Flank|MTRR_uc010itn.1_RNA|MTRR_uc003jee.3_Missense_Mutation_p.M1I|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	p.M28I	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN			2	114	+			28					O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	c.84G>T	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557964	0.45590	.	.	ENSG00000124275	ENST00000264668;ENST00000341013;ENST00000440940;ENST00000502550;ENST00000506877;ENST00000512217	T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12	5.46	5.46	0.80206	.	0.425178	0.28442	N	0.015327	T	0.33323	0.0859	N	0.08118	0	0.80722	D	1	P	0.44195	0.828	B	0.39465	0.3	T	0.15838	-1.0423	10	0.38643	T	0.18	-25.5132	7.1159	0.25416	0.2065:0.0:0.7935:0.0	.	28	Q9UBK8	MTRR_HUMAN	I	28;1;1;1;1;1	ENSP00000264668:M28I;ENSP00000341918:M1I;ENSP00000402510:M1I;ENSP00000424599:M1I;ENSP00000427416:M1I;ENSP00000421318:M1I	ENSP00000264668:M28I	M	+	3	0	MTRR	7923910	1.000000	0.71417	0.943000	0.38184	0.201000	0.24016	2.203000	0.42752	2.559000	0.86315	0.655000	0.94253	ATG		0.403	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1			19	24	1	0	3.99206e-14	0.007413	4.91399e-14	19	24				
CDH18	1016	broad.mit.edu	37	5	19473630	19473630	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:19473630G>T	ENST00000507958.1	-	15	3068	c.2078C>A	c.(2077-2079)cCt>cAt	p.P693H	CDH18_ENST00000274170.4_Missense_Mutation_p.P693H|CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.P693H			Q13634	CAD18_HUMAN	cadherin 18, type 2	693					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTCACTTCAGGTCTGATATC	0.502																																							uc003jgc.2		NA																	0				ovary(5)|large_intestine(1)|skin(1)	7						c.(2077-2079)CCT>CAT		cadherin 18, type 2 preproprotein							182.0	158.0	166.0					5																	19473630		2203	4300	6503	SO:0001583	missense	1016				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:19473630G>T	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.2078C>A	5.37:g.19473630G>T	ENSP00000425093:p.Pro693His					CDH18_uc003jgd.2_Missense_Mutation_p.P693H|CDH18_uc011cnm.1_3'UTR	p.P693H	NM_004934	NP_004925	Q13634	CAD18_HUMAN			12	2455	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		693			Cytoplasmic (Potential).		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	c.2078C>A	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274807	0.80580	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	D;D;D	0.85088	-1.94;-1.94;-1.94	6.01	6.01	0.97437	Cadherin, cytoplasmic domain (1);	0.051008	0.85682	D	0.000000	D	0.94679	0.8284	M	0.93898	3.47	0.54753	D	0.999981	D	0.89917	1.0	D	0.79108	0.992	D	0.95239	0.8349	9	.	.	.	.	19.085	0.93200	0.0:0.0:1.0:0.0	.	693	Q13634	CAD18_HUMAN	H	693	ENSP00000371710:P693H;ENSP00000425093:P693H;ENSP00000274170:P693H	.	P	-	2	0	CDH18	19509387	1.000000	0.71417	0.980000	0.43619	0.966000	0.64601	7.727000	0.84838	2.861000	0.98227	0.650000	0.86243	CCT		0.502	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		16	69	1	0	1.3612e-06	0.003163	1.53135e-06	16	69				
ADAMTS12	81792	broad.mit.edu	37	5	33527457	33527457	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:33527457T>G	ENST00000504830.1	-	24	4956	c.4621A>C	c.(4621-4623)Aag>Cag	p.K1541Q	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.K1456Q	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1541	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						AGTTTGTCCTTAGTGCAAAGT	0.423										HNSCC(64;0.19)																													uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(4621-4623)AAG>CAG		ADAM metallopeptidase with thrombospondin type 1							101.0	95.0	97.0					5																	33527457		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33527457T>G	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4621A>C	5.37:g.33527457T>G	ENSP00000422554:p.Lys1541Gln	HNSCC(64;0.19)				ADAMTS12_uc010iuq.1_Missense_Mutation_p.K1456Q	p.K1541Q	NM_030955	NP_112217	P58397	ATS12_HUMAN			24	4784	-			1541			PLAC.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.4621A>C	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.280937	0.59758	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.61274	0.15;0.12	5.93	5.93	0.95920	PLAC (1);	0.050377	0.85682	D	0.000000	T	0.70386	0.3218	M	0.64997	1.995	0.80722	D	1	D;D	0.71674	0.998;0.994	D;P	0.63877	0.919;0.725	T	0.72020	-0.4416	10	0.52906	T	0.07	.	12.7684	0.57405	0.0:0.0:0.0:1.0	.	1456;1541	P58397-3;P58397	.;ATS12_HUMAN	Q	1541;1456	ENSP00000422554:K1541Q;ENSP00000344847:K1456Q	ENSP00000344847:K1456Q	K	-	1	0	ADAMTS12	33563214	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.829000	0.48128	2.263000	0.75096	0.533000	0.62120	AAG		0.423	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		13	42	0	0	0	0.001368	0	13	42				
IL7R	3575	broad.mit.edu	37	5	35867450	35867450	+	Silent	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:35867450A>G	ENST00000303115.3	+	3	393	c.264A>G	c.(262-264)ctA>ctG	p.L88L	IL7R_ENST00000511031.1_3'UTR|IL7R_ENST00000511982.1_Silent_p.L88L|IL7R_ENST00000343305.4_Silent_p.L88L|IL7R_ENST00000506850.1_Silent_p.L88L	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	88					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TCAGGAAACTACAAGAGATAT	0.398			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					0				ovary(3)|breast(1)|skin(1)	5						c.(262-264)CTA>CTG		interleukin 7 receptor precursor							87.0	89.0	89.0					5																	35867450		2203	4300	6503	SO:0001819	synonymous_variant	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35867450A>G	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.264A>G	5.37:g.35867450A>G						IL7R_uc011coo.1_Silent_p.L88L|IL7R_uc011cop.1_RNA	p.L88L	NM_002185	NP_002176	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		3	353	+	all_lung(31;0.00015)		88			Extracellular (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Silent	SNP	ENST00000303115.3	37	c.264A>G	CCDS3911.1																																																																																				0.398	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			7	34	0	0	0	0.001984	0	7	34				
MROH2B	133558	broad.mit.edu	37	5	41004621	41004621	+	Missense_Mutation	SNP	G	G	A	rs368816862		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:41004621G>A	ENST00000399564.4	-	37	4471	c.4021C>T	c.(4021-4023)Cat>Tat	p.H1341Y	MROH2B_ENST00000506092.2_Missense_Mutation_p.H896Y	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1341																	AACTGCTTATGTTTCTTCACC	0.393																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(4021-4023)CAT>TAT		HEAT repeat family member 7B2		G	TYR/HIS	1,3693		0,1,1846	79.0	72.0	74.0		4021	3.5	1.0	5		74	0,8190		0,0,4095	no	missense	HEATR7B2	NM_173489.4	83	0,1,5941	AA,AG,GG		0.0,0.0271,0.0084	benign	1341/1586	41004621	1,11883	1847	4095	5942	SO:0001583	missense	133558						binding	g.chr5:41004621G>A		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4021C>T	5.37:g.41004621G>A	ENSP00000382476:p.His1341Tyr					HEATR7B2_uc003jmi.3_Missense_Mutation_p.H896Y	p.H1341Y	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN			37	4511	-			1341					Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.4021C>T	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	9.470	1.095265	0.20471	2.71E-4	0.0	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.63580	-0.05;-0.05	5.52	3.52	0.40303	Armadillo-like helical (1);Armadillo-type fold (1);	0.204155	0.33753	N	0.004597	T	0.32675	0.0837	N	0.11154	0.105	0.24667	N	0.993434	B	0.11235	0.004	B	0.11329	0.006	T	0.27571	-1.0070	10	0.02654	T	1	.	5.8842	0.18872	0.0995:0.0:0.671:0.2296	.	1341	Q7Z745	HTRB2_HUMAN	Y	896;1046;1341	ENSP00000441504:H896Y;ENSP00000382476:H1341Y	ENSP00000296803:H1046Y	H	-	1	0	HEATR7B2	41040378	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.085000	0.30840	1.304000	0.44892	0.643000	0.83706	CAT		0.393	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		10	22	0	0	0	0.006214	0	10	22				
OXCT1	5019	broad.mit.edu	37	5	41870434	41870434	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:41870434G>A	ENST00000196371.5	-	1	187	c.27C>T	c.(25-27)tcC>tcT	p.S9S	OXCT1-AS1_ENST00000508458.1_RNA	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	9					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	GCCGAAGCCCGGAGGAGAGGA	0.652																																							uc003jmn.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(25-27)TCC>TCT		3-oxoacid CoA transferase 1 precursor	Succinic acid(DB00139)						47.0	44.0	45.0					5																	41870434		2202	4300	6502	SO:0001819	synonymous_variant	5019				cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity	g.chr5:41870434G>A	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.27C>T	5.37:g.41870434G>A							p.S9S	NM_000436	NP_000427	P55809	SCOT1_HUMAN			1	358	-			9					B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	c.27C>T	CCDS3937.1																																																																																				0.652	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436		6	24	0	0	0	0.001984	0	6	24				
PDE8B	8622	broad.mit.edu	37	5	76649204	76649204	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:76649204G>T	ENST00000264917.5	+	10	1185	c.1140G>T	c.(1138-1140)ctG>ctT	p.L380L	PDE8B_ENST00000340978.3_Silent_p.L333L|PDE8B_ENST00000346042.3_Intron|PDE8B_ENST00000342343.4_Silent_p.L360L|PDE8B_ENST00000333194.4_Silent_p.L380L	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	380					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	TCAAGAAACTGTGTTGTACCA	0.373																																							uc003kfa.2		NA																	0					0						c.(1138-1140)CTG>CTT		phosphodiesterase 8B isoform 1							230.0	201.0	211.0					5																	76649204		2203	4300	6503	SO:0001819	synonymous_variant	8622				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity	g.chr5:76649204G>T	AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.1140G>T	5.37:g.76649204G>T						PDE8B_uc003kfb.2_Silent_p.L360L|PDE8B_uc003kfc.2_Silent_p.L380L|PDE8B_uc003kfd.2_Silent_p.L333L|PDE8B_uc003kfe.2_Intron	p.L380L	NM_003719	NP_003710	O95263	PDE8B_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	10	1185	+		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)	380					Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Silent	SNP	ENST00000264917.5	37	c.1140G>T	CCDS4037.1																																																																																				0.373	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719		18	15	1	0	1.96895e-08	0.00278	2.2999e-08	18	15				
GPR98	84059	broad.mit.edu	37	5	90106906	90106906	+	Missense_Mutation	SNP	C	C	T	rs375450242		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:90106906C>T	ENST00000405460.2	+	74	15925	c.15829C>T	c.(15829-15831)Cgt>Tgt	p.R5277C	GPR98_ENST00000425867.2_Missense_Mutation_p.R938C	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5277					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATTGCCCTTTCGTGGTATCTA	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		22625	0.001		0.0	False		,,,				2504	0.0						uc003kju.2		NA																	0				ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(15829-15831)CGT>TGT		G protein-coupled receptor 98 precursor							128.0	120.0	123.0					5																	90106906		1908	4126	6034	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:90106906C>T	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15829C>T	5.37:g.90106906C>T	ENSP00000384582:p.Arg5277Cys					GPR98_uc003kjt.2_Missense_Mutation_p.R2983C|GPR98_uc003kjw.2_Missense_Mutation_p.R938C	p.R5277C	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	74	15925	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	5277			Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.15829C>T	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	7.309	0.614619	0.14129	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.28454	1.67;1.61	5.36	4.43	0.53597	.	1.160740	0.06054	N	0.657052	T	0.32194	0.0821	L	0.29908	0.895	0.09310	N	1	D;D;D	0.56287	0.958;0.963;0.975	B;B;P	0.49502	0.409;0.17;0.613	T	0.12319	-1.0552	9	.	.	.	.	8.9444	0.35749	0.1301:0.5725:0.2974:0.0	.	938;5277;938	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	C	5277;5277;938	ENSP00000384582:R5277C;ENSP00000392618:R938C	.	R	+	1	0	GPR98	90142662	0.986000	0.35501	0.005000	0.12908	0.115000	0.19883	2.505000	0.45424	2.506000	0.84524	0.655000	0.94253	CGT		0.413	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		20	29	0	0	0	0.007413	0	20	29				
FAM170A	340069	broad.mit.edu	37	5	118969672	118969672	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:118969672C>T	ENST00000515256.1	+	3	401	c.229C>T	c.(229-231)Cga>Tga	p.R77*				A1A519	F170A_HUMAN	family with sequence similarity 170, member A	77					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	24						GAGAATACATCGAGACAGCCC	0.512																																							uc003ksm.2		NA																	0				skin(1)	1						c.(229-231)CGA>TGA		family with sequence similarity 170, member A							78.0	83.0	82.0					5																	118969672		1992	4167	6159	SO:0001587	stop_gained	340069					intracellular	zinc ion binding	g.chr5:118969672C>T	AF427126	CCDS43353.1, CCDS54889.1	5q23.1	2008-06-12			ENSG00000164334	ENSG00000164334			27963	protein-coding gene	gene with protein product						12477932	Standard	NM_182761		Approved		uc003ksn.3	A1A519	OTTHUMG00000162946	ENST00000515256.1:c.229C>T	5.37:g.118969672C>T	ENSP00000422684:p.Arg77*					FAM170A_uc003ksl.2_Nonsense_Mutation_p.R77*|FAM170A_uc003ksn.2_Nonsense_Mutation_p.R77*|FAM170A_uc003kso.2_Nonsense_Mutation_p.R30*	p.R77*	NM_182761	NP_877438	A1A519	F170A_HUMAN			3	439	+			77					Q66LM8|Q7Z4V2|Q8IW94	Nonsense_Mutation	SNP	ENST00000515256.1	37	c.229C>T		.	.	.	.	.	.	.	.	.	.	C	18.26	3.584125	0.65992	.	.	ENSG00000164334	ENST00000296787;ENST00000515256;ENST00000509264	.	.	.	4.35	0.399	0.16325	.	1.574610	0.03598	N	0.232996	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	4.1474	7.6931	0.28579	0.0:0.4088:0.4965:0.0947	.	.	.	.	X	30;77;77	.	.	R	+	1	2	FAM170A	118997571	0.004000	0.15560	0.000000	0.03702	0.007000	0.05969	0.351000	0.20096	0.057000	0.16193	0.655000	0.94253	CGA		0.512	FAM170A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371126.1	NM_182761		10	42	0	0	0	0.010729	0	10	42				
FBN2	2201	broad.mit.edu	37	5	127714528	127714528	+	Silent	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:127714528A>G	ENST00000508053.1	-	18	2633	c.1659T>C	c.(1657-1659)ccT>ccC	p.P553P	FBN2_ENST00000508989.1_Silent_p.P520P|FBN2_ENST00000262464.4_Silent_p.P553P|FBN2_ENST00000511489.1_5'Flank			P35556	FBN2_HUMAN	fibrillin 2	553	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AATAGGAACCAGGTGTGTTAA	0.398																																							uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(1657-1659)CCT>CCC		fibrillin 2 precursor							116.0	109.0	112.0					5																	127714528		2203	4300	6503	SO:0001819	synonymous_variant	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127714528A>G	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1659T>C	5.37:g.127714528A>G						FBN2_uc003kuv.2_Silent_p.P520P	p.P553P	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	12	2098	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	553			EGF-like 7; calcium-binding.		B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	c.1659T>C	CCDS34222.1																																																																																				0.398	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		32	28	0	0	0	0.010818	0	32	28				
RAD50	10111	broad.mit.edu	37	5	131973867	131973867	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:131973867G>A	ENST00000265335.6	+	23	3957	c.3570G>A	c.(3568-3570)aaG>aaA	p.K1190K	AC004041.2_ENST00000417516.1_RNA|AC004041.2_ENST00000457489.1_RNA|AC004041.2_ENST00000458509.1_RNA|AC004041.2_ENST00000435042.1_RNA|RAD50_ENST00000378823.3_Silent_p.K1051K			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1190					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGATGCTGAAGGGAGACACAG	0.453								Homologous recombination																															uc003kxi.2		NA																	0				lung(2)|ovary(1)|skin(1)	4						c.(3568-3570)AAG>AAA	Homologous_recombination	RAD50 homolog isoform 1							115.0	106.0	109.0					5																	131973867		2203	4300	6503	SO:0001819	synonymous_variant	10111				DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding	g.chr5:131973867G>A	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3570G>A	5.37:g.131973867G>A						RAD50_uc003kxh.2_Silent_p.K1051K	p.K1190K	NM_005732	NP_005723	Q92878	RAD50_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		23	3957	+		all_cancers(142;0.0368)|Breast(839;0.198)	1190					B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Silent	SNP	ENST00000265335.6	37	c.3570G>A	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569416	0.45798	.	.	ENSG00000113522	ENST00000455677	.	.	.	5.95	-1.99	0.07457	.	.	.	.	.	T	0.58466	0.2124	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57106	-0.7868	4	.	.	.	-22.4333	12.5308	0.56113	0.6475:0.0:0.3525:0.0	.	.	.	.	R	69	.	.	G	+	1	0	RAD50	132001766	1.000000	0.71417	0.976000	0.42696	0.975000	0.68041	0.792000	0.26929	-0.270000	0.09285	-0.136000	0.14681	GGG		0.453	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732		7	13	0	0	0	0.00308	0	7	13				
PCDHA4	56144	broad.mit.edu	37	5	140188961	140188961	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:140188961G>C	ENST00000530339.1	+	1	2189	c.2189G>C	c.(2188-2190)gGc>gCc	p.G730A	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.G730A|PCDHA4_ENST00000356878.4_Missense_Mutation_p.G730A|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	730					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G730D(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCACCGAGGGCGCGTGCGCT	0.662																																							uc003lhi.2		NA																	2	Substitution - Missense(2)		endometrium(2)	ovary(4)|skin(2)	6						c.(2188-2190)GGC>GCC		protocadherin alpha 4 isoform 1 precursor							56.0	52.0	54.0					5																	140188961		2203	4300	6503	SO:0001583	missense	56144				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140188961G>C	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.2189G>C	5.37:g.140188961G>C	ENSP00000435300:p.Gly730Ala					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.G730A|PCDHA4_uc011daa.1_Missense_Mutation_p.G730A	p.G730A	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2290	+			730			Cytoplasmic (Potential).		O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	c.2189G>C	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	g	2.821	-0.244718	0.05906	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.13778	2.56;2.56;2.56	3.83	3.83	0.44106	.	0.419805	0.16703	N	0.203058	T	0.18299	0.0439	L	0.61387	1.9	0.09310	N	1	B;B;B	0.24483	0.104;0.003;0.005	B;B;B	0.33254	0.16;0.005;0.005	T	0.10314	-1.0635	10	0.39692	T	0.17	.	10.8936	0.47010	0.0978:0.0:0.9022:0.0	.	730;730;730	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	A	730	ENSP00000423470:G730A;ENSP00000349344:G730A;ENSP00000435300:G730A	ENSP00000349344:G730A	G	+	2	0	PCDHA4	140169145	0.160000	0.22878	0.156000	0.22583	0.036000	0.12997	2.443000	0.44881	1.866000	0.54105	0.484000	0.47621	GGC		0.662	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		26	35	0	0	0	0.004656	0	26	35				
PCDHA9	9752	broad.mit.edu	37	5	140230279	140230279	+	Silent	SNP	G	G	A	rs373763041		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:140230279G>A	ENST00000532602.1	+	1	3232	c.2199G>A	c.(2197-2199)gcG>gcA	p.A733A	PCDHA9_ENST00000378122.3_Silent_p.A733A|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	733					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGAGTGCGCGCCTGGCAAGC	0.637																																					Melanoma(55;1800 1972 14909)	Melanoma(55;1800 1972 14909)	uc003lhu.2		NA																	0				large_intestine(2)|ovary(2)|skin(1)	5						c.(2197-2199)GCG>GCA		protocadherin alpha 9 isoform 1 precursor		G	,,,,,,,,,,,	0,4394		0,0,2197	71.0	64.0	66.0		2199,,,,,,,,,,,2199	1.7	0.0	5		66	2,8538	2.2+/-6.3	0,2,4268	no	coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding-synonymous	PCDHA9,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_014005.3,NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1	,,,,,,,,,,,	0,2,6465	AA,AG,GG		0.0234,0.0,0.0155	,,,,,,,,,,,	733/843,,,,,,,,,,,733/951	140230279	2,12932	2197	4270	6467	SO:0001819	synonymous_variant	9752				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140230279G>A	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2199G>A	5.37:g.140230279G>A						PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.A733A	p.A733A	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2923	+			733			Cytoplasmic (Potential).		O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	37	c.2199G>A	CCDS54920.1																																																																																				0.637	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857		37	35	0	0	0	0.004878	0	37	35				
PCDHB7	56129	broad.mit.edu	37	5	140554444	140554444	+	Silent	SNP	G	G	T	rs554701227		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:140554444G>T	ENST00000231137.3	+	1	2202	c.2028G>T	c.(2026-2028)gcG>gcT	p.A676A	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	676					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCCGGAGGCGGCCCCGGACC	0.692																																							uc003lit.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2026-2028)GCG>GCT		protocadherin beta 7 precursor							49.0	79.0	69.0					5																	140554444		2188	4285	6473	SO:0001819	synonymous_variant	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140554444G>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2028G>T	5.37:g.140554444G>T						PCDHB8_uc011dai.1_5'Flank	p.A676A	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2202	+			676			Extracellular (Potential).		A1L3Y8	Silent	SNP	ENST00000231137.3	37	c.2028G>T	CCDS4249.1																																																																																				0.692	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		40	99	1	0	2.00842e-17	0.010771	2.5406e-17	40	99				
PCDHB10	56126	broad.mit.edu	37	5	140568964	140568964	+	5'Flank	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:140568964G>T	ENST00000239446.4	+	0	0					NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTACCTGGTGGTGGCGTTGG	0.701																																							uc003liw.1		NA																	0					0						c.(2071-2073)GTG>GTT		protocadherin beta 9 precursor							63.0	71.0	69.0					5																	140568964		2146	4170	6316	SO:0001631	upstream_gene_variant	56127				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140568964G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626		5.37:g.140568964G>T	Exception_encountered					PCDHB10_uc003lix.2_5'Flank	p.V691V	NM_019119	NP_061992	Q9Y5E1	PCDB9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		3	2073	+			691			Helical; (Potential).		Q96T99	Silent	SNP	ENST00000239446.4	37	c.2073G>T	CCDS4252.1																																																																																				0.701	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		72	121	1	0	4.41824e-40	0.00361	5.98917e-40	72	121				
PCDHB14	56122	broad.mit.edu	37	5	140604476	140604476	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:140604476G>A	ENST00000239449.4	+	1	1399	c.1399G>A	c.(1399-1401)Gcc>Acc	p.A467T	PCDHB14_ENST00000515856.2_Missense_Mutation_p.A314T	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	467	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAACAGCCCCGCCCTGCACAT	0.627																																					Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	0				ovary(1)	1						c.(1399-1401)GCC>ACC		protocadherin beta 14 precursor							107.0	114.0	111.0					5																	140604476		2203	4295	6498	SO:0001583	missense	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140604476G>A	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1399G>A	5.37:g.140604476G>A	ENSP00000239449:p.Ala467Thr					PCDHB14_uc011dal.1_Missense_Mutation_p.A314T	p.A467T	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1399	+			467			Extracellular (Potential).|Cadherin 5.		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	c.1399G>A	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	19.29	3.799767	0.70567	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.60548	0.18;0.18	4.5	4.5	0.54988	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.65831	0.2729	L	0.49640	1.575	0.27576	N	0.949736	D	0.71674	0.998	P	0.53593	0.73	T	0.63033	-0.6727	9	0.87932	D	0	.	17.2613	0.87070	0.0:0.0:1.0:0.0	.	467	Q9Y5E9	PCDBE_HUMAN	T	314;467	ENSP00000444518:A314T;ENSP00000239449:A467T	ENSP00000239449:A467T	A	+	1	0	PCDHB14	140584660	0.925000	0.31364	1.000000	0.80357	0.987000	0.75469	4.349000	0.59385	2.235000	0.73313	0.556000	0.70494	GCC		0.627	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		93	126	0	0	0	0.00361	0	93	126				
PCDHGA8	9708	broad.mit.edu	37	5	140773984	140773985	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:140773984_140773985GC>TT	ENST00000398604.2	+	1	1604_1605	c.1604_1605GC>TT	c.(1603-1605)aGC>aTT	p.S535I	PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	535	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAACAGCCAGCGACAGCGGGG	0.584																																							uc003lkd.1		NA																	0					0						c.(1603-1605)AGC>ATT		protocadherin gamma subfamily A, 8 isoform 1																																				SO:0001583	missense	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140773984_140773985GC>TT	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	Exception_encountered	5.37:g.140773984_140773985delinsTT	ENSP00000381605:p.Ser535Ile					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.S535I	p.S535I	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2502_2503	+			535			Extracellular (Potential).|Cadherin 5.		A7MCZ4|O15039	Missense_Mutation	DNP	ENST00000398604.2	37	c.1604_1605GC>TT	CCDS47291.1																																																																																				0.584	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		21	91	0	0	0	0.004672	0	21	91				
JAKMIP2	9832	broad.mit.edu	37	5	146997527	146997527	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:146997527A>T	ENST00000265272.5	-	19	2760	c.2293T>A	c.(2293-2295)Tat>Aat	p.Y765N	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.Y744N|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.Y723N	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	765						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACAGTCATACTCTCTGCTC	0.463																																							uc003loq.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(2293-2295)TAT>AAT		janus kinase and microtubule interacting protein							164.0	136.0	146.0					5																	146997527		2203	4300	6503	SO:0001583	missense	9832					Golgi apparatus		g.chr5:146997527A>T	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2293T>A	5.37:g.146997527A>T	ENSP00000265272:p.Tyr765Asn					JAKMIP2_uc011dbx.1_Missense_Mutation_p.Y723N|JAKMIP2_uc003lor.1_Missense_Mutation_p.Y744N|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.Y765N	p.Y765N	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		19	2675	-			765			Potential.		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	c.2293T>A	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731063	0.69074	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.24723	1.85;1.84;1.84	5.61	5.61	0.85477	.	0.068070	0.64402	D	0.000010	T	0.21881	0.0527	L	0.40543	1.245	0.51482	D	0.999921	P;P;P;P	0.43701	0.815;0.815;0.815;0.815	B;B;B;B	0.39258	0.295;0.295;0.295;0.221	T	0.02115	-1.1211	10	0.54805	T	0.06	.	11.2267	0.48888	0.8633:0.0:0.0:0.1367	.	723;765;744;765	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	N	744;765;723;744	ENSP00000421398:Y744N;ENSP00000265272:Y765N;ENSP00000328989:Y723N	ENSP00000265272:Y765N	Y	-	1	0	JAKMIP2	146977720	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.957000	0.93082	2.261000	0.74972	0.460000	0.39030	TAT		0.463	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		14	39	0	0	0	0.001855	0	14	39				
CPEB4	80315	broad.mit.edu	37	5	173359497	173359497	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:173359497A>G	ENST00000265085.5	+	3	2706	c.1252A>G	c.(1252-1254)Att>Gtt	p.I418V	CPEB4_ENST00000519467.1_Intron|CPEB4_ENST00000522336.1_Missense_Mutation_p.I36V|CPEB4_ENST00000517880.1_Intron|CPEB4_ENST00000519835.1_Intron|CPEB4_ENST00000520867.1_Intron|CPEB4_ENST00000334035.5_Intron	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	418					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CTCTCTGCTTATTAATGGTAA	0.358																																							uc003mcs.3		NA																	0					0						c.(1252-1254)ATT>GTT		cytoplasmic polyadenylation element binding							120.0	113.0	116.0					5																	173359497		2203	4300	6503	SO:0001583	missense	80315						nucleotide binding|RNA binding	g.chr5:173359497A>G	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1252A>G	5.37:g.173359497A>G	ENSP00000265085:p.Ile418Val					CPEB4_uc010jju.1_Intron|CPEB4_uc010jjv.2_Intron|CPEB4_uc011dfg.1_Intron|CPEB4_uc003mct.3_Missense_Mutation_p.I36V|CPEB4_uc003mcu.3_Intron	p.I418V	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		3	2658	+	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	418					B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	37	c.1252A>G	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	A	12.20	1.865934	0.32977	.	.	ENSG00000113742	ENST00000265085;ENST00000522336	T	0.41758	0.99	5.61	3.23	0.37069	.	0.264180	0.37483	N	0.002068	T	0.26448	0.0646	N	0.22421	0.69	0.80722	D	1	B;B	0.16166	0.0;0.016	B;B	0.14578	0.001;0.011	T	0.04840	-1.0923	10	0.48119	T	0.1	-5.8448	7.1776	0.25753	0.8232:0.0:0.1768:0.0	.	36;418	E5RFP2;Q17RY0	.;CPEB4_HUMAN	V	418;36	ENSP00000265085:I418V	ENSP00000265085:I418V	I	+	1	0	CPEB4	173292103	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.948000	0.40303	0.415000	0.25817	-0.376000	0.06991	ATT		0.358	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627		21	16	0	0	0	0.00333	0	21	16				
