#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ATAD3B	83858	broad.mit.edu	37	1	1412652	1412652	+	Splice_Site	SNP	A	A	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:1412652A>T	ENST00000308647.7	+	2	321		c.e2-1		ATAD3B_ENST00000378741.3_Splice_Site	NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B							mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		ATGCGCCCGCAGGTTACGCCA	0.562																																							uc001afv.2		NA																	0					0						c.e2-2		AAA-ATPase  TOB3							44.0	41.0	42.0					1																	1412652		2203	4294	6497	SO:0001630	splice_region_variant	83858						ATP binding|nucleoside-triphosphatase activity	g.chr1:1412652A>T	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.206-1A>T	1.37:g.1412652A>T						ATAD3B_uc001afw.2_5'Flank|ATAD3B_uc001afx.2_5'Flank	p.R69_splice	NM_031921	NP_114127	Q5T9A4	ATD3B_HUMAN		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)	2	307	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)						A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Splice_Site	SNP	ENST00000308647.7	37	c.206_splice	CCDS30.1	.	.	.	.	.	.	.	.	.	.	a	5.324	0.245125	0.10077	.	.	ENSG00000160072	ENST00000360489;ENST00000308647	.	.	.	2.9	2.9	0.33743	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3332	0.43835	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATAD3B	1402515	1.000000	0.71417	0.647000	0.29507	0.003000	0.03518	5.764000	0.68826	1.198000	0.43158	0.254000	0.18369	.		0.562	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	Intron	10	9	0	0	0	0.010729	0	10	9				
CLSTN1	22883	broad.mit.edu	37	1	9811565	9811565	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:9811565G>A	ENST00000377298.4	-	5	1407	c.615C>T	c.(613-615)atC>atT	p.I205I	CLSTN1_ENST00000377288.3_Silent_p.I205I|CLSTN1_ENST00000361311.4_Silent_p.I195I	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	205	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CGTCTGGAGTGATGATTTCGT	0.532																																							uc001aqh.2		NA																	0				skin(1)	1						c.(613-615)ATC>ATT		calsyntenin 1 isoform 1							107.0	98.0	101.0					1																	9811565		2203	4300	6503	SO:0001819	synonymous_variant	22883				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding	g.chr1:9811565G>A	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.615C>T	1.37:g.9811565G>A						CLSTN1_uc001aqi.2_Silent_p.I195I|CLSTN1_uc010oag.1_Silent_p.I205I	p.I205I	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)	5	1374	-	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	205			Cadherin 2.|Extracellular (Potential).		A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	37	c.615C>T	CCDS30580.1																																																																																				0.532	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1			4	56	0	0	0	0.009096	0	4	56				
ZBTB40	9923	broad.mit.edu	37	1	22816582	22816582	+	Silent	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:22816582C>G	ENST00000375647.4	+	2	348	c.141C>G	c.(139-141)ctC>ctG	p.L47L	ZBTB40_ENST00000404138.1_Silent_p.L47L|ZBTB40_ENST00000374651.4_Silent_p.L47L	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	47	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CTGCCAGCCTCCTGTTCAAAA	0.512																																							uc001bft.2		NA																	0				ovary(1)	1						c.(139-141)CTC>CTG		zinc finger and BTB domain containing 40							80.0	72.0	75.0					1																	22816582		2203	4300	6503	SO:0001819	synonymous_variant	9923				bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:22816582C>G	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.141C>G	1.37:g.22816582C>G						ZBTB40_uc001bfu.2_Silent_p.L47L|ZBTB40_uc009vqi.1_Silent_p.L47L	p.L47L	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)	3	652	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	47			BTB.		O75066|Q5TFU5|Q8N1R1	Silent	SNP	ENST00000375647.4	37	c.141C>G	CCDS224.1																																																																																				0.512	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870		3	77	0	0	0	0.004672	0	3	77				
ZNF436	80818	broad.mit.edu	37	1	23693616	23693616	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:23693616C>T	ENST00000314011.4	-	3	215	c.79G>A	c.(79-81)Gaa>Aaa	p.E27K	ZNF436_ENST00000374608.3_Missense_Mutation_p.E27K|C1orf213_ENST00000454117.1_5'Flank|C1orf213_ENST00000335648.3_5'Flank|C1orf213_ENST00000518821.1_5'Flank|C1orf213_ENST00000437367.2_5'Flank	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	27	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GGTCTCCATTCTTCCCGGGTG	0.443																																							uc001bgt.2		NA																	0				breast(1)	1						c.(79-81)GAA>AAA		zinc finger protein 436							141.0	132.0	135.0					1																	23693616		2203	4300	6503	SO:0001583	missense	80818				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:23693616C>T	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.79G>A	1.37:g.23693616C>T	ENSP00000313582:p.Glu27Lys					ZNF436_uc001bgu.2_Missense_Mutation_p.E27K|C1orf213_uc001bgv.2_5'Flank|C1orf213_uc001bgw.2_5'Flank	p.E27K	NM_030634	NP_085137	Q9C0F3	ZN436_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)	2	460	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)	27			KRAB.		Q658I9	Missense_Mutation	SNP	ENST00000314011.4	37	c.79G>A	CCDS233.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.906249	0.92107	.	.	ENSG00000125945	ENST00000314011;ENST00000374609;ENST00000374608	T;T;T	0.12255	2.7;2.7;2.7	4.97	4.97	0.65823	Krueppel-associated box (4);	0.000000	0.53938	D	0.000046	T	0.27765	0.0683	M	0.92026	3.265	0.43025	D	0.994583	P	0.52061	0.95	B	0.41666	0.363	T	0.46275	-0.9203	10	0.54805	T	0.06	-18.9305	16.0792	0.80989	0.0:1.0:0.0:0.0	.	27	Q9C0F3	ZN436_HUMAN	K	27	ENSP00000313582:E27K;ENSP00000363737:E27K;ENSP00000363736:E27K	ENSP00000313582:E27K	E	-	1	0	ZNF436	23566203	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.949000	0.56668	2.475000	0.83589	0.591000	0.81541	GAA		0.443	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634		16	69	0	0	0	0.00499	0	16	69				
MAP3K6	9064	broad.mit.edu	37	1	27687484	27687484	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:27687484G>C	ENST00000493901.1	-	15	2087	c.1848C>G	c.(1846-1848)atC>atG	p.I616M	MAP3K6_ENST00000374040.3_Missense_Mutation_p.I608M|MAP3K6_ENST00000357582.2_Missense_Mutation_p.I616M	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	616					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CCCAGGCCTGGATCAGGCCGC	0.692																																							uc001bny.1		NA																	0				breast(4)|lung(3)|ovary(1)|central_nervous_system(1)	9						c.(1846-1848)ATC>ATG		mitogen-activated protein kinase kinase kinase							11.0	15.0	14.0					1																	27687484		2114	4247	6361	SO:0001583	missense	9064				activation of JUN kinase activity		ATP binding|magnesium ion binding|MAP kinase kinase kinase activity	g.chr1:27687484G>C	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.1848C>G	1.37:g.27687484G>C	ENSP00000419591:p.Ile616Met					MAP3K6_uc009vsw.1_Missense_Mutation_p.I608M|MAP3K6_uc001bnz.1_Missense_Mutation_p.I139M	p.I616M	NM_004672	NP_004663	O95382	M3K6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)	14	2097	-		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	616					A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	ENST00000493901.1	37	c.1848C>G	CCDS299.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.86|18.86	3.713473|3.713473	0.68730|0.68730	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582|ENST00000472410	T;T;T|.	0.68181|.	-0.31;-0.31;-0.31|.	5.2|5.2	-1.23|-1.23	0.09465|0.09465	.|.	.|.	.|.	.|.	.|.	T|T	0.51719|0.51719	0.1691|0.1691	M|M	0.65498|0.65498	2.005|2.005	0.33682|0.33682	D|D	0.612195|0.612195	D;D|.	0.57899|.	0.981;0.968|.	P;P|.	0.57009|.	0.811;0.652|.	T|T	0.57980|0.57980	-0.7717|-0.7717	9|5	0.46703|.	T|.	0.11|.	.|.	4.6572|4.6572	0.12624|0.12624	0.4592:0.1612:0.3796:0.0|0.4592:0.1612:0.3796:0.0	.|.	608;616|.	O95382-3;O95382|.	.;M3K6_HUMAN|.	M|C	608;616;339;616|340	ENSP00000363152:I608M;ENSP00000419591:I616M;ENSP00000350195:I616M|.	ENSP00000350195:I616M|.	I|S	-|-	3|2	3|0	MAP3K6|MAP3K6	27560071|27560071	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.919000|0.919000	0.55068|0.55068	0.961000|0.961000	0.29267|0.29267	-0.179000|-0.179000	0.10654|0.10654	0.655000|0.655000	0.94253|0.94253	ATC|TCC		0.692	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672		10	11	0	0	0	0.008291	0	10	11				
MECR	51102	broad.mit.edu	37	1	29528493	29528493	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:29528493C>G	ENST00000263702.6	-	6	743	c.718G>C	c.(718-720)Gag>Cag	p.E240Q	MECR_ENST00000489248.1_5'Flank|MECR_ENST00000373791.3_Missense_Mutation_p.E164Q			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	240					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		CTTAGCTCCTCTTCTGTGATG	0.498																																							uc001brq.1		NA																	0				ovary(1)	1						c.(718-720)GAG>CAG		trans-2-enoyl-CoA reductase, mitochondrial							257.0	256.0	256.0					1																	29528493		2203	4300	6503	SO:0001583	missense	51102				fatty acid biosynthetic process	mitochondrion	trans-2-enoyl-CoA reductase (NADPH) activity|zinc ion binding	g.chr1:29528493C>G		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.718G>C	1.37:g.29528493C>G	ENSP00000263702:p.Glu240Gln					MECR_uc001brp.1_Missense_Mutation_p.E164Q|MECR_uc001brr.1_Missense_Mutation_p.E164Q|MECR_uc001brs.1_RNA|MECR_uc001brt.1_Missense_Mutation_p.E164Q|MECR_uc010ofz.1_Missense_Mutation_p.E240Q	p.E240Q	NM_016011	NP_057095	Q9BV79	MECR_HUMAN		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)	6	754	-		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)	240					B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	c.718G>C	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025356	0.75390	.	.	ENSG00000116353	ENST00000373791;ENST00000263702;ENST00000373792;ENST00000453185	T;T	0.49139	0.79;0.79	5.75	5.75	0.90469	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.137096	0.64402	D	0.000004	T	0.55481	0.1923	M	0.78285	2.405	0.80722	D	1	B	0.22346	0.068	B	0.32724	0.151	T	0.51387	-0.8712	10	0.28530	T	0.3	.	17.4377	0.87557	0.0:1.0:0.0:0.0	.	240	Q9BV79	MECR_HUMAN	Q	164;240;152;79	ENSP00000362896:E164Q;ENSP00000263702:E240Q	ENSP00000263702:E240Q	E	-	1	0	MECR	29401080	1.000000	0.71417	0.999000	0.59377	0.849000	0.48306	7.227000	0.78070	2.706000	0.92434	0.561000	0.74099	GAG		0.498	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011		6	331	0	0	0	0.001168	0	6	331				
MKNK1	8569	broad.mit.edu	37	1	47028476	47028476	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:47028476C>A	ENST00000371946.4	-	11	971	c.808G>T	c.(808-810)Gtc>Ttc	p.V270F	MKNK1-AS1_ENST00000602433.1_RNA|MKNK1_ENST00000428112.2_Missense_Mutation_p.V229F|MKNK1_ENST00000371945.4_Missense_Mutation_p.V229F|MKNK1_ENST00000371944.4_Missense_Mutation_p.V134F|MKNK1_ENST00000341183.5_Missense_Mutation_p.V229F	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					TCCGTGAAGACCTCCACTACC	0.602																																							uc001cqb.2		NA																	0				lung(2)	2						c.(808-810)GTC>TTC		MAP kinase-interacting serine/threonine kinase 1							56.0	48.0	50.0					1																	47028476		2203	4300	6503	SO:0001583	missense	8569				intracellular protein kinase cascade|peptidyl-serine phosphorylation|regulation of translation	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:47028476C>A	AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.808G>T	1.37:g.47028476C>A	ENSP00000361014:p.Val270Phe					MKNK1_uc010omd.1_Missense_Mutation_p.V134F|MKNK1_uc001cqc.2_Missense_Mutation_p.V229F|MKNK1_uc009vyi.2_Missense_Mutation_p.V229F|MKNK1_uc010ome.1_Missense_Mutation_p.V134F|MKNK1_uc009vyj.2_Missense_Mutation_p.V174F	p.V270F	NM_003684	NP_003675	Q9BUB5	MKNK1_HUMAN			11	1052	-	Acute lymphoblastic leukemia(166;0.155)		270			Protein kinase.		D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	37	c.808G>T	CCDS538.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.528527|5.528527	0.96446|0.96446	.|.	.|.	ENSG00000079277|ENSG00000079277	ENST00000524749|ENST00000371946;ENST00000371945;ENST00000371944;ENST00000341183;ENST00000428112	.|T;T;T;T;T	.|0.71341	.|-0.1;-0.49;0.19;-0.56;-0.56	5.42|5.42	5.42|5.42	0.78866|0.78866	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75824|0.75824	0.3902|0.3902	N|N	0.25201|0.25201	0.72|0.72	0.80722|0.80722	D|D	1|1	.|P;D;P;P;D;D	.|0.69078	.|0.627;0.972;0.855;0.825;0.984;0.997	.|P;P;P;P;P;D	.|0.71656	.|0.532;0.767;0.652;0.521;0.891;0.974	T|T	0.78250|0.78250	-0.2277|-0.2277	5|10	.|0.66056	.|D	.|0.02	.|.	18.3905|18.3905	0.90481|0.90481	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|134;134;229;229;229;270	.|B4DQK5;Q7Z319;A8K341;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.|.;.;.;.;.;MKNK1_HUMAN	S|F	21|270;229;134;229;229	.|ENSP00000361014:V270F;ENSP00000361013:V229F;ENSP00000361012:V134F;ENSP00000339573:V229F;ENSP00000411135:V229F	.|ENSP00000339573:V229F	R|V	-|-	3|1	2|0	MKNK1|MKNK1	46801063|46801063	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	7.651000|7.651000	0.83577|0.83577	2.826000|2.826000	0.97356|0.97356	0.563000|0.563000	0.77884|0.77884	AGG|GTC		0.602	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684		7	17	1	0	0.00448238	0.004482	0.00460689	7	17				
SGIP1	84251	broad.mit.edu	37	1	67154913	67154913	+	Silent	SNP	A	A	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:67154913A>T	ENST00000371037.4	+	16	1475	c.1398A>T	c.(1396-1398)ccA>ccT	p.P466P	SGIP1_ENST00000371036.3_Silent_p.P266P|SGIP1_ENST00000371035.3_Silent_p.P256P|SGIP1_ENST00000237247.6_Silent_p.P497P|SGIP1_ENST00000371039.1_Silent_p.P267P	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	466	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						CCCGGCCTCCATCCCGGCCAA	0.537																																							uc001dcr.2		NA																	0				ovary(3)	3						c.(1396-1398)CCA>CCT		SH3-domain GRB2-like (endophilin) interacting							184.0	187.0	186.0					1																	67154913		2203	4300	6503	SO:0001819	synonymous_variant	84251				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding	g.chr1:67154913A>T	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1398A>T	1.37:g.67154913A>T						SGIP1_uc010opd.1_Silent_p.P66P|SGIP1_uc001dcs.2_Silent_p.P66P|SGIP1_uc001dct.2_Silent_p.P66P|SGIP1_uc009wat.2_Silent_p.P260P	p.P466P	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN			16	1615	+			466			Pro-rich.		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Silent	SNP	ENST00000371037.4	37	c.1398A>T	CCDS30744.1																																																																																				0.537	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291		69	223	0	0	0	0.01441	0	69	223				
LRRC7	57554	broad.mit.edu	37	1	70488908	70488908	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:70488908G>T	ENST00000035383.5	+	15	1561	c.1531G>T	c.(1531-1533)Gat>Tat	p.D511Y	RP11-181B18.1_ENST00000425754.1_RNA|LRRC7_ENST00000310961.5_Missense_Mutation_p.D516Y|LRRC7_ENST00000415775.2_Intron|RP11-181B18.1_ENST00000414132.1_RNA	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	511						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GGCCAGGTGTGATCAGCAGAT	0.577																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(1531-1533)GAT>TAT		leucine rich repeat containing 7							87.0	79.0	82.0					1																	70488908		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70488908G>T		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1531G>T	1.37:g.70488908G>T	ENSP00000035383:p.Asp511Tyr					LRRC7_uc009wbg.2_Intron	p.D511Y	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN			15	1561	+			511					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.1531G>T	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336638	0.41398	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.38240	1.15;1.22	5.86	5.86	0.93980	.	0.061936	0.64402	D	0.000010	T	0.31513	0.0799	N	0.08118	0	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.45440	-0.9261	10	0.87932	D	0	.	15.6849	0.77402	0.0:0.0:1.0:0.0	.	511	Q96NW7	LRRC7_HUMAN	Y	516;511;334	ENSP00000309245:D516Y;ENSP00000035383:D511Y	ENSP00000035383:D511Y	D	+	1	0	LRRC7	70261496	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.453000	0.60061	2.775000	0.95449	0.585000	0.79938	GAT		0.577	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		24	49	1	0	1.85244e-09	0.01892	2.12528e-09	24	49				
PRKACB	5567	broad.mit.edu	37	1	84662323	84662323	+	Silent	SNP	A	A	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:84662323A>T	ENST00000370689.2	+	6	708	c.444A>T	c.(442-444)gcA>gcT	p.A148A	PRKACB_ENST00000394838.2_Silent_p.A155A|PRKACB_ENST00000370680.1_Silent_p.A154A|PRKACB_ENST00000370688.3_Silent_p.A148A|PRKACB_ENST00000394839.2_Silent_p.A118A|PRKACB_ENST00000370682.3_Silent_p.A152A|PRKACB_ENST00000470673.1_3'UTR|PRKACB_ENST00000370685.3_Silent_p.A195A	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta	148	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		GGTTCTATGCAGCTCAGATAG	0.358																																							uc001djj.2		NA																	0				lung(2)|ovary(1)	3						c.(442-444)GCA>GCT		cAMP-dependent protein kinase catalytic subunit							120.0	110.0	114.0					1																	84662323		2203	4300	6503	SO:0001819	synonymous_variant	5567				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding	g.chr1:84662323A>T	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.444A>T	1.37:g.84662323A>T						PRKACB_uc001djl.2_Silent_p.A195A|PRKACB_uc010ort.1_Silent_p.A155A|PRKACB_uc001djn.2_Silent_p.A152A|PRKACB_uc010oru.1_Silent_p.A136A|PRKACB_uc001djp.2_Silent_p.A154A|PRKACB_uc001djq.2_Silent_p.A118A|PRKACB_uc010orv.1_Silent_p.A135A|PRKACB_uc001dji.2_Silent_p.A148A|PRKACB_uc001djk.2_Silent_p.A195A|PRKACB_uc009wcf.1_Silent_p.A154A	p.A148A	NM_002731	NP_002722	P22694	KAPCB_HUMAN		all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)	6	708	+			148			Protein kinase.		B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Silent	SNP	ENST00000370689.2	37	c.444A>T	CCDS691.1																																																																																				0.358	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	NM_182948		15	41	0	0	0	0.003163	0	15	41				
CELSR2	1952	broad.mit.edu	37	1	109794155	109794155	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:109794155C>G	ENST00000271332.3	+	1	1515	c.1454C>G	c.(1453-1455)tCt>tGt	p.S485C		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	485	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCACTCTCTAATGTCTCT	0.567																																					NSCLC(158;1285 2011 34800 34852 42084)	NSCLC(158;1285 2011 34800 34852 42084)	uc001dxa.3		NA																	0				ovary(4)|lung(3)|skin(1)	8						c.(1453-1455)TCT>TGT		cadherin EGF LAG seven-pass G-type receptor 2							172.0	159.0	163.0					1																	109794155		2203	4300	6503	SO:0001583	missense	1952				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr1:109794155C>G	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1454C>G	1.37:g.109794155C>G	ENSP00000271332:p.Ser485Cys						p.S485C	NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)	1	1515	+		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)	485			Cadherin 3.|Extracellular (Potential).		Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	c.1454C>G	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	14.85	2.657691	0.47467	.	.	ENSG00000143126	ENST00000271332	T	0.56103	0.48	4.82	3.92	0.45320	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.65154	0.2664	M	0.87900	2.915	0.46458	D	0.999059	D	0.76494	0.999	D	0.75484	0.986	T	0.69435	-0.5146	9	0.49607	T	0.09	.	9.68	0.40065	0.0:0.7864:0.1382:0.0753	.	485	Q9HCU4	CELR2_HUMAN	C	485	ENSP00000271332:S485C	ENSP00000271332:S485C	S	+	2	0	CELSR2	109595678	0.904000	0.30761	0.997000	0.53966	0.790000	0.44656	1.067000	0.30616	1.262000	0.44165	-0.355000	0.07637	TCT		0.567	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408		5	258	0	0	0	0.001168	0	5	258				
AHCYL1	10768	broad.mit.edu	37	1	110562203	110562203	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:110562203G>A	ENST00000369799.5	+	15	1787	c.1420G>A	c.(1420-1422)Gag>Aag	p.E474K	AHCYL1_ENST00000393614.4_Missense_Mutation_p.E427K|AHCYL1_ENST00000359172.3_Missense_Mutation_p.E427K	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	474					mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TAATGCACCCGAGGGGCGATA	0.408																																							uc001dyx.2		NA																	0				ovary(1)	1						c.(1420-1422)GAG>AAG		S-adenosylhomocysteine hydrolase-like 1							132.0	139.0	136.0					1																	110562203		2203	4300	6503	SO:0001583	missense	10768				one-carbon metabolic process	endoplasmic reticulum	adenosylhomocysteinase activity	g.chr1:110562203G>A	U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1420G>A	1.37:g.110562203G>A	ENSP00000358814:p.Glu474Lys					AHCYL1_uc010ovw.1_Missense_Mutation_p.E427K|AHCYL1_uc001dyy.2_Missense_Mutation_p.E427K|AHCYL1_uc010ovx.1_Missense_Mutation_p.E427K	p.E474K	NM_006621	NP_006612	O43865	SAHH2_HUMAN		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)	15	1787	+		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	474					B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	ENST00000369799.5	37	c.1420G>A	CCDS818.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573813	0.86542	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	T;T;T	0.76186	-1.0;-1.0;-1.0	6.17	6.17	0.99709	.	0.129255	0.64402	D	0.000001	T	0.65386	0.2686	L	0.58583	1.82	0.80722	D	1	B	0.28760	0.221	B	0.22880	0.042	T	0.63686	-0.6581	10	0.51188	T	0.08	-12.2661	20.8794	0.99867	0.0:0.0:1.0:0.0	.	474	O43865	SAHH2_HUMAN	K	474;427;427	ENSP00000358814:E474K;ENSP00000352092:E427K;ENSP00000377238:E427K	ENSP00000352092:E427K	E	+	1	0	AHCYL1	110363726	1.000000	0.71417	0.846000	0.33378	0.866000	0.49608	9.837000	0.99465	2.941000	0.99782	0.655000	0.94253	GAG		0.408	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032243.1			35	124	0	0	0	0.007835	0	35	124				
SLC16A4	9122	broad.mit.edu	37	1	110921598	110921598	+	Missense_Mutation	SNP	T	T	C	rs541251825		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:110921598T>C	ENST00000369779.4	-	6	1156	c.907A>G	c.(907-909)Ata>Gta	p.I303V	SLC16A4_ENST00000437429.2_Missense_Mutation_p.I193V|SLC16A4_ENST00000369781.4_Intron|SLC16A4_ENST00000497687.1_5'UTR|SLC16A4_ENST00000541986.1_Missense_Mutation_p.I241V|SLC16A4_ENST00000472422.2_Missense_Mutation_p.I255V	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	303					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	CAAGTAAATATGTAGAAGAAA	0.398													t|||	1	0.000199681	0.0	0.0014	5008	,	,		20664	0.0		0.0	False		,,,				2504	0.0						uc001dzo.1		NA																	0				ovary(3)	3						c.(907-909)ATA>GTA		solute carrier family 16, member 4	Pyruvic acid(DB00119)						110.0	106.0	107.0					1																	110921598		2203	4300	6503	SO:0001583	missense	9122					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity	g.chr1:110921598T>C	U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.907A>G	1.37:g.110921598T>C	ENSP00000358794:p.Ile303Val					SLC16A4_uc009wfs.1_Missense_Mutation_p.I255V|SLC16A4_uc001dzp.1_Intron|SLC16A4_uc010ovy.1_Missense_Mutation_p.I241V|SLC16A4_uc001dzq.1_Intron|SLC16A4_uc010ovz.1_Missense_Mutation_p.I193V	p.I303V	NM_004696	NP_004687	O15374	MOT5_HUMAN		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	6	1089	-		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)	303			Helical; (Potential).		A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Missense_Mutation	SNP	ENST00000369779.4	37	c.907A>G	CCDS823.1	.	.	.	.	.	.	.	.	.	.	t	9.837	1.190096	0.21954	.	.	ENSG00000168679	ENST00000369779;ENST00000472422;ENST00000437429;ENST00000541986;ENST00000467986	T;T;T;T;T	0.80824	0.29;0.29;0.29;0.29;-1.42	5.99	2.18	0.27775	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.184288	0.56097	D	0.000024	T	0.56848	0.2013	L	0.34521	1.04	0.37775	D	0.926814	P;P;B;P	0.44816	0.844;0.727;0.003;0.727	P;B;B;P	0.53593	0.73;0.338;0.042;0.462	T	0.63994	-0.6511	10	0.05525	T	0.97	.	3.922	0.09248	0.1282:0.0688:0.1343:0.6687	.	193;241;255;303	E7EPY8;B4DJ67;G3V175;O15374	.;.;.;MOT5_HUMAN	V	303;255;193;241;70	ENSP00000358794:I303V;ENSP00000432495:I255V;ENSP00000394790:I193V;ENSP00000446087:I241V;ENSP00000435768:I70V	ENSP00000358794:I303V	I	-	1	0	SLC16A4	110723121	1.000000	0.71417	0.960000	0.40013	0.967000	0.64934	3.178000	0.50879	0.486000	0.27676	-0.255000	0.11280	ATA		0.398	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696		17	53	0	0	0	0.004007	0	17	53				
CHRNB2	1141	broad.mit.edu	37	1	154543767	154543767	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:154543767G>C	ENST00000368476.3	+	5	732	c.468G>C	c.(466-468)aaG>aaC	p.K156N		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	156					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.K156N(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	GCGCATGCAAGATTGAAGTAA	0.527																																							uc001ffg.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(466-468)AAG>AAC		neuronal nicotinic acetylcholine receptor beta 2	Nicotine(DB00184)						120.0	104.0	110.0					1																	154543767		2203	4300	6503	SO:0001583	missense	1141				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr1:154543767G>C	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.468G>C	1.37:g.154543767G>C	ENSP00000357461:p.Lys156Asn						p.K156N	NM_000748	NP_000739	P17787	ACHB2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		5	732	+	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		156			Extracellular (Potential).		Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	c.468G>C	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400476	0.62177	.	.	ENSG00000160716	ENST00000368476	T	0.79454	-1.27	4.38	3.46	0.39613	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.054728	0.64402	D	0.000002	T	0.78935	0.4362	L	0.55990	1.75	0.58432	D	0.999992	D	0.71674	0.998	D	0.72625	0.978	T	0.79766	-0.1665	10	0.49607	T	0.09	.	11.9219	0.52797	0.0866:0.0:0.9134:0.0	.	156	P17787	ACHB2_HUMAN	N	156	ENSP00000357461:K156N	ENSP00000357461:K156N	K	+	3	2	CHRNB2	152810391	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.686000	0.46968	1.027000	0.39758	0.563000	0.77884	AAG		0.527	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748		13	132	0	0	0	0.016723	0	13	132				
SPTA1	6708	broad.mit.edu	37	1	158615379	158615379	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:158615379A>C	ENST00000368147.4	-	28	4082	c.3902T>G	c.(3901-3903)cTg>cGg	p.L1301R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1301					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCAGTTCTGCAGATCCCTAGA	0.428																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(3901-3903)CTG>CGG		spectrin, alpha, erythrocytic 1							126.0	121.0	123.0					1																	158615379		1979	4150	6129	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158615379A>C	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3902T>G	1.37:g.158615379A>C	ENSP00000357129:p.Leu1301Arg						p.L1301R	NM_003126	NP_003117	P02549	SPTA1_HUMAN			28	4101	-	all_hematologic(112;0.0378)		1301			Spectrin 13.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.3902T>G	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.290657	0.40494	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.58358	0.34;0.34	5.07	3.94	0.45596	.	.	.	.	.	T	0.65386	0.2686	M	0.86028	2.79	0.43137	D	0.994889	D	0.89917	1.0	D	0.97110	1.0	T	0.71394	-0.4606	9	0.72032	D	0.01	.	10.4137	0.44309	0.8538:0.0:0.0:0.1462	.	1301	P02549	SPTA1_HUMAN	R	1301	ENSP00000357130:L1301R;ENSP00000357129:L1301R	ENSP00000357129:L1301R	L	-	2	0	SPTA1	156882003	1.000000	0.71417	0.582000	0.28627	0.034000	0.12701	6.497000	0.73674	0.941000	0.37499	0.533000	0.62120	CTG		0.428	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		26	125	0	0	0	0.005443	0	26	125				
DDR2	4921	broad.mit.edu	37	1	162729613	162729613	+	Silent	SNP	C	C	T	rs56351141	byFrequency	TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:162729613C>T	ENST00000367922.3	+	9	1137	c.699C>T	c.(697-699)acC>acT	p.T233T	DDR2_ENST00000367921.3_Silent_p.T233T	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	233					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	GCCAATTGACCGATGGTGTGT	0.537													C|||	27	0.00539137	0.0015	0.0115	5008	,	,		17195	0.0		0.0119	False		,,,				2504	0.0051				NSCLC(161;314 2006 8283 19651 23192)	NSCLC(161;314 2006 8283 19651 23192)	uc001gcf.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6						c.(697-699)ACC>ACT		discoidin domain receptor family, member 2		C	,	9,4397	16.8+/-37.8	0,9,2194	102.0	89.0	94.0		699,699	-8.8	0.7	1	dbSNP_129	94	119,8481	62.1+/-124.0	1,117,4182	no	coding-synonymous,coding-synonymous	DDR2	NM_001014796.1,NM_006182.2	,	1,126,6376	TT,TC,CC		1.3837,0.2043,0.9842	,	233/856,233/856	162729613	128,12878	2203	4300	6503	SO:0001819	synonymous_variant	4921				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:162729613C>T	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.699C>T	1.37:g.162729613C>T						DDR2_uc001gcg.2_Silent_p.T233T	p.T233T	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.113)		9	1164	+	all_hematologic(112;0.115)		233			Extracellular (Potential).		Q7Z730	Silent	SNP	ENST00000367922.3	37	c.699C>T	CCDS1241.1																																																																																				0.537	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182		4	106	0	0	0	0.014758	0	4	106				
PBX1	5087	broad.mit.edu	37	1	164769122	164769122	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:164769122G>T	ENST00000420696.2	+	4	885	c.697G>T	c.(697-699)Gcg>Tcg	p.A233S	PBX1_ENST00000559240.1_Missense_Mutation_p.A233S|PBX1_ENST00000560641.1_Missense_Mutation_p.A128S|PBX1_ENST00000540246.1_Missense_Mutation_p.A128S|PBX1_ENST00000401534.1_Missense_Mutation_p.A233S|PBX1_ENST00000367897.1_Missense_Mutation_p.A233S|PBX1_ENST00000540236.1_Missense_Mutation_p.A233S	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	233					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						ATTTCTGGATGCGCGGTGAGT	0.612			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																		uc001gct.2		NA		Dom	yes		1	1q23	5087	T	pre-B-cell leukemia transcription factor 1			"""L, M"""	TCF3|EWSR1		pre B-ALL|myoepithelioma	EWSR1/PBX1(3)	0				soft_tissue(3)|lung(1)|skin(1)	5						c.(697-699)GCG>TCG		pre-B-cell leukemia homeobox 1							102.0	84.0	90.0					1																	164769122		2203	4300	6503	SO:0001583	missense	5087				negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr1:164769122G>T	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.697G>T	1.37:g.164769122G>T	ENSP00000405890:p.Ala233Ser					PBX1_uc010pku.1_Missense_Mutation_p.A233S|PBX1_uc010pkv.1_Missense_Mutation_p.A150S|PBX1_uc001gcs.2_Missense_Mutation_p.A233S|PBX1_uc010pkw.1_Missense_Mutation_p.A123S	p.A233S	NM_002585	NP_002576	P40424	PBX1_HUMAN			4	955	+			233			Homeobox; TALE-type.		B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	c.697G>T	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702329	0.88924	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	5.64	5.64	0.86602	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.82697	0.5093	L	0.35644	1.08	.	.	.	B;P;P;P;P	0.49862	0.072;0.926;0.926;0.926;0.929	B;P;P;P;P	0.56474	0.057;0.744;0.575;0.799;0.696	T	0.82979	-0.0188	9	0.49607	T	0.09	-10.8365	19.3125	0.94195	0.0:0.0:1.0:0.0	.	128;233;233;233;233	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	S	233;233;233;233;128	ENSP00000405890:A233S;ENSP00000356872:A233S;ENSP00000439943:A233S;ENSP00000384856:A233S;ENSP00000440869:A128S	ENSP00000356872:A233S	A	+	1	0	PBX1	163035746	1.000000	0.71417	0.882000	0.34594	0.901000	0.52897	9.338000	0.96553	2.653000	0.90120	0.655000	0.94253	GCG		0.612	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585		12	35	1	0	5.16669e-11	0.010729	6.09298e-11	12	35				
SLC9C2	284525	broad.mit.edu	37	1	173569349	173569349	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:173569349C>T	ENST00000367714.3	-	3	557	c.135G>A	c.(133-135)ttG>ttA	p.L45L	SLC9C2_ENST00000536496.1_Intron|RP3-436N22.3_ENST00000431459.1_RNA	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	45					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										AACACATCTTCAAAAGCCcta	0.373																																							uc001giz.2		NA																	0				ovary(2)	2						c.(133-135)TTG>TTA		solute carrier family 9, member 11							67.0	61.0	63.0					1																	173569349		2203	4299	6502	SO:0001819	synonymous_variant	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173569349C>T	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.135G>A	1.37:g.173569349C>T						SLC9A11_uc010pmq.1_Intron	p.L45L	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN			3	558	-			45			Helical; (Potential).		Q86UF3	Silent	SNP	ENST00000367714.3	37	c.135G>A	CCDS1308.1																																																																																				0.373	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		8	32	0	0	0	0.004482	0	8	32				
RABGAP1L	9910	broad.mit.edu	37	1	174244980	174244981	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:174244980_174244981GG>AA	ENST00000251507.4	+	9	1237_1238	c.1063_1064GG>AA	c.(1063-1065)GGa>AAa	p.G355K	RABGAP1L_ENST00000357444.6_Missense_Mutation_p.G318K|RABGAP1L_ENST00000367689.3_Missense_Mutation_p.G2K	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						GGAATCCATGGGAAAGAGCTAT	0.347																																							uc001gjx.2		NA																	0				ovary(2)|lung(1)|kidney(1)	4						c.(1063-1065)GGA>AAA		RAB GTPase activating protein 1-like isoform A																																				SO:0001583	missense	9910				regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity	g.chr1:174244980_174244981GG>AA	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	Exception_encountered	1.37:g.174244980_174244981delinsAA	ENSP00000251507:p.Gly355Lys					RABGAP1L_uc009wwq.1_Missense_Mutation_p.G367K|RABGAP1L_uc001gjw.2_Missense_Mutation_p.G318K|RABGAP1L_uc001gjy.2_Missense_Mutation_p.G23K|RABGAP1L_uc001gjz.2_Missense_Mutation_p.G2K	p.G355K	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN			9	1258_1259	+			355					B7ZAA4	Missense_Mutation	DNP	ENST00000251507.4	37	c.1063_1064GG>AA	CCDS1314.1																																																																																				0.347	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084497.1	NM_001243765		7	100	0	0	0	0.004672	0	7	100				
ASTN1	460	broad.mit.edu	37	1	177133755	177133755	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:177133755G>A	ENST00000367654.3	-	1	269	c.58C>T	c.(58-60)Ctg>Ttg	p.L20L	ASTN1_ENST00000424564.2_Silent_p.L20L|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000361833.2_Silent_p.L20L|ASTN1_ENST00000367657.3_Silent_p.L20L	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	20					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GCCGTGGCCAGCACCGCCGCC	0.692																																							uc001glc.2		NA																	0				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(58-60)CTG>TTG		astrotactin isoform 1							14.0	15.0	15.0					1																	177133755		2191	4293	6484	SO:0001819	synonymous_variant	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:177133755G>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.58C>T	1.37:g.177133755G>A						ASTN1_uc001glb.1_Silent_p.L20L|ASTN1_uc001gld.1_Silent_p.L20L|ASTN1_uc009wwx.1_Silent_p.L20L	p.L20L	NM_004319	NP_004310	O14525	ASTN1_HUMAN			1	270	-			20					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37	c.58C>T																																																																																					0.692	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		5	19	0	0	0	0.014758	0	5	19				
C1ORF220	400798	broad.mit.edu	37	1	178514863	178514863	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:178514863G>A	ENST00000367636.4	+	2	587	c.249G>A	c.(247-249)caG>caA	p.Q83Q	C1orf220_ENST00000521244.1_3'UTR|C1orf220_ENST00000319387.2_3'UTR																							AGCTTCTGCAGTTGGGAAGAC	0.532																																							uc001glx.1		NA																	0					0						c.(247-249)CAG>CAA		hypothetical protein LOC400798							89.0	74.0	79.0					1																	178514863		2203	4300	6503	SO:0001819	synonymous_variant	400798							g.chr1:178514863G>A																												ENST00000367636.4:c.249G>A	1.37:g.178514863G>A						C1orf49_uc001glv.1_Intron	p.Q83Q	NM_207467	NP_997350					2	606	+									Silent	SNP	ENST00000367636.4	37	c.249G>A																																																																																					0.532	C1ORF220-201	NOVEL	basic|appris_principal	protein_coding	protein_coding				15	67	0	0	0	0.020292	0	15	67				
CEP350	9857	broad.mit.edu	37	1	180003104	180003104	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:180003104C>G	ENST00000367607.3	+	16	4251	c.3833C>G	c.(3832-3834)tCt>tGt	p.S1278C		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1278	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S1278F(1)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TCAGAAAGATCTAAGTCGTCA	0.453																																							uc001gnt.2		NA																	1	Substitution - Missense(1)		autonomic_ganglia(1)	ovary(4)	4						c.(3832-3834)TCT>TGT		centrosome-associated protein 350							129.0	120.0	123.0					1																	180003104		2203	4300	6503	SO:0001583	missense	9857					centrosome|nucleus|spindle		g.chr1:180003104C>G	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3833C>G	1.37:g.180003104C>G	ENSP00000356579:p.Ser1278Cys					CEP350_uc009wxl.2_Missense_Mutation_p.S1277C|CEP350_uc001gnu.2_Missense_Mutation_p.S1111C	p.S1278C	NM_014810	NP_055625	Q5VT06	CE350_HUMAN			16	4216	+			1278			Ser-rich.		O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	c.3833C>G	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.994929	0.35226	.	.	ENSG00000135837	ENST00000367607	T	0.58210	0.35	5.55	5.55	0.83447	.	0.322381	0.21689	N	0.070613	T	0.40522	0.1120	N	0.24115	0.695	0.33804	D	0.627029	D;D	0.57257	0.979;0.979	B;B	0.43360	0.417;0.319	T	0.52230	-0.8603	9	.	.	.	.	13.1804	0.59651	0.1592:0.8408:0.0:0.0	.	1278;1278	E7EU22;Q5VT06	.;CE350_HUMAN	C	1278	ENSP00000356579:S1278C	.	S	+	2	0	CEP350	178269727	0.995000	0.38212	0.997000	0.53966	0.285000	0.27093	1.217000	0.32455	2.614000	0.88457	0.551000	0.68910	TCT		0.453	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		5	62	0	0	0	0.014758	0	5	62				
CACNA1S	779	broad.mit.edu	37	1	201047120	201047120	+	Silent	SNP	G	G	A	rs141808465	byFrequency	TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:201047120G>A	ENST00000362061.3	-	11	1732	c.1506C>T	c.(1504-1506)ttC>ttT	p.F502F	CACNA1S_ENST00000367338.3_Silent_p.F502F	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	502					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TACACACCACGAAGCAGTCGA	0.592													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19787	0.0		0.0	False		,,,				2504	0.0						uc001gvv.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1504-1506)TTC>TTT		calcium channel, voltage-dependent, L type,	Magnesium Sulfate(DB00653)|Verapamil(DB00661)	G		4,4402	8.1+/-20.4	0,4,2199	123.0	99.0	107.0		1506	-0.5	1.0	1	dbSNP_134	107	0,8600		0,0,4300	no	coding-synonymous	CACNA1S	NM_000069.2		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		502/1874	201047120	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	779				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity	g.chr1:201047120G>A	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1506C>T	1.37:g.201047120G>A							p.F502F	NM_000069	NP_000060	Q13698	CAC1S_HUMAN			11	1733	-			502			Helical; Name=S3 of repeat II; (Potential).|II.		A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	37	c.1506C>T	CCDS1407.1																																																																																				0.592	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		15	87	0	0	0	0.014323	0	15	87				
LPGAT1	9926	broad.mit.edu	37	1	211966499	211966499	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:211966499G>C	ENST00000366997.4	-	3	498	c.272C>G	c.(271-273)tCa>tGa	p.S91*	RN7SL344P_ENST00000485522.2_RNA|LPGAT1_ENST00000366996.1_Nonsense_Mutation_p.S91*	NM_014873.2	NP_055688.1	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	91					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		TTCATCTTTTGAAACTGCTTT	0.373																																							uc001hiu.2		NA																	0				ovary(1)|skin(1)	2						c.(271-273)TCA>TGA		lysophosphatidylglycerol acyltransferase 1							274.0	255.0	262.0					1																	211966499		2203	4300	6503	SO:0001587	stop_gained	9926				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity	g.chr1:211966499G>C	D86960	CCDS31018.1	1q32.3	2008-05-14	2004-11-25	2004-11-26	ENSG00000123684	ENSG00000123684			28985	protein-coding gene	gene with protein product		610473	"""family with sequence similarity 34, member A"""	FAM34A		9039502, 15485873	Standard	NM_014873		Approved	KIAA0205, FAM34A1, NET8	uc001hiv.3	Q92604	OTTHUMG00000037120	ENST00000366997.4:c.272C>G	1.37:g.211966499G>C	ENSP00000355964:p.Ser91*					LPGAT1_uc001hiv.2_Nonsense_Mutation_p.S91*	p.S91*	NM_014873	NP_055688	Q92604	LGAT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)	3	1085	-			91					Q53YL2	Nonsense_Mutation	SNP	ENST00000366997.4	37	c.272C>G	CCDS31018.1	.	.	.	.	.	.	.	.	.	.	G	44	10.762496	0.99463	.	.	ENSG00000123684	ENST00000366997;ENST00000366996	.	.	.	5.44	3.58	0.41010	.	0.255439	0.41001	D	0.000967	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-0.1012	11.9511	0.52956	0.1406:0.0:0.8594:0.0	.	.	.	.	X	91	.	ENSP00000355963:S91X	S	-	2	0	LPGAT1	210033122	1.000000	0.71417	0.001000	0.08648	0.937000	0.57800	5.960000	0.70348	0.699000	0.31761	-0.265000	0.10407	TCA		0.373	LPGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090150.1	NM_014873		5	220	0	0	0	0.014758	0	5	220				
GCSAML	148823	broad.mit.edu	37	1	247719752	247719752	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:247719752G>T	ENST00000366488.4	+	2	177	c.73G>T	c.(73-75)Gat>Tat	p.D25Y	GCSAML_ENST00000463359.1_5'UTR|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000527084.1_5'UTR|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000536561.1_Intron	NM_001281836.1|NM_001281837.1|NM_001281853.1|NM_145278.3	NP_001268765.1|NP_001268766.1|NP_001268782.1|NP_660321.1	Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like	25																	AGGAAACCCAGATGAGGAAAG	0.378																																							uc001idf.2		NA																	0					0						c.(73-75)GAT>TAT		hypothetical protein LOC148823							98.0	112.0	107.0					1																	247719752		2203	4300	6503	SO:0001583	missense	148823							g.chr1:247719752G>T	AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648	ENST00000366488.4:c.73G>T	1.37:g.247719752G>T	ENSP00000355444:p.Asp25Tyr					C1orf150_uc009xgw.2_RNA|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	p.D25Y	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	118	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		25					B2R4Y5|B3KX46|Q5JQT3	Missense_Mutation	SNP	ENST00000366488.4	37	c.73G>T	CCDS1635.1	.	.	.	.	.	.	.	.	.	.	G	4.291	0.053216	0.08291	.	.	ENSG00000169224	ENST00000526896;ENST00000366488	.	.	.	2.9	0.954	0.19595	.	.	.	.	.	T	0.22282	0.0537	N	0.19112	0.55	0.09310	N	0.999998	P	0.39157	0.662	B	0.40009	0.316	T	0.13361	-1.0512	8	0.56958	D	0.05	-0.4678	4.2866	0.10858	0.1366:0.2362:0.6272:0.0	.	25	Q5JQS6	CA150_HUMAN	Y	25	.	ENSP00000355444:D25Y	D	+	1	0	C1orf150	245786375	0.001000	0.12720	0.003000	0.11579	0.081000	0.17604	0.122000	0.15687	0.265000	0.21872	0.491000	0.48974	GAT		0.378	GCSAML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097745.4	NM_145278		7	21	1	0	8.12818e-05	0.001984	8.56207e-05	7	21				
OR2M5	127059	broad.mit.edu	37	1	248309181	248309181	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:248309181C>A	ENST00000366476.1	+	1	732	c.732C>A	c.(730-732)caC>caA	p.H244Q		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	244			H -> N (found in a renal cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:21248752}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GTTCCTCTCACCTCATGGTGG	0.488																																							uc010pze.1		NA																	0		p.H244N(1)		ovary(2)|kidney(1)	3						c.(730-732)CAC>CAA		olfactory receptor, family 2, subfamily M,							239.0	220.0	227.0					1																	248309181		2203	4300	6503	SO:0001583	missense	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248309181C>A		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.732C>A	1.37:g.248309181C>A	ENSP00000355432:p.His244Gln						p.H244Q	NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	732	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		244		H -> N (found in a renal cell carcinoma sample; somatic mutation).	Helical; Name=6; (Potential).			Missense_Mutation	SNP	ENST00000366476.1	37	c.732C>A	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	c	14.43	2.533032	0.45073	.	.	ENSG00000162727	ENST00000366476	T	0.00307	8.17	3.28	-2.0	0.07433	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33515	U	0.004832	T	0.00906	0.0030	H	0.98005	4.125	0.22926	N	0.998554	D	0.76494	0.999	D	0.78314	0.991	T	0.25467	-1.0131	10	0.87932	D	0	.	9.0437	0.36333	0.0:0.3443:0.0:0.6557	.	244	A3KFT3	OR2M5_HUMAN	Q	244	ENSP00000355432:H244Q	ENSP00000355432:H244Q	H	+	3	2	OR2M5	246375804	0.686000	0.27661	0.007000	0.13788	0.724000	0.41520	0.265000	0.18515	-0.240000	0.09696	-0.386000	0.06593	CAC		0.488	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		64	197	1	0	1.74971e-23	0.01441	2.26164e-23	64	197				
DIP2C	22982	broad.mit.edu	37	10	387205	387205	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:387205G>C	ENST00000280886.6	-	29	3605	c.3518C>G	c.(3517-3519)tCt>tGt	p.S1173C		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1173						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CACTTCTCTAGAGGGGTAAAG	0.488																																							uc001ifp.2		NA																	0				breast(4)|ovary(2)|large_intestine(1)	7						c.(3517-3519)TCT>TGT		DIP2 disco-interacting protein 2 homolog C							149.0	123.0	131.0					10																	387205		2203	4300	6503	SO:0001583	missense	22982					nucleus	catalytic activity|transcription factor binding	g.chr10:387205G>C	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3518C>G	10.37:g.387205G>C	ENSP00000280886:p.Ser1173Cys					DIP2C_uc009xhi.1_Missense_Mutation_p.S559C	p.S1173C	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)	29	3608	-		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	1173					B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	c.3518C>G	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.859289	0.91433	.	.	ENSG00000151240	ENST00000280886;ENST00000535541;ENST00000381503	T	0.11712	2.75	5.53	5.53	0.82687	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.36771	0.0979	M	0.78456	2.415	0.80722	D	1	D	0.67145	0.996	D	0.70016	0.967	T	0.11251	-1.0595	10	0.87932	D	0	-21.5985	19.4647	0.94932	0.0:0.0:1.0:0.0	.	1173	Q9Y2E4	DIP2C_HUMAN	C	1173;98;22	ENSP00000280886:S1173C	ENSP00000280886:S1173C	S	-	2	0	DIP2C	377205	1.000000	0.71417	0.988000	0.46212	0.980000	0.70556	9.813000	0.99286	2.606000	0.88127	0.650000	0.86243	TCT		0.488	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974		4	72	0	0	0	0.009096	0	4	72				
ZNF33A	7581	broad.mit.edu	37	10	38343844	38343844	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:38343844C>G	ENST00000458705.2	+	5	947	c.789C>G	c.(787-789)ttC>ttG	p.F263L	ZNF33A_ENST00000374618.3_Missense_Mutation_p.F264L|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000307441.9_Missense_Mutation_p.F263L|ZNF33A_ENST00000432900.2_Missense_Mutation_p.F270L			Q06730	ZN33A_HUMAN	zinc finger protein 33A	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						CCCTCTTGTTCCATCAGATAT	0.388																																							uc001izh.2		NA																	0				ovary(2)|skin(1)	3						c.(787-789)TTC>TTG		zinc finger protein 33A isoform b							72.0	68.0	69.0					10																	38343844		2203	4300	6503	SO:0001583	missense	7581					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38343844C>G	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.789C>G	10.37:g.38343844C>G	ENSP00000387713:p.Phe263Leu					ZNF33A_uc001izg.2_Missense_Mutation_p.F264L|ZNF33A_uc010qev.1_Missense_Mutation_p.F270L|ZNF33A_uc001izi.1_Intron	p.F263L	NM_006974	NP_008905	Q06730	ZN33A_HUMAN			5	967	+			263					A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	c.789C>G	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	C	2.018	-0.425351	0.04701	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.04862	3.55;3.55;3.54;3.54	2.05	-2.16	0.07080	.	0.432664	0.17186	N	0.183718	T	0.01454	0.0047	N	0.00926	-1.1	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.003	B;B;B	0.09377	0.004;0.002;0.003	T	0.43442	-0.9391	10	0.22109	T	0.4	.	2.2761	0.04103	0.417:0.2694:0.0:0.3135	.	270;263;264	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	L	264;270;263;263	ENSP00000363747:F264L;ENSP00000402467:F270L;ENSP00000387713:F263L;ENSP00000304268:F263L	ENSP00000304268:F263L	F	+	3	2	ZNF33A	38383850	0.000000	0.05858	0.010000	0.14722	0.261000	0.26267	-4.225000	0.00270	-0.216000	0.10048	0.460000	0.39030	TTC		0.388	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		16	54	0	0	0	0.003163	0	16	54				