MGAT4B	11282	broad.mit.edu	37	5	179225515	179225515	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:179225515C>T	ENST00000292591.7	-	12	1770	c.1420G>A	c.(1420-1422)Gac>Aac	p.D474N	MGAT4B_ENST00000521305.1_5'Flank|MGAT4B_ENST00000337755.5_Missense_Mutation_p.D489N|MIR1229_ENST00000408467.1_RNA	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	474					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAACTTACGTCGAAGGGCAGC	0.607																																					GBM(13;414 434 4098 22176 23230)	GBM(13;414 434 4098 22176 23230)	uc003mks.2		NA																	0					0						c.(1420-1422)GAC>AAC		alpha-1,3-mannosyl-glycoprotein							104.0	84.0	90.0					5																	179225515		2203	4300	6503	SO:0001583	missense	11282				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr5:179225515C>T	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1420G>A	5.37:g.179225515C>T	ENSP00000292591:p.Asp474Asn					MGAT4B_uc003mkp.2_Missense_Mutation_p.D328N|MGAT4B_uc003mkq.2_Missense_Mutation_p.R249Q|MGAT4B_uc003mkr.2_Missense_Mutation_p.D489N|MIR1229_hsa-mir-1229|MI0006319_5'Flank	p.D474N	NM_014275	NP_055090	Q9UQ53	MGT4B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		12	1789	-	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	474			Lumenal (Potential).		A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	ENST00000292591.7	37	c.1420G>A	CCDS4448.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.98|12.98	2.099856|2.099856	0.37048|0.37048	.|.	.|.	ENSG00000161013|ENSG00000161013	ENST00000337755;ENST00000292591;ENST00000519836|ENST00000518778;ENST00000520875	T;T|.	0.30714|.	1.52;1.54|.	3.96|3.96	3.96|3.96	0.45880|0.45880	.|.	0.169294|.	0.49916|.	N|.	0.000128|.	T|T	0.53514|0.53514	0.1801|0.1801	N|N	0.26042|0.26042	0.785|0.785	0.80722|0.80722	D|D	1|1	D;D;D|.	0.65815|.	0.995;0.995;0.987|.	P;P;P|.	0.54815|.	0.679;0.761;0.652|.	T|T	0.51172|0.51172	-0.8739|-0.8739	10|5	0.35671|.	T|.	0.21|.	-14.549|-14.549	16.227|16.227	0.82300|0.82300	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	474;489;473|.	Q9UQ53;A8MPR0;Q9UQ53-2|.	MGT4B_HUMAN;.;.|.	N|Q	489;474;342|298;254	ENSP00000338487:D489N;ENSP00000292591:D474N|.	ENSP00000292591:D474N|.	D|R	-|-	1|2	0|0	MGAT4B|MGAT4B	179158121|179158121	0.999000|0.999000	0.42202|0.42202	0.899000|0.899000	0.35326|0.35326	0.431000|0.431000	0.31685|0.31685	4.219000|4.219000	0.58561|0.58561	2.048000|2.048000	0.60808|0.60808	0.462000|0.462000	0.41574|0.41574	GAC|CGA		0.607	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275		6	26	0	0	0	0.001984	0	6	26				
HUS1B	135458	broad.mit.edu	37	6	656914	656914	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:656914C>T	ENST00000380907.2	-	1	49	c.31G>A	c.(31-33)Ggc>Agc	p.G11S	EXOC2_ENST00000448181.3_Intron|EXOC2_ENST00000230449.4_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	11					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)				endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		TCTAGACAGCCTTTGCCGGTG	0.652																																							uc003mtg.2		NA																	0					0						c.(31-33)GGC>AGC		HUS1 checkpoint protein B							65.0	62.0	63.0					6																	656914		2201	4289	6490	SO:0001583	missense	135458							g.chr6:656914C>T	AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.31G>A	6.37:g.656914C>T	ENSP00000370293:p.Gly11Ser					EXOC2_uc003mtd.2_Intron|EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	p.G11S	NM_148959	NP_683762	Q8NHY5	HUS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)	1	51	-	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)	11					Q5T4Z2	Missense_Mutation	SNP	ENST00000380907.2	37	c.31G>A	CCDS4470.1	.	.	.	.	.	.	.	.	.	.	C	2.200	-0.383288	0.04966	.	.	ENSG00000188996	ENST00000380907	T	0.11169	2.8	2.8	1.88	0.25563	.	0.457149	0.17494	U	0.172254	T	0.02380	0.0073	L	0.31578	0.945	0.09310	N	1	B	0.22800	0.075	B	0.29176	0.099	T	0.46289	-0.9202	10	0.21540	T	0.41	.	7.4119	0.27021	0.0:0.7097:0.2903:0.0	.	11	Q8NHY5	HUS1B_HUMAN	S	11	ENSP00000370293:G11S	ENSP00000370293:G11S	G	-	1	0	HUS1B	601914	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.824000	0.27379	0.697000	0.31718	0.491000	0.48974	GGC		0.652	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205617.2	NM_148959		14	39	0	0	0	0.003163	0	14	39				
RREB1	6239	broad.mit.edu	37	6	7229349	7229349	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:7229349G>A	ENST00000349384.6	+	10	1331	c.1017G>A	c.(1015-1017)gtG>gtA	p.V339V	RREB1_ENST00000334984.6_Silent_p.V339V|RREB1_ENST00000379938.2_Silent_p.V339V|RREB1_ENST00000379933.3_Silent_p.V339V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	339					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AGACCCATGTGGCGGCAGACC	0.627																																							uc003mxc.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11						c.(1015-1017)GTG>GTA		ras responsive element binding protein 1 isoform							40.0	37.0	38.0					6																	7229349		2203	4300	6503	SO:0001819	synonymous_variant	6239				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding	g.chr6:7229349G>A	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.1017G>A	6.37:g.7229349G>A						RREB1_uc003mxb.2_Silent_p.V339V|RREB1_uc010jnx.2_Silent_p.V339V	p.V339V	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN			10	1407	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	339					A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Silent	SNP	ENST00000349384.6	37	c.1017G>A	CCDS34336.1																																																																																				0.627	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			6	29	0	0	0	0.001984	0	6	29				
DSP	1832	broad.mit.edu	37	6	7580467	7580467	+	Silent	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:7580467G>C	ENST00000379802.3	+	23	4385	c.4044G>C	c.(4042-4044)ctG>ctC	p.L1348L	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1348	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAAATGAACTGAGTAAGGTAA	0.443																																							uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(4042-4044)CTG>CTC		desmoplakin isoform I							83.0	87.0	85.0					6																	7580467		2203	4300	6503	SO:0001819	synonymous_variant	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7580467G>C	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.4044G>C	6.37:g.7580467G>C						DSP_uc003mxq.1_Intron	p.L1348L	NM_004415	NP_004406	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	23	4323	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	1348			Central fibrous rod domain.|Potential.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	c.4044G>C	CCDS4501.1																																																																																				0.443	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		6	39	0	0	0	0.001168	0	6	39				
DSP	1832	broad.mit.edu	37	6	7581116	7581116	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:7581116G>C	ENST00000379802.3	+	23	5034	c.4693G>C	c.(4693-4695)Gag>Cag	p.E1565Q	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1565	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CTCTCTGAAAGAGCTGCAGCT	0.542																																							uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(4693-4695)GAG>CAG		desmoplakin isoform I							62.0	67.0	65.0					6																	7581116		2203	4300	6503	SO:0001583	missense	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7581116G>C	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.4693G>C	6.37:g.7581116G>C	ENSP00000369129:p.Glu1565Gln					DSP_uc003mxq.1_Intron	p.E1565Q	NM_004415	NP_004406	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	23	4972	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	1565			Central fibrous rod domain.|Potential.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	c.4693G>C	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894104	0.52121	.	.	ENSG00000096696	ENST00000379802	T	0.80033	-1.33	5.58	5.58	0.84498	.	0.375135	0.25375	N	0.031124	T	0.65133	0.2662	L	0.27053	0.805	0.80722	D	1	P	0.41366	0.747	B	0.38842	0.283	T	0.69781	-0.5052	10	0.44086	T	0.13	.	19.5753	0.95439	0.0:0.0:1.0:0.0	.	1565	P15924	DESP_HUMAN	Q	1565	ENSP00000369129:E1565Q	ENSP00000369129:E1565Q	E	+	1	0	DSP	7526115	1.000000	0.71417	0.831000	0.32960	0.864000	0.49448	6.746000	0.74866	2.623000	0.88846	0.655000	0.94253	GAG		0.542	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		16	44	0	0	0	0.004007	0	16	44				
JARID2	3720	broad.mit.edu	37	6	15496899	15496899	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:15496899G>A	ENST00000341776.2	+	7	1687	c.1443G>A	c.(1441-1443)ctG>ctA	p.L481L	JARID2_ENST00000397311.3_Silent_p.L309L|JARID2_ENST00000541660.1_Silent_p.L443L	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	481					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GAGGTCTGCTGAACGGACACG	0.672																																							uc003nbj.2		NA																	0				ovary(2)|lung(1)|pancreas(1)	4						c.(1441-1443)CTG>CTA		jumonji, AT rich interactive domain 2 protein							25.0	29.0	28.0					6																	15496899		2202	4299	6501	SO:0001819	synonymous_variant	3720				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding	g.chr6:15496899G>A	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1443G>A	6.37:g.15496899G>A						JARID2_uc011diu.1_Silent_p.L345L|JARID2_uc011div.1_Silent_p.L309L|JARID2_uc011diw.1_Silent_p.L443L	p.L481L	NM_004973	NP_004964	Q92833	JARD2_HUMAN			7	1687	+	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)	481					A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Silent	SNP	ENST00000341776.2	37	c.1443G>A	CCDS4533.1																																																																																				0.672	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973		6	25	0	0	0	0.001984	0	6	25				
HIST1H1D	3007	broad.mit.edu	37	6	26234874	26234874	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:26234874C>G	ENST00000244534.5	-	1	342	c.288G>C	c.(286-288)caG>caC	p.Q96H		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	96	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				TACCTTTGGTCTGCACCAGAG	0.527																																							uc003nhd.2		NA																	0				skin(1)	1						c.(286-288)CAG>CAC		histone cluster 1, H1d							98.0	104.0	102.0					6																	26234874		2203	4300	6503	SO:0001583	missense	3007				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:26234874C>G	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.288G>C	6.37:g.26234874C>G	ENSP00000244534:p.Gln96His						p.Q96H	NM_005320	NP_005311	P16402	H13_HUMAN			1	343	-		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)	96			H15.		B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	c.288G>C	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	14.44	2.535316	0.45176	.	.	ENSG00000124575	ENST00000244534	T	0.11604	2.76	5.23	5.23	0.72850	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.058253	0.64402	D	0.000001	T	0.28466	0.0704	M	0.89214	3.015	0.58432	D	0.999996	D	0.61080	0.989	D	0.70716	0.97	T	0.05716	-1.0868	10	0.87932	D	0	-43.6494	11.6271	0.51151	0.0:0.9184:0.0:0.0816	.	96	P16402	H13_HUMAN	H	96	ENSP00000244534:Q96H	ENSP00000244534:Q96H	Q	-	3	2	HIST1H1D	26342853	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	2.155000	0.42301	2.623000	0.88846	0.655000	0.94253	CAG		0.527	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320		21	109	0	0	0	0.012319	0	21	109				
BTN3A3	10384	broad.mit.edu	37	6	26452130	26452130	+	Missense_Mutation	SNP	G	G	A	rs531717427		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:26452130G>A	ENST00000244519.2	+	11	1489	c.1246G>A	c.(1246-1248)Gtg>Atg	p.V416M	BTN3A3_ENST00000339789.4_Missense_Mutation_p.V374M|BTN3A3_ENST00000361232.3_Missense_Mutation_p.V367M	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	416	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						TAGTAAGAACGTGGAGAGGAA	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		20141	0.0		0.0	False		,,,				2504	0.001						uc003nhz.2		NA																	0					0						c.(1246-1248)GTG>ATG		butyrophilin, subfamily 3, member A3 isoform a							108.0	101.0	103.0					6																	26452130		2203	4300	6503	SO:0001583	missense	10384					integral to membrane		g.chr6:26452130G>A	U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1246G>A	6.37:g.26452130G>A	ENSP00000244519:p.Val416Met					BTN3A3_uc003nia.2_Missense_Mutation_p.V374M|BTN3A3_uc011dkn.1_Missense_Mutation_p.V367M	p.V416M	NM_006994	NP_008925	O00478	BT3A3_HUMAN			11	1426	+			416			B30.2/SPRY.|Cytoplasmic (Potential).		B4DWI7|E9PCP5	Missense_Mutation	SNP	ENST00000244519.2	37	c.1246G>A	CCDS4611.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402820	0.42613	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232;ENST00000490254	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	3.15	-0.454	0.12197	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.55545	0.1927	M	0.65975	2.015	0.09310	N	1	D;D	0.89917	0.997;1.0	P;D	0.81914	0.889;0.995	T	0.45234	-0.9275	9	0.66056	D	0.02	.	0.8362	0.01140	0.248:0.1806:0.3881:0.1833	.	367;416	E9PCP5;O00478	.;BT3A3_HUMAN	M	416;374;367;206	ENSP00000244519:V416M;ENSP00000344968:V374M;ENSP00000355238:V367M;ENSP00000419736:V206M	ENSP00000244519:V416M	V	+	1	0	BTN3A3	26560109	0.000000	0.05858	0.000000	0.03702	0.139000	0.21198	0.050000	0.14120	-0.248000	0.09583	0.455000	0.32223	GTG		0.498	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040116.2	NM_006994		8	48	0	0	0	0.00308	0	8	48				
HIST1H2AL	8332	broad.mit.edu	37	6	27833191	27833191	+	Missense_Mutation	SNP	C	C	G	rs184589037		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:27833191C>G	ENST00000357320.2	+	1	158	c.59C>G	c.(58-60)tCt>tGt	p.S20C		NM_003511.2	NP_003502.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	20						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(2)	9						ACCCGCTCTTCTCGTGCCGGT	0.647																																							uc003njw.2		NA																	0					0						c.(58-60)TCT>TGT		histone cluster 1, H2al							75.0	85.0	81.0					6																	27833191		2203	4300	6503	SO:0001583	missense	8332				nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding	g.chr6:27833191C>G	X83549	CCDS4634.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198374	ENSG00000276903		"""Histones / Replication-dependent"""	4730	protein-coding gene	gene with protein product		602793	"""H2A histone family, member I"", ""histone 1, H2al"""	H2AFI		9439656, 9031620, 12408966	Standard	NM_003511		Approved	H2A/i, dJ193B12.9	uc003njw.3	P0C0S8	OTTHUMG00000014492	ENST00000357320.2:c.59C>G	6.37:g.27833191C>G	ENSP00000349873:p.Ser20Cys						p.S20C	NM_003511	NP_003502	P0C0S8	H2A1_HUMAN			1	85	+			20					P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000357320.2	37	c.59C>G	CCDS4634.1	.	.	.	.	.	.	.	.	.	.	.	9.207	1.029933	0.19512	.	.	ENSG00000198374	ENST00000357320	T	0.48522	0.81	4.89	4.01	0.46588	.	0.000000	0.29638	U	0.011590	T	0.49167	0.1541	.	.	.	0.36155	D	0.847723	.	.	.	.	.	.	T	0.58346	-0.7652	7	0.87932	D	0	.	12.4913	0.55901	0.0:0.9187:0.0:0.0813	.	.	.	.	C	20	ENSP00000349873:S20C	ENSP00000349873:S20C	S	+	2	0	HIST1H2AL	27941170	1.000000	0.71417	0.024000	0.17045	0.035000	0.12851	4.606000	0.61126	1.195000	0.43115	0.655000	0.94253	TCT		0.647	HIST1H2AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040160.1	NM_003511		27	82	0	0	0	0.007291	0	27	82				
PRRC2A	7916	broad.mit.edu	37	6	31597526	31597526	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:31597526G>A	ENST00000376033.2	+	14	2392	c.2158G>A	c.(2158-2160)Gat>Aat	p.D720N	PRRC2A_ENST00000376007.4_Missense_Mutation_p.D720N	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	720	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AATGAACTTTGATCCCCGATG	0.647																																							uc003nvb.3		NA																	0					0						c.(2158-2160)GAT>AAT		HLA-B associated transcript-2							30.0	31.0	30.0					6																	31597526		2136	4141	6277	SO:0001583	missense	7916					cytoplasm|nucleus	protein binding	g.chr6:31597526G>A	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.2158G>A	6.37:g.31597526G>A	ENSP00000365201:p.Asp720Asn					BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.D720N	p.D720N	NM_080686	NP_542417	P48634	PRC2A_HUMAN			14	2407	+			720			4 X 57 AA type A repeats.		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	c.2158G>A	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637144	0.67130	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.15487	2.42;2.42	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000015	T	0.35508	0.0934	M	0.66297	2.02	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.03306	-1.1050	10	0.87932	D	0	-15.1033	18.5093	0.90910	0.0:0.0:1.0:0.0	.	720	P48634	PRC2A_HUMAN	N	720;709;720;720	ENSP00000365175:D720N;ENSP00000365201:D720N	ENSP00000365175:D720N	D	+	1	0	PRRC2A	31705505	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.257000	0.95545	2.906000	0.99361	0.655000	0.94253	GAT		0.647	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686		18	35	0	0	0	0.008871	0	18	35				
VWA7	80737	broad.mit.edu	37	6	31737788	31737788	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:31737788G>C	ENST00000375688.4	-	8	1390	c.1190C>G	c.(1189-1191)tCa>tGa	p.S397*	VWA7_ENST00000447450.1_Nonsense_Mutation_p.S397*|VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Nonsense_Mutation_p.S397*			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	397	VWFA.					extracellular region (GO:0005576)											CTGCAGGGCTGACAGGCACAT	0.612																																							uc011dog.1		NA																	0				ovary(3)	3						c.(1189-1191)TCA>TGA		G7c protein precursor							100.0	69.0	80.0					6																	31737788		1511	2709	4220	SO:0001587	stop_gained	80737					extracellular region		g.chr6:31737788G>C		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1190C>G	6.37:g.31737788G>C	ENSP00000364840:p.Ser397*					C6orf27_uc003nxd.2_Nonsense_Mutation_p.S72*|C6orf27_uc011doh.1_RNA	p.S397*	NM_025258	NP_079534	Q9Y334	G7C_HUMAN			8	1428	-			397					A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Nonsense_Mutation	SNP	ENST00000375688.4	37	c.1190C>G	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	G	39	7.558690	0.98358	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-8.9208	15.4821	0.75537	0.0:0.0:1.0:0.0	.	.	.	.	X	397	.	ENSP00000364838:S397X	S	-	2	0	C6orf27	31845767	1.000000	0.71417	0.999000	0.59377	0.501000	0.33797	7.587000	0.82613	2.737000	0.93849	0.561000	0.74099	TCA		0.612	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258		3	32	0	0	0	0.004672	0	3	32				
NOTCH4	4855	broad.mit.edu	37	6	32163228	32163228	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:32163228C>T	ENST00000375023.3	-	30	6136	c.5998G>A	c.(5998-6000)Gag>Aag	p.E2000K	GPSM3_ENST00000487761.1_5'Flank|GPSM3_ENST00000375043.3_5'UTR|GPSM3_ENST00000375040.3_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	2000					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TTTTTACCCTCTCCTCCTTGG	0.507																																							uc003obb.2		NA																	0				lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						c.(5998-6000)GAG>AAG		notch4 preproprotein							78.0	100.0	92.0					6																	32163228		1508	2707	4215	SO:0001583	missense	4855				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity	g.chr6:32163228C>T		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.5998G>A	6.37:g.32163228C>T	ENSP00000364163:p.Glu2000Lys					GPSM3_uc003oax.3_5'Flank|GPSM3_uc003oay.3_5'Flank|GPSM3_uc003oaz.2_5'UTR|NOTCH4_uc011dpt.1_3'UTR|NOTCH4_uc003oba.2_Missense_Mutation_p.E660K|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	p.E2000K	NM_004557	NP_004548	Q99466	NOTC4_HUMAN			30	6137	-			2000			Cytoplasmic (Potential).		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	c.5998G>A	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332507	0.41297	.	.	ENSG00000204301	ENST00000375023	T	0.81247	-1.47	5.03	3.23	0.37069	.	0.912911	0.09046	N	0.856499	T	0.48677	0.1513	N	0.19112	0.55	0.22918	N	0.998562	B;B	0.18461	0.005;0.028	B;B	0.11329	0.002;0.006	T	0.47235	-0.9133	10	0.51188	T	0.08	.	7.1743	0.25736	0.0:0.795:0.0:0.205	.	2000;1999	Q99466;B0S882	NOTC4_HUMAN;.	K	2000	ENSP00000364163:E2000K	ENSP00000364163:E2000K	E	-	1	0	NOTCH4	32271206	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.842000	0.27627	0.807000	0.34208	-0.140000	0.14226	GAG		0.507	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			11	54	0	0	0	0.008291	0	11	54				
C6orf10	10665	broad.mit.edu	37	6	32260881	32260881	+	Silent	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:32260881A>T	ENST00000447241.2	-	23	1741	c.1569T>A	c.(1567-1569)ggT>ggA	p.G523G	C6orf10_ENST00000527965.1_Silent_p.G507G|C6orf10_ENST00000533191.1_Silent_p.G521G|C6orf10_ENST00000442822.2_Intron|C6orf10_ENST00000375007.4_Silent_p.G521G|C6orf10_ENST00000375015.4_Silent_p.G522G	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	523	Lys-rich.					integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						ttcctttgtcaccttttgtgt	0.353																																							uc011dpy.1		NA																	0				skin(1)	1						c.(1567-1569)GGT>GGA		chromosome 6 open reading frame 10							90.0	95.0	93.0					6																	32260881		1511	2709	4220	SO:0001819	synonymous_variant	10665					integral to membrane		g.chr6:32260881A>T	U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.1569T>A	6.37:g.32260881A>T						C6orf10_uc011dpx.1_Intron	p.G523G	NM_006781	NP_006772	Q5SRN2	CF010_HUMAN			12	1742	-			523			Lys-rich.		A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	Silent	SNP	ENST00000447241.2	37	c.1569T>A	CCDS34422.1																																																																																				0.353	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076178.4	NM_006781		17	37	0	0	0	0.004007	0	17	37				
TAP2	6891	broad.mit.edu	37	6	32802973	32802973	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:32802973G>A	ENST00000452392.2	-	5	1076	c.903C>T	c.(901-903)ccC>ccT	p.P301P	TAP2_ENST00000485701.1_5'Flank|TAP2_ENST00000374897.2_Silent_p.P301P|TAP2_ENST00000374899.4_Silent_p.P301P			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)									Vitamin E(DB00163)	CTATTGTGAAGGGCATGTGCA	0.542																																							uc003occ.2		NA																	0					0						c.(901-903)CCC>CCT		transporter 2, ATP-binding cassette, sub-family							97.0	72.0	81.0					6																	32802973		1511	2709	4220	SO:0001819	synonymous_variant	6891				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding	g.chr6:32802973G>A	M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.903C>T	6.37:g.32802973G>A						TAP2_uc011dqf.1_Silent_p.P301P|TAP2_uc003ocb.1_Silent_p.P301P|TAP2_uc003ocd.2_Silent_p.P301P	p.P301P	NM_018833	NP_061313	Q03519	TAP2_HUMAN			4	934	-			301			Involved in peptide-binding site.|Helical; Name=7; (Potential).|ABC transmembrane type-1.		E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000452392.2	37	c.903C>T																																																																																					0.542	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000361828.1	NM_000544		10	41	0	0	0	0.006214	0	10	41				
ANKS1A	23294	broad.mit.edu	37	6	35053622	35053622	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:35053622C>T	ENST00000360359.3	+	22	3350	c.3212C>T	c.(3211-3213)tCc>tTc	p.S1071F	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	1071	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GCCCAGAAGTCCAGGGCGACG	0.592																																							uc003ojx.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(3211-3213)TCC>TTC		ankyrin repeat and sterile alpha motif domain							53.0	52.0	52.0					6																	35053622		2203	4300	6503	SO:0001583	missense	23294					cytoplasm	protein binding	g.chr6:35053622C>T	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.3212C>T	6.37:g.35053622C>T	ENSP00000353518:p.Ser1071Phe					ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Missense_Mutation_p.S612F|ANKS1A_uc010jvp.1_Missense_Mutation_p.S445F	p.S1071F	NM_015245	NP_056060	Q92625	ANS1A_HUMAN			22	3354	+			1071			PID.		A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	c.3212C>T	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250930	0.80135	.	.	ENSG00000064999	ENST00000360359;ENST00000373990	T	0.39229	1.09	5.7	4.83	0.62350	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.302554	0.23197	N	0.050839	T	0.37705	0.1013	L	0.47716	1.5	0.80722	D	1	P;P;P	0.44877	0.845;0.845;0.814	P;P;B	0.49708	0.62;0.62;0.406	T	0.37572	-0.9700	10	0.87932	D	0	-6.6429	16.0182	0.80460	0.1355:0.8645:0.0:0.0	.	397;397;1071	Q49AR9;E7EM84;Q92625	.;.;ANS1A_HUMAN	F	1071;397	ENSP00000353518:S1071F	ENSP00000353518:S1071F	S	+	2	0	ANKS1A	35161600	1.000000	0.71417	0.987000	0.45799	0.839000	0.47603	4.894000	0.63206	1.386000	0.46466	0.655000	0.94253	TCC		0.592	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478		6	37	0	0	0	0.001168	0	6	37				
RSPH9	221421	broad.mit.edu	37	6	43638551	43638551	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:43638551G>A	ENST00000372163.4	+	5	749	c.696G>A	c.(694-696)agG>agA	p.R232R	RSPH9_ENST00000372165.4_Missense_Mutation_p.G250R	NM_152732.4	NP_689945.2	Q9H1X1	RSPH9_HUMAN	radial spoke head 9 homolog (Chlamydomonas)	232					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)				NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						AGATGGAGAGGGGCAATGCCC	0.632									Kartagener syndrome																														uc003ovw.1		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(694-696)AGG>AGA		radial spoke head 9 homolog							87.0	72.0	77.0					6																	43638551		2203	4300	6503	SO:0001819	synonymous_variant	221421	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton		g.chr6:43638551G>A	AK055407	CCDS4905.1, CCDS55005.1	6p21.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000172426	ENSG00000172426			21057	protein-coding gene	gene with protein product		612648	"""mitochondrial ribosomal protein S18A-like 1"", ""chromosome 6 open reading frame 206"""	MRPS18AL1, C6orf206		19200523	Standard	NM_152732		Approved	FLJ30845, CILD12	uc003ovx.2	Q9H1X1	OTTHUMG00000014746	ENST00000372163.4:c.696G>A	6.37:g.43638551G>A						RSPH9_uc003ovx.1_Missense_Mutation_p.G250R	p.R232R	NM_152732	NP_689945	Q9H1X1	RSPH9_HUMAN			5	722	+			232					A8K5T4|Q96NH9	Silent	SNP	ENST00000372163.4	37	c.696G>A	CCDS4905.1	.	.	.	.	.	.	.	.	.	.	G	7.598	0.672162	0.14776	.	.	ENSG00000172426	ENST00000372165	.	.	.	5.97	-4.08	0.03963	.	0.681915	0.13405	N	0.390347	T	0.22244	0.0536	.	.	.	0.80722	D	1	B	0.21309	0.054	B	0.19666	0.026	T	0.18178	-1.0345	7	.	.	.	-0.757	13.6696	0.62416	0.6121:0.0:0.3879:0.0	.	250	Q96NH9	.	R	250	.	.	G	+	1	0	RSPH9	43746529	0.000000	0.05858	0.896000	0.35187	0.946000	0.59487	-1.582000	0.02117	-0.638000	0.05509	-0.345000	0.07892	GGG		0.632	RSPH9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040690.1	NM_152732		5	69	0	0	0	0.000602	0	5	69				
GCM1	8521	broad.mit.edu	37	6	52993489	52993489	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:52993489T>C	ENST00000259803.7	-	6	1037	c.826A>G	c.(826-828)Agt>Ggt	p.S276G	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	276					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					AGGTCTCCACTACTGTAGGTT	0.498																																							uc003pbp.2		NA																	0				central_nervous_system(1)	1						c.(826-828)AGT>GGT		glial cells missing homolog a							90.0	89.0	89.0					6																	52993489		2203	4300	6503	SO:0001583	missense	8521					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr6:52993489T>C	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.826A>G	6.37:g.52993489T>C	ENSP00000259803:p.Ser276Gly						p.S276G	NM_003643	NP_003634	Q9NP62	GCM1_HUMAN			6	1035	-	Lung NSC(77;0.0755)		276					Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	ENST00000259803.7	37	c.826A>G	CCDS4950.1	.	.	.	.	.	.	.	.	.	.	T	8.815	0.936158	0.18206	.	.	ENSG00000137270	ENST00000259803	T	0.74737	-0.87	5.47	0.397	0.16314	.	0.849896	0.10706	N	0.643460	T	0.33177	0.0854	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.15549	-1.0433	10	0.19590	T	0.45	-6.8764	4.2211	0.10558	0.1507:0.333:0.0:0.5163	.	276	Q9NP62	GCM1_HUMAN	G	276	ENSP00000259803:S276G	ENSP00000259803:S276G	S	-	1	0	GCM1	53101448	0.000000	0.05858	0.000000	0.03702	0.639000	0.38242	0.159000	0.16442	0.060000	0.16281	0.383000	0.25322	AGT		0.498	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1			11	38	0	0	0	0.001855	0	11	38				