FRMPD2	143162	broad.mit.edu	37	10	49447710	49447710	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:49447710C>T	ENST00000374201.3	-	7	1028	c.726G>A	c.(724-726)caG>caA	p.Q242Q	FRMPD2_ENST00000407470.4_Silent_p.Q211Q|FRMPD2_ENST00000305531.3_Silent_p.Q218Q	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	242					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTGGTGAGCTCTGGGTCTCCG	0.512																																							uc001jgi.2		NA																	0				large_intestine(1)	1						c.(724-726)CAG>CAA		FERM and PDZ domain containing 2 isoform 3							116.0	93.0	101.0					10																	49447710		2203	4300	6503	SO:0001819	synonymous_variant	143162				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding	g.chr10:49447710C>T	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.726G>A	10.37:g.49447710C>T						FRMPD2_uc001jgh.2_Silent_p.Q211Q|FRMPD2_uc001jgj.2_Silent_p.Q220Q	p.Q242Q	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN		Kidney(211;0.201)	7	833	-			242					B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	c.726G>A	CCDS31195.1																																																																																				0.512	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		3	29	0	0	0	0.009096	0	3	29				
HK1	3098	broad.mit.edu	37	10	71136840	71136840	+	Silent	SNP	C	C	T	rs567037782		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:71136840C>T	ENST00000359426.6	+	8	1130	c.1026C>T	c.(1024-1026)atC>atT	p.I342I	HK1_ENST00000494253.1_3'UTR|HK1_ENST00000298649.3_Silent_p.I341I|HK1_ENST00000448642.2_Silent_p.I377I|HK1_ENST00000360289.2_Silent_p.I330I|HK1_ENST00000404387.2_Silent_p.I346I	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	342	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						TGTCAGCCATCGAAAAGTAGG	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		16379	0.0		0.001	False		,,,				2504	0.0						uc001jpl.3		NA																	0				ovary(1)	1						c.(1024-1026)ATC>ATT		hexokinase 1 isoform HKI							104.0	98.0	100.0					10																	71136840		2203	4300	6503	SO:0001819	synonymous_variant	3098				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity	g.chr10:71136840C>T	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1026C>T	10.37:g.71136840C>T						HK1_uc001jpg.3_Silent_p.I330I|HK1_uc001jph.3_Silent_p.I346I|HK1_uc001jpi.3_Silent_p.I346I|HK1_uc001jpj.3_Silent_p.I377I|HK1_uc001jpk.3_Silent_p.I341I|HK1_uc009xqd.2_Silent_p.I220I	p.I342I	NM_000188	NP_000179	P19367	HXK1_HUMAN			8	1127	+			342			Regulatory.		E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Silent	SNP	ENST00000359426.6	37	c.1026C>T	CCDS7292.1																																																																																				0.517	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188		15	69	0	0	0	0.003163	0	15	69				
UNC5B	219699	broad.mit.edu	37	10	73045160	73045160	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:73045160C>T	ENST00000335350.6	+	4	942	c.526C>T	c.(526-528)Ccg>Tcg	p.P176S	UNC5B_ENST00000373192.4_Missense_Mutation_p.P176S	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	176	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCAGTGCCGCCCGCCGGAGGG	0.657											OREG0020248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001jro.2		NA																	0				ovary(2)|lung(1)	3						c.(526-528)CCG>TCG		unc-5 homolog B precursor							32.0	29.0	30.0					10																	73045160		2200	4298	6498	SO:0001583	missense	219699				apoptosis|axon guidance|regulation of apoptosis	integral to membrane		g.chr10:73045160C>T	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.526C>T	10.37:g.73045160C>T	ENSP00000334329:p.Pro176Ser		OREG0020248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1142	UNC5B_uc001jrp.2_Missense_Mutation_p.P176S	p.P176S	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN			4	971	+			176			Ig-like C2-type.|Extracellular (Potential).		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	c.526C>T	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	C	32	5.162606	0.94727	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.38077	1.16;1.16	4.84	4.84	0.62591	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.052494	0.85682	D	0.000000	T	0.62344	0.2420	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74023	0.969;0.982	T	0.67684	-0.5607	10	0.62326	D	0.03	-17.1022	17.9569	0.89072	0.0:1.0:0.0:0.0	.	176;176	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	S	176	ENSP00000334329:P176S;ENSP00000362288:P176S	ENSP00000334329:P176S	P	+	1	0	UNC5B	72715166	1.000000	0.71417	0.996000	0.52242	0.874000	0.50279	7.815000	0.86186	2.233000	0.73108	0.561000	0.74099	CCG		0.657	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		3	14	0	0	0	0.004672	0	3	14				
IDE	3416	broad.mit.edu	37	10	94297241	94297241	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:94297241G>A	ENST00000265986.6	-	2	221	c.165C>T	c.(163-165)acC>acT	p.T55T		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	55					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	CAGGAGACTTGGTAATGTGAT	0.383																																							uc001kia.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(163-165)ACC>ACT		insulin-degrading enzyme isoform 1 precursor	Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						211.0	189.0	196.0					10																	94297241		2203	4300	6503	SO:0001819	synonymous_variant	3416				beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding	g.chr10:94297241G>A	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.165C>T	10.37:g.94297241G>A							p.T55T	NM_004969	NP_004960	P14735	IDE_HUMAN			2	241	-			55					B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	ENST00000265986.6	37	c.165C>T	CCDS7421.1																																																																																				0.383	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969		17	68	0	0	0	0.00499	0	17	68				
PDZD7	79955	broad.mit.edu	37	10	102778631	102778631	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:102778631G>A	ENST00000370215.3	-	8	1497	c.1272C>T	c.(1270-1272)ctC>ctT	p.L424L		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	424						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		GGGGTCGGCTGAGGGCCAGCA	0.692											OREG0020453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001kso.1		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1270-1272)CTC>CTT		PDZ domain containing 7							11.0	15.0	14.0					10																	102778631		2198	4289	6487	SO:0001819	synonymous_variant	79955					cilium|nucleus	protein binding	g.chr10:102778631G>A	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1272C>T	10.37:g.102778631G>A			OREG0020453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1369	PDZD7_uc001ksn.2_Silent_p.L424L	p.L424L	NM_024895	NP_079171	Q9H5P4	PDZD7_HUMAN		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)	8	1487	-			424					D5FJ77|Q8N321	Silent	SNP	ENST00000370215.3	37	c.1272C>T	CCDS31269.1																																																																																				0.692	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895		3	15	0	0	0	0.004672	0	3	15				
CLRN3	119467	broad.mit.edu	37	10	129676535	129676535	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:129676535C>A	ENST00000368671.3	-	3	721	c.559G>T	c.(559-561)Gtc>Ttc	p.V187F		NM_152311.3	NP_689524.1	Q8NCR9	CLRN3_HUMAN	clarin 3	187						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				AGAAGAATGACGAGCAGTATG	0.468																																							uc001lka.1		NA																	0				skin(1)	1						c.(559-561)GTC>TTC		clarin 3							235.0	199.0	211.0					10																	129676535		2203	4300	6503	SO:0001583	missense	119467					integral to membrane		g.chr10:129676535C>A	BC029478	CCDS7656.1	10q26.2	2006-11-24	2006-11-23	2006-11-23	ENSG00000180745	ENSG00000180745			20795	protein-coding gene	gene with protein product			"""transmembrane protein 12"""	TMEM12		12145752, 12080385	Standard	NM_152311		Approved	MGC32871, USH3AL1	uc001lka.1	Q8NCR9	OTTHUMG00000019253	ENST00000368671.3:c.559G>T	10.37:g.129676535C>A	ENSP00000357660:p.Val187Phe					CLRN3_uc001ljz.1_Missense_Mutation_p.V119F	p.V187F	NM_152311	NP_689524	Q8NCR9	CLRN3_HUMAN			3	722	-		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)	187			Helical; (Potential).		Q6MZX8	Missense_Mutation	SNP	ENST00000368671.3	37	c.559G>T	CCDS7656.1	.	.	.	.	.	.	.	.	.	.	c	12.91	2.078733	0.36662	.	.	ENSG00000180745	ENST00000368671	T	0.69306	-0.39	4.48	-1.95	0.07548	.	0.547097	0.17741	N	0.163553	T	0.59959	0.2232	L	0.59436	1.845	0.09310	N	1	P;P	0.41131	0.494;0.739	P;B	0.44447	0.45;0.321	T	0.56329	-0.7997	10	0.11485	T	0.65	.	11.7754	0.51983	0.0:0.4569:0.0:0.5431	.	187;119	Q8NCR9;Q8NCR9-2	CLRN3_HUMAN;.	F	187	ENSP00000357660:V187F	ENSP00000357660:V187F	V	-	1	0	CLRN3	129566525	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.548000	0.06048	-0.587000	0.05890	-1.811000	0.00612	GTC		0.468	CLRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050987.1	NM_152311		36	74	1	0	4.65686e-17	0.017118	5.91602e-17	36	74				
FRG2B	441581	broad.mit.edu	37	10	135440196	135440196	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr10:135440196G>C	ENST00000425520.1	-	1	103	c.51C>G	c.(49-51)tgC>tgG	p.C17W	FRG2B_ENST00000443774.1_Missense_Mutation_p.C17W	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	17						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GGTCAGTGGAGCACTGGATGG	0.502																																							uc010qvg.1		NA																	0					0						c.(49-51)TGC>TGG		FSHD region gene 2 family, member B							187.0	215.0	205.0					10																	135440196		2203	4298	6501	SO:0001583	missense	441581					nucleus		g.chr10:135440196G>C	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.51C>G	10.37:g.135440196G>C	ENSP00000401310:p.Cys17Trp						p.C17W	NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	1	104	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	17					Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	c.51C>G	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	0.666	-0.803967	0.02819	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.34072	1.38;1.38	0.109	0.109	0.14578	.	2.570310	0.01892	N	0.038611	T	0.23171	0.0560	N	0.08118	0	0.09310	N	1	B	0.24963	0.115	B	0.33254	0.16	T	0.25847	-1.0120	9	0.37606	T	0.19	.	.	.	.	.	17	Q96QU4	FRG2B_HUMAN	W	17	ENSP00000408343:C17W;ENSP00000401310:C17W	ENSP00000401310:C17W	C	-	3	2	FRG2B	135290186	0.782000	0.28689	0.014000	0.15608	0.014000	0.08584	0.831000	0.27476	0.181000	0.19994	0.184000	0.17185	TGC		0.502	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998		12	251	0	0	0	0.003163	0	12	251				
OR52B4	143496	broad.mit.edu	37	11	4389047	4389047	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:4389047G>T	ENST00000408920.2	-	1	569	c.479C>A	c.(478-480)cCt>cAt	p.P160H		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	160					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAATATGATAGGGAAAATTGT	0.368																																							uc010qye.1		NA																	0					0						c.(478-480)CCT>CAT		olfactory receptor, family 52, subfamily B,							71.0	68.0	69.0					11																	4389047		1838	4087	5925	SO:0001583	missense	143496				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4389047G>T	AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.479C>A	11.37:g.4389047G>T	ENSP00000386160:p.Pro160His						p.P160H	NM_001005161	NP_001005161	Q8NGK2	O52B4_HUMAN		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	479	-		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)	160			Helical; Name=4; (Potential).		A6NP68|Q6IFK6	Missense_Mutation	SNP	ENST00000408920.2	37	c.479C>A	CCDS41609.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.437989	0.25900	.	.	ENSG00000221996	ENST00000408920	T	0.51325	0.71	5.29	5.29	0.74685	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000027	T	0.79305	0.4423	H	0.96269	3.795	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.76206	-0.3044	10	0.87932	D	0	.	17.6601	0.88191	0.0:0.0:1.0:0.0	.	160	Q8NGK2	O52B4_HUMAN	H	160	ENSP00000386160:P160H	ENSP00000386160:P160H	P	-	2	0	OR52B4	4345623	1.000000	0.71417	0.025000	0.17156	0.004000	0.04260	3.674000	0.54598	2.756000	0.94617	0.655000	0.94253	CCT		0.368	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161		12	37	1	0	3.07112e-06	0.010729	3.37937e-06	12	37				
OR52L1	338751	broad.mit.edu	37	11	6008152	6008152	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:6008152C>T	ENST00000332249.4	-	1	63	c.9G>A	c.(7-9)ttG>ttA	p.L3L		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAAAGAAACCAAAGTCATGA	0.433																																					Melanoma(121;653 1666 10547 22796 51255)	Melanoma(121;653 1666 10547 22796 51255)	uc001mcd.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(7-9)TTG>TTA		olfactory receptor, family 52, subfamily L,							47.0	47.0	47.0					11																	6008152		1858	4083	5941	SO:0001819	synonymous_variant	338751				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6008152C>T	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.9G>A	11.37:g.6008152C>T							p.L3L	NM_001005173	NP_001005173	Q8NGH7	O52L1_HUMAN		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	64	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	3			Extracellular (Potential).		B2RPA6|Q6IFK9	Silent	SNP	ENST00000332249.4	37	c.9G>A	CCDS44529.1																																																																																				0.433	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173		10	44	0	0	0	0.010729	0	10	44				
SBF2	81846	broad.mit.edu	37	11	9850975	9850975	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:9850975C>A	ENST00000256190.8	-	28	3858	c.3721G>T	c.(3721-3723)Gct>Tct	p.A1241S		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1241	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		ACAGAAACAGCATTCAGTAAG	0.373																																							uc001mib.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(3721-3723)GCT>TCT		SET binding factor 2							138.0	131.0	133.0					11																	9850975		2201	4294	6495	SO:0001583	missense	81846				myelination	cytoplasm|membrane	phosphatase activity|protein binding	g.chr11:9850975C>A	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.3721G>T	11.37:g.9850975C>A	ENSP00000256190:p.Ala1241Ser						p.A1241S	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN		all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)	28	3859	-			1241			Myotubularin phosphatase.		Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	c.3721G>T	CCDS31427.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.360|9.360	1.067694|1.067694	0.20067|0.20067	.|.	.|.	ENSG00000133812|ENSG00000133812	ENST00000256190|ENST00000530741	D|.	0.90563|.	-2.69|.	5.38|5.38	5.38|5.38	0.77491|0.77491	Myotubularin phosphatase domain (1);|.	0.215443|.	0.48286|.	D|.	0.000186|.	T|T	0.52725|0.52725	0.1752|0.1752	N|N	0.17278|0.17278	0.47|0.47	0.41284|0.41284	D|D	0.986939|0.986939	B|.	0.02656|.	0.0|.	B|.	0.09377|.	0.004|.	T|T	0.49021|0.49021	-0.8982|-0.8982	10|5	0.05620|.	T|.	0.96|.	.|.	19.132|19.132	0.93412|0.93412	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1241|.	Q86WG5|.	MTMRD_HUMAN|.	S|I	1241|124	ENSP00000256190:A1241S|.	ENSP00000256190:A1241S|.	A|M	-|-	1|3	0|0	SBF2|SBF2	9807551|9807551	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.120000|6.120000	0.71596|0.71596	2.531000|2.531000	0.85337|0.85337	0.655000|0.655000	0.94253|0.94253	GCT|ATG		0.373	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962		25	85	1	0	9.57634e-11	0.01892	1.12039e-10	25	85				
INSC	387755	broad.mit.edu	37	11	15197396	15197396	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:15197396G>A	ENST00000379554.3	+	3	353	c.307G>A	c.(307-309)Gag>Aag	p.E103K	INSC_ENST00000379556.3_Missense_Mutation_p.E56K|INSC_ENST00000424273.1_Missense_Mutation_p.E56K|INSC_ENST00000528567.1_Missense_Mutation_p.E56K|INSC_ENST00000530161.1_Missense_Mutation_p.E56K|INSC_ENST00000525218.1_Missense_Mutation_p.E56K	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	103					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						CAGCCTGGAAGAGGATGCACA	0.612																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(307-309)GAG>AAG		inscuteable isoform a							58.0	62.0	60.0					11																	15197396		2090	4216	6306	SO:0001583	missense	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15197396G>A	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.307G>A	11.37:g.15197396G>A	ENSP00000368872:p.Glu103Lys					INSC_uc001mlz.2_Missense_Mutation_p.E56K|INSC_uc001mma.2_Missense_Mutation_p.E56K|INSC_uc010rcs.1_Missense_Mutation_p.E56K|INSC_uc001mmb.2_Missense_Mutation_p.E56K|INSC_uc001mmc.2_Missense_Mutation_p.E56K	p.E103K	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN			3	353	+			103					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	c.307G>A	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622647	0.46840	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000416761;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.33654	1.43;1.47;1.4;1.44;1.47;1.4	5.32	5.32	0.75619	.	0.130981	0.51477	D	0.000086	T	0.22936	0.0554	N	0.14661	0.345	0.50313	D	0.999863	B;B;B;B	0.20052	0.027;0.002;0.041;0.041	B;B;B;B	0.21360	0.034;0.007;0.016;0.016	T	0.05852	-1.0860	10	0.30078	T	0.28	-21.2756	12.8116	0.57643	0.0849:0.0:0.9151:0.0	.	56;56;56;103	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	K	103;56;56;56;56;56;56	ENSP00000368872:E103K;ENSP00000368874:E56K;ENSP00000389161:E56K;ENSP00000435022:E56K;ENSP00000436194:E56K;ENSP00000436113:E56K	ENSP00000368872:E103K	E	+	1	0	INSC	15153972	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	7.556000	0.82233	2.490000	0.84030	0.561000	0.74099	GAG		0.612	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		4	51	0	0	0	0.014758	0	4	51				
NELL1	4745	broad.mit.edu	37	11	20949951	20949951	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:20949951C>A	ENST00000357134.5	+	9	1075	c.923C>A	c.(922-924)tCc>tAc	p.S308Y	NELL1_ENST00000532434.1_Missense_Mutation_p.S308Y|NELL1_ENST00000298925.5_Missense_Mutation_p.S336Y|NELL1_ENST00000325319.5_Missense_Mutation_p.S251Y	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	308	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CGAAGGATGTCCTGTCCCCCT	0.522																																							uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(922-924)TCC>TAC		nel-like 1 isoform 1 precursor							207.0	164.0	178.0					11																	20949951		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20949951C>A	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.923C>A	11.37:g.20949951C>A	ENSP00000349654:p.Ser308Tyr					NELL1_uc001mqf.2_Missense_Mutation_p.S308Y|NELL1_uc009yid.2_Missense_Mutation_p.S336Y|NELL1_uc010rdo.1_Missense_Mutation_p.S251Y|NELL1_uc010rdp.1_Missense_Mutation_p.S68Y	p.S308Y	NM_006157	NP_006148	Q92832	NELL1_HUMAN			9	1076	+			308			VWFC 1.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.923C>A	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204417	0.38905	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.93	5.01	0.66863	von Willebrand factor, type C (4);	0.256396	0.40640	N	0.001041	T	0.72827	0.3509	M	0.72118	2.19	0.39204	D	0.9632	B;B;P;B	0.36354	0.178;0.096;0.549;0.096	B;B;B;B	0.42245	0.054;0.055;0.381;0.09	T	0.76203	-0.3045	10	0.56958	D	0.05	-9.4605	11.4506	0.50149	0.0:0.861:0.0:0.139	.	251;336;308;308	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	Y	336;308;251;308	ENSP00000298925:S336Y;ENSP00000349654:S308Y;ENSP00000317837:S251Y;ENSP00000437170:S308Y	ENSP00000298925:S336Y	S	+	2	0	NELL1	20906527	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.173000	0.50839	1.483000	0.48342	0.561000	0.74099	TCC		0.522	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		18	64	1	0	6.94344e-10	0.006122	7.99712e-10	18	64				
FNBP4	23360	broad.mit.edu	37	11	47788812	47788812	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:47788812C>T	ENST00000263773.5	-	1	41	c.29G>A	c.(28-30)gGc>gAc	p.G10D	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	10						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						GGGCCTACGGCCGGGTACCGC	0.751																																							uc009ylv.2		NA																	0				ovary(1)	1						c.(28-30)GGC>GAC		formin binding protein 4							3.0	5.0	4.0					11																	47788812		1470	3501	4971	SO:0001583	missense	23360							g.chr11:47788812C>T	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.29G>A	11.37:g.47788812C>T	ENSP00000263773:p.Gly10Asp					FNBP4_uc001ngj.2_5'Flank|FNBP4_uc001ngl.2_RNA	p.G10D	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN			1	182	-			10					Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	c.29G>A	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.323774	0.81580	.	.	ENSG00000109920	ENST00000263773	T	0.64085	-0.08	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.77212	0.4097	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.79090	-0.1946	10	0.87932	D	0	-9.4607	15.4155	0.74962	0.0:1.0:0.0:0.0	.	10	Q8N3X1	FNBP4_HUMAN	D	10	ENSP00000263773:G10D	ENSP00000263773:G10D	G	-	2	0	FNBP4	47745388	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.617000	0.54181	2.746000	0.94184	0.655000	0.94253	GGC		0.751	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3			5	6	0	0	0	0.014758	0	5	6				
OR4C3	256144	broad.mit.edu	37	11	48347185	48347185	+	Silent	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:48347185C>A	ENST00000319856.4	+	1	714	c.693C>A	c.(691-693)atC>atA	p.I231I		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						GTGGTTTAATCTGCCTGTTGA	0.502																																							uc010rhv.1		NA																	0				skin(1)	1						c.(691-693)ATC>ATA		olfactory receptor, family 4, subfamily C,							278.0	186.0	217.0					11																	48347185		2201	4298	6499	SO:0001819	synonymous_variant	256144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48347185C>A	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.693C>A	11.37:g.48347185C>A							p.I231I	NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN			1	693	+			204			Helical; Name=5; (Potential).		B2RNF2|Q6IFB3	Silent	SNP	ENST00000319856.4	37	c.693C>A	CCDS31489.1																																																																																				0.502	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702		15	67	1	0	7.93312e-07	0.020292	8.82783e-07	15	67				
TRIM48	79097	broad.mit.edu	37	11	55033101	55033101	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:55033101C>A	ENST00000417545.2	+	3	571	c.485C>A	c.(484-486)tCt>tAt	p.S162Y		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	146						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						AAAATGCAGTCTTTATGGGAA	0.423																																							uc010rid.1		NA																	0					0						c.(484-486)TCT>TAT		tripartite motif-containing 48							31.0	34.0	33.0					11																	55033101		2175	4241	6416	SO:0001583	missense	79097					intracellular	zinc ion binding	g.chr11:55033101C>A	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.485C>A	11.37:g.55033101C>A	ENSP00000402414:p.Ser162Tyr						p.S162Y	NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN			3	571	+			146					Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	c.485C>A	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	c	1.491	-0.554602	0.03996	.	.	ENSG00000150244	ENST00000417545	T	0.57436	0.4	0.596	0.596	0.17496	.	.	.	.	.	T	0.44350	0.1289	L	0.58510	1.815	0.09310	N	1	P	0.42483	0.781	B	0.44133	0.442	T	0.36432	-0.9748	8	0.02654	T	1	.	.	.	.	.	146	Q8IWZ4	TRI48_HUMAN	Y	162	ENSP00000402414:S162Y	ENSP00000402414:S162Y	S	+	2	0	TRIM48	54789677	0.008000	0.16893	0.003000	0.11579	0.002000	0.02628	-0.045000	0.12003	0.629000	0.30376	0.413000	0.27773	TCT		0.423	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1			3	27	1	0	6.4e-05	0.004672	6.76571e-05	3	27				
OR4S2	219431	broad.mit.edu	37	11	55419086	55419086	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:55419086C>A	ENST00000312422.2	+	1	707	c.707C>A	c.(706-708)tCc>tAc	p.S236Y		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S236Y(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				AAAGCCCTCTCCACCTGTGGC	0.493																																							uc001nhs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(706-708)TCC>TAC		olfactory receptor, family 4, subfamily S,							169.0	137.0	148.0					11																	55419086		2177	4030	6207	SO:0001583	missense	219431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55419086C>A	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.707C>A	11.37:g.55419086C>A	ENSP00000310337:p.Ser236Tyr						p.S236Y	NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN			1	707	+		all_epithelial(135;0.0748)	236			Helical; Name=6; (Potential).		Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	37	c.707C>A	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912501	0.72983	.	.	ENSG00000174982	ENST00000312422	T	0.00311	8.15	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000064	T	0.01254	0.0041	H	0.96398	3.815	0.40243	D	0.977983	D	0.89917	1.0	D	0.97110	1.0	T	0.51284	-0.8725	10	0.59425	D	0.04	.	17.6379	0.88128	0.0:1.0:0.0:0.0	.	236	Q8NH73	OR4S2_HUMAN	Y	236	ENSP00000310337:S236Y	ENSP00000310337:S236Y	S	+	2	0	OR4S2	55175662	0.033000	0.19621	1.000000	0.80357	0.989000	0.77384	0.811000	0.27198	2.508000	0.84585	0.542000	0.68232	TCC		0.493	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059		34	93	1	0	2.80507e-11	0.012213	3.33454e-11	34	93				
OR5F1	338674	broad.mit.edu	37	11	55761773	55761773	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:55761773G>T	ENST00000278409.1	-	1	328	c.329C>A	c.(328-330)aCc>aAc	p.T110N		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	110					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					GATGCATTCGGTTGTCGCCAG	0.468																																							uc010riv.1		NA																	0				ovary(1)|pancreas(1)	2						c.(328-330)ACC>AAC		olfactory receptor, family 5, subfamily F,							84.0	82.0	83.0					11																	55761773		2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55761773G>T	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.329C>A	11.37:g.55761773G>T	ENSP00000278409:p.Thr110Asn						p.T110N	NM_003697	NP_003688	O95221	OR5F1_HUMAN			1	329	-	Esophageal squamous(21;0.00448)		110			Helical; Name=3; (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.329C>A	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	G	4.584	0.108521	0.08780	.	.	ENSG00000149133	ENST00000278409	D	0.81579	-1.51	3.03	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.81987	0.4939	M	0.82132	2.575	0.09310	N	1	B	0.17852	0.024	B	0.25884	0.064	T	0.76364	-0.2986	9	0.87932	D	0	.	12.8922	0.58078	0.0:0.0:1.0:0.0	.	110	O95221	OR5F1_HUMAN	N	110	ENSP00000278409:T110N	ENSP00000278409:T110N	T	-	2	0	OR5F1	55518349	0.000000	0.05858	0.570000	0.28473	0.172000	0.22775	0.623000	0.24447	1.422000	0.47177	0.297000	0.19635	ACC		0.468	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		39	67	1	0	2.37825e-27	0.010771	3.11487e-27	39	67				
OR8K1	390157	broad.mit.edu	37	11	56113845	56113845	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:56113845G>C	ENST00000279783.2	+	1	425	c.331G>C	c.(331-333)Gag>Cag	p.E111Q		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					AGCATTCTTTGAGATTTTCAT	0.408										HNSCC(65;0.19)																													uc010rjg.1		NA																	0				ovary(1)|pancreas(1)	2						c.(331-333)GAG>CAG		olfactory receptor, family 8, subfamily K,							179.0	180.0	180.0					11																	56113845		2201	4296	6497	SO:0001583	missense	390157				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56113845G>C	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.331G>C	11.37:g.56113845G>C	ENSP00000279783:p.Glu111Gln	HNSCC(65;0.19)					p.E111Q	NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN			1	331	+	Esophageal squamous(21;0.00448)		111			Helical; Name=3; (Potential).		B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	37	c.331G>C	CCDS31528.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928235	0.34002	.	.	ENSG00000150261	ENST00000279783	T	0.00551	6.65	5.0	0.682	0.17992	GPCR, rhodopsin-like superfamily (1);	0.561532	0.15800	N	0.244009	T	0.00210	0.0006	N	0.02539	-0.55	0.09310	N	1	P	0.35774	0.519	B	0.15870	0.014	T	0.47971	-0.9075	10	0.41790	T	0.15	-6.9851	6.1453	0.20283	0.2838:0.2184:0.4978:0.0	.	111	Q8NGG5	OR8K1_HUMAN	Q	111	ENSP00000279783:E111Q	ENSP00000279783:E111Q	E	+	1	0	OR8K1	55870421	0.000000	0.05858	0.669000	0.29828	0.982000	0.71751	-0.154000	0.10130	0.512000	0.28257	0.549000	0.68633	GAG		0.408	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907		15	165	0	0	0	0.00499	0	15	165				
OR6Q1	219952	broad.mit.edu	37	11	57798701	57798701	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:57798701G>T	ENST00000302622.3	+	1	300	c.277G>T	c.(277-279)Ggc>Tgc	p.G93C	OR9Q1_ENST00000335397.3_Intron	NM_001005186.2	NP_001005186.2	Q8NGQ2	OR6Q1_HUMAN	olfactory receptor, family 6, subfamily Q, member 1	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			biliary_tract(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(21;0.0707)|all_epithelial(135;0.142)				GGTGGATGGTGGCAAGAATAT	0.478																																							uc010rjz.1		NA																	0				kidney(1)	1						c.(277-279)GGC>TGC		olfactory receptor, family 6, subfamily Q,							172.0	162.0	165.0					11																	57798701		2201	4296	6497	SO:0001583	missense	219952				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57798701G>T	AB065737	CCDS31541.1	11q12.1	2012-08-09			ENSG00000172381	ENSG00000172381		"""GPCR / Class A : Olfactory receptors"""	15302	protein-coding gene	gene with protein product							Standard	NM_001005186		Approved		uc010rjz.2	Q8NGQ2	OTTHUMG00000168831	ENST00000302622.3:c.277G>T	11.37:g.57798701G>T	ENSP00000307734:p.Gly93Cys					OR9Q1_uc001nmj.2_Intron	p.G93C	NM_001005186	NP_001005186	Q8NGQ2	OR6Q1_HUMAN			1	277	+		Breast(21;0.0707)|all_epithelial(135;0.142)	93			Extracellular (Potential).		B9EKW1|Q6IFH1|Q96R34	Missense_Mutation	SNP	ENST00000302622.3	37	c.277G>T	CCDS31541.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.394731	0.25205	.	.	ENSG00000172381	ENST00000302622	T	0.03065	4.06	4.8	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.189708	0.25738	N	0.028633	T	0.04815	0.0130	N	0.25286	0.73	0.09310	N	1	P	0.46859	0.885	P	0.51193	0.662	T	0.29027	-1.0025	10	0.62326	D	0.03	.	6.2431	0.20801	0.0959:0.0:0.7218:0.1824	.	93	Q8NGQ2	OR6Q1_HUMAN	C	93	ENSP00000307734:G93C	ENSP00000307734:G93C	G	+	1	0	OR6Q1	57555277	0.000000	0.05858	0.322000	0.25334	0.104000	0.19210	0.245000	0.18142	1.026000	0.39733	0.643000	0.83706	GGC		0.478	OR6Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401257.1	NM_001005186		49	118	1	0	1.65492e-34	0.01441	2.20656e-34	49	118				
ACTN3	89	broad.mit.edu	37	11	66322659	66322659	+	RNA	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:66322659G>A	ENST00000502692.1	+	0	861				ACTN3_ENST00000513398.1_RNA	NM_001258371.1	NP_001245300.1	Q08043	ACTN3_HUMAN	actinin, alpha 3 (gene/pseudogene)						focal adhesion assembly (GO:0048041)|muscle filament sliding (GO:0030049)|regulation of apoptotic process (GO:0042981)	actin filament (GO:0005884)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)	10						TGACCTCATCGACTACGCCAA	0.622																																							uc001oio.1		NA																	0					0						c.(616-618)GAC>AAC		actinin, alpha 3							68.0	75.0	73.0					11																	66322659		2195	4292	6487			89				focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle	g.chr11:66322659G>A	M86407		11q13.2	2013-10-02	2012-10-05		ENSG00000248746	ENSG00000248746			165	protein-coding gene	gene with protein product		102574	"""actinin, alpha 3"""			1339456	Standard	NM_001104		Approved		uc031qbp.1	Q08043	OTTHUMG00000160815		11.37:g.66322659G>A						ACTN3_uc010rpi.1_RNA	p.D206N	NM_001104	NP_001095	Q08043	ACTN3_HUMAN			6	634	+			206			Actin-binding.|CH 2.		A6NP77|Q4KKV2	Missense_Mutation	SNP	ENST00000502692.1	37	c.616G>A																																																																																					0.622	ACTN3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000362465.1	NM_001104		21	44	0	0	0	0.012319	0	21	44				
TENM4	26011	broad.mit.edu	37	11	78381203	78381203	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:78381203G>A	ENST00000278550.7	-	32	6649	c.6187C>T	c.(6187-6189)Ctg>Ttg	p.L2063L		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2063					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CGGTCAATCAGGGGCCCAATC	0.547																																							uc001ozl.3		NA																	0				ovary(2)|pancreas(2)	4						c.(6187-6189)CTG>TTG		odz, odd Oz/ten-m homolog 4							74.0	84.0	80.0					11																	78381203		2096	4207	6303	SO:0001819	synonymous_variant	26011				signal transduction	integral to membrane		g.chr11:78381203G>A	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6187C>T	11.37:g.78381203G>A						ODZ4_uc001ozk.3_Silent_p.L288L|ODZ4_uc009yvb.1_Silent_p.L647L	p.L2063L	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN			32	6650	-			2063			YD 12.|Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	c.6187C>T	CCDS44688.1																																																																																				0.547	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			10	32	0	0	0	0.006214	0	10	32				
BCO2	83875	broad.mit.edu	37	11	112085561	112085561	+	Missense_Mutation	SNP	A	A	G	rs374509038		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:112085561A>G	ENST00000357685.5	+	10	1544	c.1409A>G	c.(1408-1410)tAt>tGt	p.Y470C	BCO2_ENST00000438022.1_Missense_Mutation_p.Y436C|BCO2_ENST00000361053.4_Missense_Mutation_p.Y397C|BCO2_ENST00000532593.1_Missense_Mutation_p.Y365C|BCO2_ENST00000526088.1_Missense_Mutation_p.Y436C|BCO2_ENST00000393032.2_Missense_Mutation_p.Y436C|BCO2_ENST00000531169.1_Missense_Mutation_p.Y436C			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	470					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						CAGATCTACTATGATCGATTC	0.393																																					GBM(177;1916 2099 21049 29541 39946)	GBM(177;1916 2099 21049 29541 39946)	uc001pnf.2		NA																	0					0						c.(1408-1410)TAT>TGT		beta-carotene dioxygenase 2 isoform a		A	CYS/TYR,CYS/TYR	0,4402		0,0,2201	195.0	183.0	187.0		1307,1409	5.6	1.0	11		187	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	BCO2	NM_001037290.1,NM_031938.4	194,194	0,1,6497	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging	436/546,470/580	112085561	1,12995	2201	4297	6498	SO:0001583	missense	83875				carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr11:112085561A>G	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.1409A>G	11.37:g.112085561A>G	ENSP00000350314:p.Tyr470Cys					BCO2_uc001pne.1_Missense_Mutation_p.Y297C|BCO2_uc001png.2_Missense_Mutation_p.Y397C|BCO2_uc001pnh.2_Missense_Mutation_p.Y436C|BCO2_uc010rwt.1_Missense_Mutation_p.Y365C|BCO2_uc009yyn.2_Missense_Mutation_p.Y436C|BCO2_uc001pni.2_Missense_Mutation_p.Y436C	p.Y470C	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN			10	1526	+			470					B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	c.1409A>G	CCDS8358.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.88|17.88	3.497610|3.497610	0.64186|0.64186	0.0|0.0	1.16E-4|1.16E-4	ENSG00000197580|ENSG00000197580	ENST00000525175|ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	.|D;D;D;D;D;D;D	.|0.95412	.|-3.7;-3.68;-3.68;-3.68;-3.7;-3.58;-3.68	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.111706	.|0.64402	.|D	.|0.000006	D|D	0.98213|0.98213	0.9409|0.9409	M|M	0.92555|0.92555	3.32|3.32	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;1.0;1.0	D|D	0.99402|0.99402	1.0928|1.0928	5|10	.|0.87932	.|D	.|0	-23.6284|-23.6284	15.5314|15.5314	0.75964|0.75964	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|447;397;470;297	.|C9JEZ9;E9PBI8;Q9BYV7;Q8NAZ7	.|.;.;BCDO2_HUMAN;.	V|C	33|470;436;397;436;436;365;436	.|ENSP00000350314:Y470C;ENSP00000376752:Y436C;ENSP00000354338:Y397C;ENSP00000414843:Y436C;ENSP00000436615:Y436C;ENSP00000431802:Y365C;ENSP00000437053:Y436C	.|ENSP00000350314:Y470C	M|Y	+|+	1|2	0|0	BCO2|BCO2	111590771|111590771	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.425000|0.425000	0.31504|0.31504	6.959000|6.959000	0.76031|0.76031	2.145000|2.145000	0.66743|0.66743	0.533000|0.533000	0.62120|0.62120	ATG|TAT		0.393	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290		30	64	0	0	0	0.008361	0	30	64				
PCSK7	9159	broad.mit.edu	37	11	117094859	117094859	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:117094859C>G	ENST00000320934.3	-	8	1619	c.989G>C	c.(988-990)gGa>gCa	p.G330A	PCSK7_ENST00000540028.1_5'UTR	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	330	Peptidase S8.				peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		GTGTTGGCCTCCGTTGCCACT	0.537			T	IGH@	MLCLS																																		uc001pqr.2		NA		Dom	yes		11	11q23.3	9159	T	proprotein convertase subtilisin/kexin type 7			L	IGH@		MLCLS		0					0						c.(988-990)GGA>GCA		proprotein convertase subtilisin/kexin type 7							292.0	216.0	242.0					11																	117094859		2201	4296	6497	SO:0001583	missense	9159				peptide hormone processing	integral to Golgi membrane	serine-type endopeptidase activity	g.chr11:117094859C>G	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.989G>C	11.37:g.117094859C>G	ENSP00000325917:p.Gly330Ala						p.G330A	NM_004716	NP_004707	Q16549	PCSK7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)	8	1190	-	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	330			Catalytic.|Extracellular (Potential).		B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	ENST00000320934.3	37	c.989G>C	CCDS8382.1	.	.	.	.	.	.	.	.	.	.	C	35	5.441950	0.96187	.	.	ENSG00000160613	ENST00000320934;ENST00000543900	D	0.81908	-1.55	5.6	5.6	0.85130	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.91462	0.7305	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92107	0.5693	10	0.87932	D	0	-27.6911	18.6006	0.91247	0.0:1.0:0.0:0.0	.	330	Q16549	PCSK7_HUMAN	A	330	ENSP00000325917:G330A	ENSP00000325917:G330A	G	-	2	0	PCSK7	116600069	1.000000	0.71417	0.891000	0.34965	0.908000	0.53690	7.618000	0.83043	2.623000	0.88846	0.655000	0.94253	GGA		0.537	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716		23	64	0	0	0	0.014323	0	23	64				
PHLDB1	23187	broad.mit.edu	37	11	118516195	118516195	+	Silent	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr11:118516195G>T	ENST00000361417.2	+	17	3654	c.3243G>T	c.(3241-3243)tcG>tcT	p.S1081S	PHLDB1_ENST00000527898.1_Silent_p.S132S|PHLDB1_ENST00000524713.1_Silent_p.S224S|PHLDB1_ENST00000356063.5_Silent_p.S1034S|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1081										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CGGGCCCCTCGGGCTTCCCCC	0.672																																							uc001ptr.1		NA																	0					0						c.(3241-3243)TCG>TCT		pleckstrin homology-like domain, family B,							50.0	59.0	56.0					11																	118516195		2199	4295	6494	SO:0001819	synonymous_variant	23187							g.chr11:118516195G>T		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3243G>T	11.37:g.118516195G>T						PHLDB1_uc001pts.2_Silent_p.S1081S|PHLDB1_uc001ptt.2_Silent_p.S1034S|PHLDB1_uc001ptu.1_RNA|PHLDB1_uc001ptv.1_Silent_p.S896S|PHLDB1_uc001ptw.1_Silent_p.S436S|PHLDB1_uc009zai.1_Silent_p.S117S|PHLDB1_uc001ptx.1_Silent_p.S117S|PHLDB1_uc010ryi.1_Silent_p.S224S	p.S1081S	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)	17	3596	+	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)	1081					B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Silent	SNP	ENST00000361417.2	37	c.3243G>T	CCDS8401.1																																																																																				0.672	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157		23	98	1	0	2.89027e-11	0.014323	3.42208e-11	23	98				
CACNA1C	775	broad.mit.edu	37	12	2705059	2705059	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:2705059C>A	ENST00000347598.4	+	20	2683	c.2683C>A	c.(2683-2685)Cgc>Agc	p.R895S	CACNA1C_ENST00000399634.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R895S|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399591.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R920S|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399637.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000480911.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399621.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000402845.3_Missense_Mutation_p.R895S|CACNA1C_ENST00000406454.3_Missense_Mutation_p.R895S|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R895S|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R895S|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R895S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	895					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCAGTGCCACCGCATTGTCAA	0.577																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(2683-2685)CGC>AGC		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						119.0	119.0	119.0					12																	2705059		2092	4221	6313	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2705059C>A	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.2683C>A	12.37:g.2705059C>A	ENSP00000266376:p.Arg895Ser					CACNA1C_uc009zdv.1_Missense_Mutation_p.R892S|CACNA1C_uc001qkb.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkc.2_Missense_Mutation_p.R895S|CACNA1C_uc001qke.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkf.2_Missense_Mutation_p.R895S|CACNA1C_uc001qjz.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkd.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkg.2_Missense_Mutation_p.R895S|CACNA1C_uc009zdw.1_Missense_Mutation_p.R895S|CACNA1C_uc001qkh.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkl.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkn.2_Missense_Mutation_p.R895S|CACNA1C_uc001qko.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkp.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkr.2_Missense_Mutation_p.R895S|CACNA1C_uc001qku.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkq.2_Missense_Mutation_p.R895S|CACNA1C_uc001qks.2_Missense_Mutation_p.R895S|CACNA1C_uc001qkt.2_Missense_Mutation_p.R895S|CACNA1C_uc001qka.1_Missense_Mutation_p.R430S|CACNA1C_uc001qki.1_Missense_Mutation_p.R631S|CACNA1C_uc001qkj.1_Missense_Mutation_p.R631S|CACNA1C_uc001qkk.1_Missense_Mutation_p.R631S|CACNA1C_uc001qkm.1_Missense_Mutation_p.R631S|CACNA1C_uc001qkw.2_Missense_Mutation_p.R184S	p.R895S	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	20	2996	+			895			III.|Cytoplasmic (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.2683C>A	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491820	0.44249	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96334	-3.9;-3.9;-3.94;-3.9;-3.88;-3.9;-3.92;-3.82;-3.87;-3.91;-3.84;-3.82;-3.91;-3.95;-3.84;-3.76;-3.98;-3.92;-3.89;-3.94;-3.85;-3.94;-3.97	4.93	4.93	0.64822	.	0.114431	0.64402	D	0.000012	D	0.97324	0.9125	L	0.49126	1.545	0.47994	D	0.999562	D;D;P;P;D;P;D;P;P;B;P;P;B;P;P;P;P;P;P;B;P;P;P;P;B;P	0.76494	0.999;0.958;0.788;0.826;0.998;0.928;0.958;0.875;0.928;0.128;0.928;0.891;0.252;0.875;0.826;0.802;0.891;0.851;0.928;0.34;0.891;0.928;0.928;0.913;0.15;0.913	D;P;B;B;D;P;P;P;P;B;P;B;B;P;B;B;B;B;B;B;B;P;B;B;B;B	0.79784	0.993;0.456;0.326;0.194;0.993;0.456;0.456;0.526;0.525;0.154;0.456;0.209;0.229;0.526;0.103;0.326;0.356;0.325;0.362;0.109;0.28;0.456;0.362;0.287;0.105;0.351	D	0.97787	1.0236	10	0.59425	D	0.04	.	18.3199	0.90234	0.0:1.0:0.0:0.0	.	895;892;895;895;895;895;895;895;895;895;895;895;866;895;895;895;895;895;895;895;895;895;895;895;895;895	Q13936-14;Q13936-35;Q13936;E9PDI6;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	920;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;895;736	ENSP00000336982:R920S;ENSP00000382563:R895S;ENSP00000437936:R895S;ENSP00000382552:R895S;ENSP00000382547:R895S;ENSP00000382506:R895S;ENSP00000382530:R895S;ENSP00000382546:R895S;ENSP00000382500:R895S;ENSP00000382549:R895S;ENSP00000266376:R895S;ENSP00000382515:R895S;ENSP00000382510:R895S;ENSP00000341092:R895S;ENSP00000382537:R895S;ENSP00000329877:R895S;ENSP00000382557:R895S;ENSP00000385724:R895S;ENSP00000382512:R895S;ENSP00000382542:R895S;ENSP00000382526:R895S;ENSP00000385896:R895S;ENSP00000382504:R895S	ENSP00000323129:R736S	R	+	1	0	CACNA1C	2575320	0.983000	0.35010	1.000000	0.80357	0.925000	0.55904	2.302000	0.43637	2.566000	0.86566	0.557000	0.71058	CGC		0.577	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		27	69	1	0	3.28513e-13	0.021523	4.01817e-13	27	69				
CHD4	1108	broad.mit.edu	37	12	6697099	6697099	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:6697099T>C	ENST00000357008.2	-	24	3645	c.3482A>G	c.(3481-3483)cAc>cGc	p.H1161R	CHD4_ENST00000309577.6_Missense_Mutation_p.H1161R|CHD4_ENST00000544484.1_Missense_Mutation_p.H1158R|CHD4_ENST00000544040.1_Missense_Mutation_p.H1154R|CHD4_ENST00000540960.1_5'Flank	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1161	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CCCAATCCGGTGAGCTCTGCT	0.448																																					Colon(32;586 792 4568 16848 45314)	Colon(32;586 792 4568 16848 45314)	uc001qpo.2		NA																	0				central_nervous_system(2)	2						c.(3481-3483)CAC>CGC		chromodomain helicase DNA binding protein 4							69.0	67.0	67.0					12																	6697099		2203	4300	6503	SO:0001583	missense	1108				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding	g.chr12:6697099T>C	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3482A>G	12.37:g.6697099T>C	ENSP00000349508:p.His1161Arg					CHD4_uc001qpn.2_Missense_Mutation_p.H1154R|CHD4_uc001qpp.2_Missense_Mutation_p.H1158R	p.H1161R	NM_001273	NP_001264	Q14839	CHD4_HUMAN			24	3646	-			1161			Helicase C-terminal.		Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	c.3482A>G	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473738	0.63737	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96	5.91	5.91	0.95273	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93025	0.7780	H	0.99830	4.82	0.80722	D	1	B;B;D	0.61080	0.196;0.17;0.989	B;B;D	0.75020	0.072;0.13;0.985	D	0.96226	0.9164	10	0.87932	D	0	.	16.3352	0.83056	0.0:0.0:0.0:1.0	.	1161;1161;1154	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	R	1158;1154;1161;1161;1135	ENSP00000440392:H1158R;ENSP00000440542:H1154R;ENSP00000312419:H1161R;ENSP00000349508:H1161R	ENSP00000312419:H1161R	H	-	2	0	CHD4	6567360	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.658000	0.83755	2.261000	0.74972	0.443000	0.29094	CAC		0.448	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273		22	55	0	0	0	0.014323	0	22	55				
GRIN2B	2904	broad.mit.edu	37	12	13769541	13769541	+	Silent	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:13769541G>T	ENST00000609686.1	-	5	1385	c.1176C>A	c.(1174-1176)ccC>ccA	p.P392P		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	392					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GACACATTCGGGGCCACACAT	0.502																																							uc001rbt.2		NA																	0				central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(1174-1176)CCC>CCA		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						183.0	170.0	174.0					12																	13769541		2203	4300	6503	SO:0001819	synonymous_variant	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13769541G>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1176C>A	12.37:g.13769541G>T							p.P392P	NM_000834	NP_000825	Q13224	NMDE2_HUMAN			5	1355	-			392			Extracellular (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	c.1176C>A	CCDS8662.1																																																																																				0.502	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			24	88	1	0	2.39556e-15	0.016522	2.99193e-15	24	88				
ATF7IP	55729	broad.mit.edu	37	12	14577906	14577906	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:14577906G>A	ENST00000540793.1	+	1	1212	c.1057G>A	c.(1057-1059)Gaa>Aaa	p.E353K	ATF7IP_ENST00000543189.1_Missense_Mutation_p.E353K|ATF7IP_ENST00000544627.1_Missense_Mutation_p.E361K|ATF7IP_ENST00000536444.1_Missense_Mutation_p.E353K|ATF7IP_ENST00000261168.4_Missense_Mutation_p.E353K|ATF7IP_ENST00000541654.1_3'UTR			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	353	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						AGAAACTCTAGAAACAGATGA	0.333																																							uc001rbw.2		NA																	0				lung(3)|ovary(1)|skin(1)	5						c.(1057-1059)GAA>AAA		activating transcription factor 7 interacting							66.0	74.0	71.0					12																	14577906		2203	4298	6501	SO:0001583	missense	55729				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding	g.chr12:14577906G>A	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1057G>A	12.37:g.14577906G>A	ENSP00000444589:p.Glu353Lys					ATF7IP_uc010shs.1_Missense_Mutation_p.E353K|ATF7IP_uc001rbu.2_Missense_Mutation_p.E353K|ATF7IP_uc001rbv.1_Missense_Mutation_p.E353K|ATF7IP_uc001rbx.2_Missense_Mutation_p.E353K|ATF7IP_uc010sht.1_Missense_Mutation_p.E353K|ATF7IP_uc001rby.3_Missense_Mutation_p.E353K|ATF7IP_uc001rbz.1_Missense_Mutation_p.E353K|ATF7IP_uc001rca.2_Missense_Mutation_p.E353K|ATF7IP_uc001rcb.2_5'Flank	p.E353K	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN			2	1215	+			353			Glu-rich.		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	c.1057G>A	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300411	0.40694	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.27890	1.98;1.98;1.98;1.98;1.64;1.98	5.55	4.56	0.56223	.	0.329133	0.26418	N	0.024497	T	0.27832	0.0685	L	0.43152	1.355	0.26002	N	0.982103	B;B;B;B;B	0.17268	0.021;0.021;0.003;0.003;0.011	B;B;B;B;B	0.19946	0.027;0.027;0.004;0.004;0.009	T	0.17258	-1.0375	10	0.45353	T	0.12	-8.1753	12.4582	0.55716	0.1494:0.0:0.8506:0.0	.	361;353;353;353;353	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2	.;.;.;MCAF1_HUMAN;.	K	353;353;353;361;353;353	ENSP00000261168:E353K;ENSP00000443179:E353K;ENSP00000445955:E353K;ENSP00000440440:E361K;ENSP00000379575:E353K;ENSP00000444589:E353K	ENSP00000261168:E353K	E	+	1	0	ATF7IP	14469173	0.990000	0.36364	0.851000	0.33527	0.951000	0.60555	1.937000	0.40193	1.304000	0.44892	0.655000	0.94253	GAA		0.333	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179		19	75	0	0	0	0.007413	0	19	75				