FAM83B	222584	broad.mit.edu	37	6	54806260	54806260	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:54806260A>G	ENST00000306858.7	+	5	2607	c.2491A>G	c.(2491-2493)Aag>Gag	p.K831E	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	831										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TCCTAGAAGAAAGCATTCTTC	0.378																																							uc003pck.2		NA																	0				ovary(6)	6						c.(2491-2493)AAG>GAG		hypothetical protein LOC222584							46.0	44.0	45.0					6																	54806260		2203	4300	6503	SO:0001583	missense	222584							g.chr6:54806260A>G	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2491A>G	6.37:g.54806260A>G	ENSP00000304078:p.Lys831Glu						p.K831E	NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN			5	2607	+	Lung NSC(77;0.0178)|Renal(3;0.122)		831					Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	c.2491A>G	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	A	8.422	0.846613	0.16963	.	.	ENSG00000168143	ENST00000306858	T	0.08807	3.05	5.56	5.56	0.83823	.	0.211472	0.41605	N	0.000853	T	0.04092	0.0114	L	0.55103	1.725	0.36457	D	0.866425	B	0.32071	0.355	B	0.28638	0.092	T	0.20773	-1.0265	10	0.46703	T	0.11	-27.3801	10.122	0.42627	0.9253:0.0:0.0747:0.0	.	831	Q5T0W9	FA83B_HUMAN	E	831	ENSP00000304078:K831E	ENSP00000304078:K831E	K	+	1	0	FAM83B	54914219	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	3.847000	0.55895	2.118000	0.64928	0.533000	0.62120	AAG		0.378	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		9	26	0	0	0	0.004482	0	9	26				
LGSN	51557	broad.mit.edu	37	6	63989943	63989943	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:63989943A>T	ENST00000370657.4	-	4	1546	c.1513T>A	c.(1513-1515)Tta>Ata	p.L505I	LGSN_ENST00000370658.5_3'UTR			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	505					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AAATACTCTAAGAATTTATTT	0.323																																							uc003peh.2		NA																	0				skin(2)	2						c.(1513-1515)TTA>ATA		lengsin, lens protein with glutamine synthetase	L-Glutamic Acid(DB00142)						54.0	60.0	58.0					6																	63989943		2197	4297	6494	SO:0001583	missense	51557				glutamine biosynthetic process		glutamate-ammonia ligase activity	g.chr6:63989943A>T	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.1513T>A	6.37:g.63989943A>T	ENSP00000359691:p.Leu505Ile					LGSN_uc003pei.2_3'UTR	p.L505I	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN			4	1547	-			505					A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	ENST00000370657.4	37	c.1513T>A	CCDS4964.1	.	.	.	.	.	.	.	.	.	.	A	19.22	3.784747	0.70222	.	.	ENSG00000146166	ENST00000370657	D	0.85773	-2.03	5.96	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.80633	0.4660	M	0.84326	2.69	0.80722	D	1	P	0.51351	0.944	P	0.47891	0.56	T	0.77859	-0.2431	10	0.38643	T	0.18	-17.1266	7.308	0.26459	0.5748:0.0:0.4252:0.0	.	505	Q5TDP6	LGSN_HUMAN	I	505	ENSP00000359691:L505I	ENSP00000359691:L505I	L	-	1	2	LGSN	64047902	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.210000	0.32370	0.528000	0.28580	0.533000	0.62120	TTA		0.323	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	NM_016571		60	47	0	0	0	0.00361	0	60	47				
RIMS1	22999	broad.mit.edu	37	6	72889469	72889469	+	Silent	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:72889469C>A	ENST00000521978.1	+	5	663	c.663C>A	c.(661-663)ccC>ccA	p.P221P	RIMS1_ENST00000520567.1_Silent_p.P221P|RIMS1_ENST00000348717.5_Silent_p.P221P|RIMS1_ENST00000491071.2_Silent_p.P221P|RIMS1_ENST00000522291.1_Silent_p.P221P|RIMS1_ENST00000517960.1_Silent_p.P221P|RIMS1_ENST00000518273.1_Silent_p.P221P|RIMS1_ENST00000264839.7_Silent_p.P221P	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	221					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CTCAGACACCCCTAAGCACAG	0.602																																							uc003pga.2		NA																	0				ovary(7)|pancreas(2)|breast(1)	10						c.(661-663)CCC>CCA		regulating synaptic membrane exocytosis 1							69.0	78.0	75.0					6																	72889469		2128	4250	6378	SO:0001819	synonymous_variant	22999				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr6:72889469C>A	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.663C>A	6.37:g.72889469C>A						RIMS1_uc011dyb.1_5'Flank|RIMS1_uc003pgc.2_5'Flank|RIMS1_uc003pgb.3_5'Flank	p.P221P	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN			5	740	+		all_epithelial(107;0.179)|all_hematologic(105;0.212)	221					A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	37	c.663C>A	CCDS47449.1																																																																																				0.602	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			25	67	1	0	1.17739e-12	0.005443	1.43324e-12	25	67				
MDN1	23195	broad.mit.edu	37	6	90402199	90402199	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:90402199T>A	ENST00000369393.3	-	63	10665	c.10550A>T	c.(10549-10551)gAc>gTc	p.D3517V	MDN1_ENST00000428876.1_Missense_Mutation_p.D3517V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3517					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GGCCCTCTGGTCCAACTCTCC	0.602																																							uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(10549-10551)GAC>GTC		MDN1, midasin homolog							48.0	48.0	48.0					6																	90402199		2203	4300	6503	SO:0001583	missense	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90402199T>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10550A>T	6.37:g.90402199T>A	ENSP00000358400:p.Asp3517Val						p.D3517V	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	63	10666	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	3517					O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	c.10550A>T	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	14.00	2.406324	0.42715	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03772	3.81;3.81	5.64	5.64	0.86602	.	0.115836	0.56097	D	0.000024	T	0.05593	0.0147	M	0.78916	2.43	0.58432	D	0.999997	P	0.50272	0.933	B	0.42386	0.386	T	0.23726	-1.0180	10	0.42905	T	0.14	.	15.8687	0.79091	0.0:0.0:0.0:1.0	.	3517	Q9NU22	MDN1_HUMAN	V	3517	ENSP00000358400:D3517V;ENSP00000413970:D3517V	ENSP00000358400:D3517V	D	-	2	0	MDN1	90458920	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.407000	0.44565	2.146000	0.66826	0.379000	0.24179	GAC		0.602	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			13	24	0	0	0	0.00245	0	13	24				
MDN1	23195	broad.mit.edu	37	6	90421912	90421912	+	Silent	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:90421912C>G	ENST00000369393.3	-	49	7609	c.7494G>C	c.(7492-7494)ctG>ctC	p.L2498L	MDN1_ENST00000428876.1_Silent_p.L2498L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2498					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CATTGAATTTCAGGTTCTCAG	0.398																																							uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(7492-7494)CTG>CTC		MDN1, midasin homolog							135.0	139.0	138.0					6																	90421912		2203	4300	6503	SO:0001819	synonymous_variant	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90421912C>G	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.7494G>C	6.37:g.90421912C>G							p.L2498L	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	49	7610	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	2498					O15019|Q5T794	Silent	SNP	ENST00000369393.3	37	c.7494G>C	CCDS5024.1																																																																																				0.398	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			50	74	0	0	0	0.00361	0	50	74				
FUT9	10690	broad.mit.edu	37	6	96651885	96651885	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:96651885C>A	ENST00000302103.5	+	3	1180	c.854C>A	c.(853-855)tCa>tAa	p.S285*		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	285					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		CCAGCAGATTCATTCATTCAT	0.383																																					Melanoma(98;1369 1476 6592 22940 26587)	Melanoma(98;1369 1476 6592 22940 26587)	uc003pop.3		NA																	0				skin(4)|ovary(1)	5						c.(853-855)TCA>TAA		fucosyltransferase 9 (alpha (1,3)							61.0	58.0	59.0					6																	96651885		2203	4300	6503	SO:0001587	stop_gained	10690				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity	g.chr6:96651885C>A	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.854C>A	6.37:g.96651885C>A	ENSP00000302599:p.Ser285*						p.S285*	NM_006581	NP_006572	Q9Y231	FUT9_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.08)	3	1195	+		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)	285			Lumenal (Potential).		Q5T0W4	Nonsense_Mutation	SNP	ENST00000302103.5	37	c.854C>A	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	C	37	6.111771	0.97291	.	.	ENSG00000172461	ENST00000302103	.	.	.	5.29	5.29	0.74685	.	0.056752	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5651	17.919	0.88960	0.0:1.0:0.0:0.0	.	.	.	.	X	285	.	ENSP00000302599:S285X	S	+	2	0	FUT9	96758606	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.476000	0.83614	0.467000	0.42956	TCA		0.383	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581		15	26	1	0	7.93312e-07	0.00245	8.97997e-07	15	26				
KLHL32	114792	broad.mit.edu	37	6	97562061	97562061	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:97562061A>G	ENST00000369261.4	+	7	1393	c.1030A>G	c.(1030-1032)Atg>Gtg	p.M344V	KLHL32_ENST00000539200.1_Missense_Mutation_p.M275V|KLHL32_ENST00000536676.1_Missense_Mutation_p.M308V|KLHL32_ENST00000544166.1_Intron	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	344										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TGTGGCAGTCATGGGGGACTT	0.572																																							uc010kcm.1		NA																	0				ovary(3)|skin(1)	4						c.(1030-1032)ATG>GTG		kelch-like 32							90.0	86.0	87.0					6																	97562061		2203	4300	6503	SO:0001583	missense	114792							g.chr6:97562061A>G	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.1030A>G	6.37:g.97562061A>G	ENSP00000358265:p.Met344Val					KLHL32_uc003poy.2_Missense_Mutation_p.M344V|KLHL32_uc011ead.1_Missense_Mutation_p.M308V|KLHL32_uc003poz.2_Intron|KLHL32_uc011eae.1_Missense_Mutation_p.M275V|KLHL32_uc003ppa.2_Intron	p.M344V	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0558)	7	1502	+		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)	344			Kelch 1.		B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	c.1030A>G	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.851006	0.71719	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.62498	0.02;0.02;0.02	5.36	5.36	0.76844	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.49098	0.1537	N	0.04387	-0.21	0.80722	D	1	P;P;B;B	0.50156	0.86;0.932;0.046;0.288	P;D;B;B	0.67103	0.728;0.949;0.099;0.157	T	0.61530	-0.7044	10	0.36615	T	0.2	.	15.522	0.75874	1.0:0.0:0.0:0.0	.	275;308;344;344	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	V	344;308;275	ENSP00000358265:M344V;ENSP00000440382:M308V;ENSP00000441527:M275V	ENSP00000358265:M344V	M	+	1	0	KLHL32	97668782	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.907000	0.75724	2.231000	0.72958	0.533000	0.62120	ATG		0.572	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904		6	68	0	0	0	0.001168	0	6	68				
KIAA1919	91749	broad.mit.edu	37	6	111583529	111583529	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:111583529A>G	ENST00000368847.4	+	2	450	c.97A>G	c.(97-99)Agt>Ggt	p.S33G		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	33					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		AAATATCAGTAGTCTGTCTTT	0.373																																							uc003puv.3		NA																	0				ovary(3)	3						c.(97-99)AGT>GGT		sodium-dependent glucose transporter 1							319.0	302.0	308.0					6																	111583529		2203	4300	6503	SO:0001583	missense	91749				carbohydrate transport|sodium ion transport	apical plasma membrane|integral to membrane	symporter activity	g.chr6:111583529A>G	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.97A>G	6.37:g.111583529A>G	ENSP00000357840:p.Ser33Gly						p.S33G	NM_153369	NP_699200	Q5TF39	NAGT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)	2	519	+		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)	33			Extracellular (Potential).		A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	ENST00000368847.4	37	c.97A>G	CCDS5090.1	.	.	.	.	.	.	.	.	.	.	A	10.46	1.357217	0.24598	.	.	ENSG00000173214	ENST00000368847	T	0.59083	0.29	5.84	-0.171	0.13331	Major facilitator superfamily domain, general substrate transporter (1);	0.244071	0.46145	D	0.000309	T	0.21881	0.0527	L	0.48362	1.52	0.09310	N	1	B	0.10296	0.003	B	0.15052	0.012	T	0.25363	-1.0134	10	0.25751	T	0.34	-4.9048	6.0006	0.19519	0.4757:0.2363:0.288:0.0	.	33	Q5TF39	NAGT1_HUMAN	G	33	ENSP00000357840:S33G	ENSP00000357840:S33G	S	+	1	0	KIAA1919	111690222	1.000000	0.71417	0.626000	0.29213	0.920000	0.55202	2.113000	0.41902	0.073000	0.16731	0.459000	0.35465	AGT		0.373	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1	NM_153369		56	79	0	0	0	0.00361	0	56	79				
REV3L	5980	broad.mit.edu	37	6	111650886	111650886	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:111650886C>G	ENST00000358835.3	-	26	8544	c.8090G>C	c.(8089-8091)aGa>aCa	p.R2697T	REV3L_ENST00000368802.3_Missense_Mutation_p.R2697T|REV3L_ENST00000435970.1_Missense_Mutation_p.R2619T|REV3L_ENST00000368805.1_Missense_Mutation_p.R2697T			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2697					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CACCATAAATCTAGTCTTCAA	0.383								DNA polymerases (catalytic subunits)																															uc003puy.3		NA																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(8089-8091)AGA>ACA	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA polymerase zeta							118.0	108.0	111.0					6																	111650886		2203	4300	6503	SO:0001583	missense	5980				DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding	g.chr6:111650886C>G	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.8090G>C	6.37:g.111650886C>G	ENSP00000351697:p.Arg2697Thr					REV3L_uc003pux.3_Missense_Mutation_p.R2619T|REV3L_uc003puz.3_Missense_Mutation_p.R2619T|REV3L_uc003pva.1_RNA	p.R2697T	NM_002912	NP_002903	O60673	DPOLZ_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)	25	8413	-		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)	2697					O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	c.8090G>C	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496574	0.85069	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.76	5.76	0.90799	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.111999	0.56097	D	0.000023	D	0.84160	0.5411	H	0.99211	4.47	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.90427	0.4421	10	0.87932	D	0	-7.7323	19.9765	0.97312	0.0:1.0:0.0:0.0	.	2697	O60673	DPOLZ_HUMAN	T	2697;2697;2697;2619	ENSP00000357792:R2697T;ENSP00000357795:R2697T;ENSP00000351697:R2697T;ENSP00000402003:R2619T	ENSP00000351697:R2697T	R	-	2	0	REV3L	111757579	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	7.725000	0.84808	2.733000	0.93635	0.467000	0.42956	AGA		0.383	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912		12	33	0	0	0	0.010729	0	12	33				
THEMIS	387357	broad.mit.edu	37	6	128134390	128134390	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:128134390G>T	ENST00000368248.2	-	4	1544	c.1396C>A	c.(1396-1398)Ctt>Att	p.L466I	THEMIS_ENST00000537166.1_Missense_Mutation_p.L431I|THEMIS_ENST00000543064.1_Missense_Mutation_p.L466I|THEMIS_ENST00000368250.1_Missense_Mutation_p.L387I	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	466	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TCAATGGAAAGATCCCTGACA	0.468																																							uc003qbi.2		NA																	0				ovary(2)|skin(2)	4						c.(1396-1398)CTT>ATT		thymocyte selection pathway associated isoform							79.0	80.0	80.0					6																	128134390		2203	4300	6503	SO:0001583	missense	387357				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus		g.chr6:128134390G>T	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1396C>A	6.37:g.128134390G>T	ENSP00000357231:p.Leu466Ile					THEMIS_uc010kfa.2_Missense_Mutation_p.L369I|THEMIS_uc011ebt.1_Missense_Mutation_p.L466I|THEMIS_uc010kfb.2_Missense_Mutation_p.L431I	p.L466I	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN			5	1715	-			466			CABIT 2.		A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	c.1396C>A	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893866	0.52121	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	T	0.27027	0.0662	M	0.72118	2.19	0.44337	D	0.997229	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.00645	-1.1629	10	0.52906	T	0.07	-20.9181	13.0668	0.59038	0.0732:0.0:0.9268:0.0	.	466;466	F5H1J9;Q8N1K5	.;THMS1_HUMAN	I	387;466;466;431	ENSP00000357233:L387I;ENSP00000439594:L466I;ENSP00000357231:L466I;ENSP00000439863:L431I	ENSP00000357231:L466I	L	-	1	0	THEMIS	128176083	1.000000	0.71417	0.999000	0.59377	0.732000	0.41865	6.135000	0.71696	2.683000	0.91414	0.563000	0.77884	CTT		0.468	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923		15	59	1	0	2.62699e-14	0.003163	3.24094e-14	15	59				
OR2A4	79541	broad.mit.edu	37	6	132021854	132021854	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:132021854T>C	ENST00000315453.2	-	1	781	c.688A>G	c.(688-690)Agg>Ggg	p.R230G	ENPP3_ENST00000414305.1_Intron|ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000357639.3_Intron	NM_030908.1	NP_112170.1	O95047	OR2A4_HUMAN	olfactory receptor, family 2, subfamily A, member 4	230					positive regulation of cytokinesis (GO:0032467)|regulation of actin cytoskeleton organization (GO:0032956)	cleavage furrow (GO:0032154)|Flemming body (GO:0090543)|integral component of membrane (GO:0016021)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|ovary(1)|skin(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.018)|OV - Ovarian serous cystadenocarcinoma(155;0.041)		TGAACTTCCCTTGATTGGATC	0.488																																							uc011ecd.1		NA																	0				ovary(1)|skin(1)	2						c.(688-690)AGG>GGG		olfactory receptor, family 2, subfamily A,							50.0	67.0	62.0					6																	132021854		1828	4251	6079	SO:0001583	missense	79541				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:132021854T>C	AC005587	CCDS5149.1	6q23	2012-08-09	2003-05-22		ENSG00000180658	ENSG00000180658		"""GPCR / Class A : Olfactory receptors"""	14729	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 10"""	OR2A10			Standard	NM_030908		Approved		uc011ecd.2	O95047	OTTHUMG00000016316	ENST00000315453.2:c.688A>G	6.37:g.132021854T>C	ENSP00000319546:p.Arg230Gly					ENPP3_uc003qcu.3_Intron|ENPP3_uc010kfq.2_Intron|ENPP3_uc003qcv.2_Intron	p.R230G	NM_030908	NP_112170	O95047	OR2A4_HUMAN		GBM - Glioblastoma multiforme(226;0.018)|OV - Ovarian serous cystadenocarcinoma(155;0.041)	1	688	-	Breast(56;0.0753)		230			Cytoplasmic (Potential).		Q0VAR3|Q6IF18|Q9NQN0	Missense_Mutation	SNP	ENST00000315453.2	37	c.688A>G	CCDS5149.1	.	.	.	.	.	.	.	.	.	.	-	0.007	-1.978461	0.00448	.	.	ENSG00000180658	ENST00000315453	T	0.00107	8.72	1.79	-1.04	0.10068	GPCR, rhodopsin-like superfamily (1);	0.657383	0.12517	N	0.462005	T	0.00012	0.0000	N	0.00879	-1.12	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33803	-0.9854	10	0.11182	T	0.66	.	0.2576	0.00214	0.2011:0.27:0.2003:0.3286	.	230	O95047	OR2A4_HUMAN	G	230	ENSP00000319546:R230G	ENSP00000319546:R230G	R	-	1	2	OR2A4	132063547	0.000000	0.05858	0.075000	0.20258	0.000000	0.00434	-1.172000	0.03112	-0.277000	0.09193	0.000000	0.15137	AGG		0.488	OR2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109221.1	NM_030908		10	81	0	0	0	0.00245	0	10	81				
SHPRH	257218	broad.mit.edu	37	6	146264414	146264414	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:146264414A>T	ENST00000367505.2	-	9	2367	c.2103T>A	c.(2101-2103)ttT>ttA	p.F701L	SHPRH_ENST00000438092.2_Missense_Mutation_p.F701L|SHPRH_ENST00000275233.7_Missense_Mutation_p.F701L|SHPRH_ENST00000367503.3_Missense_Mutation_p.F701L			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	701					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GGGGGCAGTAAAAAGGCTTGA	0.453																																							uc003qlf.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(2101-2103)TTT>TTA		SNF2 histone linker PHD RING helicase isoform a							70.0	72.0	72.0					6																	146264414		1950	4149	6099	SO:0001583	missense	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146264414A>T	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2103T>A	6.37:g.146264414A>T	ENSP00000356475:p.Phe701Leu					SHPRH_uc003qld.2_Missense_Mutation_p.F701L|SHPRH_uc003qle.2_Missense_Mutation_p.F701L|SHPRH_uc003qlg.1_Missense_Mutation_p.F257L|SHPRH_uc003qlj.1_Missense_Mutation_p.F590L	p.F701L	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	9	2502	-		Ovarian(120;0.0365)	701			PHD-type.		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	c.2103T>A	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.303766	0.81136	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.36	0.0236	0.14138	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);DEAD-like helicase (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.64394	0.2594	L	0.47078	1.49	0.53005	D	0.999966	D;D;D;D	0.89917	0.998;1.0;0.999;1.0	D;D;D;D	0.91635	0.994;0.996;0.994;0.999	T	0.66783	-0.5836	10	0.66056	D	0.02	-26.1917	11.0098	0.47657	0.5165:0.0:0.4835:0.0	.	590;701;701;590	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	L	701;701;701;701;590	ENSP00000356475:F701L;ENSP00000356473:F701L;ENSP00000412797:F701L;ENSP00000275233:F701L	ENSP00000275233:F701L	F	-	3	2	SHPRH	146306107	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	1.408000	0.34668	-0.140000	0.11394	0.528000	0.53228	TTT		0.453	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		15	24	0	0	0	0.00245	0	15	24				
SHPRH	257218	broad.mit.edu	37	6	146268732	146268732	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:146268732A>C	ENST00000367505.2	-	6	1373	c.1109T>G	c.(1108-1110)aTt>aGt	p.I370S	SHPRH_ENST00000438092.2_Missense_Mutation_p.I370S|SHPRH_ENST00000275233.7_Missense_Mutation_p.I370S|SHPRH_ENST00000367503.3_Missense_Mutation_p.I370S			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	370	Helicase ATP-binding; first part. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		ATCTGCTAAAATTCCACCAAG	0.423																																							uc003qlf.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(1108-1110)ATT>AGT		SNF2 histone linker PHD RING helicase isoform a							111.0	107.0	108.0					6																	146268732		1897	4118	6015	SO:0001583	missense	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146268732A>C	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.1109T>G	6.37:g.146268732A>C	ENSP00000356475:p.Ile370Ser					SHPRH_uc003qld.2_Missense_Mutation_p.I370S|SHPRH_uc003qle.2_Missense_Mutation_p.I370S|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Missense_Mutation_p.I259S|SHPRH_uc003qlk.1_Missense_Mutation_p.I370S	p.I370S	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	6	1508	-		Ovarian(120;0.0365)	370			Helicase ATP-binding; first part.		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	c.1109T>G	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	A	28.5	4.923815	0.92319	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	D;D;D;D	0.96011	-3.88;-3.88;-3.88;-3.88	5.59	5.59	0.84812	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.64402	D	0.000003	D	0.97015	0.9025	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.998	D	0.97927	1.0318	10	0.87932	D	0	-16.1015	15.769	0.78149	1.0:0.0:0.0:0.0	.	259;370;370;259	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	S	370;370;370;370;259	ENSP00000356475:I370S;ENSP00000356473:I370S;ENSP00000412797:I370S;ENSP00000275233:I370S	ENSP00000275233:I370S	I	-	2	0	SHPRH	146310425	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.339000	0.96797	2.118000	0.64928	0.482000	0.46254	ATT		0.423	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		13	62	0	0	0	0.001368	0	13	62				
SYNE1	23345	broad.mit.edu	37	6	152605206	152605206	+	Silent	SNP	C	C	A	rs149923357	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:152605206C>A	ENST00000367255.5	-	96	18715	c.18114G>T	c.(18112-18114)gcG>gcT	p.A6038A	SYNE1_ENST00000423061.1_Silent_p.A5967A|SYNE1_ENST00000265368.4_Silent_p.A6038A|SYNE1_ENST00000341594.5_Silent_p.A5650A|SYNE1_ENST00000356820.4_Silent_p.A562A|SYNE1_ENST00000448038.1_Silent_p.A5967A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6038					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A6038A(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAGCTGCTCCGCAGGGTCGG	0.552										HNSCC(10;0.0054)																													uc010kiw.2		NA																	2	Substitution - coding silent(2)		large_intestine(2)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(18112-18114)GCG>GCT		spectrin repeat containing, nuclear envelope 1							79.0	77.0	78.0					6																	152605206		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152605206C>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18114G>T	6.37:g.152605206C>A		HNSCC(10;0.0054)				SYNE1_uc010kiv.2_Silent_p.A562A|SYNE1_uc003qos.3_Silent_p.A562A|SYNE1_uc003qot.3_Silent_p.A5967A|SYNE1_uc003qou.3_Silent_p.A6038A|SYNE1_uc010kiy.1_Silent_p.A217A	p.A6038A	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	96	18716	-		Ovarian(120;0.0955)	6038			Spectrin 20.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.18114G>T	CCDS5236.2																																																																																				0.552	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		38	31	1	0	3.61848e-18	0.007835	4.59848e-18	38	31				
FBXO5	26271	broad.mit.edu	37	6	153296193	153296193	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:153296193T>G	ENST00000229758.3	-	2	725	c.667A>C	c.(667-669)Att>Ctt	p.I223L	FBXO5_ENST00000477822.1_5'Flank|FBXO5_ENST00000367241.3_Missense_Mutation_p.I177L	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	223	Interaction with EVI5.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		CTGGCTATAATTTCCTTCAGC	0.373																																					NSCLC(121;372 1757 17721 17977 29669)	NSCLC(121;372 1757 17721 17977 29669)	uc003qpg.2		NA																	0					0						c.(667-669)ATT>CTT		F-box only protein 5 isoform a							88.0	92.0	91.0					6																	153296193		2203	4300	6503	SO:0001583	missense	26271				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding	g.chr6:153296193T>G	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.667A>C	6.37:g.153296193T>G	ENSP00000229758:p.Ile223Leu					FBXO5_uc003qph.2_Missense_Mutation_p.I177L	p.I223L	NM_012177	NP_036309	Q9UKT4	FBX5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)	2	776	-		Ovarian(120;0.125)	223			Interaction with EVI5.		B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	ENST00000229758.3	37	c.667A>C	CCDS5242.1	.	.	.	.	.	.	.	.	.	.	T	4.223	0.040233	0.08148	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.43688	0.94;0.94	5.92	-1.48	0.08745	.	1.072030	0.07176	N	0.853231	T	0.04724	0.0128	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31364	-0.9946	10	0.22109	T	0.4	-0.5413	1.4397	0.02351	0.1538:0.3488:0.2147:0.2827	.	223	Q9UKT4	FBX5_HUMAN	L	223;177	ENSP00000229758:I223L;ENSP00000356210:I177L	ENSP00000229758:I223L	I	-	1	0	FBXO5	153337886	0.112000	0.22096	0.022000	0.16811	0.028000	0.11728	0.286000	0.18902	0.054000	0.16065	0.533000	0.62120	ATT		0.373	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1			30	37	0	0	0	0.009535	0	30	37				
EZR	7430	broad.mit.edu	37	6	159188057	159188057	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:159188057A>T	ENST00000367075.3	-	14	1818	c.1650T>A	c.(1648-1650)aaT>aaA	p.N550K	MIR3918_ENST00000581555.1_RNA|EZR_ENST00000337147.7_Missense_Mutation_p.N550K|EZR_ENST00000392177.4_Missense_Mutation_p.N518K	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	550	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GGATGATGTCATTGTGGGTCC	0.562			T	ROS1	NSCLC																																		uc003qrt.3		NA		Dom	yes		6	6q25.3	7430		ezrin			E					0				ovary(1)	1						c.(1648-1650)AAT>AAA		ezrin							247.0	209.0	222.0					6																	159188057		2203	4300	6503	SO:0001583	missense	7430				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding	g.chr6:159188057A>T	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1650T>A	6.37:g.159188057A>T	ENSP00000356042:p.Asn550Lys					EZR_uc011efr.1_Missense_Mutation_p.N157K|EZR_uc011efs.1_Missense_Mutation_p.N518K|EZR_uc003qru.3_Missense_Mutation_p.N550K	p.N550K	NM_003379	NP_003370	P15311	EZRI_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)	13	1865	-		Breast(66;0.000776)|Ovarian(120;0.0303)	550			Interaction with SCYL3.		E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	ENST00000367075.3	37	c.1650T>A	CCDS5258.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.089357	0.76756	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.83419	-1.72;-1.72;-1.72	5.37	-10.3	0.00346	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.085566	0.85682	D	0.000000	D	0.86016	0.5832	M	0.83953	2.67	0.58432	D	0.999996	D;D	0.58970	0.984;0.984	D;D	0.68621	0.944;0.959	D	0.93147	0.6546	10	0.59425	D	0.04	.	20.2162	0.98298	0.7683:0.0:0.2317:0.0	.	518;550	E7EQR4;P15311	.;EZRI_HUMAN	K	550;550;518	ENSP00000338934:N550K;ENSP00000356042:N550K;ENSP00000376016:N518K	ENSP00000338934:N550K	N	-	3	2	EZR	159108045	0.003000	0.15002	0.934000	0.37439	0.990000	0.78478	-1.077000	0.03416	-2.374000	0.00599	-0.379000	0.06801	AAT		0.562	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379		73	98	0	0	0	0.00361	0	73	98				