OVOS2	144203	broad.mit.edu	37	12	31286090	31286090	+	IGR	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:31286090C>G								RP11-551L14.1 (15685 upstream) : FAM60A (147427 downstream)																							CTTTCCTTTTCAATACCTTCA	0.378																																							uc010sjy.1		NA																	0					NA						c.(2695-2697)GAA>CAA		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							27.0	24.0	25.0					12																	31286090		1776	4026	5802	SO:0001628	intergenic_variant	0							g.chr12:31286090C>G																													12.37:g.31286090C>G							p.E899Q							20	2695	-									Missense_Mutation	SNP		37	c.2695G>C																																																																																				0	0.378									10	40	0	0	0	0.00499	0	10	40				
DDX23	9416	broad.mit.edu	37	12	49233875	49233875	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:49233875C>A	ENST00000308025.3	-	4	414	c.335G>T	c.(334-336)cGa>cTa	p.R112L	DDX23_ENST00000553182.1_5'UTR	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	112	Arg-rich.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						GTCTTTTCCTCGACCAGGAGA	0.438																																							uc001rsm.2		NA																	0				kidney(3)|ovary(1)|lung(1)|skin(1)	6						c.(334-336)CGA>CTA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 23							149.0	148.0	148.0					12																	49233875		2203	4300	6503	SO:0001583	missense	9416					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding	g.chr12:49233875C>A	AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.335G>T	12.37:g.49233875C>A	ENSP00000310723:p.Arg112Leu						p.R112L	NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN			4	426	-			112			Arg-rich.		B2R600|B4DH15|O43188	Missense_Mutation	SNP	ENST00000308025.3	37	c.335G>T	CCDS8770.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000648	0.74818	.	.	ENSG00000174243	ENST00000308025;ENST00000552512;ENST00000551468	T	0.21734	1.99	5.87	5.87	0.94306	.	0.320099	0.30201	N	0.010171	T	0.15696	0.0378	N	0.14661	0.345	0.48040	D	0.999577	P	0.39748	0.686	B	0.37451	0.25	T	0.04216	-1.0968	10	0.35671	T	0.21	-4.4377	19.0502	0.93039	0.0:1.0:0.0:0.0	.	112	Q9BUQ8	DDX23_HUMAN	L	112	ENSP00000310723:R112L	ENSP00000310723:R112L	R	-	2	0	DDX23	47520142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.527000	0.60573	2.798000	0.96311	0.650000	0.86243	CGA		0.438	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2	NM_004818		37	105	1	0	1.26612e-14	0.015359	1.56154e-14	37	105				
KMT2D	8085	broad.mit.edu	37	12	49433570	49433571	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:49433570_49433571GA>TT	ENST00000301067.7	-	31	7981_7982	c.7982_7983TC>AA	c.(7981-7983)cTC>cAA	p.L2661Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2661					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGGTACCTGGGAGTTCAGCTGT	0.579																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(7981-7983)CTC>CAA		myeloid/lymphoid or mixed-lineage leukemia 2																																				SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49433570_49433571GA>TT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7982_7983delinsTT	12.37:g.49433570_49433571delinsTT	ENSP00000301067:p.Leu2661Gln	HNSCC(34;0.089)					p.L2661Q	NM_003482	NP_003473	O14686	MLL2_HUMAN			31	7982_7983	-			2661					O14687	Missense_Mutation	DNP	ENST00000301067.7	37	c.7982_7983TC>AA	CCDS44873.1																																																																																				0.579	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			7	32	0	0	0	0.004672	0	7	32				
KRT1	3848	broad.mit.edu	37	12	53073746	53073746	+	Silent	SNP	A	A	G	rs553332826		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:53073746A>G	ENST00000252244.3	-	1	445	c.387T>C	c.(385-387)ttT>ttC	p.F129F		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	129	Gly/Phe/Ser-rich.|Head.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						cacctccaccaaaaccaccac	0.572													A|||	1	0.000199681	0.0	0.0	5008	,	,		14341	0.0		0.0	False		,,,				2504	0.001						uc001sau.1		NA																	0				ovary(1)|skin(1)	2						c.(385-387)TTT>TTC		keratin 1							373.0	328.0	343.0					12																	53073746		2203	4300	6503	SO:0001819	synonymous_variant	3848				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding	g.chr12:53073746A>G	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.387T>C	12.37:g.53073746A>G						KRT1_uc001sav.1_Silent_p.F129F	p.F129F	NM_006121	NP_006112	P04264	K2C1_HUMAN			1	446	-			129			Head.|Gly/Phe/Ser-rich.		B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	ENST00000252244.3	37	c.387T>C	CCDS8836.1																																																																																				0.572	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121		8	24	0	0	0	0.00308	0	8	24				
PDE1B	5153	broad.mit.edu	37	12	54963037	54963037	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:54963037C>T	ENST00000243052.3	+	4	733	c.297C>T	c.(295-297)gaC>gaT	p.D99D	PDE1B_ENST00000538346.1_Silent_p.D58D|PDE1B_ENST00000394277.3_Intron|PDE1B_ENST00000550620.1_Silent_p.D79D	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	99					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	AGGTGCGGGACTGGCTGGCCT	0.642																																							uc001sgd.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(295-297)GAC>GAT		phosphodiesterase 1B isoform 1							52.0	56.0	55.0					12																	54963037		2203	4300	6503	SO:0001819	synonymous_variant	5153				activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:54963037C>T	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.297C>T	12.37:g.54963037C>T						PDE1B_uc010soz.1_5'UTR|PDE1B_uc010spa.1_Silent_p.D58D|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Silent_p.D79D|PDE1B_uc009znq.2_Intron	p.D99D	NM_000924	NP_000915	Q01064	PDE1B_HUMAN			4	463	+			99					Q92825|Q96KP3	Silent	SNP	ENST00000243052.3	37	c.297C>T	CCDS8882.1																																																																																				0.642	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			15	60	0	0	0	0.003163	0	15	60				
MIP	4284	broad.mit.edu	37	12	56848280	56848280	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:56848280G>T	ENST00000257979.4	-	1	146	c.118C>A	c.(118-120)Cat>Aat	p.H40N	MIP_ENST00000555551.1_Intron	NM_012064.3	NP_036196.1	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	40					canalicular bile acid transport (GO:0015722)|lens development in camera-type eye (GO:0002088)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)|water transport (GO:0006833)	gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|structural constituent of eye lens (GO:0005212)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	16						TGCAGAACATGCAGGGGTCCA	0.572																																							uc001slh.2		NA																	0				skin(1)	1						c.(118-120)CAT>AAT		major intrinsic protein of lens fiber							85.0	81.0	83.0					12																	56848280		2203	4300	6503	SO:0001583	missense	4284				response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens	g.chr12:56848280G>T		CCDS8919.1	12q13	2012-10-02				ENSG00000135517		"""Ion channels / Aquaporins"""	7103	protein-coding gene	gene with protein product	aquaporin 0	154050				1840563, 7536742	Standard	NM_012064		Approved	MP26, LIM1, AQP0	uc001slh.3	P30301		ENST00000257979.4:c.118C>A	12.37:g.56848280G>T	ENSP00000257979:p.His40Asn						p.H40N	NM_012064	NP_036196	P30301	MIP_HUMAN			1	150	-			40			Helical; (By similarity).		Q17R41	Missense_Mutation	SNP	ENST00000257979.4	37	c.118C>A	CCDS8919.1	.	.	.	.	.	.	.	.	.	.	G	9.892	1.204590	0.22205	.	.	ENSG00000135517	ENST00000257979	D	0.92299	-3.01	5.31	4.36	0.52297	Aquaporin-like (2);	0.157463	0.53938	D	0.000051	T	0.77987	0.4213	N	0.02539	-0.55	0.38313	D	0.943314	B	0.02656	0.0	B	0.09377	0.004	T	0.74121	-0.3767	10	0.16420	T	0.52	-10.249	11.2257	0.48882	0.0:0.0:0.6722:0.3278	.	40	P30301	MIP_HUMAN	N	40	ENSP00000257979:H40N	ENSP00000257979:H40N	H	-	1	0	MIP	55134547	0.987000	0.35691	1.000000	0.80357	0.931000	0.56810	2.278000	0.43426	2.657000	0.90304	0.655000	0.94253	CAT		0.572	MIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409620.1	NM_012064		29	75	1	0	1.77063e-15	0.005443	2.22079e-15	29	75				
LRP1	4035	broad.mit.edu	37	12	57569388	57569388	+	Silent	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:57569388C>G	ENST00000243077.3	+	23	4159	c.3693C>G	c.(3691-3693)ctC>ctG	p.L1231L		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1231	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCAAGCATCTCAAATGCAGCC	0.607											OREG0021937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(3691-3693)CTC>CTG		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						139.0	121.0	127.0					12																	57569388		2203	4300	6503	SO:0001819	synonymous_variant	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57569388C>G	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3693C>G	12.37:g.57569388C>G			OREG0021937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1024		p.L1231L	NM_002332	NP_002323	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	23	4159	+			1231			Extracellular (Potential).|EGF-like 6.		Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	c.3693C>G	CCDS8932.1																																																																																				0.607	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		7	80	0	0	0	0.001984	0	7	80				
CAND1	55832	broad.mit.edu	37	12	67703981	67703981	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:67703981G>C	ENST00000545606.1	+	13	3682	c.3245G>C	c.(3244-3246)aGa>aCa	p.R1082T		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	1082					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CTGGATATTAGAAAGGCAGCA	0.348																																							uc001stn.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(3244-3246)AGA>ACA		TIP120 protein							207.0	195.0	199.0					12																	67703981		2203	4300	6503	SO:0001583	missense	55832				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding	g.chr12:67703981G>C		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.3245G>C	12.37:g.67703981G>C	ENSP00000442318:p.Arg1082Thr					CAND1_uc001sto.2_Missense_Mutation_p.R592T	p.R1082T	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)	13	3682	+			1082			HEAT 25.		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	c.3245G>C	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862158	0.71949	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000544619	T;T	0.78816	-1.21;-1.21	5.43	4.54	0.55810	TATA-binding protein interacting (TIP20) (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.91226	0.7235	H	0.95611	3.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93665	0.6985	9	.	.	.	-15.2935	14.5133	0.67802	0.0709:0.0:0.9291:0.0	.	914;1082	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	T	1082;1082;622	ENSP00000442318:R1082T;ENSP00000444089:R622T	.	R	+	2	0	CAND1	65990248	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.779000	0.99018	1.423000	0.47198	-0.140000	0.14226	AGA		0.348	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448		4	100	0	0	0	0.014758	0	4	100				
CCT2	10576	broad.mit.edu	37	12	69987387	69987387	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:69987387G>A	ENST00000299300.6	+	10	1164	c.976G>A	c.(976-978)Gtc>Atc	p.V326I	CCT2_ENST00000544368.2_Missense_Mutation_p.V326I|CCT2_ENST00000543146.2_Missense_Mutation_p.V279I	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	326					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CCTAGCTCTTGTCACAGGTAT	0.373																																							uc001svb.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(976-978)GTC>ATC		chaperonin containing TCP1, subunit 2							100.0	92.0	95.0					12																	69987387		2203	4300	6503	SO:0001583	missense	10576				'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding	g.chr12:69987387G>A	AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.976G>A	12.37:g.69987387G>A	ENSP00000299300:p.Val326Ile					CCT2_uc009zrm.1_RNA|CCT2_uc009zrn.1_Missense_Mutation_p.V326I|CCT2_uc010stl.1_Missense_Mutation_p.V279I	p.V326I	NM_006431	NP_006422	P78371	TCPB_HUMAN	Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)		10	1070	+	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		326					A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Missense_Mutation	SNP	ENST00000299300.6	37	c.976G>A	CCDS8991.1	.	.	.	.	.	.	.	.	.	.	G	32	5.179640	0.94846	.	.	ENSG00000166226	ENST00000299300;ENST00000544368;ENST00000543146	T;T;T	0.78481	-1.18;-1.18;-1.18	5.91	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.86785	0.6016	M	0.75150	2.29	0.80722	D	1	P;P	0.44380	0.834;0.701	P;P	0.62089	0.865;0.898	D	0.86593	0.1861	9	.	.	.	-30.7823	15.273	0.73720	0.067:0.0:0.9329:0.0	.	326;326	F5GWF6;P78371	.;TCPB_HUMAN	I	326;326;279	ENSP00000299300:V326I;ENSP00000441847:V326I;ENSP00000445471:V279I	.	V	+	1	0	CCT2	68273654	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.407000	0.97325	1.500000	0.48636	0.655000	0.94253	GTC		0.373	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403818.1	NM_006431		8	32	0	0	0	0.004482	0	8	32				
MGAT4C	25834	broad.mit.edu	37	12	86373772	86373772	+	Silent	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:86373772T>A	ENST00000604798.1	-	8	1936	c.732A>T	c.(730-732)ctA>ctT	p.L244L	MGAT4C_ENST00000332156.1_Silent_p.L244L|MGAT4C_ENST00000548651.1_Silent_p.L244L|MGAT4C_ENST00000552808.2_Silent_p.L244L|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000393205.2_Silent_p.L273L|MGAT4C_ENST00000549405.2_Silent_p.L244L			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	244					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AAGTTCCTTCTAGGGATGCAA	0.353																																							uc001tai.3		NA																	0				ovary(3)	3						c.(730-732)CTA>CTT		alpha-1,3-mannosyl-glycoprotein							68.0	65.0	66.0					12																	86373772		2203	4300	6503	SO:0001819	synonymous_variant	25834				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr12:86373772T>A		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.732A>T	12.37:g.86373772T>A						MGAT4C_uc001tal.3_Silent_p.L244L|MGAT4C_uc001taj.3_Silent_p.L244L|MGAT4C_uc001tak.3_Silent_p.L244L|MGAT4C_uc010sum.1_Silent_p.L268L|MGAT4C_uc001tah.3_Silent_p.L244L	p.L244L	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN			8	1982	-			244			Lumenal (Potential).		B4DRH2|Q4G199|Q9UIU5	Silent	SNP	ENST00000604798.1	37	c.732A>T	CCDS9030.1																																																																																				0.353	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244		13	30	0	0	0	0.016723	0	13	30				
LUM	4060	broad.mit.edu	37	12	91502497	91502497	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:91502497T>A	ENST00000266718.4	-	2	714	c.260A>T	c.(259-261)gAg>gTg	p.E87V	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	87					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						AGTTACATTCTCAAAGGCCTT	0.378																																							uc001tbm.2		NA																	0				central_nervous_system(2)	2						c.(259-261)GAG>GTG		lumican precursor							99.0	101.0	100.0					12																	91502497		2203	4300	6503	SO:0001583	missense	4060				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent	g.chr12:91502497T>A	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.260A>T	12.37:g.91502497T>A	ENSP00000266718:p.Glu87Val					LUM_uc001tbn.2_Intron	p.E87V	NM_002345	NP_002336	P51884	LUM_HUMAN			2	649	-			87			LRR 1.		B2R6R5|Q96QM7	Missense_Mutation	SNP	ENST00000266718.4	37	c.260A>T	CCDS9038.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.992746	0.74703	.	.	ENSG00000139329	ENST00000266718	T	0.59224	0.28	5.66	5.66	0.87406	.	0.149852	0.64402	D	0.000016	T	0.44222	0.1283	N	0.17345	0.48	0.51767	D	0.999931	B	0.24258	0.1	B	0.22152	0.038	T	0.34775	-0.9815	10	0.44086	T	0.13	-14.612	16.1988	0.82053	0.0:0.0:0.0:1.0	.	87	P51884	LUM_HUMAN	V	87	ENSP00000266718:E87V	ENSP00000266718:E87V	E	-	2	0	LUM	90026628	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.655000	0.83696	2.284000	0.76573	0.528000	0.53228	GAG		0.378	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345		11	47	0	0	0	0.013537	0	11	47				
POLR3B	55703	broad.mit.edu	37	12	106772115	106772115	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:106772115C>G	ENST00000228347.4	+	8	789	c.567C>G	c.(565-567)atC>atG	p.I189M	POLR3B_ENST00000539066.1_Missense_Mutation_p.I131M	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	189					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						AGAACAGGATCATCGTGGAGG	0.418																																							uc001tlp.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(565-567)ATC>ATG		DNA-directed RNA polymerase III B isoform 1							161.0	151.0	154.0					12																	106772115		2203	4300	6503	SO:0001583	missense	55703				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding	g.chr12:106772115C>G	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.567C>G	12.37:g.106772115C>G	ENSP00000228347:p.Ile189Met					POLR3B_uc001tlq.2_Missense_Mutation_p.I131M	p.I189M	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN			8	789	+			189					A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	c.567C>G	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374860	0.61735	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	T;T	0.70164	-0.46;-0.46	5.73	4.84	0.62591	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.63307	0.2500	L	0.33668	1.02	0.80722	D	1	P	0.42556	0.783	P	0.50162	0.633	T	0.62760	-0.6786	10	0.42905	T	0.14	-11.7341	9.3905	0.38370	0.1776:0.7476:0.0:0.0748	.	189	Q9NW08	RPC2_HUMAN	M	189;189;131	ENSP00000228347:I189M;ENSP00000445721:I131M	ENSP00000228347:I189M	I	+	3	3	POLR3B	105296245	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	0.573000	0.23699	1.424000	0.47217	0.650000	0.86243	ATC		0.418	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082		14	114	0	0	0	0.016723	0	14	114				
TMEM132C	92293	broad.mit.edu	37	12	128899644	128899644	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:128899644C>T	ENST00000435159.2	+	2	453	c.453C>T	c.(451-453)ttC>ttT	p.F151F		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	151						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						AGGTTCTTTTCCACATCATGG	0.532																																							uc001uhs.3		NA																	0				central_nervous_system(1)	1						c.(115-117)TTC>TTT		transmembrane protein 132C							20.0	21.0	21.0					12																	128899644		692	1591	2283	SO:0001819	synonymous_variant	92293					integral to membrane		g.chr12:128899644C>T	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.453C>T	12.37:g.128899644C>T							p.F39F	NM_001136103	NP_001129575	Q8N3T6	T132C_HUMAN			1	354	+			151			Extracellular (Potential).		Q69YX8	Silent	SNP	ENST00000435159.2	37	c.117C>T																																																																																					0.532	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062		7	9	0	0	0	0.004482	0	7	9				
FZD10	11211	broad.mit.edu	37	12	130648151	130648151	+	Missense_Mutation	SNP	G	G	C	rs374628122		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:130648151G>C	ENST00000229030.4	+	1	1148	c.664G>C	c.(664-666)Gag>Cag	p.E222Q	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_Missense_Mutation_p.R189P			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	222					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CTGGAGCCGCGAGGACAAGCG	0.692																																							uc001uii.2		NA																	0				lung(3)|breast(1)|central_nervous_system(1)	5						c.(664-666)GAG>CAG		frizzled 10 precursor							64.0	51.0	56.0					12																	130648151		2203	4300	6503	SO:0001583	missense	11211				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr12:130648151G>C	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.664G>C	12.37:g.130648151G>C	ENSP00000229030:p.Glu222Gln					uc001uig.1_5'Flank|uc001uih.1_5'Flank	p.E222Q	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)	1	1120	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		222			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000229030.4	37	c.664G>C	CCDS9267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.48|11.48	1.650979|1.650979	0.29336|0.29336	.|.	.|.	ENSG00000111432|ENSG00000111432	ENST00000229030|ENST00000539839	D|.	0.82526|.	-1.62|.	5.26|5.26	4.34|4.34	0.51931|0.51931	.|.	0.316389|.	0.28448|.	U|.	0.015310|.	T|T	0.38081|0.38081	0.1027|0.1027	N|N	0.20610|0.20610	0.595|0.595	0.21325|0.21325	N|N	0.999729|0.999729	B|.	0.06786|.	0.001|.	B|.	0.14023|.	0.01|.	T|T	0.36866|0.36866	-0.9730|-0.9730	10|6	0.30078|0.87932	T|D	0.28|0	.|.	14.7019|14.7019	0.69162|0.69162	0.0:0.2758:0.7242:0.0|0.0:0.2758:0.7242:0.0	.|.	222|.	Q9ULW2|.	FZD10_HUMAN|.	Q|P	222|189	ENSP00000229030:E222Q|.	ENSP00000229030:E222Q|ENSP00000438460:R189P	E|R	+|+	1|2	0|0	FZD10|FZD10	129214104|129214104	1.000000|1.000000	0.71417|0.71417	0.268000|0.268000	0.24571|0.24571	0.996000|0.996000	0.88848|0.88848	6.438000|6.438000	0.73426|0.73426	1.137000|1.137000	0.42214|0.42214	0.561000|0.561000	0.74099|0.74099	GAG|CGA		0.692	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				18	60	0	0	0	0.006122	0	18	60				
DOCK9	23348	broad.mit.edu	37	13	99508166	99508166	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr13:99508166T>C	ENST00000376460.1	-	34	3897	c.3817A>G	c.(3817-3819)Aat>Gat	p.N1273D	DOCK9_ENST00000339416.2_Missense_Mutation_p.N1274D|DOCK9_ENST00000448493.2_Missense_Mutation_p.N1285D	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1274					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCCAGGGAATTGCTCTTCTCA	0.393																																							uc001vnt.2		NA																	0				central_nervous_system(1)	1						c.(3820-3822)AAT>GAT		dedicator of cytokinesis 9 isoform a							187.0	177.0	180.0					13																	99508166		1858	4102	5960	SO:0001583	missense	23348				blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr13:99508166T>C	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.3817A>G	13.37:g.99508166T>C	ENSP00000365643:p.Asn1273Asp					DOCK9_uc001vnw.2_Missense_Mutation_p.N1273D|DOCK9_uc001vnv.1_RNA|DOCK9_uc010tir.1_Missense_Mutation_p.N1274D|DOCK9_uc010tip.1_5'Flank|DOCK9_uc010tiq.1_Missense_Mutation_p.N252D|DOCK9_uc010afu.1_3'UTR	p.N1274D	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN			34	3875	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		1274					B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	c.3820A>G	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	T	9.631	1.136528	0.21123	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000448493;ENST00000449796	T;T;T;T	0.42900	2.05;2.05;2.05;0.96	5.76	4.58	0.56647	.	0.158085	0.64402	D	0.000015	T	0.25901	0.0631	N	0.25332	0.735	0.80722	D	1	P;P;B	0.44627	0.839;0.696;0.399	B;B;B	0.38842	0.218;0.283;0.101	T	0.03619	-1.1019	10	0.09338	T	0.73	-27.1049	11.4523	0.50160	0.0:0.0702:0.0:0.9298	.	1274;1273;1274	A8MWZ5;Q9BZ29-5;Q9BZ29	.;.;DOCK9_HUMAN	D	1273;1274;1274;1274;1273;204;1274;1285;25	ENSP00000365643:N1273D;ENSP00000341086:N1274D;ENSP00000401958:N1285D;ENSP00000403528:N25D	ENSP00000341086:N1274D	N	-	1	0	DOCK9	98306167	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	3.903000	0.56318	1.026000	0.39733	0.533000	0.62120	AAT		0.393	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296		48	90	0	0	0	0.01441	0	48	90				
MYO16	23026	broad.mit.edu	37	13	109365050	109365050	+	Missense_Mutation	SNP	G	G	T	rs111464054		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr13:109365050G>T	ENST00000357550.2	+	2	309	c.268G>T	c.(268-270)Gtc>Ttc	p.V90F	MYO16_ENST00000251041.5_Missense_Mutation_p.V90F|MYO16_ENST00000356711.2_Missense_Mutation_p.V90F	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCACACCCTCGTCTCCTCGGG	0.577																																							uc001vqt.1		NA																	0				ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(268-270)GTC>TTC		myosin heavy chain Myr 8							108.0	93.0	98.0					13																	109365050		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109365050G>T		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.268G>T	13.37:g.109365050G>T	ENSP00000350160:p.Val90Phe					MYO16_uc010agk.1_Missense_Mutation_p.V112F	p.V90F	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		3	394	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		90						Missense_Mutation	SNP	ENST00000357550.2	37	c.268G>T	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	11.28	1.590787	0.28357	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.52754	0.65;0.65;0.65	5.28	-1.11	0.09840	Ankyrin repeat-containing domain (4);	0.639252	0.11360	U	0.572010	T	0.29491	0.0735	N	0.11673	0.155	0.09310	N	1	P;D	0.55800	0.908;0.973	P;P	0.49561	0.458;0.615	T	0.17837	-1.0356	9	.	.	.	.	5.008	0.14298	0.38:0.3446:0.2754:0.0	.	90;90	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	F	90	ENSP00000349145:V90F;ENSP00000350160:V90F;ENSP00000251041:V90F	.	V	+	1	0	MYO16	108163051	0.001000	0.12720	0.000000	0.03702	0.019000	0.09904	-0.409000	0.07160	-0.010000	0.14271	-0.145000	0.13849	GTC		0.577	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		25	73	1	0	2.49675e-24	0.007291	3.25567e-24	25	73				