C6orf118	168090	broad.mit.edu	37	6	165713854	165713854	+	Splice_Site	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:165713854T>A	ENST00000230301.8	-	3	895	c.875A>T	c.(874-876)aAg>aTg	p.K292M	C6orf118_ENST00000543069.1_Splice_Site_p.K188M	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	292										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GTTTCTTACCTTAACTTTTTT	0.393																																							uc003qum.3		NA																	0					0						c.(874-876)AAG>ATG		hypothetical protein LOC168090							87.0	101.0	96.0					6																	165713854		2203	4300	6503	SO:0001630	splice_region_variant	168090							g.chr6:165713854T>A		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.876+1A>T	6.37:g.165713854T>A						C6orf118_uc011egi.1_RNA	p.K292M	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	3	911	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	292					Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	c.875A>T	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580847	0.46006	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.15718	2.4;2.4	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000003	T	0.29389	0.0732	M	0.68317	2.08	0.40436	D	0.979994	D	0.89917	1.0	D	0.76575	0.988	T	0.07121	-1.0789	10	0.87932	D	0	.	12.6908	0.56974	0.0:0.0:0.0:1.0	.	292	Q5T5N4	CF118_HUMAN	M	292;188	ENSP00000230301:K292M;ENSP00000439288:K188M	ENSP00000230301:K292M	K	-	2	0	C6orf118	165633844	1.000000	0.71417	0.894000	0.35097	0.114000	0.19823	4.061000	0.57485	1.966000	0.57179	0.533000	0.62120	AAG		0.393	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980	Missense_Mutation	10	87	0	0	0	0.010729	0	10	87				
RBAK	57786	broad.mit.edu	37	7	5104216	5104216	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:5104216G>A	ENST00000353796.3	+	6	1453	c.1129G>A	c.(1129-1131)Gaa>Aaa	p.E377K	RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.E377K|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	377					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TCCATGTAACGAATGTGGGAA	0.468																																							uc010kss.1		NA																	0				ovary(3)|kidney(1)|skin(1)	5						c.(1129-1131)GAA>AAA		RB-associated KRAB repressor							137.0	138.0	137.0					7																	5104216		2203	4300	6503	SO:0001583	missense	57786				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr7:5104216G>A	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1129G>A	7.37:g.5104216G>A	ENSP00000275423:p.Glu377Lys					LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Missense_Mutation_p.E377K	p.E377K	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)	6	1453	+		Ovarian(82;0.0175)	377			C2H2-type 5.		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	c.1129G>A	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701580	0.48307	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.07327	3.2;3.2	3.76	2.87	0.33458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.122525	0.37095	N	0.002245	T	0.17280	0.0415	L	0.41573	1.285	0.33707	D	0.615285	D	0.71674	0.998	D	0.78314	0.991	T	0.14587	-1.0467	8	.	.	.	.	10.9458	0.47299	0.0:0.0:0.8115:0.1885	.	377	Q9NYW8	RBAK_HUMAN	K	377	ENSP00000275423:E377K;ENSP00000380120:E377K	.	E	+	1	0	RBAK	5070742	0.001000	0.12720	0.017000	0.16124	0.983000	0.72400	0.530000	0.23036	1.145000	0.42336	0.555000	0.69702	GAA		0.468	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163		24	127	0	0	0	0.003954	0	24	127				
HDAC9	9734	broad.mit.edu	37	7	18767237	18767237	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:18767237C>G	ENST00000432645.2	+	12	1757	c.1757C>G	c.(1756-1758)tCt>tGt	p.S586C	HDAC9_ENST00000401921.1_Missense_Mutation_p.S545C|HDAC9_ENST00000406451.4_Missense_Mutation_p.S586C|HDAC9_ENST00000441542.2_Missense_Mutation_p.S589C	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	586					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.S589F(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CGTGCGCTCTCTGTGCGCCAA	0.542																																							uc003suh.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|central_nervous_system(2)|kidney(1)	5						c.(1756-1758)TCT>TGT		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						37.0	42.0	40.0					7																	18767237		2031	4179	6210	SO:0001583	missense	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18767237C>G	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1757C>G	7.37:g.18767237C>G	ENSP00000410337:p.Ser586Cys					HDAC9_uc003sue.2_Missense_Mutation_p.S586C|HDAC9_uc011jyd.1_Missense_Mutation_p.S586C|HDAC9_uc003sui.2_Missense_Mutation_p.S589C|HDAC9_uc003suj.2_Missense_Mutation_p.S545C|HDAC9_uc003sua.1_Missense_Mutation_p.S564C|HDAC9_uc010kue.1_Missense_Mutation_p.S241C	p.S586C	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN			12	1798	+	all_lung(11;0.187)		586					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	c.1757C>G	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.009805	0.35415	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.12	5.12	0.69794	.	1.040220	0.07633	N	0.929010	T	0.56217	0.1970	L	0.44542	1.39	0.43863	D	0.99646	P;P;P;P;P;P;P	0.52316	0.844;0.844;0.932;0.932;0.889;0.932;0.952	B;B;B;B;B;B;B	0.43950	0.321;0.22;0.437;0.437;0.171;0.437;0.352	T	0.54476	-0.8288	10	0.62326	D	0.03	-5.6789	12.1922	0.54278	0.2871:0.7129:0.0:0.0	.	586;498;545;589;586;586;564	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	C	586;545;586;589;498	ENSP00000384657:S586C;ENSP00000383912:S545C;ENSP00000410337:S586C;ENSP00000408617:S589C	ENSP00000339165:S498C	S	+	2	0	HDAC9	18733762	0.712000	0.27916	0.256000	0.24389	0.371000	0.29859	2.024000	0.41049	2.531000	0.85337	0.557000	0.71058	TCT		0.542	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			8	10	0	0	0	0.006214	0	8	10				
HDAC9	9734	broad.mit.edu	37	7	18767262	18767262	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:18767262G>T	ENST00000432645.2	+	12	1782	c.1782G>T	c.(1780-1782)gcG>gcT	p.A594A	HDAC9_ENST00000401921.1_Silent_p.A553A|HDAC9_ENST00000406451.4_Silent_p.A594A|HDAC9_ENST00000441542.2_Silent_p.A597A	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	594					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CGCTGGCTGCGGTTGGCATGG	0.567																																							uc003suh.2		NA																	0				lung(2)|central_nervous_system(2)|kidney(1)	5						c.(1780-1782)GCG>GCT		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						43.0	48.0	46.0					7																	18767262		2030	4191	6221	SO:0001819	synonymous_variant	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18767262G>T	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1782G>T	7.37:g.18767262G>T						HDAC9_uc003sue.2_Silent_p.A594A|HDAC9_uc011jyd.1_Silent_p.A594A|HDAC9_uc003sui.2_Silent_p.A597A|HDAC9_uc003suj.2_Silent_p.A553A|HDAC9_uc003sua.1_Silent_p.A572A|HDAC9_uc010kue.1_Silent_p.A249A	p.A594A	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN			12	1823	+	all_lung(11;0.187)		594					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	37	c.1782G>T	CCDS47555.1																																																																																				0.567	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			10	10	1	0	9.70103e-10	0.008291	1.15278e-09	10	10				
HOXA5	3202	broad.mit.edu	37	7	27181551	27181551	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:27181551A>G	ENST00000222726.3	-	2	776	c.716T>C	c.(715-717)aTt>aCt	p.I239T	HOXA-AS3_ENST00000521197.1_RNA|HOXA3_ENST00000521401.1_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|HOXA5_ENST00000520854.1_5'UTR|RP1-170O19.22_ENST00000467897.2_RNA	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	239					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						CCAGATTTTAATTTGTCTCTC	0.498											OREG0017911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(119;75 2200 7557 42868)	Colon(119;75 2200 7557 42868)	uc003syn.1		NA																	0					0						c.(715-717)ATT>ACT		homeobox A5							122.0	122.0	122.0					7																	27181551		2203	4300	6503	SO:0001583	missense	3202				negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27181551A>G		CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.716T>C	7.37:g.27181551A>G	ENSP00000222726:p.Ile239Thr		OREG0017911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	792		p.I239T	NM_019102	NP_061975	P20719	HXA5_HUMAN			2	777	-			239			Homeobox.		A4D179|O43367|Q96CY6	Missense_Mutation	SNP	ENST00000222726.3	37	c.716T>C	CCDS5406.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.209345	0.58343	.	.	ENSG00000106004	ENST00000222726	D	0.97114	-4.25	4.76	4.76	0.60689	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98764	0.9584	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99748	1.1017	10	0.87932	D	0	.	14.5605	0.68133	1.0:0.0:0.0:0.0	.	239	P20719	HXA5_HUMAN	T	239	ENSP00000222726:I239T	ENSP00000222726:I239T	I	-	2	0	HOXA5	27148076	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.261000	0.95576	1.915000	0.55452	0.443000	0.29094	ATT		0.498	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358705.1			62	94	0	0	0	0.00361	0	62	94				
CCDC129	223075	broad.mit.edu	37	7	31683324	31683324	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:31683324C>T	ENST00000407970.3	+	11	2378	c.2340C>T	c.(2338-2340)acC>acT	p.T780T	CCDC129_ENST00000319386.3_Silent_p.T632T|CCDC129_ENST00000409210.1_Silent_p.T688T|CCDC129_ENST00000451887.2_Silent_p.T806T	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	780										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AGCCCCTCACCAAATCCGTCT	0.512																																							uc003tcj.1		NA																	0					0						c.(2338-2340)ACC>ACT		coiled-coil domain containing 129							93.0	80.0	84.0					7																	31683324		2203	4300	6503	SO:0001819	synonymous_variant	223075							g.chr7:31683324C>T	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2340C>T	7.37:g.31683324C>T						CCDC129_uc011kad.1_Silent_p.T790T|CCDC129_uc003tci.1_Silent_p.T631T|CCDC129_uc011kae.1_Silent_p.T806T|CCDC129_uc003tck.1_Silent_p.T688T	p.T780T	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN			11	3333	+			780					A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	ENST00000407970.3	37	c.2340C>T	CCDS5435.2																																																																																				0.512	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300		25	71	0	0	0	0.00632	0	25	71				
AMPH	273	broad.mit.edu	37	7	38433708	38433708	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:38433708C>A	ENST00000356264.2	-	18	1720	c.1505G>T	c.(1504-1506)gGg>gTg	p.G502V	AMPH_ENST00000471913.1_5'UTR|AMPH_ENST00000325590.5_Missense_Mutation_p.G460V|AMPH_ENST00000428293.2_Missense_Mutation_p.G460V	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	502					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TACTCCTTCCCCGGCAGGGAC	0.582																																							uc003tgu.2		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(1504-1506)GGG>GTG		amphiphysin isoform 1							142.0	127.0	133.0					7																	38433708		2203	4300	6503	SO:0001583	missense	273				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane		g.chr7:38433708C>A		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1505G>T	7.37:g.38433708C>A	ENSP00000348602:p.Gly502Val					AMPH_uc003tgv.2_Missense_Mutation_p.G460V|AMPH_uc003tgt.2_Missense_Mutation_p.G387V|AMPH_uc003tgw.1_Missense_Mutation_p.G525V|AMPH_uc010kxl.1_RNA	p.G502V	NM_001635	NP_001626	P49418	AMPH_HUMAN			18	1574	-			502					A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	c.1505G>T	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	C	8.377	0.836645	0.16891	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242	T;T;T	0.59906	0.26;0.23;0.25	5.93	-0.0843	0.13691	.	0.857885	0.10403	N	0.678875	T	0.54902	0.1887	L	0.29908	0.895	0.25768	N	0.984879	D;B;B;D	0.56746	0.977;0.383;0.44;0.965	P;B;B;P	0.58873	0.847;0.143;0.101;0.63	T	0.45760	-0.9239	10	0.51188	T	0.08	-6.7893	5.2388	0.15460	0.0:0.477:0.1404:0.3827	.	548;460;502;390	Q8NFL6;P49418-2;P49418;Q8NFL4	.;.;AMPH_HUMAN;.	V	460;502;460;404	ENSP00000317441:G460V;ENSP00000348602:G502V;ENSP00000390734:G460V	ENSP00000317441:G460V	G	-	2	0	AMPH	38400233	0.000000	0.05858	0.009000	0.14445	0.126000	0.20510	-0.268000	0.08607	0.078000	0.16900	-0.251000	0.11542	GGG		0.582	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635		76	116	1	0	7.31121e-38	0.00361	9.83788e-38	76	116				
GCK	2645	broad.mit.edu	37	7	44191930	44191930	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:44191930C>T	ENST00000403799.3	-	3	772	c.303G>A	c.(301-303)gtG>gtA	p.V101V	GCK_ENST00000395796.3_Silent_p.V100V|GCK_ENST00000437084.1_Silent_p.V101V|GCK_ENST00000345378.2_Silent_p.V102V|GCK_ENST00000476008.1_5'Flank	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	101	Hexokinase type-1.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						GTTTGGTCTTCACGCTCCACT	0.622																																							uc003tkl.2		NA																	0				skin(3)|lung(1)	4						c.(301-303)GTG>GTA		glucokinase isoform 1							333.0	276.0	295.0					7																	44191930		2203	4300	6503	SO:0001819	synonymous_variant	2645				cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding	g.chr7:44191930C>T	AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.303G>A	7.37:g.44191930C>T						GCK_uc003tkj.1_Silent_p.V100V|GCK_uc003tkk.1_Silent_p.V102V	p.V101V	NM_000162	NP_000153	P35557	HXK4_HUMAN			3	773	-			101					A4D2J2|A4D2J3|Q05810	Silent	SNP	ENST00000403799.3	37	c.303G>A	CCDS5479.1																																																																																				0.622	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251069.2			41	133	0	0	0	0.011902	0	41	133				
ZNF713	349075	broad.mit.edu	37	7	56006821	56006821	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:56006821C>A	ENST00000429591.2	+	4	453	c.415C>A	c.(415-417)Cat>Aat	p.H139N	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TTTTGATTACCATCCAGAGTT	0.398																																							uc003trc.1		NA																	0				ovary(2)	2						c.(415-417)CAT>AAT		zinc finger protein 713							64.0	66.0	66.0					7																	56006821		2203	4300	6503	SO:0001583	missense	349075				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:56006821C>A	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.415C>A	7.37:g.56006821C>A	ENSP00000416662:p.His139Asn					ZNF713_uc003tra.1_Missense_Mutation_p.H152N|MRPS17_uc003trb.2_Intron	p.H139N	NM_182633	NP_872439	Q8N859	ZN713_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		4	453	+	Breast(14;0.214)		139						Missense_Mutation	SNP	ENST00000429591.2	37	c.415C>A	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	C	8.744	0.919746	0.17982	.	.	ENSG00000178665	ENST00000429591	T	0.05580	3.42	3.78	3.78	0.43462	.	0.417057	0.17764	N	0.162797	T	0.03095	0.0091	N	0.05230	-0.09	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.40175	-0.9577	10	0.30854	T	0.27	.	7.4008	0.26962	0.0:0.884:0.0:0.116	.	139	Q8N859	ZN713_HUMAN	N	139	ENSP00000416662:H139N	ENSP00000416662:H139N	H	+	1	0	ZNF713	55974315	.	.	0.956000	0.39512	0.938000	0.57974	.	.	2.395000	0.81488	0.591000	0.81541	CAT		0.398	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633		18	27	1	0	1.33834e-09	0.007413	1.58693e-09	18	27				
ZNF479	90827	broad.mit.edu	37	7	57188633	57188633	+	Silent	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:57188633G>T	ENST00000331162.4	-	5	759	c.489C>A	c.(487-489)gtC>gtA	p.V163V		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			CAAAGACTTTGACATATTTAT	0.308																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(487-489)GTC>GTA		zinc finger protein 479							32.0	31.0	31.0					7																	57188633		1807	4054	5861	SO:0001819	synonymous_variant	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57188633G>T	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.489C>A	7.37:g.57188633G>T							p.V163V	NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	760	-			163						Silent	SNP	ENST00000331162.4	37	c.489C>A	CCDS43590.1																																																																																				0.308	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		13	37	1	0	8.60227e-14	0.004007	1.05652e-13	13	37				
HIP1	3092	broad.mit.edu	37	7	75174020	75174020	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:75174020G>C	ENST00000336926.6	-	27	2765	c.2739C>G	c.(2737-2739)agC>agG	p.S913R	HIP1_ENST00000434438.2_Missense_Mutation_p.S862R	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	913	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.|Important for actin binding. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GCTGGGCTGTGCTAGCAGCAA	0.517			T	PDGFRB	CMML																																		uc003uds.1		NA		Dom	yes		7	7q11.23	3092	T	huntingtin interacting protein 1			L	PDGFRB		CMML		0				lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						c.(2737-2739)AGC>AGG		huntingtin interacting protein 1							107.0	98.0	101.0					7																	75174020		2203	4300	6503	SO:0001583	missense	3092				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton	g.chr7:75174020G>C	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2739C>G	7.37:g.75174020G>C	ENSP00000336747:p.Ser913Arg					HIP1_uc011kfz.1_Missense_Mutation_p.S739R	p.S913R	NM_005338	NP_005329	O00291	HIP1_HUMAN			27	2780	-			913			Important for actin binding (By similarity).|I/LWEQ.		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	c.2739C>G	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193105	0.78902	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.56103	0.48;0.48	5.6	4.71	0.59529	I/LWEQ (4);	0.000000	0.85682	D	0.000000	T	0.79221	0.4409	H	0.94183	3.505	0.58432	D	0.999996	D;D	0.89917	0.996;1.0	D;D	0.77004	0.979;0.989	D	0.85041	0.0923	10	0.87932	D	0	-22.4668	13.6601	0.62361	0.0764:0.0:0.9236:0.0	.	862;913	E7ES17;O00291	.;HIP1_HUMAN	R	913;862	ENSP00000336747:S913R;ENSP00000410300:S862R	ENSP00000336747:S913R	S	-	3	2	HIP1	75011956	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.327000	0.72910	1.341000	0.45600	0.655000	0.94253	AGC		0.517	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		14	36	0	0	0	0.00245	0	14	36				
KIAA1324L	222223	broad.mit.edu	37	7	86522305	86522305	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:86522305C>T	ENST00000450689.2	-	20	2982	c.2797G>A	c.(2797-2799)Ggt>Agt	p.G933S	KIAA1324L_ENST00000416314.1_Missense_Mutation_p.G766S|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.G862S|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.G693S	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	933						integral component of membrane (GO:0016021)		p.G693C(1)|p.G933C(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GCTCCCACACCGGCTCCCACC	0.453																																							uc011kha.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(1)	7						c.(2797-2799)GGT>AGT		hypothetical protein LOC222223 isoform 1							109.0	115.0	113.0					7																	86522305		2203	4300	6503	SO:0001583	missense	222223					integral to membrane		g.chr7:86522305C>T	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2797G>A	7.37:g.86522305C>T	ENSP00000413445:p.Gly933Ser					KIAA1324L_uc003uif.1_Missense_Mutation_p.G693S|KIAA1324L_uc011kgz.1_Missense_Mutation_p.G819S|KIAA1324L_uc003uie.2_Missense_Mutation_p.G766S	p.G933S	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN			20	2982	-	Esophageal squamous(14;0.0058)		933			Helical; (Potential).		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	c.2797G>A	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.54|17.54	3.416083|3.416083	0.62511|0.62511	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314|ENST00000423294	T;T;T;T|.	0.16897|.	2.58;2.33;2.31;2.33|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.047218|.	0.85682|.	D|.	0.000000|.	T|T	0.68760|0.68760	0.3036|0.3036	L|L	0.43646|0.43646	1.37|1.37	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.986;1.0;1.0|.	P;D;D|.	0.97110|.	0.631;1.0;1.0|.	T|T	0.62053|0.62053	-0.6935|-0.6935	10|5	0.02654|.	T|.	1|.	.|.	19.5289|19.5289	0.95219|0.95219	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	933;693;766|.	A8MWY0;A8MWY0-2;B4DJV3|.	K132L_HUMAN;.;.|.	S|Q	933;693;862;766|893	ENSP00000413445:G933S;ENSP00000297222:G693S;ENSP00000397377:G862S;ENSP00000402390:G766S|.	ENSP00000297222:G693S|.	G|R	-|-	1|2	0|0	KIAA1324L|KIAA1324L	86360241|86360241	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	6.070000|6.070000	0.71220|0.71220	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GGT|CGG		0.453	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748		42	63	0	0	0	0.006999	0	42	63				
ADAM22	53616	broad.mit.edu	37	7	87746095	87746095	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:87746095A>C	ENST00000265727.7	+	7	652	c.573A>C	c.(571-573)agA>agC	p.R191S	ADAM22_ENST00000315984.7_Missense_Mutation_p.R191S|ADAM22_ENST00000398204.4_Missense_Mutation_p.R191S|ADAM22_ENST00000398209.3_Missense_Mutation_p.R191S|ADAM22_ENST00000398201.4_Missense_Mutation_p.R191S|ADAM22_ENST00000439864.1_Missense_Mutation_p.R191S			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	191					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			ACAAATCCAGACTGTTTGAAT	0.343																																							uc003ujn.2		NA																	0				ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.(571-573)AGA>AGC		ADAM metallopeptidase domain 22 isoform 1							203.0	186.0	191.0					7																	87746095		1869	4108	5977	SO:0001583	missense	53616				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding	g.chr7:87746095A>C	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.573A>C	7.37:g.87746095A>C	ENSP00000265727:p.Arg191Ser					ADAM22_uc003uji.1_Missense_Mutation_p.R190S|ADAM22_uc003ujj.1_Missense_Mutation_p.R191S|ADAM22_uc003ujk.1_Missense_Mutation_p.R191S|ADAM22_uc003ujl.1_Missense_Mutation_p.R191S|ADAM22_uc003ujm.2_Missense_Mutation_p.R191S|ADAM22_uc003ujo.2_Missense_Mutation_p.R191S|ADAM22_uc003ujp.1_Missense_Mutation_p.R243S	p.R191S	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		7	652	+	Esophageal squamous(14;0.00202)		191					O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	37	c.573A>C	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	A	11.19	1.564513	0.27915	.	.	ENSG00000008277	ENST00000398204;ENST00000439864;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T;T	0.04015	4.51;3.73;4.5;4.5;4.52;4.52;4.51	5.93	2.22	0.28083	.	0.355252	0.31989	N	0.006747	T	0.02970	0.0088	N	0.14661	0.345	0.26617	N	0.972722	B;B;B;B;B;B	0.28900	0.001;0.0;0.0;0.019;0.227;0.001	B;B;B;B;B;B	0.29353	0.005;0.004;0.002;0.062;0.101;0.003	T	0.42310	-0.9459	10	0.35671	T	0.21	.	7.5433	0.27751	0.7349:0.0:0.2651:0.0	.	243;191;191;191;191;191	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2;E7EPF1;D6W5P7	.;.;ADA22_HUMAN;.;.;.	S	191;191;191;191;191;191;158	ENSP00000381262:R191S;ENSP00000391334:R191S;ENSP00000381260:R191S;ENSP00000265727:R191S;ENSP00000315900:R191S;ENSP00000381267:R191S;ENSP00000381261:R158S	ENSP00000265727:R191S	R	+	3	2	ADAM22	87584031	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.418000	0.34782	0.457000	0.26962	0.533000	0.62120	AGA		0.343	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723		5	19	0	0	0	0.001168	0	5	19				
SAMD9L	219285	broad.mit.edu	37	7	92764557	92764557	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:92764557T>C	ENST00000318238.4	-	5	1944	c.728A>G	c.(727-729)gAc>gGc	p.D243G	SAMD9L_ENST00000437805.1_Missense_Mutation_p.D243G|SAMD9L_ENST00000411955.1_Missense_Mutation_p.D243G	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	243					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			ATGGGGTTTGTCCTTGACTCC	0.398																																							uc003umh.1		NA																	0				ovary(4)	4						c.(727-729)GAC>GGC		sterile alpha motif domain containing 9-like							95.0	88.0	91.0					7																	92764557		2203	4300	6503	SO:0001583	missense	219285							g.chr7:92764557T>C	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.728A>G	7.37:g.92764557T>C	ENSP00000326247:p.Asp243Gly					SAMD9L_uc003umj.1_Missense_Mutation_p.D243G|SAMD9L_uc003umi.1_Missense_Mutation_p.D243G|SAMD9L_uc010lfb.1_Missense_Mutation_p.D243G|SAMD9L_uc003umk.1_Missense_Mutation_p.D243G|SAMD9L_uc010lfc.1_Missense_Mutation_p.D243G|SAMD9L_uc010lfd.1_Missense_Mutation_p.D243G|SAMD9L_uc011khx.1_Intron	p.D243G	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	1944	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		243					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	c.728A>G	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563096	0.45694	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.14022	2.54;2.54;2.54	4.85	3.66	0.41972	.	0.138528	0.44483	D	0.000442	T	0.25269	0.0614	L	0.54323	1.7	0.44092	D	0.996857	D	0.64830	0.994	P	0.57960	0.83	T	0.00832	-1.1548	10	0.72032	D	0.01	-5.6922	10.5769	0.45233	0.1446:0.0:0.0:0.8554	.	243	Q8IVG5	SAM9L_HUMAN	G	243	ENSP00000326247:D243G;ENSP00000405760:D243G;ENSP00000408796:D243G	ENSP00000326247:D243G	D	-	2	0	SAMD9L	92602493	1.000000	0.71417	0.907000	0.35723	0.933000	0.57130	4.879000	0.63100	0.833000	0.34828	0.377000	0.23210	GAC		0.398	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		31	47	0	0	0	0.009535	0	31	47				
CCDC132	55610	broad.mit.edu	37	7	92923899	92923899	+	Missense_Mutation	SNP	G	G	T	rs371166383		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:92923899G>T	ENST00000305866.5	+	14	1246	c.1118G>T	c.(1117-1119)cGt>cTt	p.R373L	CCDC132_ENST00000535481.1_Missense_Mutation_p.R93L|CCDC132_ENST00000541136.1_Missense_Mutation_p.R184L|CCDC132_ENST00000544910.1_Missense_Mutation_p.R343L|CCDC132_ENST00000317751.6_Missense_Mutation_p.R104L	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	373						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AATTTTGATCGTGGCTACATA	0.274																																							uc003umo.2		NA																	0					0						c.(1117-1119)CGT>CTT		coiled-coil domain containing 132 isoform a							105.0	112.0	110.0					7																	92923899		1796	4045	5841	SO:0001583	missense	55610							g.chr7:92923899G>T	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1118G>T	7.37:g.92923899G>T	ENSP00000307666:p.Arg373Leu					CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.R343L|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.R93L	p.R373L	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		14	1246	+	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		373					B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	c.1118G>T	CCDS43617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.532928|4.532928	0.85812|0.85812	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751|ENST00000458707	T|.	0.47177|.	0.85|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69214|0.69214	0.3086|0.3086	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D;D|.	0.63880|.	0.993;0.992;0.993|.	D;D;P|.	0.70487|.	0.953;0.969;0.823|.	T|T	0.64037|0.64037	-0.6501|-0.6501	10|5	0.72032|.	D|.	0.01|.	-25.5961|-25.5961	18.7975|18.7975	0.92001|0.92001	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	93;343;373|.	B4DS55;F5H5U7;Q96JG6|.	.;.;CC132_HUMAN|.	L|L	373;343;184;93;104|160	ENSP00000325582:R104L|.	ENSP00000307666:R373L|.	R|V	+|+	2|1	0|0	CCDC132|CCDC132	92761835|92761835	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.215000|7.215000	0.77966|0.77966	2.807000|2.807000	0.96579|0.96579	0.591000|0.591000	0.81541|0.81541	CGT|GTG		0.274	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667		16	74	1	0	8.34094e-07	0.008871	9.42217e-07	16	74				
TSC22D4	81628	broad.mit.edu	37	7	100075071	100075071	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:100075071C>A	ENST00000300181.2	-	2	1345	c.591G>T	c.(589-591)gaG>gaT	p.E197D	TSC22D4_ENST00000393991.1_5'UTR|TSC22D4_ENST00000496728.1_5'UTR	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	197					negative regulation of transcription, DNA-templated (GO:0045892)|response to osmotic stress (GO:0006970)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGGTCTCAGGCTCTGGGGGGC	0.706																																							uc003uva.2		NA																	0				breast(2)	2						c.(589-591)GAG>GAT		TSC22 domain family, member 4							11.0	13.0	12.0					7																	100075071		2196	4275	6471	SO:0001583	missense	81628				negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr7:100075071C>A	BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925			21696	protein-coding gene	gene with protein product		611914					Standard	NM_030935		Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000300181.2:c.591G>T	7.37:g.100075071C>A	ENSP00000300181:p.Glu197Asp					TSC22D4_uc003uvb.2_5'UTR|TSC22D4_uc011kjv.1_5'UTR|TSC22D4_uc010lgx.2_Missense_Mutation_p.E197D|TSC22D4_uc003uvc.3_Missense_Mutation_p.E197D	p.E197D	NM_030935	NP_112197	Q9Y3Q8	T22D4_HUMAN			2	1346	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		197					A4D2C3|A8MWR6|D6W5V9	Missense_Mutation	SNP	ENST00000300181.2	37	c.591G>T	CCDS5695.1	.	.	.	.	.	.	.	.	.	.	C	11.00	1.510631	0.27036	.	.	ENSG00000166925	ENST00000300181	.	.	.	4.9	2.89	0.33648	.	0.161766	0.28946	N	0.013631	T	0.43255	0.1239	L	0.36672	1.1	0.80722	D	1	B;B	0.28636	0.218;0.083	B;B	0.35550	0.205;0.101	T	0.13361	-1.0512	9	0.17832	T	0.49	-16.1391	5.4648	0.16637	0.0:0.6841:0.2002:0.1157	.	197;197	Q8IV54;Q9Y3Q8	.;T22D4_HUMAN	D	197	.	ENSP00000300181:E197D	E	-	3	2	TSC22D4	99913007	0.849000	0.29639	0.942000	0.38095	0.333000	0.28666	0.990000	0.29642	1.005000	0.39183	0.298000	0.19748	GAG		0.706	TSC22D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316970.1	NM_030935		8	28	1	0	5.18039e-06	0.00308	5.78056e-06	8	28				
ZAN	7455	broad.mit.edu	37	7	100346018	100346018	+	RNA	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:100346018G>A	ENST00000348028.3	+	0	1339				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TTCCGGGGATGGTGGACACTG	0.552																																							uc003uwj.2		NA																	0				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(1174-1176)GGT>AGT		zonadhesin isoform 3							62.0	63.0	63.0					7																	100346018		1908	4118	6026			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100346018G>A	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100346018G>A						ZAN_uc003uwk.2_Missense_Mutation_p.G392S|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	p.G392S	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		11	1339	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		392			MAM 3.|Extracellular (Potential).		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37	c.1174G>A		.	.	.	.	.	.	.	.	.	.	G	17.97	3.518552	0.64634	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.02067	4.47;4.47;4.47	4.96	2.13	0.27403	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.40385	N	0.001118	T	0.03305	0.0096	L	0.47190	1.495	0.09310	N	0.99999	P;P	0.42078	0.728;0.77	B;P	0.46389	0.381;0.515	T	0.37174	-0.9717	10	0.39692	T	0.17	.	5.8259	0.18554	0.3235:0.0:0.6765:0.0	.	392;392	F5H0T8;Q9Y493	.;ZAN_HUMAN	S	392	ENSP00000445943:G392S;ENSP00000445091:G392S;ENSP00000444427:G392S	ENSP00000423579:G392S	G	+	1	0	ZAN	100183954	0.000000	0.05858	0.005000	0.12908	0.132000	0.20833	0.181000	0.16880	0.734000	0.32515	0.555000	0.69702	GGT		0.552	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		7	29	0	0	0	0.00308	0	7	29				
ASZ1	136991	broad.mit.edu	37	7	117021089	117021090	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:117021089_117021090GG>AT	ENST00000284629.2	-	9	982_983	c.920_921CC>AT	c.(919-921)aCC>aAT	p.T307N		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CTTCCCTCATGGTCAAAAGATG	0.312																																							uc003vjb.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(919-921)ACC>AAT		ankyrin repeat, SAM and basic leucine zipper																																				SO:0001583	missense	136991				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity	g.chr7:117021089_117021090GG>AT	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.920_921delinsAT	7.37:g.117021089_117021090delinsAT	ENSP00000284629:p.Thr307Asn					ASZ1_uc011kno.1_Missense_Mutation_p.T307N|ASZ1_uc011knp.1_Missense_Mutation_p.T99N	p.T307N	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)		9	983_984	-	Lung NSC(10;0.00156)|all_lung(10;0.00175)		307			SAM.			Missense_Mutation	DNP	ENST00000284629.2	37	c.920_921CC>AT	CCDS5772.1																																																																																				0.312	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7	NM_130768		17	88	0	0	0	0.004672	0	17	88				
GCC1	79571	broad.mit.edu	37	7	127224822	127224822	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:127224822C>T	ENST00000321407.2	-	1	839	c.415G>A	c.(415-417)Ggc>Agc	p.G139S	GCC1_ENST00000497650.1_Intron	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	139					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CTGCTAACGCCACTCTCGGAC	0.562																																							uc003vma.2		NA																	0				ovary(2)	2						c.(415-417)GGC>AGC		Golgi coiled-coil protein 1							135.0	125.0	128.0					7																	127224822		2203	4300	6503	SO:0001583	missense	79571					Golgi membrane|plasma membrane	protein binding	g.chr7:127224822C>T	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.415G>A	7.37:g.127224822C>T	ENSP00000318821:p.Gly139Ser						p.G139S	NM_024523	NP_078799	Q96CN9	GCC1_HUMAN			1	833	-			139					Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	37	c.415G>A	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450141	0.63290	.	.	ENSG00000179562	ENST00000321407	T	0.16597	2.33	5.89	5.89	0.94794	.	0.049068	0.85682	D	0.000000	T	0.39655	0.1086	M	0.66939	2.045	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.03641	-1.1017	10	0.15499	T	0.54	-22.6209	17.7302	0.88375	0.0:1.0:0.0:0.0	.	139	Q96CN9	GCC1_HUMAN	S	139	ENSP00000318821:G139S	ENSP00000318821:G139S	G	-	1	0	GCC1	127012058	1.000000	0.71417	0.998000	0.56505	0.098000	0.18820	5.200000	0.65158	2.789000	0.95967	0.655000	0.94253	GGC		0.562	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523		15	87	0	0	0	0.00245	0	15	87				
AKR1B1	231	broad.mit.edu	37	7	134143774	134143774	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:134143774G>C	ENST00000285930.4	-	1	120	c.41C>G	c.(40-42)cCc>cGc	p.P14R	AKR1B1_ENST00000489022.1_5'UTR	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)	14					C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)			kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	CCCCAGGATGGGCATCTTGGC	0.716											OREG0018334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003vrp.1		NA																	0				ovary(3)	3						c.(40-42)CCC>CGC		aldo-keto reductase family 1, member B1	NADH(DB00157)|Sulindac(DB00605)						35.0	28.0	30.0					7																	134143774		2202	4300	6502	SO:0001583	missense	231				C21-steroid hormone biosynthetic process|carbohydrate metabolic process|response to stress	cytosol|extracellular space|nucleus	alditol:NADP+ 1-oxidoreductase activity|electron carrier activity|protein binding	g.chr7:134143774G>C	J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.41C>G	7.37:g.134143774G>C	ENSP00000285930:p.Pro14Arg		OREG0018334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1608	AKR1B1_uc003vrq.1_RNA	p.P14R	NM_001628	NP_001619	P15121	ALDR_HUMAN			1	115	-			14			NADP (Potential).		B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Missense_Mutation	SNP	ENST00000285930.4	37	c.41C>G	CCDS5831.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871990	0.91587	.	.	ENSG00000085662	ENST00000285930	T	0.15718	2.4	5.51	5.51	0.81932	NADP-dependent oxidoreductase domain (2);	0.097992	0.64402	D	0.000001	T	0.55226	0.1907	H	0.99777	4.77	0.80722	D	1	D	0.56287	0.975	P	0.49140	0.601	T	0.79405	-0.1817	10	0.87932	D	0	.	18.4034	0.90525	0.0:0.0:1.0:0.0	.	14	P15121	ALDR_HUMAN	R	14	ENSP00000285930:P14R	ENSP00000285930:P14R	P	-	2	0	AKR1B1	133794314	1.000000	0.71417	0.964000	0.40570	0.814000	0.46013	8.763000	0.91715	2.595000	0.87683	0.561000	0.74099	CCC		0.716	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339448.2	NM_001628		4	12	0	0	0	0.009096	0	4	12				
OR6V1	346517	broad.mit.edu	37	7	142750304	142750304	+	Silent	SNP	C	C	A	rs4725609		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:142750304C>A	ENST00000418316.1	+	1	888	c.867C>A	c.(865-867)acC>acA	p.T289T		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					TTATCCTTACCTTCTGCAATC	0.527																																							uc011ksv.1		NA																	0				ovary(1)	1						c.(865-867)ACC>ACA		olfactory receptor, family 6, subfamily V,							62.0	64.0	64.0					7																	142750304		1947	4137	6084	SO:0001819	synonymous_variant	346517				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:142750304C>A		CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.867C>A	7.37:g.142750304C>A							p.T289T	NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN			1	867	+	Melanoma(164;0.059)		289			Helical; Name=7; (Potential).		A4D2I0|B9EH48|Q6IF70	Silent	SNP	ENST00000418316.1	37	c.867C>A	CCDS47728.1																																																																																				0.527	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350860.1			11	31	1	0	3.86212e-05	0.008291	4.19862e-05	11	31				
TAS2R40	259286	broad.mit.edu	37	7	142919733	142919733	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:142919733G>C	ENST00000408947.3	+	1	604	c.562G>C	c.(562-564)Gag>Cag	p.E188Q	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	188					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					GTACTTCTCTGAGACCAATAT	0.463																																							uc011ksx.1		NA																	0				ovary(1)	1						c.(562-564)GAG>CAG		taste receptor, type 2, member 40							126.0	119.0	121.0					7																	142919733		1898	4132	6030	SO:0001583	missense	259286				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr7:142919733G>C	AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.562G>C	7.37:g.142919733G>C	ENSP00000386210:p.Glu188Gln						p.E188Q	NM_176882	NP_795363	P59535	T2R40_HUMAN			1	562	+	Melanoma(164;0.059)		188			Extracellular (Potential).		A4D2I2|Q645W6	Missense_Mutation	SNP	ENST00000408947.3	37	c.562G>C	CCDS43662.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.588292	0.46110	.	.	ENSG00000221937	ENST00000408947	T	0.00768	5.72	5.29	1.31	0.21738	.	0.937254	0.08832	U	0.887211	T	0.01976	0.0062	L	0.49126	1.545	0.09310	N	1	D	0.56287	0.975	P	0.55455	0.776	T	0.53173	-0.8476	10	0.46703	T	0.11	.	8.7977	0.34890	0.5052:0.0:0.4948:0.0	.	188	P59535	T2R40_HUMAN	Q	188	ENSP00000386210:E188Q	ENSP00000386210:E188Q	E	+	1	0	TAS2R40	142629855	0.004000	0.15560	0.992000	0.48379	0.682000	0.39822	1.010000	0.29898	0.210000	0.20664	0.655000	0.94253	GAG		0.463	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327097.1			9	72	0	0	0	0.004482	0	9	72				
CUL1	8454	broad.mit.edu	37	7	148427226	148427226	+	Silent	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:148427226C>G	ENST00000325222.4	+	2	291	c.12C>G	c.(10-12)acC>acG	p.T4T	AC005229.1_ENST00000578165.1_RNA|CUL1_ENST00000602748.1_Silent_p.T4T|CUL1_ENST00000409469.1_Silent_p.T4T	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	4					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TGTCGTCAACCCGGAGCCAGA	0.517																																							uc010lpg.2		NA																	0				lung(1)	1						c.(10-12)ACC>ACG		cullin 1							108.0	105.0	106.0					7																	148427226		2203	4300	6503	SO:0001819	synonymous_variant	8454				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding	g.chr7:148427226C>G	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.12C>G	7.37:g.148427226C>G						CUL1_uc003wey.2_Silent_p.T4T|CUL1_uc003wez.2_5'UTR	p.T4T	NM_003592	NP_003583	Q13616	CUL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00291)		2	538	+	Melanoma(164;0.15)		4					D3DWG3|O60719|Q08AL6|Q8IYW1	Silent	SNP	ENST00000325222.4	37	c.12C>G	CCDS34772.1																																																																																				0.517	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592		12	58	0	0	0	0.010729	0	12	58				
XRCC2	7516	broad.mit.edu	37	7	152346361	152346361	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:152346361G>A	ENST00000359321.1	-	3	294	c.209C>T	c.(208-210)tCa>tTa	p.S70L	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	70					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		GCCACCTTCTGATTTGGGAAG	0.388								Homologous recombination																															uc003wld.2		NA																	0				breast(1)|liver(1)	2						c.(208-210)TCA>TTA	Homologous_recombination	X-ray repair cross complementing protein 2							109.0	97.0	101.0					7																	152346361		2203	4300	6503	SO:0001583	missense	7516				meiosis	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity	g.chr7:152346361G>A	Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.209C>T	7.37:g.152346361G>A	ENSP00000352271:p.Ser70Leu						p.S70L	NM_005431	NP_005422	O43543	XRCC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)	3	295	-		all_hematologic(28;0.0592)|Prostate(32;0.081)	70					B2R925	Missense_Mutation	SNP	ENST00000359321.1	37	c.209C>T	CCDS5933.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326202	0.60743	.	.	ENSG00000196584	ENST00000359321	T	0.41758	0.99	5.39	5.39	0.77823	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.216608	0.40728	N	0.001021	T	0.50854	0.1640	M	0.72353	2.195	0.45528	D	0.998489	B	0.23990	0.095	B	0.33121	0.158	T	0.53034	-0.8495	10	0.66056	D	0.02	-9.8336	18.129	0.89595	0.0:0.0:1.0:0.0	.	70	O43543	XRCC2_HUMAN	L	70	ENSP00000352271:S70L	ENSP00000352271:S70L	S	-	2	0	XRCC2	151977294	1.000000	0.71417	0.969000	0.41365	0.923000	0.55619	4.880000	0.63107	2.509000	0.84616	0.591000	0.81541	TCA		0.388	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322783.1	NM_005431		8	38	0	0	0	0.006214	0	8	38				
RAB11FIP1	80223	broad.mit.edu	37	8	37728853	37728853	+	Missense_Mutation	SNP	G	G	A	rs75558150		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:37728853G>A	ENST00000330843.4	-	4	3479	c.3467C>T	c.(3466-3468)tCg>tTg	p.S1156L	RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000287263.4_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	1156					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			ATGTGTCTCCGAGGGTGAGAC	0.532											OREG0018713	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		18804	0.0		0.001	False		,,,				2504	0.0						uc003xkm.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(3466-3468)TCG>TTG		RAB11 family interacting protein 1 isoform 3		G	LEU/SER,	1,4405	2.1+/-5.4	0,1,2202	76.0	81.0	79.0		3467,	5.3	1.0	8	dbSNP_131	79	14,8586	9.8+/-36.6	0,14,4286	yes	missense,intron	RAB11FIP1	NM_001002814.2,NM_025151.4	145,	0,15,6488	AA,AG,GG		0.1628,0.0227,0.1153	probably-damaging,	1156/1284,	37728853	15,12991	2203	4300	6503	SO:0001583	missense	80223				protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding	g.chr8:37728853G>A	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.3467C>T	8.37:g.37728853G>A	ENSP00000331342:p.Ser1156Leu		OREG0018713	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	872	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Missense_Mutation_p.S485L|RAB11FIP1_uc003xko.1_Missense_Mutation_p.S485L|RAB11FIP1_uc003xkp.1_Intron	p.S1156L	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	LUSC - Lung squamous cell carcinoma(8;3.62e-11)		4	3511	-		Lung NSC(58;0.118)|all_lung(54;0.195)	1156					J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	37	c.3467C>T	CCDS34882.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	32	5.186435	0.94885	2.27E-4	0.001628	ENSG00000156675	ENST00000330843	T	0.18174	2.23	5.29	5.29	0.74685	.	0.000000	0.44902	D	0.000414	T	0.42404	0.1201	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.11941	-1.0567	10	0.40728	T	0.16	-12.4918	18.9538	0.92650	0.0:0.0:1.0:0.0	.	485;1156	Q67C35;Q6WKZ4	.;RFIP1_HUMAN	L	1156	ENSP00000331342:S1156L	ENSP00000331342:S1156L	S	-	2	0	RAB11FIP1	37848011	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	8.050000	0.89445	2.475000	0.83589	0.555000	0.69702	TCG		0.532	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151		12	52	0	0	0	0.001368	0	12	52				
ST18	9705	broad.mit.edu	37	8	53084928	53084928	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:53084928C>G	ENST00000276480.7	-	10	1176	c.493G>C	c.(493-495)Gac>Cac	p.D165H		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	165					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AAGCACTCGTCTGCTTCATCG	0.398																																							uc003xqz.2		NA																	0				ovary(4)|skin(1)	5						c.(493-495)GAC>CAC		suppression of tumorigenicity 18							116.0	106.0	109.0					8																	53084928		2203	4300	6503	SO:0001583	missense	9705					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:53084928C>G	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.493G>C	8.37:g.53084928C>G	ENSP00000276480:p.Asp165His					ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Missense_Mutation_p.D130H|ST18_uc011lds.1_Missense_Mutation_p.D70H|ST18_uc003xra.2_Missense_Mutation_p.D165H|ST18_uc003xrb.2_Missense_Mutation_p.D165H	p.D165H	NM_014682	NP_055497	O60284	ST18_HUMAN			5	649	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	165					Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	c.493G>C	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	3.982	-0.006207	0.07773	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.45276	0.9;0.9	5.63	3.83	0.44106	.	0.644929	0.16806	N	0.198789	T	0.29093	0.0723	L	0.31294	0.92	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.18335	-1.0340	10	0.41790	T	0.15	-8.5495	7.0389	0.25008	0.0:0.5881:0.269:0.1429	.	165	O60284	ST18_HUMAN	H	165	ENSP00000276480:D165H;ENSP00000428521:D165H	ENSP00000276480:D165H	D	-	1	0	ST18	53247481	0.716000	0.27956	0.008000	0.14137	0.122000	0.20287	1.508000	0.35769	0.721000	0.32231	0.655000	0.94253	GAC		0.398	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			7	52	0	0	0	0.00308	0	7	52				
TRPA1	8989	broad.mit.edu	37	8	72946612	72946612	+	Splice_Site	SNP	T	T	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:72946612T>C	ENST00000262209.4	-	22	2763	c.2556A>G	c.(2554-2556)agA>agG	p.R852R	RP11-383H13.1_ENST00000537896.1_Intron|TRPA1_ENST00000519720.1_5'UTR|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	852					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AATTTTCAAATCTAGAAAAGT	0.269																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(2554-2556)AGA>AGG		ankyrin-like protein 1	Menthol(DB00825)						30.0	32.0	31.0					8																	72946612		2197	4293	6490	SO:0001630	splice_region_variant	8989					integral to plasma membrane		g.chr8:72946612T>C	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2556-1A>G	8.37:g.72946612T>C						uc011lff.1_Intron|uc003xyy.2_Intron	p.R852R	NM_007332	NP_015628	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		22	2731	-			852			Cytoplasmic (Potential).		A6NIN6	Silent	SNP	ENST00000262209.4	37	c.2556A>G	CCDS34908.1																																																																																				0.269	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	Silent	5	16	0	0	0	0.001168	0	5	16				
ZFHX4	79776	broad.mit.edu	37	8	77766341	77766341	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:77766341C>A	ENST00000521891.2	+	10	7632	c.7184C>A	c.(7183-7185)cCc>cAc	p.P2395H	ZFHX4_ENST00000455469.2_Missense_Mutation_p.P2350H|ZFHX4_ENST00000050961.6_Missense_Mutation_p.P2350H|ZFHX4_ENST00000518282.1_Missense_Mutation_p.P2369H	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2350	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATTCCATCACCCAAACCAGAA	0.547										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(7048-7050)CCC>CAC		zinc finger homeodomain 4							46.0	52.0	50.0					8																	77766341		1939	4133	6072	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77766341C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7184C>A	8.37:g.77766341C>A	ENSP00000430497:p.Pro2395His	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.P2395H|ZFHX4_uc003yaw.1_Missense_Mutation_p.P2350H	p.P2350H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	7436	+			2350			Pro-rich.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.7049C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455261	0.63401	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50548	0.74;0.79;0.76;0.75	5.02	5.02	0.67125	.	0.000000	0.44285	U	0.000473	T	0.67097	0.2857	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	T	0.66268	-0.5966	10	0.45353	T	0.12	.	18.5414	0.91029	0.0:1.0:0.0:0.0	.	2350;2350;2395	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	H	2395;2379;2350;2350;2369	ENSP00000430497:P2395H;ENSP00000399605:P2350H;ENSP00000050961:P2350H;ENSP00000430848:P2369H	ENSP00000050961:P2350H	P	+	2	0	ZFHX4	77928896	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.309000	0.78937	2.611000	0.88343	0.650000	0.86243	CCC		0.547	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		29	53	1	0	5.61819e-17	0.005443	7.07428e-17	29	53				
RUNX1T1	862	broad.mit.edu	37	8	93088214	93088214	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:93088214C>T	ENST00000523629.1	-	2	521	c.67G>A	c.(67-69)Ggg>Agg	p.G23R	RUNX1T1_ENST00000360348.2_Intron|RUNX1T1_ENST00000436581.2_Intron|RUNX1T1_ENST00000522163.1_5'UTR|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.G23R|RUNX1T1_ENST00000518844.1_5'UTR|RUNX1T1_ENST00000520724.1_Intron	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	23					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TCAAAGTTCCCTTTTTTCCGG	0.343																																							uc003yfd.2		NA																	0				lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(67-69)GGG>AGG		acute myelogenous leukemia 1 translocation 1							159.0	154.0	156.0					8																	93088214		2203	4300	6503	SO:0001583	missense	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:93088214C>T	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.67G>A	8.37:g.93088214C>T	ENSP00000428543:p.Gly23Arg					RUNX1T1_uc003yfe.1_Intron|RUNX1T1_uc010mao.2_5'UTR|RUNX1T1_uc011lgi.1_Intron|RUNX1T1_uc003yfh.1_Intron	p.G23R	NM_175634	NP_783552	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		1	151	-			23					B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	c.67G>A	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.687027	0.48097	.	.	ENSG00000079102	ENST00000523629;ENST00000265814;ENST00000518992;ENST00000519847;ENST00000522467;ENST00000517919;ENST00000520583;ENST00000523168;ENST00000521375;ENST00000520974;ENST00000518954;ENST00000520428;ENST00000518449	T;T;T	0.42131	1.57;1.57;0.98	5.48	5.48	0.80851	.	.	.	.	.	T	0.55832	0.1945	L	0.40543	1.245	0.37175	D	0.903228	D	0.64830	0.994	D	0.67725	0.953	T	0.57820	-0.7745	9	0.45353	T	0.12	-10.8903	17.8811	0.88841	0.0:1.0:0.0:0.0	.	23	Q06455	MTG8_HUMAN	R	23	ENSP00000428543:G23R;ENSP00000265814:G23R;ENSP00000431094:G23R	ENSP00000265814:G23R	G	-	1	0	RUNX1T1	93157390	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.317000	0.65822	2.737000	0.93849	0.563000	0.77884	GGG		0.343	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		35	31	0	0	0	0.003755	0	35	31				
CSMD3	114788	broad.mit.edu	37	8	113304782	113304782	+	Silent	SNP	A	A	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:113304782A>C	ENST00000297405.5	-	55	9016	c.8772T>G	c.(8770-8772)ccT>ccG	p.P2924P	CSMD3_ENST00000343508.3_Silent_p.P2884P|CSMD3_ENST00000455883.2_Silent_p.P2755P|CSMD3_ENST00000352409.3_Silent_p.P2854P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2924	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACATAGGTGGAGGATGGCTCC	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(8770-8772)CCT>CCG		CUB and Sushi multiple domains 3 isoform 1							190.0	170.0	177.0					8																	113304782		2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:113304782A>C	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8772T>G	8.37:g.113304782A>C		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Silent_p.P2126P|CSMD3_uc003ynt.2_Silent_p.P2884P|CSMD3_uc011lhx.1_Silent_p.P2755P	p.P2924P	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			55	8931	-			2924			Extracellular (Potential).|Sushi 19.		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.8772T>G	CCDS6315.1																																																																																				0.408	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		63	43	0	0	0	0.00361	0	63	43				
TRPS1	7227	broad.mit.edu	37	8	116632237	116632237	+	Nonsense_Mutation	SNP	C	C	A	rs371442998		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:116632237C>A	ENST00000220888.5	-	2	208	c.49G>T	c.(49-51)Gag>Tag	p.E17*	TRPS1_ENST00000395715.3_Nonsense_Mutation_p.E30*|TRPS1_ENST00000519076.1_Nonsense_Mutation_p.E17*|TRPS1_ENST00000520276.1_Nonsense_Mutation_p.E21*|TRPS1_ENST00000519674.1_Nonsense_Mutation_p.E17*			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	17					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E30Q(1)|p.E17Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATCTGGCCCTCGCCTTCACTT	0.438									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(49-51)GAG>TAG		zinc finger transcription factor TRPS1							84.0	77.0	79.0					8																	116632237		1840	4096	5936	SO:0001587	stop_gained	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116632237C>A	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.49G>T	8.37:g.116632237C>A	ENSP00000220888:p.Glu17*					TRPS1_uc011lhy.1_Nonsense_Mutation_p.E21*|TRPS1_uc003yny.2_Nonsense_Mutation_p.E30*|TRPS1_uc010mcy.2_Nonsense_Mutation_p.E17*	p.E17*	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		2	508	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		17					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Nonsense_Mutation	SNP	ENST00000220888.5	37	c.49G>T		.	.	.	.	.	.	.	.	.	.	C	36	5.650176	0.96714	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674;ENST00000395713;ENST00000519815;ENST00000422939	.	.	.	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.2354	20.0966	0.97849	0.0:1.0:0.0:0.0	.	.	.	.	X	30;17;17;21;17;30;30;30	.	ENSP00000220888:E17X	E	-	1	0	TRPS1	116701412	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.940000	0.75917	2.751000	0.94390	0.650000	0.86243	GAG		0.438	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		26	44	1	0	1.39806e-14	0.008361	1.73258e-14	26	44				
COL14A1	7373	broad.mit.edu	37	8	121354682	121354682	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:121354682C>T	ENST00000297848.3	+	44	5155	c.4885C>T	c.(4885-4887)Cag>Tag	p.Q1629*	COL14A1_ENST00000309791.4_Nonsense_Mutation_p.Q1629*|COL14A1_ENST00000247781.3_Nonsense_Mutation_p.Q1534*	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ACAGCTCATCCAGAGTAAGTA	0.458																																							uc003yox.2		NA																	0				ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(4885-4887)CAG>TAG		collagen, type XIV, alpha 1 precursor							176.0	147.0	157.0					8																	121354682		2203	4300	6503	SO:0001587	stop_gained	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121354682C>T		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4885C>T	8.37:g.121354682C>T	ENSP00000297848:p.Gln1629*					COL14A1_uc003yoz.2_Nonsense_Mutation_p.Q594*	p.Q1629*	NM_021110	NP_066933	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		44	5150	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		1629						Nonsense_Mutation	SNP	ENST00000297848.3	37	c.4885C>T	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	46	12.606136	0.99682	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	.	.	.	5.31	4.43	0.53597	.	0.113565	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	14.1207	0.65184	0.0:0.8498:0.1502:0.0	.	.	.	.	X	1629;1629;1534	.	ENSP00000247781:Q1534X	Q	+	1	0	COL14A1	121423863	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.261000	0.72509	1.235000	0.43724	0.555000	0.69702	CAG		0.458	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		7	47	0	0	0	0.001984	0	7	47				
FAM135B	51059	broad.mit.edu	37	8	139164596	139164596	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:139164596G>C	ENST00000395297.1	-	13	2292	c.2122C>G	c.(2122-2124)Ccc>Gcc	p.P708A		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	708								p.P708T(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CGATCACTGGGCAACTCCAGA	0.537										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(2122-2124)CCC>GCC		hypothetical protein LOC51059							45.0	45.0	45.0					8																	139164596		1927	4123	6050	SO:0001583	missense	51059							g.chr8:139164596G>C	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2122C>G	8.37:g.139164596G>C	ENSP00000378710:p.Pro708Ala	HNSCC(54;0.14)				FAM135B_uc003yux.2_Missense_Mutation_p.P609A|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.P270A|FAM135B_uc003yvb.2_Missense_Mutation_p.P270A	p.P708A	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		13	2293	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		708					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.2122C>G	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	17.40	3.381132	0.61845	.	.	ENSG00000147724	ENST00000395297	T	0.18810	2.19	5.65	4.77	0.60923	.	0.184499	0.49305	N	0.000156	T	0.26159	0.0638	M	0.69823	2.125	0.35773	D	0.821082	P;B;B	0.46142	0.873;0.36;0.049	B;B;B	0.42959	0.403;0.278;0.026	T	0.37526	-0.9702	10	0.38643	T	0.18	-17.6079	10.7213	0.46042	0.0:0.143:0.7085:0.1486	.	708;708;708	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	A	708	ENSP00000378710:P708A	ENSP00000276737:P708A	P	-	1	0	FAM135B	139233778	1.000000	0.71417	0.867000	0.34043	0.968000	0.65278	4.001000	0.57046	1.378000	0.46305	0.655000	0.94253	CCC		0.537	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		23	12	0	0	0	0.002299	0	23	12				