MYO16	23026	broad.mit.edu	37	13	109550455	109550455	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr13:109550455G>A	ENST00000357550.2	+	14	1726	c.1685G>A	c.(1684-1686)tGt>tAt	p.C562Y	MYO16_ENST00000251041.5_Missense_Mutation_p.C562Y|MYO16_ENST00000457511.2_Missense_Mutation_p.C74Y|MYO16_ENST00000356711.2_Missense_Mutation_p.C562Y	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CTGCAGTTCTGTGAGAGGAAA	0.488																																							uc001vqt.1		NA																	0				ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(1684-1686)TGT>TAT		myosin heavy chain Myr 8							141.0	121.0	128.0					13																	109550455		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109550455G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1685G>A	13.37:g.109550455G>A	ENSP00000350160:p.Cys562Tyr					MYO16_uc010agk.1_Missense_Mutation_p.C584Y|MYO16_uc001vqu.1_Missense_Mutation_p.C362Y|MYO16_uc010tjh.1_Missense_Mutation_p.C74Y	p.C562Y	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		15	1811	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		562			Myosin head-like 1.			Missense_Mutation	SNP	ENST00000357550.2	37	c.1685G>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805106	0.70682	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62	5.2	5.2	0.72013	Myosin head, motor domain (2);	0.000000	0.44483	U	0.000446	D	0.96950	0.9004	M	0.78801	2.425	0.58432	D	0.999993	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.75020	0.971;0.957;0.985	D	0.96779	0.9574	9	.	.	.	.	16.6174	0.84920	0.0:0.0:1.0:0.0	.	74;562;562	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	Y	562;562;562;562;350;74	ENSP00000349145:C562Y;ENSP00000350160:C562Y;ENSP00000251041:C562Y;ENSP00000401633:C74Y	.	C	+	2	0	MYO16	108348456	1.000000	0.71417	0.996000	0.52242	0.849000	0.48306	6.521000	0.73778	2.584000	0.87258	0.563000	0.77884	TGT		0.488	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		13	41	0	0	0	0.013537	0	13	41				
OR4N2	390429	broad.mit.edu	37	14	20295677	20295677	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:20295677C>T	ENST00000315947.1	+	1	70	c.70C>T	c.(70-72)Cag>Tag	p.Q24*	OR4N2_ENST00000568211.1_Nonsense_Mutation_p.Q24*	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCAAGATATTCAGCTCCTGGT	0.428																																							uc010tkv.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(70-72)CAG>TAG		olfactory receptor, family 4, subfamily N,							163.0	181.0	175.0					14																	20295677		2203	4300	6503	SO:0001587	stop_gained	390429				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20295677C>T		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.70C>T	14.37:g.20295677C>T	ENSP00000319601:p.Gln24*						p.Q24*	NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	70	+	all_cancers(95;0.00108)		24			Extracellular (Potential).		Q6IEY9|Q6IFA2	Nonsense_Mutation	SNP	ENST00000315947.1	37	c.70C>T	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	19.90	3.912457	0.72983	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	.	.	.	4.41	4.41	0.53225	.	0.000000	0.46145	D	0.000319	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-8.0218	14.8767	0.70498	0.0:1.0:0.0:0.0	.	.	.	.	X	24	.	ENSP00000319601:Q24X	Q	+	1	0	OR4N2	19365517	0.070000	0.21116	0.962000	0.40283	0.975000	0.68041	1.774000	0.38573	2.431000	0.82371	0.591000	0.81541	CAG		0.428	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			6	237	0	0	0	0.001168	0	6	237				
HAUS4	54930	broad.mit.edu	37	14	23421791	23421791	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:23421791C>T	ENST00000206474.7	-	3	409	c.157G>A	c.(157-159)Gag>Aag	p.E53K	RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000554446.1_5'UTR|HAUS4_ENST00000555367.1_Missense_Mutation_p.E53K|HAUS4_ENST00000555986.1_Missense_Mutation_p.E53K|RP11-298I3.5_ENST00000555074.1_Intron|HAUS4_ENST00000397409.4_Missense_Mutation_p.E53K|HAUS4_ENST00000541587.1_Missense_Mutation_p.E53K|HAUS4_ENST00000347758.2_Missense_Mutation_p.E53K|RP11-298I3.1_ENST00000548322.1_RNA|HAUS4_ENST00000490506.1_Intron|HAUS4_ENST00000342454.8_Missense_Mutation_p.E53K			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	53					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						AAGCCACTCTCATCCACATGC	0.483																																							uc001whp.2		NA																	0				ovary(1)	1						c.(157-159)GAG>AAG		HAUS augmin-like complex, subunit 4							103.0	100.0	101.0					14																	23421791		2203	4300	6503	SO:0001583	missense	54930				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle		g.chr14:23421791C>T	AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.157G>A	14.37:g.23421791C>T	ENSP00000206474:p.Glu53Lys					HAUS4_uc001who.2_RNA|HAUS4_uc001whq.2_Missense_Mutation_p.E53K|HAUS4_uc001whr.2_Missense_Mutation_p.E53K|HAUS4_uc001whs.2_Missense_Mutation_p.E53K|HAUS4_uc001wht.2_Missense_Mutation_p.E53K|HAUS4_uc001whu.2_Missense_Mutation_p.E53K|HAUS4_uc001whv.2_Intron|HAUS4_uc001whw.2_Missense_Mutation_p.E53K|HAUS4_uc001whx.2_Missense_Mutation_p.E53K	p.E53K	NM_017815	NP_060285	Q9H6D7	HAUS4_HUMAN			2	188	-			53					B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Missense_Mutation	SNP	ENST00000206474.7	37	c.157G>A	CCDS9580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.60|15.60	2.881208|2.881208	0.51801|0.51801	.|.	.|.	ENSG00000092036|ENSG00000092036	ENST00000206474;ENST00000541587;ENST00000342454;ENST00000347758;ENST00000397409;ENST00000555367;ENST00000555986;ENST00000555040;ENST00000556915;ENST00000554516;ENST00000557591|ENST00000553420	.|.	.|.	.|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.347821|.	0.32231|.	N|.	0.006384|.	T|T	0.44222|0.44222	0.1283|0.1283	L|L	0.44542|0.44542	1.39|1.39	0.24037|0.24037	N|N	0.996097|0.996097	P;P;D|.	0.63880|.	0.939;0.879;0.993|.	P;P;P|.	0.58520|.	0.584;0.503;0.84|.	T|T	0.36089|0.36089	-0.9762|-0.9762	9|5	0.20046|.	T|.	0.44|.	-13.4401|-13.4401	12.375|12.375	0.55275|0.55275	0.1681:0.8319:0.0:0.0|0.1681:0.8319:0.0:0.0	.|.	53;53;53|.	Q9H6D7-4;Q9H6D7-2;Q9H6D7|.	.;.;HAUS4_HUMAN|.	K|I	53|34	.|.	ENSP00000206474:E53K|.	E|M	-|-	1|3	0|0	HAUS4|HAUS4	22491631|22491631	0.968000|0.968000	0.33430|0.33430	0.995000|0.995000	0.50966|0.50966	0.701000|0.701000	0.40568|0.40568	1.591000|1.591000	0.36665|0.36665	2.706000|2.706000	0.92434|0.92434	0.561000|0.561000	0.74099|0.74099	GAG|ATG		0.483	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071680.3			10	84	0	0	0	0.010729	0	10	84				
MYH7	4625	broad.mit.edu	37	14	23894032	23894032	+	Missense_Mutation	SNP	C	C	G	rs397516159		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:23894032C>G	ENST00000355349.3	-	22	2787	c.2625G>C	c.(2623-2625)gaG>gaC	p.E875D		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	875					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ACACCATCTTCTCCTCCAGCT	0.587																																							uc001wjx.2		NA																	0				ovary(3)|skin(1)	4						c.(2623-2625)GAG>GAC		myosin, heavy chain 7, cardiac muscle, beta							88.0	75.0	79.0					14																	23894032		2203	4300	6503	SO:0001583	missense	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23894032C>G	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2625G>C	14.37:g.23894032C>G	ENSP00000347507:p.Glu875Asp						p.E875D	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	22	2731	-	all_cancers(95;2.54e-05)		875			Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	c.2625G>C	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190283	0.58017	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.83755	-1.76	4.73	3.83	0.44106	.	.	.	.	.	D	0.90625	0.7060	M	0.84326	2.69	0.49130	D	0.999751	D	0.69078	0.997	D	0.79108	0.992	D	0.90639	0.4573	9	0.62326	D	0.03	.	12.5703	0.56332	0.0:0.8536:0.0:0.1464	.	875	P12883	MYH7_HUMAN	D	875	ENSP00000347507:E875D	ENSP00000347507:E875D	E	-	3	2	MYH7	22963872	0.983000	0.35010	1.000000	0.80357	0.954000	0.61252	0.206000	0.17375	0.722000	0.32252	-0.797000	0.03246	GAG		0.587	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		12	85	0	0	0	0.013537	0	12	85				
STRN3	29966	broad.mit.edu	37	14	31380333	31380333	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:31380333C>G	ENST00000357479.5	-	13	1830	c.1634G>C	c.(1633-1635)gGa>gCa	p.G545A	STRN3_ENST00000366206.2_5'Flank|STRN3_ENST00000355683.5_Missense_Mutation_p.G461A	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	545					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		ACACTGTTCTCCATTAGAACT	0.373																																							uc001wqu.2		NA																	0					0						c.(1633-1635)GGA>GCA		nuclear autoantigen isoform 1							85.0	75.0	79.0					14																	31380333		2203	4300	6503	SO:0001583	missense	29966				negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity	g.chr14:31380333C>G		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1634G>C	14.37:g.31380333C>G	ENSP00000350071:p.Gly545Ala					STRN3_uc001wqv.2_Missense_Mutation_p.G461A|STRN3_uc010tpj.1_RNA	p.G545A	NM_001083893	NP_001077362	Q13033	STRN3_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)	13	1850	-	Hepatocellular(127;0.0877)|Breast(36;0.148)		545			WD 2.		A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	ENST00000357479.5	37	c.1634G>C	CCDS41938.1	.	.	.	.	.	.	.	.	.	.	C	34	5.387751	0.95988	.	.	ENSG00000196792	ENST00000355683;ENST00000357479	D;D	0.84516	-1.86;-1.86	6.02	6.02	0.97574	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.92964	0.7761	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	0.97;1.0	P;D	0.91635	0.804;0.999	D	0.92639	0.6123	10	0.72032	D	0.01	-6.4329	20.5407	0.99260	0.0:1.0:0.0:0.0	.	461;545	Q13033-2;Q13033	.;STRN3_HUMAN	A	461;545	ENSP00000347909:G461A;ENSP00000350071:G545A	ENSP00000347909:G461A	G	-	2	0	STRN3	30450084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.750000	0.85110	2.865000	0.98341	0.655000	0.94253	GGA		0.373	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574		3	43	0	0	0	0.004672	0	3	43				
MIA2	117153	broad.mit.edu	37	14	39722410	39722410	+	Nonsense_Mutation	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:39722410T>A	ENST00000280082.3	+	6	2121	c.1922T>A	c.(1921-1923)tTa>tAa	p.L641*	RP11-407N17.3_ENST00000553728.1_Intron	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	0					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		GCAATAATTTTACCTATTTTG	0.289																																							uc001wux.2		NA																	0				ovary(1)|breast(1)	2						c.(1921-1923)TTA>TAA		melanoma inhibitory activity 2							72.0	80.0	77.0					14																	39722410		2199	4281	6480	SO:0001587	stop_gained	117153					extracellular region		g.chr14:39722410T>A	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1922T>A	14.37:g.39722410T>A	ENSP00000280082:p.Leu641*						p.L641*	NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)	6	2116	+	Hepatocellular(127;0.213)		Error:Variant_position_missing_in_Q96PC5_after_alignment					A1L4H0|Q9H6C1	Nonsense_Mutation	SNP	ENST00000280082.3	37	c.1922T>A	CCDS9672.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.289372	0.80914	.	.	ENSG00000150526	ENST00000280082	.	.	.	4.36	-3.08	0.05347	.	3.461180	0.01756	N	0.030232	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.5571	0.02586	0.422:0.086:0.1449:0.3471	.	.	.	.	X	641	.	.	L	+	2	0	MIA2	38792161	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-0.267000	0.08619	-0.655000	0.05387	0.528000	0.53228	TTA		0.289	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024		24	49	0	0	0	0.016522	0	24	49				
LRFN5	145581	broad.mit.edu	37	14	42360955	42360955	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:42360955C>A	ENST00000298119.4	+	4	3077	c.1888C>A	c.(1888-1890)Cct>Act	p.P630T	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	630						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTCTGCTTTGCCTCCTTCCTG	0.458										HNSCC(30;0.082)																													uc001wvm.2		NA																	0				ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(1888-1890)CCT>ACT		leucine rich repeat and fibronectin type III							126.0	103.0	111.0					14																	42360955		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42360955C>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1888C>A	14.37:g.42360955C>A	ENSP00000298119:p.Pro630Thr	HNSCC(30;0.082)				LRFN5_uc010ana.2_Intron	p.P630T	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	4	3086	+			630			Cytoplasmic (Potential).		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.1888C>A	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.460711	0.26248	.	.	ENSG00000165379	ENST00000298119	T	0.43688	0.94	5.9	5.9	0.94986	.	0.000000	0.56097	D	0.000029	T	0.22898	0.0553	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10337	-1.0634	10	0.26408	T	0.33	.	11.0929	0.48125	0.0:0.9166:0.0:0.0834	.	630	Q96NI6	LRFN5_HUMAN	T	630	ENSP00000298119:P630T	ENSP00000298119:P630T	P	+	1	0	LRFN5	41430705	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.292000	0.59031	2.808000	0.96608	0.650000	0.86243	CCT		0.458	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		15	40	1	0	2.31682e-05	0.003163	2.48471e-05	15	40				
NIN	51199	broad.mit.edu	37	14	51223726	51223726	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:51223726T>A	ENST00000382041.3	-	18	4212	c.4022A>T	c.(4021-4023)cAg>cTg	p.Q1341L	NIN_ENST00000453196.1_Missense_Mutation_p.Q1341L|NIN_ENST00000389868.3_Intron|NIN_ENST00000245441.5_Missense_Mutation_p.Q1341L|NIN_ENST00000382043.4_Intron|NIN_ENST00000324330.9_Missense_Mutation_p.Q1341L|NIN_ENST00000530997.2_Missense_Mutation_p.Q1341L	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1341					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					gtcacaccgctggaCCACGCT	0.453			T	PDGFRB	MPD																																		uc001wym.2		NA		Dom	yes		14	14q24	51199	T	ninein (GSK3B interacting protein)			L	PDGFRB		MPD		0				skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6						c.(4021-4023)CAG>CTG		ninein isoform 5							63.0	60.0	61.0					14																	51223726		2203	4300	6503	SO:0001583	missense	51199				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding	g.chr14:51223726T>A	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4022A>T	14.37:g.51223726T>A	ENSP00000371472:p.Gln1341Leu					NIN_uc001wyi.2_Missense_Mutation_p.Q1341L|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Missense_Mutation_p.Q1347L|NIN_uc001wyo.2_Missense_Mutation_p.Q1341L	p.Q1341L	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN			18	4213	-	all_epithelial(31;0.00244)|Breast(41;0.127)		1341			Potential.		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	c.4022A>T	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	T	9.676	1.147922	0.21288	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	T;T;T;T	0.06687	3.54;3.27;3.27;3.27	5.47	-8.05	0.01106	.	1.888530	0.02357	N	0.076489	T	0.01387	0.0045	N	0.00289	-1.7	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.42865	-0.9426	10	0.09843	T	0.71	8.587	2.0094	0.03485	0.1484:0.211:0.3777:0.2629	.	1347;1341;1341;1341	Q8N4C6-5;C9J066;Q8N4C6;Q8N4C6-7	.;.;NIN_HUMAN;.	L	1341;1324;1347;1341;1341;1341	ENSP00000245441:Q1341L;ENSP00000371472:Q1341L;ENSP00000324210:Q1341L;ENSP00000412391:Q1341L	ENSP00000245441:Q1341L	Q	-	2	0	NIN	50293476	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.259000	0.08721	-1.052000	0.03222	-1.074000	0.02243	CAG		0.453	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946		19	29	0	0	0	0.007413	0	19	29				
SYNE2	23224	broad.mit.edu	37	14	64416616	64416616	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:64416616C>T	ENST00000344113.4	+	7	694	c.482C>T	c.(481-483)tCa>tTa	p.S161L	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000341472.5_Missense_Mutation_p.S161L|SYNE2_ENST00000554584.1_Missense_Mutation_p.S161L|SYNE2_ENST00000356081.3_Missense_Mutation_p.S161L|SYNE2_ENST00000358025.3_Missense_Mutation_p.S161L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	161	Actin-binding.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GTGGTTGACTCATCTCCTGCC	0.458																																							uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(481-483)TCA>TTA		spectrin repeat containing, nuclear envelope 2							205.0	204.0	204.0					14																	64416616		1992	4173	6165	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64416616C>T	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.482C>T	14.37:g.64416616C>T	ENSP00000341781:p.Ser161Leu					SYNE2_uc001xgk.2_Missense_Mutation_p.S161L|SYNE2_uc001xgl.2_Missense_Mutation_p.S161L	p.S161L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	7	712	+			161			Cytoplasmic (Potential).|Actin-binding.		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.482C>T	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539846	0.27563	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000341472;ENST00000356081;ENST00000554584;ENST00000261678	T;T;D;D;T	0.91068	0.41;0.41;-2.78;-2.55;0.08	5.7	4.7	0.59300	Calponin homology domain (1);	0.146929	0.31221	N	0.008030	D	0.84297	0.5441	L	0.27975	0.815	0.80722	D	1	B;B;B	0.18461	0.016;0.028;0.01	B;B;B	0.16722	0.007;0.016;0.006	T	0.80453	-0.1376	10	0.46703	T	0.11	.	13.1699	0.59591	0.0:0.895:0.0:0.105	.	161;161;161	Q8WXH0;Q8WXH0-2;Q8WXH0-8	SYNE2_HUMAN;.;.	L	161	ENSP00000350719:S161L;ENSP00000341781:S161L;ENSP00000344528:S161L;ENSP00000348382:S161L;ENSP00000452570:S161L	ENSP00000261678:S161L	S	+	2	0	SYNE2	63486369	0.159000	0.22864	0.910000	0.35882	0.433000	0.31745	1.827000	0.39102	2.696000	0.92011	0.655000	0.94253	TCA		0.458	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		54	188	0	0	0	0.01441	0	54	188				
ZFYVE26	23503	broad.mit.edu	37	14	68264845	68264845	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:68264845T>A	ENST00000347230.4	-	11	2272	c.2134A>T	c.(2134-2136)Agt>Tgt	p.S712C	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.S712C	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	712					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CAGCTCTGACTTTCTTGCTTT	0.542																																							uc001xka.2		NA																	0				ovary(9)|breast(2)	11						c.(2134-2136)AGT>TGT		zinc finger, FYVE domain containing 26							64.0	66.0	65.0					14																	68264845		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68264845T>A	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2134A>T	14.37:g.68264845T>A	ENSP00000251119:p.Ser712Cys					ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.S712C|ZFYVE26_uc010tta.1_Missense_Mutation_p.S712C	p.S712C	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	11	2273	-			712					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.2134A>T	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	T	11.26	1.586034	0.28268	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.27720	1.79;1.65	5.95	3.83	0.44106	.	0.519520	0.22251	N	0.062548	T	0.16171	0.0389	N	0.14661	0.345	0.20196	N	0.999927	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.10543	-1.0625	10	0.40728	T	0.16	-0.6132	6.4439	0.21865	0.2341:0.6015:0.0:0.1644	.	712;712;712	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	C	712;691;712	ENSP00000251119:S712C;ENSP00000450603:S712C	ENSP00000251119:S712C	S	-	1	0	ZFYVE26	67334598	1.000000	0.71417	0.902000	0.35471	0.734000	0.41952	1.248000	0.32827	1.527000	0.49086	-0.146000	0.13790	AGT		0.542	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		22	62	0	0	0	0.014323	0	22	62				
SEL1L	6400	broad.mit.edu	37	14	81964292	81964292	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:81964292C>T	ENST00000336735.4	-	10	1188	c.1072G>A	c.(1072-1074)Gaa>Aaa	p.E358K		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	358	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ATCAAATCTTCTTCTAGCATT	0.403																																							uc010tvv.1		NA																	0				ovary(1)	1						c.(1072-1074)GAA>AAA		sel-1 suppressor of lin-12-like precursor							115.0	100.0	105.0					14																	81964292		2203	4300	6503	SO:0001583	missense	6400				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr14:81964292C>T		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.1072G>A	14.37:g.81964292C>T	ENSP00000337053:p.Glu358Lys						p.E358K	NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0299)	10	1189	-			358			Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.		Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	37	c.1072G>A	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	C	33	5.202299	0.94997	.	.	ENSG00000071537	ENST00000336735	T	0.32515	1.45	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	L	0.50333	1.59	0.80722	D	1	P	0.47910	0.902	B	0.39339	0.297	T	0.03852	-1.0998	10	0.26408	T	0.33	.	19.3873	0.94563	0.0:1.0:0.0:0.0	.	358	Q9UBV2	SE1L1_HUMAN	K	358	ENSP00000337053:E358K	ENSP00000337053:E358K	E	-	1	0	SEL1L	81034045	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.566000	0.67372	2.890000	0.99128	0.585000	0.79938	GAA		0.403	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065		4	51	0	0	0	0.009096	0	4	51				
PPP4R4	57718	broad.mit.edu	37	14	94697044	94697044	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:94697044C>G	ENST00000304338.3	+	4	569	c.415C>G	c.(415-417)Ctc>Gtc	p.L139V	PPP4R4_ENST00000555690.1_3'UTR	NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	139					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						CCAAGTCATTCTCCTGCATCT	0.418																																							uc001ycs.1		NA																	0				skin(3)|upper_aerodigestive_tract(1)	4						c.(415-417)CTC>GTC		HEAT-like repeat-containing protein isoform 1							137.0	122.0	127.0					14																	94697044		2203	4300	6503	SO:0001583	missense	57718					cytoplasm|protein serine/threonine phosphatase complex	protein binding	g.chr14:94697044C>G	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.415C>G	14.37:g.94697044C>G	ENSP00000305924:p.Leu139Val						p.L139V	NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN			4	569	+			139					Q9BUF8|Q9HCF0	Missense_Mutation	SNP	ENST00000304338.3	37	c.415C>G	CCDS9921.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511378	0.64522	.	.	ENSG00000119698	ENST00000304338;ENST00000556470	T;T	0.35789	1.4;1.29	5.55	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.131736	0.51477	D	0.000088	T	0.51432	0.1674	M	0.62016	1.91	0.80722	D	1	D	0.64830	0.994	D	0.66847	0.947	T	0.43294	-0.9400	10	0.36615	T	0.2	-3.9569	10.1427	0.42744	0.0:0.8505:0.0:0.1495	.	139	Q6NUP7	PP4R4_HUMAN	V	139;58	ENSP00000305924:L139V;ENSP00000451556:L58V	ENSP00000305924:L139V	L	+	1	0	PPP4R4	93766797	1.000000	0.71417	0.978000	0.43139	0.870000	0.49936	2.305000	0.43664	2.611000	0.88343	0.585000	0.79938	CTC		0.418	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237		18	58	0	0	0	0.010504	0	18	58				
BEGAIN	57596	broad.mit.edu	37	14	101005469	101005469	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:101005469G>T	ENST00000355173.2	-	7	690	c.619C>A	c.(619-621)Ctg>Atg	p.L207M	BEGAIN_ENST00000556751.1_Missense_Mutation_p.L143M|CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000443071.2_Missense_Mutation_p.L207M	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	207						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				CAGAAGGCCAGGTCGCGGGCG	0.692																																					NSCLC(159;1889 2010 9965 27479 40101)	NSCLC(159;1889 2010 9965 27479 40101)	uc010txa.1		NA																	0					0						c.(619-621)CTG>ATG		brain-enriched guanylate kinase-associated							17.0	23.0	21.0					14																	101005469		2199	4297	6496	SO:0001583	missense	57596					cytoplasm|membrane	protein binding	g.chr14:101005469G>T	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.619C>A	14.37:g.101005469G>T	ENSP00000347301:p.Leu207Met					BEGAIN_uc001yhp.2_Missense_Mutation_p.L143M|BEGAIN_uc001yhq.2_Missense_Mutation_p.L207M	p.L207M	NM_001159531	NP_001153003	Q9BUH8	BEGIN_HUMAN			6	765	-		Melanoma(154;0.212)	207					Q9NPU3|Q9P282	Missense_Mutation	SNP	ENST00000355173.2	37	c.619C>A	CCDS9962.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255854	0.39896	.	.	ENSG00000183092	ENST00000355173;ENST00000556751;ENST00000443071;ENST00000553553;ENST00000556188;ENST00000554356	T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44	4.27	4.27	0.50696	.	0.627350	0.15868	N	0.240679	T	0.65312	0.2679	L	0.60455	1.87	0.48762	D	0.999702	D	0.63880	0.993	P	0.59487	0.858	T	0.62895	-0.6757	10	0.30854	T	0.27	.	16.6844	0.85301	0.0:0.0:1.0:0.0	.	207	Q9BUH8	BEGIN_HUMAN	M	207;143;207;219;207;143	ENSP00000347301:L207M;ENSP00000451380:L143M;ENSP00000411124:L207M;ENSP00000451397:L219M;ENSP00000452157:L207M;ENSP00000452607:L143M	ENSP00000347301:L207M	L	-	1	2	BEGAIN	100075222	0.931000	0.31567	0.974000	0.42286	0.011000	0.07611	5.095000	0.64529	1.917000	0.55516	0.462000	0.41574	CTG		0.692	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414329.1	NM_020836		4	18	1	0	1.23904e-05	0.014758	1.35334e-05	4	18				