COL22A1	169044	broad.mit.edu	37	8	139774680	139774680	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:139774680C>T	ENST00000303045.6	-	17	2279	c.1833G>A	c.(1831-1833)ggG>ggA	p.G611G	COL22A1_ENST00000435777.1_Silent_p.G611G	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	611	Collagen-like 3.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCCAGGCTTCCCAGGGAATC	0.567										HNSCC(7;0.00092)																													uc003yvd.2		NA																	0				ovary(11)|pancreas(1)|skin(1)	13						c.(1831-1833)GGG>GGA		collagen, type XXII, alpha 1							86.0	68.0	74.0					8																	139774680		2203	4300	6503	SO:0001819	synonymous_variant	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139774680C>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1833G>A	8.37:g.139774680C>T		HNSCC(7;0.00092)				COL22A1_uc011ljo.1_5'Flank	p.G611G	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		17	2280	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		611			Pro-rich.|Gly-rich.|Collagen-like 3.		B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	c.1833G>A	CCDS6376.1																																																																																				0.567	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		17	18	0	0	0	0.008871	0	17	18				
ZNF707	286075	broad.mit.edu	37	8	144776287	144776287	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:144776287G>A	ENST00000532205.1	+	8	1602	c.703G>A	c.(703-705)Gag>Aag	p.E235K	ZNF707_ENST00000532158.1_Missense_Mutation_p.E235K|ZNF707_ENST00000418203.2_Missense_Mutation_p.E235K|ZNF707_ENST00000454097.1_Missense_Mutation_p.E235K|ZNF707_ENST00000358656.4_Missense_Mutation_p.E235K|RP11-429J17.2_ENST00000531565.1_RNA			Q96C28	ZN707_HUMAN	zinc finger protein 707	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CTTCTGCTGCGAGGCCTGCGG	0.662																																							uc003yze.3		NA																	0				breast(1)	1						c.(703-705)GAG>AAG		zinc finger protein 707							15.0	18.0	17.0					8																	144776287		2124	4229	6353	SO:0001583	missense	286075				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr8:144776287G>A	AK001126	CCDS47932.1	8q24.3	2013-01-08				ENSG00000181135		"""Zinc fingers, C2H2-type"", ""-"""	27815	protein-coding gene	gene with protein product						12477932	Standard	NM_173831		Approved		uc010mfi.3	Q96C28		ENST00000532205.1:c.703G>A	8.37:g.144776287G>A	ENSP00000436212:p.Glu235Lys					ZNF707_uc010mfh.2_Missense_Mutation_p.E235K|ZNF707_uc010mfi.2_Missense_Mutation_p.E235K|ZNF707_uc003yzf.3_Missense_Mutation_p.E235K|ZNF707_uc003yzh.3_Missense_Mutation_p.E162K|ZNF707_uc011lkq.1_RNA|BREA2_uc010mfj.1_5'Flank	p.E235K	NM_173831	NP_776192	Q96C28	ZN707_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		7	1018	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		235			C2H2-type 3.		A8K317|B3KNY1|D3DWK7	Missense_Mutation	SNP	ENST00000532205.1	37	c.703G>A	CCDS47932.1	.	.	.	.	.	.	.	.	.	.	G	6.213	0.407429	0.11754	.	.	ENSG00000181135	ENST00000454097;ENST00000358656;ENST00000532158;ENST00000532205;ENST00000418203	T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21	2.99	1.95	0.26073	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06462	0.0166	L	0.31804	0.96	0.09310	N	1	B;D	0.53745	0.167;0.962	B;P	0.45167	0.094;0.472	T	0.31503	-0.9941	8	.	.	.	-22.1218	2.5076	0.04649	0.1771:0.0:0.5284:0.2945	.	160;235	B4DV46;Q96C28	.;ZN707_HUMAN	K	235	ENSP00000409029:E235K;ENSP00000351482:E235K;ENSP00000436250:E235K;ENSP00000436212:E235K;ENSP00000413215:E235K	.	E	+	1	0	ZNF707	144848275	0.000000	0.05858	0.166000	0.22797	0.031000	0.12232	-1.703000	0.01900	1.478000	0.48253	0.563000	0.77884	GAG		0.662	ZNF707-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382197.1	NM_173831		4	12	0	0	0	0.009096	0	4	12				
SCRIB	23513	broad.mit.edu	37	8	144891822	144891822	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr8:144891822C>T	ENST00000320476.3	-	14	1603	c.1597G>A	c.(1597-1599)Gag>Aag	p.E533K	SCRIB_ENST00000356994.2_Missense_Mutation_p.E533K|SCRIB_ENST00000377533.3_Missense_Mutation_p.E452K	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	533	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GGCTCAGCCTCAGAGACTGTG	0.667																																					Pancreas(51;966 1133 10533 14576 29674)	Pancreas(51;966 1133 10533 14576 29674)	uc003yzp.1		NA																	0				urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5						c.(1597-1599)GAG>AAG		scribble isoform b							56.0	53.0	54.0					8																	144891822		2203	4300	6503	SO:0001583	missense	23513				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding	g.chr8:144891822C>T	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1597G>A	8.37:g.144891822C>T	ENSP00000322938:p.Glu533Lys					SCRIB_uc003yzo.1_Missense_Mutation_p.E533K	p.E533K	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)		14	1604	-	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		533			Sufficient for targeting to adherens junction and to inhibit cell proliferation.		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	c.1597G>A	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	c	9.736	1.163592	0.21538	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.76448	-1.02;-1.02;-1.02	4.3	1.45	0.22620	.	.	.	.	.	T	0.54287	0.1849	N	0.14661	0.345	0.09310	N	1	B;B	0.24368	0.062;0.102	B;B	0.20767	0.014;0.031	T	0.36553	-0.9743	9	0.07644	T	0.81	.	6.5113	0.22224	0.0:0.6011:0.204:0.1949	.	533;533	Q14160;Q14160-3	SCRIB_HUMAN;.	K	533;533;452	ENSP00000349486:E533K;ENSP00000322938:E533K;ENSP00000366756:E452K	ENSP00000322938:E533K	E	-	1	0	SCRIB	144963810	0.177000	0.23109	0.001000	0.08648	0.005000	0.04900	2.333000	0.43912	0.072000	0.16694	-0.494000	0.04653	GAG		0.667	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356		9	80	0	0	0	0.004482	0	9	80				
GLDC	2731	broad.mit.edu	37	9	6602126	6602126	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:6602126T>A	ENST00000321612.6	-	8	1288	c.1138A>T	c.(1138-1140)Aac>Tac	p.N380Y		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	380					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	GTACAGATGTTGCTGGTAGCC	0.438																																							uc003zkc.2		NA																	0				ovary(2)	2						c.(1138-1140)AAC>TAC		glycine dehydrogenase (decarboxylating)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)						307.0	218.0	248.0					9																	6602126		2203	4300	6503	SO:0001583	missense	2731				glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding	g.chr9:6602126T>A	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1138A>T	9.37:g.6602126T>A	ENSP00000370737:p.Asn380Tyr						p.N380Y	NM_000170	NP_000161	P23378	GCSP_HUMAN		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	8	1331	-		Acute lymphoblastic leukemia(23;0.161)	380					Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	37	c.1138A>T	CCDS34987.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338226	0.81911	.	.	ENSG00000178445	ENST00000321612	D	0.98028	-4.67	4.81	4.81	0.61882	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Glycine cleavage system P-protein, N-terminal (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99287	0.9751	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98472	1.0601	10	0.87932	D	0	-29.2451	14.836	0.70183	0.0:0.0:0.0:1.0	.	380	P23378	GCSP_HUMAN	Y	380	ENSP00000370737:N380Y	ENSP00000370737:N380Y	N	-	1	0	GLDC	6592126	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.463000	0.80869	2.160000	0.67779	0.454000	0.30748	AAC		0.438	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170		8	21	0	0	0	0.004482	0	8	21				
MPDZ	8777	broad.mit.edu	37	9	13119517	13119517	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:13119517A>C	ENST00000319217.7	-	39	5610	c.5363T>G	c.(5362-5364)gTt>gGt	p.V1788G	MPDZ_ENST00000381022.2_Missense_Mutation_p.V1788G|MPDZ_ENST00000541718.1_Missense_Mutation_p.V1788G|MPDZ_ENST00000546205.1_Missense_Mutation_p.V1802G|MPDZ_ENST00000538841.1_Missense_Mutation_p.V647G|MPDZ_ENST00000381015.4_Missense_Mutation_p.V1788G|MPDZ_ENST00000447879.1_Missense_Mutation_p.V1755G|MPDZ_ENST00000541093.1_Missense_Mutation_p.V22G|MPDZ_ENST00000536827.1_Missense_Mutation_p.V1755G	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1788	PDZ 11. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CAAAGCGGCAACCGCTTCTTG	0.393																																							uc010mia.1		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(5362-5364)GTT>GGT		multiple PDZ domain protein							148.0	143.0	145.0					9																	13119517		1856	4105	5961	SO:0001583	missense	8777				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding	g.chr9:13119517A>C	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5363T>G	9.37:g.13119517A>C	ENSP00000320006:p.Val1788Gly					MPDZ_uc003zkx.3_Missense_Mutation_p.V53G|MPDZ_uc003zky.3_Missense_Mutation_p.V322G|MPDZ_uc010mib.2_Missense_Mutation_p.V493G|MPDZ_uc010mhx.2_Missense_Mutation_p.V610G|MPDZ_uc011lmm.1_Missense_Mutation_p.V647G|MPDZ_uc003zkz.3_Missense_Mutation_p.V481G|MPDZ_uc010mhy.2_Missense_Mutation_p.V1788G|MPDZ_uc010mhz.2_Missense_Mutation_p.V1755G|MPDZ_uc011lmn.1_Missense_Mutation_p.V1755G|MPDZ_uc003zlb.3_Missense_Mutation_p.V1788G	p.V1788G	NM_003829	NP_003820	O75970	MPDZ_HUMAN		GBM - Glioblastoma multiforme(50;2.03e-06)	38	5420	-			1788			PDZ 11.		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37	c.5363T>G		.	.	.	.	.	.	.	.	.	.	A	17.76	3.468424	0.63625	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000438511;ENST00000541093;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T;T;T;T;T	0.53640	0.7;0.61;0.61;0.7;0.61;0.7;0.7;0.61;0.7;0.7;0.7	6.03	6.03	0.97812	PDZ/DHR/GLGF (4);	0.000000	0.42294	D	0.000727	T	0.75852	0.3906	M	0.92459	3.31	0.80722	D	1	D;D;D;D;D;D;D;D	0.67145	0.988;0.977;0.977;0.985;0.994;0.995;0.996;0.977	P;P;P;P;D;P;D;P	0.71656	0.876;0.904;0.904;0.804;0.974;0.804;0.938;0.904	T	0.81398	-0.0951	10	0.56958	D	0.05	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	1755;647;493;1755;1668;1788;1788;481	B7ZMI4;B7ZB24;B4DGX5;O75970-3;E7EPZ1;O75970-2;O75970;B3KRN5	.;.;.;.;.;.;MPDZ_HUMAN;.	G	1788;1788;1788;329;22;724;647;1755;1755;1788;1668;1802	ENSP00000320006:V1788G;ENSP00000439807:V1788G;ENSP00000370410:V1788G;ENSP00000415964:V329G;ENSP00000445259:V22G;ENSP00000444230:V724G;ENSP00000444717:V647G;ENSP00000444151:V1755G;ENSP00000415208:V1755G;ENSP00000370403:V1788G;ENSP00000446358:V1802G	ENSP00000320006:V1788G	V	-	2	0	MPDZ	13109517	1.000000	0.71417	0.821000	0.32701	0.450000	0.32258	6.237000	0.72345	2.308000	0.77769	0.533000	0.62120	GTT		0.393	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		11	34	0	0	0	0.008291	0	11	34				
FAM154A	158297	broad.mit.edu	37	9	18928121	18928121	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:18928121G>A	ENST00000380534.4	-	4	1633	c.1354C>T	c.(1354-1356)Cag>Tag	p.Q452*	FAM154A_ENST00000542071.1_Nonsense_Mutation_p.Q260*|FAM154A_ENST00000380530.1_3'UTR	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	452										breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		CTGCTCTGCTGAGAGCCTGCC	0.453																																							uc003zni.1		NA																	0				pancreas(1)	1						c.(1354-1356)CAG>TAG		hypothetical protein LOC158297							81.0	82.0	82.0					9																	18928121		2203	4300	6503	SO:0001587	stop_gained	158297							g.chr9:18928121G>A	BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.1354C>T	9.37:g.18928121G>A	ENSP00000369907:p.Gln452*					FAM154A_uc010mip.1_Nonsense_Mutation_p.Q260*	p.Q452*	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN		GBM - Glioblastoma multiforme(50;6.53e-16)	4	1632	-			452					Q5VY58	Nonsense_Mutation	SNP	ENST00000380534.4	37	c.1354C>T	CCDS6487.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200467	0.94997	.	.	ENSG00000155875	ENST00000380534;ENST00000542071	.	.	.	4.64	-1.04	0.10068	.	1.603170	0.03676	N	0.244847	.	.	.	.	.	.	0.43890	D	0.996517	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	4.9142	1.502	0.02478	0.1755:0.1338:0.4017:0.289	.	.	.	.	X	452;260	.	ENSP00000369907:Q452X	Q	-	1	0	FAM154A	18918121	0.010000	0.17322	0.045000	0.18777	0.221000	0.24807	0.711000	0.25764	-0.010000	0.14271	0.650000	0.86243	CAG		0.453	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051811.1	NM_153707		19	32	0	0	0	0.006122	0	19	32				
TAF1L	138474	broad.mit.edu	37	9	32633792	32633792	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:32633792G>T	ENST00000242310.4	-	1	1875	c.1786C>A	c.(1786-1788)Caa>Aaa	p.Q596K	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	596					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AGACCCTGTTGCTTGGGGAAA	0.483																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(1786-1788)CAA>AAA		TBP-associated factor RNA polymerase 1-like							180.0	188.0	185.0					9																	32633792		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32633792G>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1786C>A	9.37:g.32633792G>T	ENSP00000418379:p.Gln596Lys					uc003zrh.1_RNA	p.Q596K	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	1876	-			596					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.1786C>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732548	0.30684	.	.	ENSG00000122728	ENST00000242310	T	0.10288	2.89	1.04	1.04	0.20106	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.03739	0.0106	N	0.04043	-0.29	0.45139	D	0.998153	B	0.32968	0.392	B	0.30401	0.115	T	0.50734	-0.8793	10	0.17369	T	0.5	.	7.4859	0.27432	0.0:0.0:1.0:0.0	.	596	Q8IZX4	TAF1L_HUMAN	K	596	ENSP00000418379:Q596K	ENSP00000418379:Q596K	Q	-	1	0	TAF1L	32623792	1.000000	0.71417	0.931000	0.37212	0.273000	0.26683	6.164000	0.71885	0.507000	0.28148	0.195000	0.17529	CAA		0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			66	692	1	0	3.30712e-30	0.00361	4.38553e-30	66	692				
CHMP5	51510	broad.mit.edu	37	9	33266023	33266023	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:33266023G>C	ENST00000223500.8	+	2	222	c.85G>C	c.(85-87)Gaa>Caa	p.E29Q	BAG1_ENST00000379704.2_5'Flank|CHMP5_ENST00000419016.2_Missense_Mutation_p.E29Q|BAG1_ENST00000472232.3_5'Flank	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5	29					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			CAGTAGAGCAGAATCCATTGA	0.448																																							uc003zsl.3		NA																	0				ovary(1)	1						c.(85-87)GAA>CAA		chromatin modifying protein 5							83.0	78.0	79.0					9																	33266023		2203	4300	6503	SO:0001583	missense	51510				cellular membrane organization|protein transport	cytosol|endosome membrane	protein binding	g.chr9:33266023G>C	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765	ENST00000223500.8:c.85G>C	9.37:g.33266023G>C	ENSP00000223500:p.Glu29Gln					SUGT1P1_uc010mjq.1_Intron|BAG1_uc003zsi.2_5'Flank|BAG1_uc003zsj.2_5'Flank|BAG1_uc003zsk.2_5'Flank|CHMP5_uc003zsm.3_Missense_Mutation_p.E29Q|CHMP5_uc011lnv.1_Missense_Mutation_p.E29Q	p.E29Q	NM_016410	NP_057494	Q9NZZ3	CHMP5_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00506)		3	440	+			29			Potential.		B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Missense_Mutation	SNP	ENST00000223500.8	37	c.85G>C	CCDS6537.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060103	0.76074	.	.	ENSG00000086065	ENST00000223500;ENST00000419016	T;T	0.72835	-0.69;-0.69	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.83238	0.5211	M	0.82193	2.58	0.58432	D	0.999997	P;P	0.49961	0.735;0.93	P;P	0.57720	0.575;0.826	D	0.84518	0.0626	10	0.52906	T	0.07	-10.108	17.0103	0.86404	0.0:0.0:1.0:0.0	.	29;29	B4DIR6;Q9NZZ3	.;CHMP5_HUMAN	Q	29	ENSP00000223500:E29Q;ENSP00000442725:E29Q	ENSP00000223500:E29Q	E	+	1	0	CHMP5	33256023	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	9.349000	0.97066	2.610000	0.88304	0.462000	0.41574	GAA		0.448	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410		16	26	0	0	0	0.00499	0	16	26				
CA9	768	broad.mit.edu	37	9	35675908	35675908	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:35675908T>G	ENST00000378357.4	+	3	688	c.584T>G	c.(583-585)cTg>cGg	p.L195R		NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	195	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	GAACTGCGCCTGCGCAACAAT	0.731																																							uc003zxo.3		NA																	0				ovary(4)|skin(1)	5						c.(583-585)CTG>CGG		carbonic anhydrase IX precursor							19.0	22.0	21.0					9																	35675908		1752	3601	5353	SO:0001583	missense	768				one-carbon metabolic process	integral to membrane|microvillus membrane|nucleolus	carbonate dehydratase activity|zinc ion binding	g.chr9:35675908T>G	X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.584T>G	9.37:g.35675908T>G	ENSP00000367608:p.Leu195Arg					C9orf100_uc003zxl.2_5'Flank|CA9_uc003zxp.3_Missense_Mutation_p.L195R	p.L195R	NM_001216	NP_001207	Q16790	CAH9_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		3	626	+	all_epithelial(49;0.217)		195			Extracellular.|Catalytic.		Q5T4R1	Missense_Mutation	SNP	ENST00000378357.4	37	c.584T>G	CCDS6585.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.327526	0.81690	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.70045	-0.45	4.68	4.68	0.58851	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.106072	0.38005	N	0.001852	D	0.84629	0.5514	M	0.93898	3.47	0.47949	D	0.999555	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.87649	0.2527	10	0.87932	D	0	.	10.6845	0.45835	0.0:0.0:0.0:1.0	.	195;195	F5H404;Q16790	.;CAH9_HUMAN	R	195	ENSP00000367608:L195R	ENSP00000367608:L195R	L	+	2	0	CA9	35665908	0.929000	0.31497	1.000000	0.80357	0.964000	0.63967	3.909000	0.56363	2.088000	0.63022	0.459000	0.35465	CTG		0.731	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216		16	60	0	0	0	0.006122	0	16	60				
SPATA31A2	642265	broad.mit.edu	37	9	39888179	39888179	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:39888179C>A	ENST00000456183.2	+	4	1195	c.1166C>A	c.(1165-1167)tCg>tAg	p.S389*		NM_001040065.1	NP_001035154.1	Q5RGS2	S31A2_HUMAN	SPATA31 subfamily A, member 2	389					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGAGAGAACTCGAAACAGCTG	0.483																																							uc004abp.2		NA																	0					0						c.(1165-1167)TCG>TAG		hypothetical protein LOC642265							11.0	11.0	11.0					9																	39888179		1164	2486	3650	SO:0001587	stop_gained	642265					integral to membrane		g.chr9:39888179C>A			9p13.1	2012-10-15	2012-10-12	2012-10-12	ENSG00000204848				32002	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A2"""	FAM75A2		20850414	Standard			Approved	OTTHUMG00000013563	uc004abm.3	Q5RGS2	OTTHUMG00000013563	ENST00000456183.2:c.1166C>A	9.37:g.39888179C>A	ENSP00000406957:p.Ser389*						p.S389*	NM_001040065	NP_001035154	Q5RGS2	F75A2_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	4	1195	+			389						Nonsense_Mutation	SNP	ENST00000456183.2	37	c.1166C>A	CCDS43809.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583261	0.65992	.	.	ENSG00000204848	ENST00000456183	.	.	.	1.85	0.915	0.19366	.	1.385230	0.04713	N	0.417874	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-0.0403	4.3048	0.10942	0.0:0.7873:0.0:0.2127	.	.	.	.	X	389	.	ENSP00000406957:S389X	S	+	2	0	FAM75A2	39878179	0.000000	0.05858	0.002000	0.10522	0.210000	0.24377	-0.325000	0.07976	0.373000	0.24621	0.121000	0.15741	TCG		0.483	SPATA31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037739.1	NM_001040065		33	39	1	0	1.67305e-13	0.00623	2.05023e-13	33	39				
RORB	6096	broad.mit.edu	37	9	77286800	77286800	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:77286800G>C	ENST00000396204.2	+	9	1240	c.1240G>C	c.(1240-1242)Gat>Cat	p.D414H	RORB_ENST00000376896.3_Missense_Mutation_p.D403H			Q92753	RORB_HUMAN	RAR-related orphan receptor B	414	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	TCACCTGGATGATGAGACCTT	0.428																																							uc004aji.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(1240-1242)GAT>CAT		RAR-related orphan receptor B							48.0	47.0	48.0					9																	77286800		2203	4299	6502	SO:0001583	missense	6096				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr9:77286800G>C	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1240G>C	9.37:g.77286800G>C	ENSP00000379507:p.Asp414His					RORB_uc004ajh.2_Missense_Mutation_p.D403H	p.D414H	NM_006914	NP_008845	Q92753	RORB_HUMAN			9	1289	+			414			Ligand-binding (Potential).		Q8WX73	Missense_Mutation	SNP	ENST00000396204.2	37	c.1240G>C		.	.	.	.	.	.	.	.	.	.	G	19.88	3.909002	0.72868	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.97041	-4.22;-4.22	5.73	5.73	0.89815	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.157760	0.56097	D	0.000034	D	0.96876	0.8980	L	0.53561	1.675	0.80722	D	1	P;B	0.38535	0.635;0.328	P;B	0.45577	0.486;0.369	D	0.96400	0.9296	10	0.52906	T	0.07	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	414;403	Q92753;Q58EY0	RORB_HUMAN;.	H	403;414	ENSP00000366093:D403H;ENSP00000379507:D414H	ENSP00000366093:D403H	D	+	1	0	RORB	76476620	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.861000	0.98227	0.655000	0.94253	GAT		0.428	RORB-201	KNOWN	basic	protein_coding	protein_coding				13	19	0	0	0	0.003163	0	13	19				
OMD	4958	broad.mit.edu	37	9	95179237	95179237	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:95179237G>A	ENST00000375550.4	-	2	879	c.604C>T	c.(604-606)Ctg>Ttg	p.L202L	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	202					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						TCTTTTAGCAGAGAATCATGA	0.378			T	USP6	aneurysmal bone cysts																																		uc004asd.3		NA		Dom	yes		9	9q22.31	4958	T	osteomodulin			M	USP6		aneurysmal bone cysts		0				ovary(2)	2						c.(604-606)CTG>TTG		osteomodulin precursor							103.0	101.0	101.0					9																	95179237		2203	4300	6503	SO:0001819	synonymous_variant	4958				cell adhesion	proteinaceous extracellular matrix		g.chr9:95179237G>A	AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.604C>T	9.37:g.95179237G>A						CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron	p.L202L	NM_005014	NP_005005	Q99983	OMD_HUMAN			2	973	-			202			LRR 5.		Q5TBF4	Silent	SNP	ENST00000375550.4	37	c.604C>T	CCDS6696.1																																																																																				0.378	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053090.1	NM_005014		19	47	0	0	0	0.006122	0	19	47				
CDK5RAP2	55755	broad.mit.edu	37	9	123169402	123169402	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:123169402G>A	ENST00000349780.4	-	32	5030	c.4851C>T	c.(4849-4851)agC>agT	p.S1617S	CDK5RAP2_ENST00000360190.4_Intron|CDK5RAP2_ENST00000360822.3_Silent_p.S1585S|CDK5RAP2_ENST00000359309.3_Silent_p.S1576S	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1617					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CCTTGAGCCTGCTCTGCAGAG	0.602																																							uc004bkf.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(4849-4851)AGC>AGT		CDK5 regulatory subunit associated protein 2							105.0	81.0	89.0					9																	123169402		2203	4300	6503	SO:0001819	synonymous_variant	55755				brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding	g.chr9:123169402G>A	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.4851C>T	9.37:g.123169402G>A						CDK5RAP2_uc010mvi.2_Silent_p.S626S|CDK5RAP2_uc004bke.2_Silent_p.S902S|CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Silent_p.S882S|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_Silent_p.S882S|CDK5RAP2_uc011lya.1_Silent_p.S882S|CDK5RAP2_uc004bkh.1_Silent_p.S1387S|CDK5RAP2_uc004bki.2_3'UTR	p.S1617S	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN			32	5032	-			1617					Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	37	c.4851C>T	CCDS6823.1																																																																																				0.602	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249		14	35	0	0	0	0.004007	0	14	35				
STRBP	55342	broad.mit.edu	37	9	125895246	125895246	+	Splice_Site	SNP	G	G	C			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:125895246G>C	ENST00000348403.5	-	17	2204	c.1775C>G	c.(1774-1776)gCa>gGa	p.A592G	STRBP_ENST00000447404.2_Splice_Site_p.A592G|STRBP_ENST00000360998.3_Splice_Site_p.A578G	NM_018387.4	NP_060857.2	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	592					cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						AACGCCCTTTGCCTGTTAAAA	0.428																																							uc004bns.2		NA																	0				breast(1)|skin(1)	2						c.(1774-1776)GCA>GGA		spermatid perinuclear RNA binding protein							82.0	77.0	78.0					9																	125895246		2203	4300	6503	SO:0001630	splice_region_variant	55342				multicellular organismal development	cytoplasm|nucleus	DNA binding	g.chr9:125895246G>C	AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000348403.5:c.1774-1C>G	9.37:g.125895246G>C						STRBP_uc004bnt.2_Missense_Mutation_p.A410G|STRBP_uc004bnu.2_Missense_Mutation_p.A578G|STRBP_uc004bnv.2_Missense_Mutation_p.A592G|STRBP_uc004bnr.2_Missense_Mutation_p.A151G	p.A592G	NM_018387	NP_060857	Q96SI9	STRBP_HUMAN			17	2205	-			592					Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	Missense_Mutation	SNP	ENST00000348403.5	37	c.1775C>G	CCDS6851.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650204	0.67472	.	.	ENSG00000165209	ENST00000447404;ENST00000348403;ENST00000360998	T;T;T	0.18174	2.49;2.49;2.23	5.96	5.96	0.96718	.	0.256050	0.44097	D	0.000488	T	0.14743	0.0356	N	0.19112	0.55	0.39517	D	0.968449	B;B	0.19200	0.02;0.034	B;B	0.18561	0.01;0.022	T	0.10636	-1.0621	10	0.29301	T	0.29	-9.1247	20.4113	0.99016	0.0:0.0:1.0:0.0	.	592;578	Q96SI9;Q96SI9-2	STRBP_HUMAN;.	G	592;592;578	ENSP00000415968:A592G;ENSP00000321347:A592G;ENSP00000354271:A578G	ENSP00000321347:A592G	A	-	2	0	STRBP	124935067	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.952000	0.70282	2.829000	0.97493	0.579000	0.79373	GCA		0.428	STRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053982.1		Missense_Mutation	21	17	0	0	0	0.012319	0	21	17				
RAPGEF1	2889	broad.mit.edu	37	9	134525549	134525549	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:134525549G>A	ENST00000372189.3	-	3	354	c.231C>T	c.(229-231)acC>acT	p.T77T	RAPGEF1_ENST00000372190.3_Silent_p.T95T|RAPGEF1_ENST00000372195.1_Silent_p.T94T	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	77					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CCACAGCACTGGTGGACATAA	0.502																																							uc004cbc.2		NA																	0				lung(3)|ovary(2)|breast(1)|skin(1)	7						c.(229-231)ACC>ACT		guanine nucleotide-releasing factor 2 isoform a							48.0	49.0	49.0					9																	134525549		1943	4157	6100	SO:0001819	synonymous_variant	2889				activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr9:134525549G>A	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.231C>T	9.37:g.134525549G>A						RAPGEF1_uc004cbb.2_Silent_p.T95T|RAPGEF1_uc010mzn.2_Silent_p.T82T|RAPGEF1_uc004cbd.2_Silent_p.T82T	p.T77T	NM_005312	NP_005303	Q13905	RPGF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)	3	361	-		Myeloproliferative disorder(178;0.204)	77					Q5JUE4|Q8IV73	Silent	SNP	ENST00000372189.3	37	c.231C>T	CCDS48047.1																																																																																				0.502	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312		9	12	0	0	0	0.006214	0	9	12				
VAV2	7410	broad.mit.edu	37	9	136642532	136642532	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:136642532C>A	ENST00000371850.3	-	23	1975	c.1944G>T	c.(1942-1944)aaG>aaT	p.K648N	VAV2_ENST00000406606.3_Missense_Mutation_p.K638N|VAV2_ENST00000371851.1_Missense_Mutation_p.K638N	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	648	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K638N(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		CAGGGCAGGGCTTCACAGATG	0.597																																							uc004ces.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						c.(1942-1944)AAG>AAT		vav 2 guanine nucleotide exchange factor isoform							143.0	137.0	139.0					9																	136642532		2203	4300	6503	SO:0001583	missense	7410				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity	g.chr9:136642532C>A		CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.1944G>T	9.37:g.136642532C>A	ENSP00000360916:p.Lys648Asn					VAV2_uc004cer.2_Missense_Mutation_p.K638N|VAV2_uc004cet.1_Missense_Mutation_p.K187N	p.K648N	NM_001134398	NP_001127870	P52735	VAV2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)	23	1990	-			648			SH3 1.		A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	c.1944G>T	CCDS48053.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604194	0.66445	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;T	0.16457	2.34;2.34;2.34	4.43	3.51	0.40186	Src homology-3 domain (3);Variant SH3 (1);	0.103138	0.64402	D	0.000004	T	0.25901	0.0631	L	0.61218	1.895	0.49130	D	0.999759	B;D;B	0.53462	0.215;0.96;0.215	B;P;B	0.52031	0.135;0.688;0.135	T	0.00912	-1.1517	10	0.42905	T	0.14	.	9.909	0.41394	0.0:0.8375:0.0:0.1625	.	638;648;638	P52735-2;P52735;P52735-3	.;VAV2_HUMAN;.	N	648;638;638;638	ENSP00000360916:K648N;ENSP00000360917:K638N;ENSP00000385362:K638N	ENSP00000317258:K638N	K	-	3	2	VAV2	135632353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.000000	0.29770	2.288000	0.76882	0.655000	0.94253	AAG		0.597	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			41	60	1	0	1.61863e-15	0.00361	2.02421e-15	41	60				