CDC42BPB	9578	broad.mit.edu	37	14	103442080	103442080	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr14:103442080C>T	ENST00000361246.2	-	11	1736	c.1448G>A	c.(1447-1449)cGa>cAa	p.R483Q		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TTCTTTATCTCGGTTTGAATT	0.473																																							uc001ymi.1		NA																	0				large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11						c.(1447-1449)CGA>CAA		CDC42-binding protein kinase beta							150.0	154.0	153.0					14																	103442080		2203	4300	6503	SO:0001583	missense	9578				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr14:103442080C>T	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1448G>A	14.37:g.103442080C>T	ENSP00000355237:p.Arg483Gln						p.R483Q	NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)	11	1680	-		Melanoma(154;0.155)	483			Potential.			Missense_Mutation	SNP	ENST00000361246.2	37	c.1448G>A	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607728	0.87258	.	.	ENSG00000198752	ENST00000361246	T	0.64260	-0.09	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	M	0.63428	1.95	0.80722	D	1	P	0.35011	0.48	B	0.24155	0.051	T	0.59820	-0.7382	10	0.34782	T	0.22	.	19.0682	0.93122	0.0:1.0:0.0:0.0	.	483	Q9Y5S2	MRCKB_HUMAN	Q	483	ENSP00000355237:R483Q	ENSP00000355237:R483Q	R	-	2	0	CDC42BPB	102511833	1.000000	0.71417	0.826000	0.32828	0.971000	0.66376	5.510000	0.67018	2.489000	0.83994	0.650000	0.86243	CGA		0.473	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035		5	169	0	0	0	0.014758	0	5	169				
RPS8P10	388076	broad.mit.edu	37	15	22440499	22440499	+	IGR	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr15:22440499G>C								RP11-2F9.4 (4322 upstream) : IGHV1OR15-1 (7882 downstream)																							GCGGCGCATAGTGGGACTCGT	0.473																																							uc001yug.2		NA																	0					NA						c.(346-348)CAC>CAG		full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																																				SO:0001628	intergenic_variant	0							g.chr15:22440499G>C																													15.37:g.22440499G>C							p.H116Q							1	367	-									Missense_Mutation	SNP		37	c.348C>G																																																																																				0	0.473									4	29	0	0	0	0.009096	0	4	29				
UBE3A	7337	broad.mit.edu	37	15	25599717	25599717	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr15:25599717T>G	ENST00000397954.2	-	8	2246	c.2247A>C	c.(2245-2247)ttA>ttC	p.L749F	UBE3A_ENST00000232165.3_Missense_Mutation_p.L746F|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000438097.1_Missense_Mutation_p.L726F|UBE3A_ENST00000428984.2_Missense_Mutation_p.L726F|UBE3A_ENST00000566215.1_Missense_Mutation_p.L726F			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	749					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		CTGGTCTGAATAAGTACTTTA	0.348																																							uc001zaq.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3						c.(2245-2247)TTA>TTC		ubiquitin protein ligase E3A isoform 2							125.0	130.0	128.0					15																	25599717		2203	4300	6503	SO:0001583	missense	7337				brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity	g.chr15:25599717T>G	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.2247A>C	15.37:g.25599717T>G	ENSP00000381045:p.Leu749Phe					uc001zae.2_Intron|UBE3A_uc001zar.2_Missense_Mutation_p.L726F|UBE3A_uc001zas.2_Missense_Mutation_p.L746F|UBE3A_uc001zat.2_Missense_Mutation_p.L726F	p.L749F	NM_000462	NP_000453	Q05086	UBE3A_HUMAN		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)	8	2247	-		all_cancers(20;3.47e-21)|Breast(32;0.00123)	749					A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	37	c.2247A>C	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	T	19.23	3.787414	0.70337	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.65	2.0	0.26442	HECT (4);	0.000000	0.64402	D	0.000001	T	0.63558	0.2521	L	0.58969	1.84	0.58432	D	0.999999	B;D	0.58970	0.406;0.984	B;P	0.58721	0.079;0.844	T	0.62445	-0.6853	10	0.66056	D	0.02	.	8.114	0.30930	0.0:0.3256:0.0:0.6744	.	746;749	Q05086-3;Q05086	.;UBE3A_HUMAN	F	746;746;749;726;726	ENSP00000232165:L746F;ENSP00000381045:L749F;ENSP00000411258:L726F;ENSP00000401265:L726F	ENSP00000232165:L746F	L	-	3	2	UBE3A	23150810	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.514000	0.35834	0.382000	0.24878	0.482000	0.46254	TTA		0.348	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462		4	120	0	0	0	0.009096	0	4	120				
GREM1	26585	broad.mit.edu	37	15	33022958	33022958	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr15:33022958G>A	ENST00000300177.4	+	2	256	c.67G>A	c.(67-69)Gaa>Aaa	p.E23K	GREM1_ENST00000560830.1_Missense_Mutation_p.E23K|GREM1_ENST00000322805.4_Missense_Mutation_p.E23K|GREM1_ENST00000560677.1_Missense_Mutation_p.E23K	NM_001191322.1|NM_001191323.1|NM_013372.6	NP_001178251.1|NP_001178252.1|NP_037504.1	O60565	GREM1_HUMAN	gremlin 1, DAN family BMP antagonist	23					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell morphogenesis (GO:0000902)|collagen fibril organization (GO:0030199)|determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone mineralization (GO:0030502)|negative regulation of bone mineralization involved in bone maturation (GO:1900158)|negative regulation of bone remodeling (GO:0046851)|negative regulation of bone trabecula formation (GO:1900155)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of receptor activity (GO:2000273)|positive regulation of receptor internalization (GO:0002092)|positive regulation of telomerase activity (GO:0051973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|regulation of epithelial to mesenchymal transition (GO:0010717)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|receptor agonist activity (GO:0048018)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)	10		all_lung(180;1.49e-09)		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)		GCCGGCTGCTGAAGGGAAAAA	0.607																																							uc001zhe.1		NA																	0					0						c.(67-69)GAA>AAA		gremlin-1 precursor							25.0	29.0	27.0					15																	33022958		2187	4271	6458	SO:0001583	missense	26585				negative regulation of BMP signaling pathway|nervous system development|regulation of epithelial to mesenchymal transition	extracellular space	cytokine activity	g.chr15:33022958G>A		CCDS10029.1, CCDS53927.1	15q13.3	2014-02-07	2013-02-26	2004-05-07	ENSG00000166923	ENSG00000166923			2001	protein-coding gene	gene with protein product		603054	"""cysteine knot superfamily 1, BMP antagonist 1"", ""gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 1"", ""colorectal adenoma and carcinoma 1"""	CKTSF1B1, CRAC1		9660951, 10026205, 22561515	Standard	NM_013372		Approved	DRM, gremlin, DAND2, HMPS	uc001zhe.2	O60565	OTTHUMG00000129319	ENST00000300177.4:c.67G>A	15.37:g.33022958G>A	ENSP00000300177:p.Glu23Lys					GREM1_uc001zhd.1_Intron|GREM1_uc010uby.1_Missense_Mutation_p.E23K	p.E23K	NM_013372	NP_037504	O60565	GREM1_HUMAN		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)	2	226	+		all_lung(180;1.49e-09)	23					Q52LV3|Q8N914|Q8N936	Missense_Mutation	SNP	ENST00000300177.4	37	c.67G>A	CCDS10029.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343188	0.82022	.	.	ENSG00000166923	ENST00000300177;ENST00000322805	T;T	0.32272	1.48;1.46	5.25	5.25	0.73442	.	0.050027	0.85682	D	0.000000	T	0.28366	0.0701	L	0.49778	1.585	0.58432	D	0.999999	B;B	0.28026	0.0;0.198	B;B	0.14578	0.0;0.011	T	0.07947	-1.0746	10	0.13470	T	0.59	-18.5274	19.0472	0.93027	0.0:0.0:1.0:0.0	.	23;23	O60565-2;O60565	.;GREM1_HUMAN	K	23	ENSP00000300177:E23K;ENSP00000323101:E23K	ENSP00000300177:E23K	E	+	1	0	GREM1	30810250	1.000000	0.71417	0.980000	0.43619	0.961000	0.63080	9.615000	0.98356	2.749000	0.94314	0.655000	0.94253	GAA		0.607	GREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251455.2	NM_013372		13	52	0	0	0	0.016723	0	13	52				
SEMA6D	80031	broad.mit.edu	37	15	48060883	48060883	+	Missense_Mutation	SNP	T	T	C	rs554085061		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr15:48060883T>C	ENST00000316364.5	+	18	2310	c.1871T>C	c.(1870-1872)tTt>tCt	p.F624S	SEMA6D_ENST00000558014.1_Intron|SEMA6D_ENST00000358066.4_Intron|SEMA6D_ENST00000389433.2_Missense_Mutation_p.F605S|SEMA6D_ENST00000389428.3_Intron|SEMA6D_ENST00000537942.1_Intron|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000536845.2_Missense_Mutation_p.F624S|SEMA6D_ENST00000354744.4_Intron|SEMA6D_ENST00000389432.2_Intron|SEMA6D_ENST00000355997.3_Intron	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	624					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TCTCGGAAATTTGTAGTTCAA	0.438																																							uc010bek.2		NA																	0				skin(3)|breast(1)	4						c.(1870-1872)TTT>TCT		semaphorin 6D isoform 4 precursor							125.0	118.0	121.0					15																	48060883		2198	4297	6495	SO:0001583	missense	80031				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity	g.chr15:48060883T>C	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1871T>C	15.37:g.48060883T>C	ENSP00000324857:p.Phe624Ser					SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Missense_Mutation_p.F624S|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	p.F624S	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)	18	2231	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	624			Extracellular (Potential).		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	c.1871T>C	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	T	13.22	2.171015	0.38315	.	.	ENSG00000137872	ENST00000536845;ENST00000316364;ENST00000389433	T;T;T	0.16597	2.35;2.35;2.33	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000017	T	0.09202	0.0227	N	0.08118	0	0.80722	D	1	B	0.27498	0.18	B	0.27796	0.083	T	0.15607	-1.0431	10	0.07644	T	0.81	.	15.8895	0.79286	0.0:0.0:0.0:1.0	.	624	Q8NFY4	SEM6D_HUMAN	S	624;624;605	ENSP00000446152:F624S;ENSP00000324857:F624S;ENSP00000374084:F605S	ENSP00000324857:F624S	F	+	2	0	SEMA6D	45848175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.523000	0.60545	2.207000	0.71202	0.533000	0.62120	TTT		0.438	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966		28	59	0	0	0	0.008361	0	28	59				
TMC3	342125	broad.mit.edu	37	15	81627180	81627180	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr15:81627180C>G	ENST00000359440.5	-	21	2475	c.2340G>C	c.(2338-2340)aaG>aaC	p.K780N	RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.K781N|RP11-761I4.3_ENST00000560851.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						TCCTGCCACTCTTGCTGCTCC	0.607																																							uc002bgo.1		NA																	0				ovary(1)|liver(1)	2						c.(2338-2340)AAG>AAC		transmembrane channel-like 3							125.0	124.0	124.0					15																	81627180		2074	4213	6287	SO:0001583	missense	342125					integral to membrane		g.chr15:81627180C>G	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.2340G>C	15.37:g.81627180C>G	ENSP00000352413:p.Lys780Asn					TMC3_uc010blr.1_RNA	p.K780N	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN			21	2340	-			780			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000359440.5	37	c.2340G>C	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	C	7.996	0.754453	0.15778	.	.	ENSG00000188869	ENST00000359440	T	0.65916	-0.18	3.64	1.75	0.24633	.	0.414923	0.17005	U	0.190731	T	0.45418	0.1341	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.25293	-1.0136	10	0.32370	T	0.25	-5.2879	5.2534	0.15534	0.0:0.5246:0.0:0.4754	.	780	Q7Z5M5	TMC3_HUMAN	N	780	ENSP00000352413:K780N	ENSP00000352413:K780N	K	-	3	2	TMC3	79414235	0.042000	0.20092	0.001000	0.08648	0.013000	0.08279	0.061000	0.14366	0.522000	0.28464	0.555000	0.69702	AAG		0.607	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841		4	101	0	0	0	0.014758	0	4	101				
EFTUD1	79631	broad.mit.edu	37	15	82532884	82532884	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr15:82532884G>C	ENST00000268206.7	-	6	559	c.391C>G	c.(391-393)Ctg>Gtg	p.L131V	EFTUD1_ENST00000359445.3_Missense_Mutation_p.L80V	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	131	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GCTTGTCGCAGAACTGCCTGT	0.368																																							uc002bgt.1		NA																	0				ovary(1)	1						c.(391-393)CTG>GTG		elongation factor Tu GTP binding domain							56.0	51.0	52.0					15																	82532884		1830	4086	5916	SO:0001583	missense	79631				mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity	g.chr15:82532884G>C	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.391C>G	15.37:g.82532884G>C	ENSP00000268206:p.Leu131Val					EFTUD1_uc002bgu.1_Missense_Mutation_p.L80V	p.L131V	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN			6	560	-			131					A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	ENST00000268206.7	37	c.391C>G	CCDS42071.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445605	0.63178	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	T;T	0.79352	-1.26;-1.26	4.01	4.01	0.46588	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.40554	U	0.001070	D	0.84982	0.5593	M	0.73372	2.23	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.992	D	0.85860	0.1409	10	0.87932	D	0	-1.1615	9.4629	0.38796	0.0989:0.0:0.9011:0.0	.	80;131	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	V	131;80	ENSP00000268206:L131V;ENSP00000352418:L80V	ENSP00000268206:L131V	L	-	1	2	EFTUD1	80319939	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.210000	0.58500	2.224000	0.72417	0.536000	0.68110	CTG		0.368	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1	NM_024580		3	25	0	0	0	0.004672	0	3	25				
NPRL3	8131	broad.mit.edu	37	16	139797	139797	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:139797C>G	ENST00000399953.3	-	11	1667	c.1265G>C	c.(1264-1266)cGt>cCt	p.R422P	Z69720.2_ENST00000601483.1_RNA|NPRL3_ENST00000405960.3_5'UTR|NPRL3_ENST00000399951.3_Missense_Mutation_p.R243P	NM_001077350.2|NM_001243247.1|NM_001243248.1|NM_001243249.1	NP_001070818.1|NP_001230176.1|NP_001230177.1|NP_001230178.1	Q12980	NPRL3_HUMAN	nitrogen permease regulator-like 3 (S. cerevisiae)	422					aorta morphogenesis (GO:0035909)|cardiac muscle tissue development (GO:0048738)|palate development (GO:0060021)|ventricular septum development (GO:0003281)		GTPase activator activity (GO:0005096)			endometrium(1)|large_intestine(3)|ovary(2)	6						CTCTCGCGGACGGGGCTCCTC	0.667																																							uc002cfr.2		NA																	0				ovary(1)	1						c.(1264-1266)CGT>CCT		conserved gene telomeric to alpha globin cluster							19.0	28.0	25.0					16																	139797		2175	4262	6437	SO:0001583	missense	8131						protein binding	g.chr16:139797C>G		CCDS73794.1, CCDS73795.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000103148	ENSG00000103148			14124	protein-coding gene	gene with protein product	"""conserved gene telomeric to alpha globin cluster"""	600928	"""chromosome 16 open reading frame 35"""	C16orf35		8575760	Standard	NM_001243247		Approved	CGTHBA, RMD11, NPR3, MARE, HS-40	uc002cfr.3	Q12980	OTTHUMG00000047792	ENST00000399953.3:c.1265G>C	16.37:g.139797C>G	ENSP00000382834:p.Arg422Pro					NPRL3_uc010uua.1_RNA|NPRL3_uc002cfp.1_RNA|NPRL3_uc002cfq.2_Missense_Mutation_p.R243P|NPRL3_uc010uub.1_Missense_Mutation_p.R397P|NPRL3_uc010uuc.1_Missense_Mutation_p.R344P|NPRL3_uc002cfs.1_Missense_Mutation_p.R397P	p.R422P	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN			12	1364	-			422					D3DU40|Q1W6H0|Q4TT56|Q92469	Missense_Mutation	SNP	ENST00000399953.3	37	c.1265G>C		.	.	.	.	.	.	.	.	.	.	C	7.742	0.701462	0.15172	.	.	ENSG00000103148	ENST00000399953;ENST00000262313;ENST00000399951	.	.	.	4.95	1.79	0.24919	.	0.440664	0.27019	N	0.021329	T	0.25717	0.0626	.	.	.	0.34168	D	0.669465	P;B;B;B	0.35226	0.491;0.229;0.001;0.0	B;B;B;B	0.23716	0.048;0.035;0.001;0.001	T	0.25047	-1.0143	8	0.30078	T	0.28	-39.675	5.637	0.17542	0.0:0.5216:0.3043:0.1741	.	344;397;397;422	B7Z220;Q4TT55;B7Z6Q0;Q12980	.;.;.;NPRL3_HUMAN	P	422;397;243	.	ENSP00000262313:R397P	R	-	2	0	NPRL3	79797	0.201000	0.23410	0.885000	0.34714	0.865000	0.49528	0.764000	0.26532	0.227000	0.20999	0.555000	0.69702	CGT		0.667	NPRL3-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001039476		3	14	0	0	0	0.004672	0	3	14				
FAHD1	81889	broad.mit.edu	37	16	1877419	1877419	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:1877419G>A	ENST00000427358.2	+	1	195	c.189G>A	c.(187-189)gcG>gcA	p.A63A	HAGH_ENST00000397356.3_5'Flank|FAHD1_ENST00000382668.4_Silent_p.A63A|HAGH_ENST00000566709.1_5'Flank|HAGH_ENST00000397353.2_5'Flank|HAGH_ENST00000455446.2_5'Flank|FAHD1_ENST00000382666.4_Silent_p.A63A	NM_031208.3	NP_112485.1	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing 1	63						cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetylpyruvate hydrolase activity (GO:0018773)|acylpyruvate hydrolase activity (GO:0047621)|fumarylpyruvate hydrolase activity (GO:0034545)|metal ion binding (GO:0046872)			NS(1)|large_intestine(1)|liver(1)|ovary(2)|urinary_tract(1)	6						TCATGCCCGCGTACACTCGCA	0.697																																							uc002cnc.1		NA																	0					0						c.(187-189)GCG>GCA		fumarylacetoacetate hydrolase domain containing							39.0	38.0	39.0					16																	1877419		2197	4296	6493	SO:0001819	synonymous_variant	81889					mitochondrion	hydrolase activity|metal ion binding|protein binding	g.chr16:1877419G>A	BC063017	CCDS10448.1, CCDS32367.1, CCDS45380.1	16p13.3	2011-10-21	2004-08-19	2004-08-26	ENSG00000180185	ENSG00000180185			14169	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 36"""	C16orf36		21878618	Standard	NM_001018104		Approved	DKFZP566J2046	uc002cnd.3	Q6P587	OTTHUMG00000128663	ENST00000427358.2:c.189G>A	16.37:g.1877419G>A						HAGH_uc002cmz.2_5'Flank|HAGH_uc002cna.2_5'Flank|HAGH_uc010uvp.1_5'Flank|HAGH_uc002cnb.1_5'Flank|HAGH_uc010bry.1_5'Flank|FAHD1_uc002cnd.2_Silent_p.A63A|FAHD1_uc010brz.2_Silent_p.A63A	p.A63A	NM_031208	NP_112485	Q6P587	FAHD1_HUMAN			1	195	+			63					B1AK40|B1AK41|Q6FIC7|Q96RY1|Q9H0N6	Silent	SNP	ENST00000427358.2	37	c.189G>A	CCDS10448.1																																																																																				0.697	FAHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250550.2	NM_001018104		4	78	0	0	0	0.014758	0	4	78				
RABEP2	79874	broad.mit.edu	37	16	28917071	28917071	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:28917071C>A	ENST00000358201.4	-	11	2033	c.1445G>T	c.(1444-1446)tGc>tTc	p.C482F	RABEP2_ENST00000544477.1_Missense_Mutation_p.C411F|RABEP2_ENST00000357573.6_Missense_Mutation_p.C446F	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	482					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CCTCAGGCTGCACAGGGAGGC	0.657																																					Pancreas(66;639 1284 10093 31061 49099)	Pancreas(66;639 1284 10093 31061 49099)	uc002drq.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1444-1446)TGC>TTC		rabaptin, RAB GTPase binding effector protein 2							43.0	50.0	48.0					16																	28917071		2063	4198	6261	SO:0001583	missense	79874				endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity	g.chr16:28917071C>A	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.1445G>T	16.37:g.28917071C>A	ENSP00000350934:p.Cys482Phe					uc010vct.1_Intron|RABEP2_uc010vdf.1_Missense_Mutation_p.C411F|RABEP2_uc010byn.2_Missense_Mutation_p.C446F	p.C482F	NM_024816	NP_079092	Q9H5N1	RABE2_HUMAN			11	1493	-			482			Potential.			Missense_Mutation	SNP	ENST00000358201.4	37	c.1445G>T	CCDS42140.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167923	0.57476	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.43294	0.95;0.95;0.95	5.16	5.16	0.70880	Rabaptin, GTPase-Rab5 binding (1);	0.277684	0.35320	N	0.003281	T	0.56381	0.1981	L	0.57536	1.79	0.36548	D	0.871662	D;D;D	0.76494	0.999;0.999;0.991	D;D;D	0.87578	0.998;0.996;0.949	T	0.65651	-0.6116	10	0.87932	D	0	-17.2938	7.5216	0.27631	0.0:0.7416:0.1695:0.0889	.	411;446;482	B4DHR0;Q9H5N1-2;Q9H5N1	.;.;RABE2_HUMAN	F	482;446;411	ENSP00000350934:C482F;ENSP00000350186:C446F;ENSP00000442798:C411F	ENSP00000350186:C446F	C	-	2	0	RABEP2	28824572	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.337000	0.33862	2.404000	0.81709	0.561000	0.74099	TGC		0.657	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432691.1	NM_024816		37	57	1	0	1.66425e-11	0.021022	1.98636e-11	37	57				
TBC1D10B	26000	broad.mit.edu	37	16	30376327	30376327	+	Splice_Site	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:30376327C>T	ENST00000409939.3	-	4	1245	c.1165G>A	c.(1165-1167)Gag>Aag	p.E389K		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	389	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			CGTTCCAGCTCCTGCAGTGGG	0.607																																							uc002dxu.2		NA																	0					0						c.(1165-1167)GAG>AAG		TBC1 domain family, member 10B							40.0	36.0	38.0					16																	30376327		2196	4300	6496	SO:0001630	splice_region_variant	26000					cytoplasm	Rab GTPase activator activity	g.chr16:30376327C>T	BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.1165-1G>A	16.37:g.30376327C>T							p.E389K	NM_015527	NP_056342	Q4KMP7	TB10B_HUMAN	Colorectal(24;0.193)		4	1183	-			389			Rab-GAP TBC.		B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	ENST00000409939.3	37	c.1165G>A	CCDS10676.2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982301	0.74474	.	.	ENSG00000169221	ENST00000409939	T	0.20463	2.07	5.13	5.13	0.70059	Rab-GAP/TBC domain (4);	0.139601	0.45867	D	0.000331	T	0.22820	0.0551	L	0.39566	1.225	0.80722	D	1	B	0.33583	0.418	B	0.36418	0.224	T	0.02917	-1.1094	10	0.49607	T	0.09	.	17.34	0.87293	0.0:1.0:0.0:0.0	.	389	Q4KMP7	TB10B_HUMAN	K	389	ENSP00000386538:E389K	ENSP00000386538:E389K	E	-	1	0	TBC1D10B	30283828	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.738000	0.84966	2.394000	0.81467	0.591000	0.81541	GAG		0.607	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3	NM_015527	Missense_Mutation	3	26	0	0	0	0.009096	0	3	26				
SLC6A10P	386757	broad.mit.edu	37	16	32890622	32890622	+	RNA	SNP	T	T	G	rs200656321		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:32890622T>G	ENST00000330048.5	-	0	3176					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		CGTTGGTGTTTTTGTAGACCA	0.617																																							uc002edh.1		NA																	0					0						c.(262-264)AAA>AAC		RecName: Full=Transporter;																																						386757							g.chr16:32890622T>G	U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32890622T>G						SLC6A10P_uc002edi.1_RNA	p.K88N							5	440	-									Missense_Mutation	SNP	ENST00000330048.5	37	c.264A>C																																																																																					0.617	SLC6A10P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000432081.2			3	11	0	0	0	0.009096	0	3	11				
ZNF423	23090	broad.mit.edu	37	16	49672436	49672436	+	Silent	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:49672436G>C	ENST00000561648.1	-	4	680	c.627C>G	c.(625-627)ctC>ctG	p.L209L	ZNF423_ENST00000262383.2_Silent_p.L209L|ZNF423_ENST00000563137.2_Silent_p.L149L|ZNF423_ENST00000562871.1_Silent_p.L149L|ZNF423_ENST00000567169.1_Silent_p.L92L|ZNF423_ENST00000535559.1_Silent_p.L92L|ZNF423_ENST00000562520.1_Silent_p.L149L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	209					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGTGGATCTTGAGGTGGTCGC	0.607																																							uc002efs.2		NA																	0				ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(625-627)CTC>CTG		zinc finger protein 423							67.0	49.0	55.0					16																	49672436		2198	4300	6498	SO:0001819	synonymous_variant	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49672436G>C	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.627C>G	16.37:g.49672436G>C						ZNF423_uc010vgn.1_Silent_p.L92L	p.L209L	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			5	925	-		all_cancers(37;0.0155)	209			C2H2-type 4.		O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	c.627C>G	CCDS32445.1																																																																																				0.607	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		8	33	0	0	0	0.004482	0	8	33				