TRAF2	7186	broad.mit.edu	37	9	139794921	139794921	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:139794921C>T	ENST00000247668.2	+	4	367	c.315C>T	c.(313-315)gcC>gcT	p.A105A	TRAF2_ENST00000536468.1_Silent_p.A105A|TRAF2_ENST00000359662.3_Silent_p.A105A	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	105					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		GCCTGCCGGCCGTCTGTCCCA	0.597																																							uc010nbu.2		NA																	0				ovary(1)|lung(1)|breast(1)|skin(1)	4						c.(313-315)GCC>GCT		TNF receptor-associated factor 2							58.0	51.0	53.0					9																	139794921		2203	4300	6503	SO:0001819	synonymous_variant	7186				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:139794921C>T	U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.315C>T	9.37:g.139794921C>T						TRAF2_uc010nbv.1_Silent_p.A105A|TRAF2_uc004cjv.2_Silent_p.A105A|TRAF2_uc011mek.1_Silent_p.A94A|TRAF2_uc010nbw.2_Silent_p.A105A	p.A105A	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)	5	488	+	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	105					A8K107|B4DPJ7|Q7Z337|Q96NT2	Silent	SNP	ENST00000247668.2	37	c.315C>T	CCDS7013.1																																																																																				0.597	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055166.1	NM_021138		3	20	0	0	0	0.009096	0	3	20				
TUBBP5	643224	broad.mit.edu	37	9	141071425	141071425	+	RNA	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:141071425C>T	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		TCCCCGACAACGTAAAAACAG	0.502																																							uc004com.2		NA																	0					0						c.(826-828)AAC>AAT		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141071425C>T	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071425C>T						TUBBP5_uc010ncq.2_3'UTR	p.N276N							4	1089	+									Silent	SNP	ENST00000503395.1	37	c.828C>T																																																																																					0.502	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		30	31	0	0	0	0.00874	0	30	31				
OFD1	8481	broad.mit.edu	37	X	13778481	13778481	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:13778481G>T	ENST00000340096.6	+	16	2229	c.1902G>T	c.(1900-1902)agG>agT	p.R634S	OFD1_ENST00000380550.3_Missense_Mutation_p.R594S|OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380567.1_Missense_Mutation_p.R494S	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	634	Mediates homooligomerization.|Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CTAAGGCAAGGGTCAAAGAGC	0.468																																							uc004cvp.3		NA																	0					0						c.(1900-1902)AGG>AGT		oral-facial-digital syndrome 1							98.0	83.0	88.0					X																	13778481		2203	4300	6503	SO:0001583	missense	8481				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding	g.chrX:13778481G>T	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1902G>T	X.37:g.13778481G>T	ENSP00000344314:p.Arg634Ser					OFD1_uc004cvr.3_Missense_Mutation_p.R201S|OFD1_uc011mil.1_Missense_Mutation_p.R201S|OFD1_uc004cvq.3_Missense_Mutation_p.R494S|OFD1_uc010nen.2_Missense_Mutation_p.R633S|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.R593S|OFD1_uc004cvv.3_Missense_Mutation_p.R593S	p.R634S	NM_003611	NP_003602	O75665	OFD1_HUMAN			16	2261	+			634			Potential.|Mediates the interaction with SDCCAG8.|Mediates homooligomerization.		B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	ENST00000340096.6	37	c.1902G>T	CCDS14157.1	.	.	.	.	.	.	.	.	.	.	.	16.30	3.085103	0.55861	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.98249	-4.82;-4.78;-2.59	5.67	0.573	0.17363	.	0.106369	0.64402	D	0.000013	D	0.98065	0.9362	M	0.70275	2.135	0.09310	N	1	D;D;D;D;D	0.69078	0.997;0.992;0.997;0.992;0.992	P;P;P;P;P	0.61132	0.884;0.826;0.884;0.813;0.826	D	0.95176	0.8295	10	0.66056	D	0.02	-7.3205	10.7023	0.45934	0.5336:0.0:0.4664:0.0	.	634;594;302;494;634	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	S	594;634;494	ENSP00000369923:R594S;ENSP00000344314:R634S;ENSP00000369941:R494S	ENSP00000344314:R634S	R	+	3	2	OFD1	13688402	0.990000	0.36364	0.000000	0.03702	0.801000	0.45260	0.328000	0.19681	-0.347000	0.08299	-0.297000	0.09499	AGG		0.468	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611		25	23	1	0	1.85244e-09	0.00333	2.19179e-09	25	23				
XK	7504	broad.mit.edu	37	X	37587654	37587654	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:37587654G>T	ENST00000378616.3	+	3	1477	c.1274G>T	c.(1273-1275)aGc>aTc	p.S425I	TM4SF2_ENST00000465127.1_Intron	NM_021083.2	NP_066569.1	P51811	XK_HUMAN	X-linked Kx blood group	425					amino acid transport (GO:0006865)|transport (GO:0006810)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	15		all_lung(315;0.175)				ACACCTTCTAGCAGTAAAACA	0.473																																							uc004ddq.2		NA																	0					0						c.(1273-1275)AGC>ATC		membrane transport protein XK							84.0	79.0	81.0					X																	37587654		2202	4300	6502	SO:0001583	missense	7504				amino acid transport	integral to membrane	protein binding|transporter activity	g.chrX:37587654G>T	Z32684	CCDS14241.1	Xp21.1	2014-07-19	2014-06-18		ENSG00000047597	ENSG00000047597		"""Blood group antigens"""	12811	protein-coding gene	gene with protein product	"""Kx antigen"", ""McLeod syndrome"""	314850	"""Kell blood group precursor (McLeod phenotype)"", ""XK, Kell blood group complex subunit (McLeod syndrome)"", ""neuroacanthocytosis"", ""neurocanthocytosis"""	NA, NAC		8004674, 11761473	Standard	NM_021083		Approved	XKR1, Kx, X1k	uc004ddq.3	P51811	OTTHUMG00000033171	ENST00000378616.3:c.1274G>T	X.37:g.37587654G>T	ENSP00000367879:p.Ser425Ile						p.S425I	NM_021083	NP_066569	P51811	XK_HUMAN			3	1356	+		all_lung(315;0.175)	425			Cytoplasmic (Potential).		Q4TTN6|Q8IUK6|Q9UC77	Missense_Mutation	SNP	ENST00000378616.3	37	c.1274G>T	CCDS14241.1	.	.	.	.	.	.	.	.	.	.	G	3.144	-0.175615	0.06421	.	.	ENSG00000047597	ENST00000378616	T	0.65549	-0.16	5.6	2.75	0.32379	.	0.575696	0.20480	N	0.091509	T	0.46814	0.1412	L	0.29908	0.895	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.33574	-0.9863	10	0.44086	T	0.13	-21.3001	8.8902	0.35429	0.0775:0.2653:0.6572:0.0	.	425	P51811	XK_HUMAN	I	425	ENSP00000367879:S425I	ENSP00000367879:S425I	S	+	2	0	XK	37472593	0.985000	0.35326	0.268000	0.24571	0.031000	0.12232	2.096000	0.41738	0.144000	0.18951	-0.192000	0.12808	AGC		0.473	XK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080875.1	NM_021083		41	30	1	0	1.63429e-32	0.00361	2.18303e-32	41	30				
USP11	8237	broad.mit.edu	37	X	47104483	47104483	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:47104483G>A	ENST00000218348.3	+	16	2284	c.2284G>A	c.(2284-2286)Gag>Aag	p.E762K	USP11_ENST00000377107.2_Missense_Mutation_p.E719K	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	762	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						GGTAGAGGCTGAGGTAAATGA	0.557																																							uc004dhp.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(2284-2286)GAG>AAG		ubiquitin specific peptidase 11							74.0	63.0	66.0					X																	47104483		2203	4300	6503	SO:0001583	missense	8237				protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chrX:47104483G>A	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2284G>A	X.37:g.47104483G>A	ENSP00000218348:p.Glu762Lys					USP11_uc004dhq.2_Missense_Mutation_p.E488K	p.E762K	NM_004651	NP_004642	P51784	UBP11_HUMAN			16	2284	+			762					B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	c.2284G>A	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487300	0.84854	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.23950	1.9;1.88	5.22	5.22	0.72569	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.151200	0.43260	D	0.000589	T	0.45776	0.1359	L	0.50993	1.605	0.50467	D	0.999872	D;D	0.64830	0.994;0.994	D;D	0.69479	0.964;0.913	T	0.43491	-0.9388	10	0.87932	D	0	-27.7923	16.5566	0.84486	0.0:0.0:1.0:0.0	.	488;762	B3KP28;P51784	.;UBP11_HUMAN	K	719;762	ENSP00000366311:E719K;ENSP00000218348:E762K	ENSP00000218348:E762K	E	+	1	0	USP11	46989427	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	9.249000	0.95470	2.166000	0.68216	0.513000	0.50165	GAG		0.557	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651		3	6	0	0	0	0.004672	0	3	6				
SHROOM4	57477	broad.mit.edu	37	X	50350668	50350668	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:50350668C>A	ENST00000289292.7	-	6	3757	c.3474G>T	c.(3472-3474)gaG>gaT	p.E1158D	SHROOM4_ENST00000376020.2_Missense_Mutation_p.E1158D|SHROOM4_ENST00000460112.3_Missense_Mutation_p.E1042D			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1158	Glu-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGGGTGGCAGctcctcttcct	0.562																																							uc004dpe.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(3472-3474)GAG>GAT		shroom family member 4							34.0	29.0	31.0					X																	50350668		2203	4300	6503	SO:0001583	missense	57477				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding	g.chrX:50350668C>A	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3474G>T	X.37:g.50350668C>A	ENSP00000289292:p.Glu1158Asp					SHROOM4_uc004dpd.3_RNA	p.E1158D	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN			6	3500	-	Ovarian(276;0.236)		1158			Glu-rich.		A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	c.3474G>T	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	C	7.817	0.716896	0.15306	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.13420	2.59;2.59;2.59	4.26	-2.77	0.05877	.	0.588882	0.16524	N	0.210641	T	0.04724	0.0128	N	0.14661	0.345	0.23023	N	0.998415	B	0.11235	0.004	B	0.04013	0.001	T	0.36089	-0.9762	10	0.16420	T	0.52	.	0.9228	0.01318	0.1461:0.2298:0.2981:0.3259	.	1158	Q9ULL8	SHRM4_HUMAN	D	1158;1158;1042	ENSP00000289292:E1158D;ENSP00000365188:E1158D;ENSP00000421450:E1042D	ENSP00000289292:E1158D	E	-	3	2	SHROOM4	50367408	0.826000	0.29277	0.729000	0.30791	0.962000	0.63368	-0.454000	0.06770	-0.794000	0.04468	0.513000	0.50165	GAG		0.562	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717		9	6	1	0	0.000442599	0.006214	0.000470905	9	6				
MSN	4478	broad.mit.edu	37	X	64955189	64955189	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:64955189G>T	ENST00000360270.5	+	8	1028	c.856G>T	c.(856-858)Ggg>Tgg	p.G286W		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	286	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						CTTGTGCATGGGGAACCATGA	0.537			T	ALK	ALCL																																		uc004dwf.2		NA		Dom	yes		X	Xq11.2-q12	4478	T	moesin			L	ALK		ALCL	MSN/ALK(6)	0				haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						c.(856-858)GGG>TGG		moesin							67.0	49.0	55.0					X																	64955189		2203	4300	6503	SO:0001583	missense	4478				leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton	g.chrX:64955189G>T	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.856G>T	X.37:g.64955189G>T	ENSP00000353408:p.Gly286Trp						p.G286W	NM_002444	NP_002435	P26038	MOES_HUMAN			8	1054	+			286			FERM.			Missense_Mutation	SNP	ENST00000360270.5	37	c.856G>T	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883267	0.91740	.	.	ENSG00000147065	ENST00000360270	D	0.83075	-1.68	5.45	5.45	0.79879	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.095398	0.64402	D	0.000001	D	0.93439	0.7907	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95055	0.8190	10	0.87932	D	0	.	16.7763	0.85551	0.0:0.0:1.0:0.0	.	286	P26038	MOES_HUMAN	W	286	ENSP00000353408:G286W	ENSP00000353408:G286W	G	+	1	0	MSN	64871914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.756000	0.98918	2.278000	0.76064	0.594000	0.82650	GGG		0.537	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444		12	4	1	0	2.61681e-11	0.00245	3.15051e-11	12	4				
ITGB1BP2	26548	broad.mit.edu	37	X	70524989	70524989	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:70524989G>A	ENST00000373829.3	+	11	1064	c.991G>A	c.(991-993)Gat>Aat	p.D331N	ITGB1BP2_ENST00000538820.1_Missense_Mutation_p.D313N	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2	331	Asp/Glu-rich (acidic).				muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					CGATTCAGATGATGATCTGAG	0.507																																							uc004dzr.1		NA																	0				ovary(1)	1						c.(991-993)GAT>AAT		integrin beta 1 binding protein 2							66.0	52.0	57.0					X																	70524989		2203	4300	6503	SO:0001583	missense	26548				muscle organ development|signal transduction		SH3 domain binding	g.chrX:70524989G>A	AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.991G>A	X.37:g.70524989G>A	ENSP00000362935:p.Asp331Asn					BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_Missense_Mutation_p.D313N	p.D331N	NM_012278	NP_036410	Q9UKP3	ITBP2_HUMAN			11	1020	+	Renal(35;0.156)		331			Asp/Glu-rich (acidic).		Q32N04|Q549J7	Missense_Mutation	SNP	ENST00000373829.3	37	c.991G>A	CCDS14411.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862707	0.51482	.	.	ENSG00000147166	ENST00000373829;ENST00000538820	.	.	.	4.84	4.84	0.62591	.	0.127176	0.53938	D	0.000049	T	0.70798	0.3265	M	0.65975	2.015	0.46774	D	0.999193	D;D	0.63880	0.993;0.993	D;D	0.72338	0.977;0.977	T	0.68796	-0.5314	9	0.31617	T	0.26	-8.7557	12.0355	0.53423	0.0:0.0:1.0:0.0	.	313;331	Q32N04;Q9UKP3	.;ITBP2_HUMAN	N	331;313	.	ENSP00000362935:D331N	D	+	1	0	ITGB1BP2	70441714	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.890000	0.63178	2.227000	0.72691	0.513000	0.50165	GAT		0.507	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057126.1	NM_012278		3	7	0	0	0	0.009096	0	3	7				
ABCB7	22	broad.mit.edu	37	X	74280087	74280087	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:74280087C>G	ENST00000373394.3	-	15	2021	c.2014G>C	c.(2014-2016)Gat>Cat	p.D672H	ABCB7_ENST00000339447.4_Missense_Mutation_p.D632H|ABCB7_ENST00000253577.3_Missense_Mutation_p.D673H			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	672	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						TCATCTGCATCAACCACTGTT	0.348																																							uc004eca.2		NA																	0				ovary(1)	1						c.(2014-2016)GAT>CAT		ATP-binding cassette, sub-family B, member 7							122.0	101.0	108.0					X																	74280087		2203	4300	6503	SO:0001583	missense	22				cellular iron ion homeostasis	integral to membrane|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|heme transporter activity	g.chrX:74280087C>G	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.2014G>C	X.37:g.74280087C>G	ENSP00000362492:p.Asp672His					ABCB7_uc004ebz.2_Missense_Mutation_p.D673H|ABCB7_uc011mqn.1_Missense_Mutation_p.D646H|ABCB7_uc010nls.2_Missense_Mutation_p.D633H|ABCB7_uc010nlt.2_Missense_Mutation_p.D632H	p.D672H	NM_004299	NP_004290	O75027	ABCB7_HUMAN			15	2039	-			672			ABC transporter.		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	ENST00000373394.3	37	c.2014G>C		.	.	.	.	.	.	.	.	.	.	C	23.1	4.369295	0.82463	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	5.63	5.63	0.86233	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.80623	0.4658	N	0.02420	-0.555	0.80722	D	1	B;D;D;B;D	0.89917	0.16;1.0;1.0;0.1;0.993	B;D;D;B;P	0.87578	0.091;0.998;0.996;0.042;0.903	D	0.86688	0.1921	10	0.54805	T	0.06	-26.0001	17.5262	0.87801	0.0:1.0:0.0:0.0	.	646;632;673;672;673	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	H	646;673;632;672;646	ENSP00000253577:D673H;ENSP00000343849:D632H;ENSP00000362492:D672H;ENSP00000436586:D646H	ENSP00000253577:D673H	D	-	1	0	ABCB7	74196812	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.487000	0.81328	2.353000	0.79882	0.594000	0.82650	GAT		0.348	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299		5	14	0	0	0	0.001168	0	5	14				
BRWD3	254065	broad.mit.edu	37	X	79932289	79932289	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:79932289C>T	ENST00000373275.4	-	41	5444	c.5228G>A	c.(5227-5229)aGa>aAa	p.R1743K	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1743					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TCGAGGCAGTCTACTGAAACG	0.423																																							uc004edt.2		NA																	0				ovary(4)	4						c.(5227-5229)AGA>AAA		bromodomain and WD repeat domain containing 3							140.0	108.0	119.0					X																	79932289		2203	4300	6503	SO:0001583	missense	254065							g.chrX:79932289C>T		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.5228G>A	X.37:g.79932289C>T	ENSP00000362372:p.Arg1743Lys					BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.R1339K|BRWD3_uc004edp.2_Missense_Mutation_p.R1572K|BRWD3_uc004edq.2_Missense_Mutation_p.R1339K|BRWD3_uc010nmj.1_Missense_Mutation_p.R1339K|BRWD3_uc004edr.2_Missense_Mutation_p.R1413K|BRWD3_uc004eds.2_Missense_Mutation_p.R1339K|BRWD3_uc004edu.2_Missense_Mutation_p.R1413K|BRWD3_uc004edv.2_Missense_Mutation_p.R1339K|BRWD3_uc004edw.2_Missense_Mutation_p.R1339K|BRWD3_uc004edx.2_Missense_Mutation_p.R1339K|BRWD3_uc004edy.2_Missense_Mutation_p.R1339K|BRWD3_uc004edz.2_Missense_Mutation_p.R1413K|BRWD3_uc004eea.2_Missense_Mutation_p.R1413K|BRWD3_uc004eeb.2_Missense_Mutation_p.R1339K|uc004edn.1_5'Flank	p.R1743K	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN			41	5491	-			1743					C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	c.5228G>A	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	C	7.633	0.679201	0.14907	.	.	ENSG00000165288	ENST00000373275	T	0.50548	0.74	4.1	4.1	0.47936	.	0.086147	0.48767	D	0.000176	T	0.19967	0.0480	N	0.02539	-0.55	0.25539	N	0.98719	B	0.06786	0.001	B	0.04013	0.001	T	0.13469	-1.0508	9	.	.	.	-12.2154	9.9375	0.41561	0.0:0.9026:0.0:0.0974	.	1743	Q6RI45	BRWD3_HUMAN	K	1743	ENSP00000362372:R1743K	.	R	-	2	0	BRWD3	79818945	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.428000	0.44749	2.056000	0.61249	0.436000	0.28706	AGA		0.423	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		8	17	0	0	0	0.006214	0	8	17				
RAB40AL	282808	broad.mit.edu	37	X	102192642	102192642	+	Silent	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:102192642C>T	ENST00000218249.5	+	1	443	c.396C>T	c.(394-396)ttC>ttT	p.F132F	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	132					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						ATCTGGCATTCAAGAGGCAGG	0.552																																							uc004ejs.2		NA																	0				ovary(2)	2						c.(394-396)TTC>TTT		RAB40A, member RAS oncogene family-like							16.0	23.0	21.0					X																	102192642		2142	4146	6288	SO:0001819	synonymous_variant	282808				protein transport|small GTPase mediated signal transduction	mitochondrion|plasma membrane	GTP binding	g.chrX:102192642C>T	BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.396C>T	X.37:g.102192642C>T							p.F132F	NM_001031834	NP_001027004	P0C0E4	RB40L_HUMAN			1	443	+			132					Q495H3	Silent	SNP	ENST00000218249.5	37	c.396C>T	CCDS35353.1																																																																																				0.552	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057679.1	NM_001031834		15	22	0	0	0	0.010504	0	15	22				
CHRDL1	91851	broad.mit.edu	37	X	109964630	109964630	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:109964630T>A	ENST00000372045.1	-	5	540	c.409A>T	c.(409-411)Acc>Tcc	p.T137S	CHRDL1_ENST00000444321.2_Missense_Mutation_p.T143S|CHRDL1_ENST00000218054.4_Missense_Mutation_p.T143S|CHRDL1_ENST00000372042.1_Missense_Mutation_p.T144S|CHRDL1_ENST00000394797.4_Missense_Mutation_p.T143S|CHRDL1_ENST00000434224.1_Intron|CHRDL1_ENST00000482160.1_Intron			Q9BU40	CRDL1_HUMAN	chordin-like 1	137	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						CTGCACTGGGTGCATTGATTG	0.478																																							uc004eou.3		NA																	0					0						c.(430-432)ACC>TCC		chordin-like 1 isoform 1 precursor							381.0	311.0	334.0					X																	109964630		2203	4300	6503	SO:0001583	missense	91851				BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region		g.chrX:109964630T>A	AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.409A>T	X.37:g.109964630T>A	ENSP00000361115:p.Thr137Ser					CHRDL1_uc004eov.2_Missense_Mutation_p.T138S|CHRDL1_uc004eow.2_Missense_Mutation_p.T143S|CHRDL1_uc010nps.2_Missense_Mutation_p.T143S|CHRDL1_uc004eot.2_Intron|CHRDL1_uc011mss.1_Intron|CHRDL1_uc004eox.3_Missense_Mutation_p.T137S	p.T144S	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN			5	779	-			137			VWFC 2.		B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37	c.430A>T		.	.	.	.	.	.	.	.	.	.	T	11.47	1.649680	0.29336	.	.	ENSG00000101938	ENST00000372045;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000444321	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	5.06	2.75	0.32379	von Willebrand factor, type C (4);	0.392085	0.28914	N	0.013728	T	0.50137	0.1598	L	0.28274	0.84	0.22185	N	0.999303	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.002;0.0;0.002	T	0.23048	-1.0199	9	.	.	.	-6.9322	4.8765	0.13658	0.0:0.3233:0.0:0.6767	.	143;138;123;137;144	E9PGS5;Q9BU40-2;Q59FB2;Q9BU40;D3DUY6	.;.;.;CRDL1_HUMAN;.	S	137;143;143;144;143	ENSP00000361115:T137S;ENSP00000218054:T143S;ENSP00000378276:T143S;ENSP00000361112:T144S;ENSP00000399739:T143S	.	T	-	1	0	CHRDL1	109851286	1.000000	0.71417	0.549000	0.28204	0.758000	0.43043	2.380000	0.44327	0.827000	0.34685	0.486000	0.48141	ACC		0.478	CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234		112	69	0	0	0	0.00361	0	112	69				
CAPN6	827	broad.mit.edu	37	X	110497506	110497507	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:110497506_110497507CC>AA	ENST00000324068.1	-	3	457_458	c.290_291GG>TT	c.(289-291)tGG>tTT	p.W97F	CAPN6_ENST00000541758.1_5'UTR	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	97	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						ATACCTTTGTCCAATGAGACTC	0.436																																							uc004epc.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						c.(289-291)TGG>TTT		calpain 6																																				SO:0001583	missense	827				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding	g.chrX:110497506_110497507CC>AA	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.290_291delinsAA	X.37:g.110497506_110497507delinsAA	ENSP00000317214:p.Trp97Phe					CAPN6_uc011msu.1_5'UTR	p.W97F	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN			3	458_459	-			97			Calpain catalytic.		D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	DNP	ENST00000324068.1	37	c.290_291GG>TT	CCDS14555.1																																																																																				0.436	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			33	17	0	0	0	0.004672	0	33	17				
CT47B1	643311	broad.mit.edu	37	X	120009314	120009314	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:120009314C>T	ENST00000371311.3	-	1	465	c.211G>A	c.(211-213)Ggc>Agc	p.G71S		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	71										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GCGGCCAGGCCTGCCGCCTGC	0.731																																							uc011muc.1		NA																	0					0						c.(211-213)GGC>AGC		cancer/testis antigen family 147, member B1							8.0	12.0	11.0					X																	120009314		684	1549	2233	SO:0001583	missense	643311							g.chrX:120009314C>T		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.211G>A	X.37:g.120009314C>T	ENSP00000360360:p.Gly71Ser						p.G71S	NM_001145718	NP_001139190	P0C2W7	CT47B_HUMAN			1	466	-			71					A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	c.211G>A	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805335	0.50315	.	.	ENSG00000236446	ENST00000371311	.	.	.	2.21	-1.4	0.08968	.	2.525960	0.02927	N	0.138684	T	0.43100	0.1232	L	0.27053	0.805	0.09310	N	1	D	0.76494	0.999	D	0.80764	0.994	T	0.29243	-1.0018	9	0.62326	D	0.03	.	3.347	0.07139	0.0:0.4169:0.2927:0.2904	.	71	P0C2W7	CT47B_HUMAN	S	71	.	ENSP00000360360:G71S	G	-	1	0	CT47B1	119893342	0.000000	0.05858	0.000000	0.03702	0.181000	0.23173	-0.252000	0.08806	-0.503000	0.06586	0.171000	0.16805	GGC		0.731	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		25	15	0	0	0	0.004656	0	25	15				
TENM1	10178	broad.mit.edu	37	X	123517897	123517897	+	Missense_Mutation	SNP	C	C	T	rs368631244		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:123517897C>T	ENST00000371130.3	-	29	6926	c.6863G>A	c.(6862-6864)aGc>aAc	p.S2288N	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.S2295N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2288					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AATCTCCGAGCTTGTGTGGTT	0.443																																							uc004euj.2		NA																	0				ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(6862-6864)AGC>AAC		odz, odd Oz/ten-m homolog 1 isoform 3		C	ASN/SER,ASN/SER,ASN/SER	0,3835		0,0,1632,571	135.0	130.0	131.0		6884,6881,6863	5.7	0.6	X		131	1,6727		0,1,2427,1872	no	missense,missense,missense	ODZ1	NM_001163278.1,NM_001163279.1,NM_014253.3	46,46,46	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	possibly-damaging,possibly-damaging,possibly-damaging	2295/2733,2294/2732,2288/2726	123517897	1,10562	2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123517897C>T	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6863G>A	X.37:g.123517897C>T	ENSP00000360171:p.Ser2288Asn					ODZ1_uc011muj.1_Missense_Mutation_p.S2294N|ODZ1_uc010nqy.2_Missense_Mutation_p.S2295N	p.S2288N	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			29	6927	-			2288			Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.6863G>A	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197824	0.58126	0.0	1.49E-4	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86097	-2.07;-2.04	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.87657	0.6232	L	0.31294	0.92	0.80722	D	1	D;P;P	0.63880	0.993;0.615;0.911	D;B;P	0.70227	0.968;0.32;0.504	D	0.84806	0.0787	10	0.20519	T	0.43	.	18.6846	0.91559	0.0:1.0:0.0:0.0	.	2294;2295;2288	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	2288;2295	ENSP00000360171:S2288N;ENSP00000403954:S2295N	ENSP00000360171:S2288N	S	-	2	0	ODZ1	123345578	1.000000	0.71417	0.595000	0.28798	0.986000	0.74619	6.089000	0.71384	2.356000	0.79943	0.600000	0.82982	AGC		0.443	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		49	32	0	0	0	0.00361	0	49	32				
USP26	83844	broad.mit.edu	37	X	132160639	132160639	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:132160639T>A	ENST00000511190.1	-	6	2079	c.1610A>T	c.(1609-1611)cAg>cTg	p.Q537L	USP26_ENST00000406273.1_Missense_Mutation_p.Q537L|USP26_ENST00000370832.1_Missense_Mutation_p.Q537L	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	537	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					GATGACTTCCTGGTCATTCTT	0.408																																					NSCLC(104;342 1621 36940 47097 52632)	NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	0				lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(1609-1611)CAG>CTG		ubiquitin-specific protease 26							104.0	105.0	105.0					X																	132160639		2203	4299	6502	SO:0001583	missense	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132160639T>A	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1610A>T	X.37:g.132160639T>A	ENSP00000423390:p.Gln537Leu					USP26_uc011mvf.1_Missense_Mutation_p.Q537L	p.Q537L	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN			6	2080	-	Acute lymphoblastic leukemia(192;0.000127)		537					B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	c.1610A>T	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	T	9.614	1.131994	0.21041	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.32023	1.47;1.47;1.47	3.95	0.0553	0.14314	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.850584	0.09873	N	0.744691	T	0.47303	0.1438	M	0.75777	2.31	0.09310	N	1	P	0.50710	0.938	P	0.58928	0.848	T	0.35475	-0.9787	10	0.54805	T	0.06	-1.4866	7.6435	0.28307	0.0:0.317:0.0:0.683	.	537	Q9BXU7	UBP26_HUMAN	L	537	ENSP00000359869:Q537L;ENSP00000423390:Q537L;ENSP00000384360:Q537L	ENSP00000359869:Q537L	Q	-	2	0	USP26	131988305	0.904000	0.30761	0.000000	0.03702	0.002000	0.02628	1.599000	0.36751	-0.382000	0.07870	-1.546000	0.00904	CAG		0.408	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		51	32	0	0	0	0.00361	0	51	32				
MAGEC1	9947	broad.mit.edu	37	X	140995288	140995288	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:140995288G>A	ENST00000285879.4	+	4	2384	c.2098G>A	c.(2098-2100)Gag>Aag	p.E700K	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	700										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGTCCTCTTGAGGGAGAGGA	0.562										HNSCC(15;0.026)																													uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2098-2100)GAG>AAG		melanoma antigen family C, 1							62.0	64.0	64.0					X																	140995288		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140995288G>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2098G>A	X.37:g.140995288G>A	ENSP00000285879:p.Glu700Lys	HNSCC(15;0.026)				MAGEC1_uc010nsl.1_Intron	p.E700K	NM_005462	NP_005453	O60732	MAGC1_HUMAN			4	2384	+	Acute lymphoblastic leukemia(192;6.56e-05)		700					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.2098G>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	g	10.45	1.352786	0.24512	.	.	ENSG00000155495	ENST00000285879	T	0.02890	4.12	0.96	-1.51	0.08664	.	.	.	.	.	T	0.01558	0.0050	N	0.14661	0.345	0.22591	N	0.998958	B	0.33494	0.414	B	0.19946	0.027	T	0.47032	-0.9148	9	0.62326	D	0.03	.	5.6247	0.17477	1.0E-4:0.3425:0.6575:0.0	.	700	O60732	MAGC1_HUMAN	K	700	ENSP00000285879:E700K	ENSP00000285879:E700K	E	+	1	0	MAGEC1	140822954	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.263000	0.08670	0.187000	0.20147	0.190000	0.17370	GAG		0.562	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		27	66	0	0	0	0.004656	0	27	66				
PASD1	139135	broad.mit.edu	37	X	150773189	150773189	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:150773189A>T	ENST00000370357.4	+	3	345	c.100A>T	c.(100-102)Aac>Tac	p.N34Y		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	34	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					TGATTACTTCAACCAAGTGAC	0.333																																							uc004fev.3		NA																	0				ovary(3)	3						c.(100-102)AAC>TAC		PAS domain containing 1							114.0	95.0	102.0					X																	150773189		2203	4300	6503	SO:0001583	missense	139135					nucleus	signal transducer activity	g.chrX:150773189A>T	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.100A>T	X.37:g.150773189A>T	ENSP00000359382:p.Asn34Tyr						p.N34Y	NM_173493	NP_775764	Q8IV76	PASD1_HUMAN			3	432	+	Acute lymphoblastic leukemia(192;6.56e-05)		34			PAS.		Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	37	c.100A>T	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446749	0.25987	.	.	ENSG00000166049	ENST00000370357	T	0.70164	-0.46	5.46	1.46	0.22682	PAS (1);	.	.	.	.	T	0.66086	0.2754	L	0.46157	1.445	0.09310	N	1	D	0.59767	0.986	P	0.53912	0.737	T	0.55879	-0.8071	9	0.87932	D	0	.	5.8099	0.18460	0.4929:0.4123:0.0948:0.0	.	34	Q8IV76	PASD1_HUMAN	Y	34	ENSP00000359382:N34Y	ENSP00000359382:N34Y	N	+	1	0	PASD1	150523845	0.024000	0.19004	0.000000	0.03702	0.005000	0.04900	1.212000	0.32394	-0.094000	0.12374	0.441000	0.28932	AAC		0.333	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493		6	5	0	0	0	0.001984	0	6	5				
L1CAM	3897	broad.mit.edu	37	X	153130418	153130418	+	Silent	SNP	G	G	A			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:153130418G>A	ENST00000370060.1	-	23	3093	c.2904C>T	c.(2902-2904)ttC>ttT	p.F968F	L1CAM_ENST00000361981.3_Silent_p.F963F|L1CAM_ENST00000543994.1_Silent_p.F970F|L1CAM_ENST00000361699.4_Silent_p.F968F|L1CAM_ENST00000370057.3_Silent_p.F968F|L1CAM_ENST00000370055.1_Silent_p.F963F|L1CAM_ENST00000538883.1_Silent_p.F970F	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	968	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCGAAGGTTGAAGGACAGTT	0.657																																							uc004fjb.2		NA																	0				ovary(8)|central_nervous_system(1)	9						c.(2902-2904)TTC>TTT		L1 cell adhesion molecule isoform 1 precursor							135.0	113.0	121.0					X																	153130418		2203	4300	6503	SO:0001819	synonymous_variant	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153130418G>A	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2904C>T	X.37:g.153130418G>A						L1CAM_uc004fjc.2_Silent_p.F968F|L1CAM_uc010nuo.2_Silent_p.F963F	p.F968F	NM_000425	NP_000416	P32004	L1CAM_HUMAN			22	3012	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		968			Extracellular (Potential).|Fibronectin type-III 4.		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	c.2904C>T	CCDS14733.1																																																																																				0.657	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		36	73	0	0	0	0.004289	0	36	73				
DDR2	4921	broad.mit.edu	37	1	162731110	162731110	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr1:162731110delT	ENST00000367922.3	+	10	1403	c.965delT	c.(964-966)cttfs	p.L322fs	DDR2_ENST00000367921.3_Frame_Shift_Del_p.L322fs	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	322					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TCCTTCCCCCTTGTCCTGGAT	0.502																																					NSCLC(161;314 2006 8283 19651 23192)	NSCLC(161;314 2006 8283 19651 23192)	uc001gcf.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6						c.(964-966)CTTfs		discoidin domain receptor family, member 2							188.0	131.0	150.0					1																	162731110		2203	4300	6503	SO:0001589	frameshift_variant	4921				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:162731110delT	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.965delT	1.37:g.162731110delT	ENSP00000356899:p.Leu322fs					DDR2_uc001gcg.2_Frame_Shift_Del_p.L322fs	p.L322fs	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.113)		10	1430	+	all_hematologic(112;0.115)		322			Extracellular (Potential).		Q7Z730	Frame_Shift_Del	DEL	ENST00000367922.3	37	c.965delT	CCDS1241.1																																																																																				0.502	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182		19	41	NA	NA	NA	NA	NA	19	41	---	---	---	---
MMRN2	79812	broad.mit.edu	37	10	88703746	88703746	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr10:88703746delG	ENST00000372027.5	-	6	1116	c.795delC	c.(793-795)gacfs	p.D265fs	MMRN2_ENST00000488950.1_5'UTR	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	265					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						TGGCCTCCACGTCAAGAGACA	0.572																																							uc001kea.2		NA																	0				large_intestine(1)	1						c.(793-795)GACfs		multimerin 2 precursor							65.0	59.0	61.0					10																	88703746		2203	4300	6503	SO:0001589	frameshift_variant	79812					extracellular space		g.chr10:88703746delG	AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.795delC	10.37:g.88703746delG	ENSP00000361097:p.Asp265fs					MMRN2_uc010qmn.1_Intron|MMRN2_uc009xtb.2_Frame_Shift_Del_p.D222fs	p.D265fs	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN			6	922	-			265					Q504V7|Q6P2N2	Frame_Shift_Del	DEL	ENST00000372027.5	37	c.795delC	CCDS7379.1																																																																																				0.572	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049179.2	NM_024756		29	36	NA	NA	NA	NA	NA	29	36	---	---	---	---
PAK1	5058	broad.mit.edu	37	11	77069990	77069992	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	CAT	CAT	-	-	CAT	CAT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:77069990_77069992delCAT	ENST00000356341.3	-	6	1079_1081	c.548_550delATG	c.(547-552)gatgct>gct	p.D183del	PAK1_ENST00000530617.1_In_Frame_Del_p.D183del|PAK1_ENST00000278568.4_In_Frame_Del_p.D183del|PAK1_ENST00000528203.1_In_Frame_Del_p.D85del|PAK1_ENST00000525542.1_5'UTR	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	183	Interaction with CRIPAK.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					GGTGGGGTAGcatcatcatcatc	0.478																																							uc001oyh.3		NA																	0				skin(2)|stomach(1)|lung(1)	4						c.(547-552)GATGCT>GCT		p21-activated kinase 1 isoform 2			,	392,0,3872		189,0,14,0,0,1929					,	3.9	1.0		dbSNP_134	110	824,25,7405		391,0,42,0,25,3669	no	codingComplex,codingComplex	PAK1	NM_002576.4,NM_001128620.1	,	580,0,56,0,25,5598	A1A1,A1A2,A1R,A2A2,A2R,RR		10.2859,9.1932,9.9137	,	,		1216,25,11277				SO:0001651	inframe_deletion	5058				apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity	g.chr11:77069990_77069992delCAT	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.548_550delATG	11.37:g.77069999_77070001delCAT	ENSP00000348696:p.Asp183del					PAK1_uc010rso.1_In_Frame_Del_p.D85del|PAK1_uc001oyg.3_In_Frame_Del_p.D183del|PAK1_uc001oyi.1_In_Frame_Del_p.D183del|PAK1_uc010rsn.1_5'UTR	p.D183del	NM_002576	NP_002567	Q13153	PAK1_HUMAN			6	1081_1083	-	all_cancers(14;1.75e-18)		183			Interaction with CRIPAK.		O75561|Q13567|Q32M53|Q32M54|Q86W79	In_Frame_Del	DEL	ENST00000356341.3	37	c.548_550delATG	CCDS8250.1																																																																																				0.478	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576		11	288	NA	NA	NA	NA	NA	11	288	---	---	---	---
PGR	5241	broad.mit.edu	37	11	100909932	100909932	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:100909932delG	ENST00000325455.5	-	8	4170	c.2717delC	c.(2716-2718)ccafs	p.P906fs	PGR_ENST00000534013.1_Frame_Shift_Del_p.P312fs|PGR_ENST00000263463.5_Frame_Shift_Del_p.P804fs	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	906	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CATCATTTCTGGAAATTCAAC	0.378																																					Pancreas(124;2271 2354 21954 22882)	Pancreas(124;2271 2354 21954 22882)	uc001pgh.2		NA																	0				lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4						c.(2716-2718)CCAfs		progesterone receptor	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)						101.0	99.0	100.0					11																	100909932		2203	4300	6503	SO:0001589	frameshift_variant	5241				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr11:100909932delG	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2717delC	11.37:g.100909932delG	ENSP00000325120:p.Pro906fs					PGR_uc001pgg.2_Frame_Shift_Del_p.P287fs|PGR_uc001pgi.2_Frame_Shift_Del_p.P804fs|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	p.P906fs	NM_000926	NP_000917	P06401	PRGR_HUMAN		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	8	3460	-		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)	906			Steroid-binding.		A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Frame_Shift_Del	DEL	ENST00000325455.5	37	c.2717delC	CCDS8310.1																																																																																				0.378	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1			9	42	NA	NA	NA	NA	NA	9	42	---	---	---	---
OR10G4	390264	broad.mit.edu	37	11	123886543	123886543	+	Frame_Shift_Del	DEL	G	G	-	rs376428185		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr11:123886543delG	ENST00000320891.4	+	1	262	c.262delG	c.(262-264)ggcfs	p.G88fs		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GTCCCCAAGCGGCAGGGCTAT	0.532																																							uc010sac.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(262-264)GGCfs		olfactory receptor, family 10, subfamily G,							25.0	24.0	24.0					11																	123886543		2194	4272	6466	SO:0001589	frameshift_variant	390264				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123886543delG	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.262delG	11.37:g.123886543delG	ENSP00000325076:p.Gly88fs						p.G88fs	NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	262	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	88			Extracellular (Potential).		Q6IEW0	Frame_Shift_Del	DEL	ENST00000320891.4	37	c.262delG	CCDS31702.1																																																																																				0.532	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		10	57	NA	NA	NA	NA	NA	10	57	---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29628226	29628226	+	Splice_Site	DEL	G	G	-	rs78710112	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:29628226delG	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000439954.2_Splice_Site|FRG1B_ENST00000358464.4_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GTTTCACTTAGGGGAAAATGG	0.358																																							uc010ztl.1		NA																	0					0						c.e3-1		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001630	splice_region_variant	284802							g.chr20:29628226delG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1G>-	20.37:g.29628226delG						FRG1B_uc002wvm.1_Splice_Site|FRG1B_uc010ztj.1_Splice_Site|FRG1B_uc010gdr.1_Splice_Site|FRG1B_uc010ztk.1_Splice_Site	p.G47_splice							3	171	+								C4AME5	Splice_Site	DEL	ENST00000278882.3	37	c.139_splice																																																																																					0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron	10	100	NA	NA	NA	NA	NA	10	100	---	---	---	---
TOX2	84969	broad.mit.edu	37	20	42635313	42635313	+	Frame_Shift_Del	DEL	G	G	-	rs139380167	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:42635313delG	ENST00000358131.5	+	3	527	c.319delG	c.(319-321)ggcfs	p.G107fs	TOX2_ENST00000341197.4_Frame_Shift_Del_p.G98fs|TOX2_ENST00000423191.2_Frame_Shift_Del_p.G56fs|RN7SL443P_ENST00000464331.2_RNA|TOX2_ENST00000372999.1_Frame_Shift_Del_p.G56fs	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	107	Required for transcriptional activation. {ECO:0000250}.				female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			GCTGTGCCACGGCCTCACCCC	0.622																																							uc002xlf.3		NA																	0				ovary(1)	1						c.(319-321)GGCfs		TOX high mobility group box family member 2							137.0	102.0	114.0					20																	42635313		2203	4300	6503	SO:0001589	frameshift_variant	84969				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr20:42635313delG	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.319delG	20.37:g.42635313delG	ENSP00000350849:p.Gly107fs					TOX2_uc010ggo.2_Frame_Shift_Del_p.G98fs|TOX2_uc002xle.3_Frame_Shift_Del_p.G56fs|TOX2_uc010ggp.2_Frame_Shift_Del_p.G56fs|TOX2_uc002xlg.2_Frame_Shift_Del_p.G56fs	p.G107fs	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		3	336	+		Myeloproliferative disorder(115;0.00452)	107			Required for transcriptional activation (By similarity).		A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Frame_Shift_Del	DEL	ENST00000358131.5	37	c.319delG	CCDS42875.1																																																																																				0.622	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2			27	64	NA	NA	NA	NA	NA	27	64	---	---	---	---
CABLES2	81928	broad.mit.edu	37	20	60966081	60966081	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr20:60966081delA	ENST00000279101.5	-	10	1391	c.1383delT	c.(1381-1383)tatfs	p.Y461fs		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	461					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TCTCGGGAAGATACAGGGCCA	0.567																																							uc002ycv.2		NA																	0				pancreas(1)	1						c.(1381-1383)TATfs		Cdk5 and Abl enzyme substrate 2							128.0	127.0	128.0					20																	60966081		2203	4300	6503	SO:0001589	frameshift_variant	81928				cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity	g.chr20:60966081delA	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.1383delT	20.37:g.60966081delA	ENSP00000279101:p.Tyr461fs						p.Y461fs	NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		10	1390	-	Breast(26;2.05e-08)		461					Q5JWL0|Q9BYK0	Frame_Shift_Del	DEL	ENST00000279101.5	37	c.1383delT	CCDS33503.1																																																																																				0.567	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265		32	47	NA	NA	NA	NA	NA	32	47	---	---	---	---
RPL3	6122	broad.mit.edu	37	22	39714471	39714472	+	Frame_Shift_Ins	INS	-	-	G	rs141020322		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr22:39714471_39714472insG	ENST00000216146.4	-	2	302_303	c.129_130insC	c.(127-132)ctcacafs	p.T44fs	SNORD43_ENST00000583861.1_RNA|RPL3_ENST00000465618.1_5'UTR|RPL3_ENST00000401609.1_5'UTR	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3	44					cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	AGGAAGGCTGTGAGGTGGACCG	0.584																																							uc003axi.2		NA																	0				breast(1)|kidney(1)	2						c.(127-132)CTCACAfs		ribosomal protein L3 isoform a																																				SO:0001589	frameshift_variant	6122				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome	g.chr22:39714471_39714472insG	AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.130dupC	22.37:g.39714472_39714472dupG	ENSP00000346001:p.Thr44fs					RPL3_uc003axh.2_Frame_Shift_Ins_p.L43fs|RPL3_uc003axj.2_5'UTR|RPL3_uc011aoj.1_Frame_Shift_Ins_p.L43fs|RPL3_uc010gxx.2_5'UTR|RPL3_uc003axg.2_5'UTR|RPL3_uc003axk.1_5'UTR	p.L43fs	NM_000967	NP_000958	P39023	RL3_HUMAN			2	197_198	-	Melanoma(58;0.04)		43_44					B2RDV9|Q15548|Q5I0G0	Frame_Shift_Ins	INS	ENST00000216146.4	37	c.129_130insC	CCDS13988.1																																																																																				0.584	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321196.1	NM_000967		32	64	NA	NA	NA	NA	NA	32	64	---	---	---	---
HCLS1	3059	broad.mit.edu	37	3	121351394	121351394	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:121351394delG	ENST00000314583.3	-	12	1116	c.1025delC	c.(1024-1026)ccafs	p.P342fs	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Frame_Shift_Del_p.P305fs	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	342					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		GGGCAGAGCTGGGGGCTCCTC	0.597																																							uc003eeh.3		NA																	0					0						c.(1024-1026)CCAfs		hematopoietic cell-specific Lyn substrate 1							46.0	48.0	48.0					3																	121351394		2203	4300	6503	SO:0001589	frameshift_variant	3059				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:121351394delG		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.1025delC	3.37:g.121351394delG	ENSP00000320176:p.Pro342fs					HCLS1_uc011bjj.1_Frame_Shift_Del_p.P305fs|HCLS1_uc011bjk.1_RNA	p.P342fs	NM_005335	NP_005326	P14317	HCLS1_HUMAN		GBM - Glioblastoma multiforme(114;0.0912)	12	1150	-			342					B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Frame_Shift_Del	DEL	ENST00000314583.3	37	c.1025delC	CCDS3003.1																																																																																				0.597	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335		12	85	NA	NA	NA	NA	NA	12	85	---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143082332	143082336	+	Frame_Shift_Del	DEL	TCAAA	TCAAA	-	rs1137649		TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	TCAAA	TCAAA	-	-	TCAAA	TCAAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr3:143082332_143082336delTCAAA	ENST00000316549.6	-	14	1802_1806	c.1594_1598delTTTGA	c.(1594-1599)tttgacfs	p.FD532fs		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	532					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						ATACTTGTGGTCAAAGCTATACCAC	0.415																																							uc003evn.2		NA																	0				ovary(2)|skin(1)	3						c.(1594-1599)TTTGACfs		solute carrier family 9 (sodium/hydrogen																																				SO:0001589	frameshift_variant	285195				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity	g.chr3:143082332_143082336delTCAAA	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1594_1598delTTTGA	3.37:g.143082332_143082336delTCAAA	ENSP00000320246:p.Phe532fs						p.F532fs	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN			14	1776_1780	-			532_533					A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Frame_Shift_Del	DEL	ENST00000316549.6	37	c.1594_1598delTTTGA	CCDS33872.1																																																																																				0.415	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653		7	84	NA	NA	NA	NA	NA	7	84	---	---	---	---
RPL9	6133	broad.mit.edu	37	4	39460773	39460773	+	5'Flank	DEL	G	G	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr4:39460773delG	ENST00000449470.2	-	0	0				LIAS_ENST00000513731.1_Frame_Shift_Del_p.L12fs|LIAS_ENST00000515061.1_3'UTR|LIAS_ENST00000261434.3_Frame_Shift_Del_p.L12fs|LIAS_ENST00000381846.1_Frame_Shift_Del_p.L12fs|RPL9_ENST00000295955.9_5'Flank|LIAS_ENST00000340169.2_Frame_Shift_Del_p.L12fs	NM_001024921.2	NP_001020092.1	P32969	RL9_HUMAN	ribosomal protein L9						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|skin(1)	8						CCCGCACCCTGGGGCCCCGGG	0.627																																							uc003guf.2		NA																	0					0						c.(34-36)CTGfs		lipoic acid synthetase isoform 1 precursor	Lipoic Acid(DB00166)						31.0	37.0	35.0					4																	39460773		2203	4300	6503	SO:0001631	upstream_gene_variant	11019				inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding	g.chr4:39460773delG	D14531	CCDS3452.1	4p13	2011-04-06			ENSG00000163682	ENSG00000163682		"""L ribosomal proteins"""	10369	protein-coding gene	gene with protein product		603686				8597601, 8415001	Standard	XM_005262661		Approved	L9	uc021sso.1	P32969	OTTHUMG00000099367		4.37:g.39460773delG	Exception_encountered					RPL9_uc003gub.2_5'Flank|RPL9_uc003guc.2_5'Flank|RPL9_uc011byk.1_5'Flank|RPL9_uc011byl.1_5'Flank|RPL9_uc003gud.1_5'Flank|LIAS_uc003gue.3_Frame_Shift_Del_p.L12fs|LIAS_uc011bym.1_Frame_Shift_Del_p.L12fs|LIAS_uc003gug.2_Frame_Shift_Del_p.L12fs|LIAS_uc003guh.2_Frame_Shift_Del_p.L12fs	p.L12fs	NM_006859	NP_006850	O43766	LIAS_HUMAN			1	109	+			12						Frame_Shift_Del	DEL	ENST00000449470.2	37	c.36delG	CCDS3452.1																																																																																				0.627	RPL9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361018.1			25	69	NA	NA	NA	NA	NA	25	69	---	---	---	---
CDHR2	54825	broad.mit.edu	37	5	176011962	176011962	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr5:176011962delG	ENST00000510636.1	+	19	2954	c.2680delG	c.(2680-2682)gtgfs	p.V894fs	CDHR2_ENST00000261944.5_Frame_Shift_Del_p.V894fs|CDHR2_ENST00000506348.1_Frame_Shift_Del_p.V894fs	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	894	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CACGCTGGTTGTGCGGGCCTG	0.612																																							uc003mem.1		NA																	0				ovary(2)	2						c.(2680-2682)GTGfs		protocadherin LKC precursor							32.0	27.0	29.0					5																	176011962		2184	4276	6460	SO:0001589	frameshift_variant	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176011962delG	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2680delG	5.37:g.176011962delG	ENSP00000424565:p.Val894fs					CDHR2_uc003men.1_Frame_Shift_Del_p.V894fs	p.V894fs	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN			19	2746	+			894			Extracellular (Potential).|Cadherin 8.		A1L3U4|A6NC80|Q9NXP8	Frame_Shift_Del	DEL	ENST00000510636.1	37	c.2680delG	CCDS34297.1																																																																																				0.612	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		5	3	NA	NA	NA	NA	NA	5	3	---	---	---	---
MOG	4340	broad.mit.edu	37	6	29640858	29640858	+	IGR	DEL	G	G	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:29640858delG	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376881.3_Frame_Shift_Del_p.Q324fs|ZFP57_ENST00000376883.1_Frame_Shift_Del_p.Q324fs|ZFP57_ENST00000488757.1_Frame_Shift_Del_p.Q344fs	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						ACAGATGCCTGGTTCTGGGCC	0.542																																							uc011dlw.1		NA																	0				ovary(3)|skin(2)	5						c.(1030-1032)CAGfs		zinc finger protein 57 homolog							149.0	162.0	158.0					6																	29640858		1208	2524	3732	SO:0001628	intergenic_variant	346171				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding	g.chr6:29640858delG		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640858delG						ZFP57_uc003nnl.3_Frame_Shift_Del_p.Q324fs	p.Q344fs	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN			4	1181	-			260					A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Frame_Shift_Del	DEL	ENST00000376917.3	37	c.1030delC	CCDS34370.1																																																																																				0.542	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		27	159	NA	NA	NA	NA	NA	27	159	---	---	---	---
ROS1	6098	broad.mit.edu	37	6	117677871	117677871	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr6:117677871delA	ENST00000368508.3	-	25	4260	c.4062delT	c.(4060-4062)tttfs	p.F1354fs	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Frame_Shift_Del_p.F1349fs	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1354					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GTGCTTTGGCAAAGTATATCA	0.408			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		uc003pxp.1		NA		Dom	yes		6	6q22	6098	T	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)			"""O, E"""	GOPC|ROS1		glioblastoma|NSCLC		0				lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25						c.(4060-4062)TTTfs		proto-oncogene c-ros-1 protein precursor							158.0	129.0	138.0					6																	117677871		2203	4300	6503	SO:0001589	frameshift_variant	6098				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:117677871delA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.4062delT	6.37:g.117677871delA	ENSP00000357494:p.Phe1354fs					ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	p.F1354fs	NM_002944	NP_002935	P08922	ROS_HUMAN		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)	25	4261	-		all_cancers(87;0.00846)|all_epithelial(87;0.0242)	1354			Extracellular (Potential).		Q15368|Q5TDB5	Frame_Shift_Del	DEL	ENST00000368508.3	37	c.4062delT	CCDS5116.1																																																																																				0.408	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			20	47	NA	NA	NA	NA	NA	20	47	---	---	---	---
VWC2	375567	broad.mit.edu	37	7	49842437	49842440	+	Splice_Site	DEL	GTAT	GTAT	-	rs202121155	byFrequency	TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	GTAT	GTAT	-	-	GTAT	GTAT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr7:49842437_49842440delGTAT	ENST00000340652.4	+	3	1382		c.e3+1			NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2						negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						TGCAAAAATGGTATGTGAGATCCC	0.559																																							uc003tot.1		NA																	0					0						c.e3+1		von Willebrand factor C domain containing 2																																				SO:0001630	splice_region_variant	375567				negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space		g.chr7:49842437_49842440delGTAT	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.826+1GTAT>-	7.37:g.49842437_49842440delGTAT							p.G276_splice	NM_198570	NP_940972	Q2TAL6	VWC2_HUMAN			3	1382	+								Q6UXE2	Splice_Site	DEL	ENST00000340652.4	37	c.826_splice	CCDS5508.1																																																																																				0.559	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570	Intron	9	55	NA	NA	NA	NA	NA	9	55	---	---	---	---
TAF1L	138474	broad.mit.edu	37	9	32633583	32633584	+	Frame_Shift_Ins	INS	-	-	T			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chr9:32633583_32633584insT	ENST00000242310.4	-	1	2083_2084	c.1994_1995insA	c.(1993-1995)aagfs	p.K665fs	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	665					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.K665fs*4(2)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCATCTTGGCCTTTTTTTTGAT	0.48																																							uc003zrg.1		NA																	2	Deletion - Frameshift(2)	p.K665fs*4(2)	large_intestine(2)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(1993-1995)AAGfs		TBP-associated factor RNA polymerase 1-like				1,4261		0,1,2130						0.6	1.0			147	0,8252		0,0,4126	no	frameshift	TAF1L	NM_153809.2		0,1,6256	A1A1,A1R,RR		0.0,0.0235,0.0080				1,12513				SO:0001589	frameshift_variant	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32633583_32633584insT	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1995dupA	9.37:g.32633591_32633591dupT	ENSP00000418379:p.Lys665fs					uc003zrh.1_RNA	p.K665fs	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	2084_2085	-			665					Q0VG57	Frame_Shift_Ins	INS	ENST00000242310.4	37	c.1994_1995insA	CCDS35003.1																																																																																				0.480	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			11	454	NA	NA	NA	NA	NA	11	454	---	---	---	---
ENOX2	10495	broad.mit.edu	37	X	129771355	129771355	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7150-01A-21D-2036-08	TCGA-78-7150-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	b68a9ab8-5042-437c-be61-a1cf0f9f9210	67131ca6-922d-4103-b302-ce1f13df83fa	g.chrX:129771355delC	ENST00000370927.1	-	9	1267	c.1246delG	c.(1246-1248)gaafs	p.E417fs	ENOX2_ENST00000370935.1_Frame_Shift_Del_p.E388fs|ENOX2_ENST00000338144.3_Frame_Shift_Del_p.E417fs|ENOX2_ENST00000394363.1_Frame_Shift_Del_p.E388fs			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	417					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						TCATTTTCTTCCTTCAGAGCT	0.408																																					Ovarian(101;828 1506 2951 9500 35258)	Ovarian(101;828 1506 2951 9500 35258)	uc004evw.2		NA																	0				ovary(1)	1						c.(1246-1248)GAAfs		ecto-NOX disulfide-thiol exchanger 2 isoform b							178.0	141.0	153.0					X																	129771355		2203	4300	6503	SO:0001589	frameshift_variant	10495				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity	g.chrX:129771355delC	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1246delG	X.37:g.129771355delC	ENSP00000359965:p.Glu417fs					ENOX2_uc004evx.2_Frame_Shift_Del_p.E387fs|ENOX2_uc004evy.2_Frame_Shift_Del_p.E387fs|ENOX2_uc004evv.2_Frame_Shift_Del_p.E241fs	p.E416fs	NM_182314	NP_872114	Q16206	ENOX2_HUMAN			12	1664	-			416			Potential.		A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Frame_Shift_Del	DEL	ENST00000370927.1	37	c.1246delG	CCDS14626.1																																																																																				0.408	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314		39	31	NA	NA	NA	NA	NA	39	31	---	---	---	---