CDH1	999	broad.mit.edu	37	16	68862085	68862085	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:68862085C>T	ENST00000261769.5	+	14	2364	c.2173C>T	c.(2173-2175)Ctg>Ttg	p.L725L	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Silent_p.L664L	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	725					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AGTTCTGATTCTGCTGCTCTT	0.517			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																														uc002ewg.1		NA	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	Mis|N|F|S	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""			E		gastric	lobular breast|gastric		0				breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243						c.(2173-2175)CTG>TTG		cadherin 1, type 1 preproprotein							116.0	107.0	110.0					16																	68862085		2198	4300	6498	SO:0001819	synonymous_variant	999	Hereditary_Diffuse_Gastric_Cancer	Familial Cancer Database	HDGC	adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	g.chr16:68862085C>T	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2173C>T	16.37:g.68862085C>T						CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Silent_p.L664L	p.L725L	NM_004360	NP_004351	P12830	CADH1_HUMAN		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)	14	2297	+		all_neural(199;0.0189)|Ovarian(137;0.0563)	725			Helical; (Potential).		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Silent	SNP	ENST00000261769.5	37	c.2173C>T	CCDS10869.1																																																																																				0.517	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360		9	92	0	0	0	0.004482	0	9	92				
PRDM7	11105	broad.mit.edu	37	16	90141396	90141396	+	Silent	SNP	G	G	T	rs147971971		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr16:90141396G>T	ENST00000449207.2	-	3	248	c.229C>A	c.(229-231)Cga>Aga	p.R77R	PRDM7_ENST00000407825.1_5'UTR|PRDM7_ENST00000569206.1_5'Flank	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	77	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GCCTGCCTTCGGTGACACATG	0.488																																							uc010cje.2		NA																	0				ovary(1)	1						c.(229-231)CGA>AGA		PR domain containing 7 isoform 1							94.0	86.0	89.0					16																	90141396		1887	4114	6001	SO:0001819	synonymous_variant	11105					chromosome|nucleus	nucleic acid binding	g.chr16:90141396G>T	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.229C>A	16.37:g.90141396G>T						PRDM7_uc010cjf.2_Silent_p.R4R|PRDM7_uc010cjh.1_RNA	p.R77R	NM_001098173	NP_001091643	Q9NQW5	PRDM7_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0278)	3	249	-		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)	77			KRAB-related.		A4Q9G8|Q08EM4|Q9NQW4	Silent	SNP	ENST00000449207.2	37	c.229C>A	CCDS45557.1																																																																																				0.488	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1			18	32	1	0	9.7654e-05	0.007413	0.000102502	18	32				
ZZEF1	23140	broad.mit.edu	37	17	3935493	3935493	+	Silent	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:3935493C>G	ENST00000381638.2	-	42	6943	c.6819G>C	c.(6817-6819)gtG>gtC	p.V2273V		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2273							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCAAGATGATCACATTATGGG	0.418																																							uc002fxe.2		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(6817-6819)GTG>GTC		zinc finger, ZZ type with EF hand domain 1							149.0	141.0	144.0					17																	3935493		2203	4300	6503	SO:0001819	synonymous_variant	23140						calcium ion binding|zinc ion binding	g.chr17:3935493C>G	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.6819G>C	17.37:g.3935493C>G						ZZEF1_uc002fxh.2_Silent_p.V587V|ZZEF1_uc002fxi.2_Silent_p.V508V	p.V2273V	NM_015113	NP_055928	O43149	ZZEF1_HUMAN			42	6883	-			2273					A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	ENST00000381638.2	37	c.6819G>C	CCDS11043.1																																																																																				0.418	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113		4	89	0	0	0	0.009096	0	4	89				
ZNF232	7775	broad.mit.edu	37	17	5009283	5009283	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:5009283C>G	ENST00000250076.3	-	5	1825	c.1171G>C	c.(1171-1173)Gag>Cag	p.E391Q	ZNF232_ENST00000575538.1_5'Flank|ZNF232_ENST00000575898.1_Missense_Mutation_p.E382Q|ZNF232_ENST00000416429.2_3'UTR	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	364					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						TTCCCACACTCATTACACTCA	0.438																																							uc002gas.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1090-1092)GAG>CAG		zinc finger protein 232							84.0	87.0	86.0					17																	5009283		2203	4300	6503	SO:0001583	missense	7775				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:5009283C>G	AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.1171G>C	17.37:g.5009283C>G	ENSP00000250076:p.Glu391Gln					ZNF232_uc002gar.1_Missense_Mutation_p.E382Q|ZNF232_uc002gat.2_Missense_Mutation_p.E391Q	p.E364Q	NM_014519	NP_055334	Q9UNY5	ZN232_HUMAN			5	1844	-			364			C2H2-type 4.			Missense_Mutation	SNP	ENST00000250076.3	37	c.1090G>C	CCDS11068.1	.	.	.	.	.	.	.	.	.	.	C	6.236	0.411633	0.11812	.	.	ENSG00000167840	ENST00000250076	T	0.07444	3.19	2.84	-1.77	0.07982	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.261463	0.20214	N	0.096838	T	0.05364	0.0142	L	0.35414	1.06	0.09310	N	1	B;B	0.23806	0.091;0.074	B;B	0.12837	0.008;0.006	T	0.30937	-0.9961	10	0.37606	T	0.19	.	7.4915	0.27464	0.0:0.509:0.0:0.491	.	364;355	Q9UNY5;Q9UNY5-2	ZN232_HUMAN;.	Q	391	ENSP00000250076:E391Q	ENSP00000250076:E391Q	E	-	1	0	ZNF232	4950007	0.000000	0.05858	0.315000	0.25238	0.995000	0.86356	-0.420000	0.07062	-0.376000	0.07943	-0.136000	0.14681	GAG		0.438	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216915.1	NM_014519		24	54	0	0	0	0.016522	0	24	54				
PIK3R6	146850	broad.mit.edu	37	17	8738629	8738629	+	Silent	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:8738629C>A	ENST00000311434.9	-	8	845	c.606G>T	c.(604-606)ggG>ggT	p.G202G	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	202					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										GACAGGCCTCCCCCAGAGCCG	0.672																																							uc002glq.1		NA																	0					0						c.(604-606)GGG>GGT		phosphoinositide-3-kinase, regulatory subunit 6							14.0	17.0	16.0					17																	8738629		2020	4163	6183	SO:0001819	synonymous_variant	146850				platelet activation	cytosol		g.chr17:8738629C>A	AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.606G>T	17.37:g.8738629C>A						PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	p.G202G	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN			8	846	-			202					Q658R3	Silent	SNP	ENST00000311434.9	37	c.606G>T																																																																																					0.672	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001010855		6	18	1	0	3.59834e-05	0.001168	3.81759e-05	6	18				
MYH8	4626	broad.mit.edu	37	17	10307870	10307870	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:10307870C>A	ENST00000403437.2	-	22	2559	c.2465G>T	c.(2464-2466)cGt>cTt	p.R822L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	822					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CATGAAGGCACGGACATTATA	0.443									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	0				skin(6)|ovary(3)|breast(2)	11						c.(2464-2466)CGT>CTT		myosin, heavy chain 8, skeletal muscle,							82.0	75.0	78.0					17																	10307870		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10307870C>A		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.2465G>T	17.37:g.10307870C>A	ENSP00000384330:p.Arg822Leu					uc002gml.1_Intron	p.R822L	NM_002472	NP_002463	P13535	MYH8_HUMAN			22	2560	-			822					Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.2465G>T	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	34	5.375645	0.95923	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.86627	-2.15	5.31	5.31	0.75309	.	0.000000	0.41823	U	0.000815	D	0.94248	0.8153	M	0.93150	3.385	0.80722	D	1	P	0.47604	0.898	P	0.54312	0.748	D	0.95286	0.8390	10	0.87932	D	0	.	19.1738	0.93594	0.0:1.0:0.0:0.0	.	822	P13535	MYH8_HUMAN	L	822	ENSP00000384330:R822L	ENSP00000252173:R822L	R	-	2	0	MYH8	10248595	1.000000	0.71417	0.476000	0.27291	0.997000	0.91878	7.585000	0.82584	2.764000	0.94973	0.655000	0.94253	CGT		0.443	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		20	59	1	0	7.41877e-09	0.012319	8.4786e-09	20	59				
MYH4	4622	broad.mit.edu	37	17	10355805	10355805	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:10355805G>T	ENST00000255381.2	-	26	3386	c.3276C>A	c.(3274-3276)agC>agA	p.S1092R	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1092					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTTGCAGATTGCTCATTTCAA	0.338																																							uc002gmn.2		NA																	0				ovary(10)|skin(2)|central_nervous_system(1)	13						c.(3274-3276)AGC>AGA		myosin, heavy polypeptide 4, skeletal muscle							113.0	104.0	107.0					17																	10355805		2203	4300	6503	SO:0001583	missense	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10355805G>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3276C>A	17.37:g.10355805G>T	ENSP00000255381:p.Ser1092Arg					uc002gml.1_Intron	p.S1092R	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN			26	3387	-			1092			Potential.			Missense_Mutation	SNP	ENST00000255381.2	37	c.3276C>A	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990643	0.54041	.	.	ENSG00000141048	ENST00000255381	D	0.82803	-1.65	5.6	5.6	0.85130	Myosin tail (1);	0.000000	0.44688	U	0.000421	D	0.92561	0.7637	M	0.92412	3.305	0.45690	D	0.998605	P	0.37781	0.608	P	0.52424	0.698	D	0.93001	0.6423	10	0.87932	D	0	.	19.9589	0.97233	0.0:0.0:1.0:0.0	.	1092	Q9Y623	MYH4_HUMAN	R	1092	ENSP00000255381:S1092R	ENSP00000255381:S1092R	S	-	3	2	MYH4	10296530	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.189000	0.42621	2.791000	0.96007	0.655000	0.94253	AGC		0.338	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		11	30	1	0	1.08611e-07	0.010729	1.21316e-07	11	30				
MFAP4	4239	broad.mit.edu	37	17	19289684	19289684	+	Missense_Mutation	SNP	G	G	A	rs367629703		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:19289684G>A	ENST00000299610.4	-	3	263	c.179C>T	c.(178-180)tCg>tTg	p.S60L	MFAP4_ENST00000395592.2_Missense_Mutation_p.S84L|MFAP4_ENST00000497081.2_Missense_Mutation_p.S85L|MFAP4_ENST00000574313.2_5'Flank	NM_002404.2	NP_002395.1	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4	60	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cellular response to UV-B (GO:0071493)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|regulation of collagen metabolic process (GO:0010712)|UV protection (GO:0009650)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)				large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	10	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					ACTGGGGCCCGAGGGGTAGAT	0.617																																							uc002gvt.2		NA																	0					0						c.(178-180)TCG>TTG		microfibrillar-associated protein 4 precursor			LEU/SER,LEU/SER	0,4406		0,0,2203	77.0	58.0	64.0		251,179	-0.3	0.5	17		64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MFAP4	NM_001198695.1,NM_002404.2	145,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	84/280,60/256	19289684	1,13005	2203	4300	6503	SO:0001583	missense	4239				cell adhesion|signal transduction	microfibril	receptor binding	g.chr17:19289684G>A	L38486	CCDS11208.1, CCDS56023.1	17p11.2	2013-02-06			ENSG00000166482	ENSG00000166482		"""Fibrinogen C domain containing"""	7035	protein-coding gene	gene with protein product	"""microfibril-associated glycoprotein 4"""	600596				7633408	Standard	NM_001198695		Approved		uc002gvs.3	P55083	OTTHUMG00000059585	ENST00000299610.4:c.179C>T	17.37:g.19289684G>A	ENSP00000299610:p.Ser60Leu					MFAP4_uc002gvr.2_RNA|MFAP4_uc002gvs.2_Missense_Mutation_p.S84L	p.S60L	NM_002404	NP_002395	P55083	MFAP4_HUMAN			3	204	-	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)		60			Fibrinogen C-terminal.		A8KAJ1|A8MVM2|B4E317|Q6P680	Missense_Mutation	SNP	ENST00000299610.4	37	c.179C>T	CCDS11208.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854957	0.32791	0.0	1.16E-4	ENSG00000166482	ENST00000395592;ENST00000299610	T;T	0.76709	-1.04;-1.04	5.3	-0.306	0.12780	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.713711	0.12374	N	0.474513	T	0.52289	0.1725	N	0.10645	0.015	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.10450	0.003;0.005	T	0.34104	-0.9842	10	0.28530	T	0.3	.	4.4206	0.11479	0.2342:0.0:0.4911:0.2747	.	60;84	P55083;A8MVM2	MFAP4_HUMAN;.	L	84;60	ENSP00000378957:S84L;ENSP00000299610:S60L	ENSP00000299610:S60L	S	-	2	0	MFAP4	19230277	0.032000	0.19561	0.457000	0.27056	0.970000	0.65996	1.174000	0.31932	-0.047000	0.13423	-0.355000	0.07637	TCG		0.617	MFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132493.2	NM_002404		4	28	0	0	0	0.009096	0	4	28				
KRT18P55	284085	broad.mit.edu	37	17	26604103	26604103	+	RNA	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:26604103G>C	ENST00000577198.1	-	0	858				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		GGTGGTCGTTGAGGCTTTGCA	0.607																																							uc002has.3		NA																	0					0						c.(370-372)CTC>CTG		SubName: Full=Putative uncharacterized protein FLJ40504; SubName: Full=cDNA FLJ40504 fis, clone TESTI2045509, highly similar to KERATIN, TYPE I CYTOSKELETAL 18;							61.0	67.0	65.0					17																	26604103		2169	4282	6451			284085							g.chr17:26604103G>C			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26604103G>C							p.L124L	NM_173624	NP_775895				UCEC - Uterine corpus endometrioid carcinoma (53;0.155)	3	468	-	all_lung(13;0.000238)|Lung NSC(42;0.000789)								Silent	SNP	ENST00000577198.1	37	c.372C>G																																																																																					0.607	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000446194.1	NR_028334		11	123	0	0	0	0.010729	0	11	123				
RPL23A	6147	broad.mit.edu	37	17	27047846	27047846	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:27047846G>A	ENST00000422514.2	+	2	760	c.147G>A	c.(145-147)ccG>ccA	p.P49P	SNORD42A_ENST00000459584.1_RNA|RAB34_ENST00000453384.3_5'Flank|RAB34_ENST00000447716.1_5'Flank|SNORD42B_ENST00000458893.1_RNA|AC010761.8_ENST00000582718.1_RNA|RAB34_ENST00000450529.1_5'Flank|RAB34_ENST00000415040.2_5'Flank|RAB34_ENST00000395242.2_5'Flank|SNORD4A_ENST00000459174.1_RNA|RPL23A_ENST00000394938.4_Silent_p.P87P|RAB34_ENST00000436730.3_5'Flank|RAB34_ENST00000301043.6_5'Flank|RPL23A_ENST00000472628.1_5'UTR|RPL23A_ENST00000496182.1_5'UTR|RAB34_ENST00000395245.3_5'Flank|SNORD4B_ENST00000459083.1_RNA	NM_000984.5	NP_000975.2	P62750	RL23A_HUMAN	ribosomal protein L23a	49					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(3)|ovary(1)	5	Lung NSC(42;0.00431)					TCCGGCGGCCGAAGACACTGC	0.537											OREG0024282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002hci.2		NA																	0				ovary(1)	1						c.(145-147)CCG>CCA		ribosomal protein L23a							39.0	44.0	42.0					17																	27047846		2197	4292	6489	SO:0001819	synonymous_variant	6147				cell proliferation|endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	nucleotide binding|protein binding|rRNA binding|structural constituent of ribosome	g.chr17:27047846G>A	U43701	CCDS11241.1	17q11.2	2011-04-06			ENSG00000198242	ENSG00000198242		"""L ribosomal proteins"""	10317	protein-coding gene	gene with protein product		602326				9417910	Standard	NM_000984		Approved	L23A	uc002hci.3	P62750	OTTHUMG00000132684	ENST00000422514.2:c.147G>A	17.37:g.27047846G>A			OREG0024282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	791	RAB34_uc002hce.2_5'Flank|RAB34_uc002hcg.2_5'Flank|RAB34_uc002hcf.2_5'Flank|RAB34_uc010was.1_5'Flank|RAB34_uc010wat.1_5'Flank|RAB34_uc002hch.2_5'Flank|RAB34_uc010wau.1_5'Flank|RAB34_uc010wav.1_5'Flank|RPL23A_uc002hck.1_RNA|SNORD4A_uc002hcl.2_5'Flank|SNORD42A_uc002hcm.1_5'Flank|SNORD4B_uc002hcn.1_5'Flank	p.P49P	NM_000984	NP_000975	P62750	RL23A_HUMAN			2	171	+	Lung NSC(42;0.00431)		49					B2R5B2|P29316|P39024|Q92774	Silent	SNP	ENST00000422514.2	37	c.147G>A	CCDS11241.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.485370	0.26686	.	.	ENSG00000198242	ENST00000355731	.	.	.	5.83	0.371	0.16168	.	.	.	.	.	T	0.43077	0.1231	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20107	-1.0285	4	.	.	.	-14.1483	2.7644	0.05316	0.362:0.388:0.1188:0.1312	.	.	.	.	Q	51	.	.	R	+	2	0	RPL23A	24071973	0.994000	0.37717	0.996000	0.52242	0.958000	0.62258	0.440000	0.21592	-0.102000	0.12197	-1.185000	0.01705	CGA		0.537	RPL23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255975.1	NM_000984		11	74	0	0	0	0.016723	0	11	74				
SLC6A4	6532	broad.mit.edu	37	17	28539761	28539761	+	Missense_Mutation	SNP	C	C	T	rs374583307		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:28539761C>T	ENST00000401766.2	-	8	1713	c.1201G>A	c.(1201-1203)Gca>Aca	p.A401T	SLC6A4_ENST00000261707.3_Missense_Mutation_p.A401T			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	401					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	GTCCTACCTGCGTCTTTGGCC	0.443																																							uc002hey.3		NA																	0				skin(3)|ovary(1)	4						c.(1201-1203)GCA>ACA		solute carrier family 6 member 4	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)	C	THR/ALA	0,4406		0,0,2203	143.0	124.0	131.0		1201	4.3	1.0	17		131	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC6A4	NM_001045.4	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	401/631	28539761	1,13005	2203	4300	6503	SO:0001583	missense	6532				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity	g.chr17:28539761C>T	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1201G>A	17.37:g.28539761C>T	ENSP00000385822:p.Ala401Thr					SLC6A4_uc010csg.2_5'Flank	p.A401T	NM_001045	NP_001036	P31645	SC6A4_HUMAN			9	1745	-			401					Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	37	c.1201G>A	CCDS11256.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.382805	0.42207	0.0	1.16E-4	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T	0.75367	-0.93;-0.93	5.38	4.35	0.52113	.	0.335796	0.35677	N	0.003041	T	0.50582	0.1624	N	0.12527	0.23	0.47094	D	0.999319	B	0.12630	0.006	B	0.14023	0.01	T	0.46978	-0.9152	10	0.25106	T	0.35	.	5.0931	0.14720	0.0:0.7646:0.0:0.2354	.	401	P31645	SC6A4_HUMAN	T	443;401;401	ENSP00000385822:A401T;ENSP00000261707:A401T	ENSP00000261707:A401T	A	-	1	0	SLC6A4	25563887	0.991000	0.36638	1.000000	0.80357	0.922000	0.55478	3.078000	0.50096	2.806000	0.96561	0.655000	0.94253	GCA		0.443	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045		4	70	0	0	0	0.014758	0	4	70				
GAS2L2	246176	broad.mit.edu	37	17	34077157	34077157	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:34077157T>G	ENST00000254466.6	-	2	593	c.566A>C	c.(565-567)gAc>gCc	p.D189A	GAS2L2_ENST00000587565.1_Intron	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	189					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGGCGAGGGGTCGGGCGGGGG	0.741																																							uc002hjv.1		NA																	0				ovary(1)|skin(1)	2						c.(565-567)GAC>GCC		growth arrest-specific 2 like 2							20.0	26.0	24.0					17																	34077157		2188	4280	6468	SO:0001583	missense	246176				cell cycle arrest	cytoplasm|cytoskeleton		g.chr17:34077157T>G	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.566A>C	17.37:g.34077157T>G	ENSP00000254466:p.Asp189Ala						p.D189A	NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	2	594	-		Ovarian(249;0.17)	189					Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	c.566A>C	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	T	7.826	0.718860	0.15372	.	.	ENSG00000132139	ENST00000254466	T	0.18016	2.24	4.98	2.77	0.32553	.	1.437920	0.04140	N	0.319452	T	0.17152	0.0412	L	0.51422	1.61	0.26149	N	0.980163	P	0.37781	0.608	B	0.30401	0.115	T	0.28902	-1.0029	10	0.49607	T	0.09	0.0179	8.0796	0.30737	0.0:0.1677:0.0:0.8323	.	189	Q8NHY3	GA2L2_HUMAN	A	189	ENSP00000254466:D189A	ENSP00000254466:D189A	D	-	2	0	GAS2L2	31101270	0.986000	0.35501	0.134000	0.22075	0.011000	0.07611	2.112000	0.41892	0.749000	0.32854	0.402000	0.26972	GAC		0.741	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285		6	54	0	0	0	0.008291	0	6	54				
PSMD3	5709	broad.mit.edu	37	17	38140573	38140573	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:38140573G>A	ENST00000264639.4	+	2	421	c.247G>A	c.(247-249)Gag>Aag	p.E83K	PSMD3_ENST00000541736.1_Intron	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	83					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					GAAACAGCTAGAGAAAGCGGT	0.527																																					Ovarian(186;531 2051 6385 19668 48409)	Ovarian(186;531 2051 6385 19668 48409)	uc002htn.1		NA																	0				ovary(1)|pancreas(1)	2						c.(247-249)GAG>AAG		proteasome 26S non-ATPase subunit 3							64.0	60.0	61.0					17																	38140573		2203	4300	6503	SO:0001583	missense	5709				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding	g.chr17:38140573G>A	D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.247G>A	17.37:g.38140573G>A	ENSP00000264639:p.Glu83Lys					PSMD3_uc010wen.1_Intron|PSMD3_uc010weo.1_Intron	p.E83K	NM_002809	NP_002800	O43242	PSMD3_HUMAN			2	411	+	Colorectal(19;0.000442)		83					B3KMW9|B4DT72|Q96EI2|Q9BQA4	Missense_Mutation	SNP	ENST00000264639.4	37	c.247G>A	CCDS11356.1	.	.	.	.	.	.	.	.	.	.	G	35	5.427738	0.96131	.	.	ENSG00000108344	ENST00000264639;ENST00000415039	.	.	.	5.5	5.5	0.81552	.	0.048159	0.85682	D	0.000000	T	0.61627	0.2362	L	0.55834	1.745	0.80722	D	1	P	0.46784	0.884	P	0.44946	0.465	T	0.65915	-0.6052	9	0.87932	D	0	-31.4665	19.6014	0.95563	0.0:0.0:1.0:0.0	.	83	O43242	PSMD3_HUMAN	K	83;70	.	ENSP00000264639:E83K	E	+	1	0	PSMD3	35394099	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	9.394000	0.97261	2.854000	0.98071	0.655000	0.94253	GAG		0.527	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257018.1	NM_002809		4	57	0	0	0	0.009096	0	4	57				
KRT39	390792	broad.mit.edu	37	17	39116741	39116741	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:39116741C>G	ENST00000355612.2	-	6	1044	c.1009G>C	c.(1009-1011)Gag>Cag	p.E337Q	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	337	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				AGGATGCACTCTTGGGAATCT	0.473																																							uc002hvo.1		NA																	0					0						c.(1009-1011)GAG>CAG		type I hair keratin KA35							126.0	125.0	125.0					17																	39116741		2203	4296	6499	SO:0001583	missense	390792					intermediate filament	structural molecule activity	g.chr17:39116741C>G	AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.1009G>C	17.37:g.39116741C>G	ENSP00000347823:p.Glu337Gln					KRT39_uc010wfm.1_Missense_Mutation_p.E70Q	p.E337Q	NM_213656	NP_998821	Q6A163	K1C39_HUMAN			6	1045	-		Breast(137;0.00043)|Ovarian(249;0.15)	337			Coil 2.|Rod.		B2RXK6|Q6IFU6	Missense_Mutation	SNP	ENST00000355612.2	37	c.1009G>C	CCDS11382.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559417	0.45590	.	.	ENSG00000196859	ENST00000355612	D	0.90900	-2.75	5.81	5.81	0.92471	Filament (1);	0.000000	0.43110	D	0.000608	D	0.94781	0.8315	M	0.64080	1.96	0.39645	D	0.970382	D	0.89917	1.0	D	0.91635	0.999	D	0.94199	0.7448	10	0.46703	T	0.11	.	20.0695	0.97716	0.0:1.0:0.0:0.0	.	337	Q6A163	K1C39_HUMAN	Q	337	ENSP00000347823:E337Q	ENSP00000347823:E337Q	E	-	1	0	KRT39	36370267	1.000000	0.71417	0.967000	0.41034	0.024000	0.10985	2.851000	0.48302	2.750000	0.94351	0.591000	0.81541	GAG		0.473	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257287.1	NM_213656		4	191	0	0	0	0.009096	0	4	191				
TMEM100	55273	broad.mit.edu	37	17	53798254	53798254	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:53798254A>G	ENST00000575734.1	-	4	986	c.178T>C	c.(178-180)Ttt>Ctt	p.F60L	TMEM100_ENST00000424486.2_Missense_Mutation_p.F60L|TMEM100_ENST00000570586.1_5'Flank	NM_001099640.1	NP_001093110.1	Q9NV29	TM100_HUMAN	transmembrane protein 100	60					angiogenesis (GO:0001525)|arterial endothelial cell differentiation (GO:0060842)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of vasculogenesis (GO:2001214)|protein kinase B signaling (GO:0043491)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	11						ACCACAGCAAAGGGGATGATG	0.537																																							uc002iuj.3		NA																	0					0						c.(178-180)TTT>CTT		transmembrane protein 100							124.0	118.0	120.0					17																	53798254		2203	4300	6503	SO:0001583	missense	55273					integral to membrane		g.chr17:53798254A>G	AK001832	CCDS11587.1	17q23.1	2005-12-16				ENSG00000166292			25607	protein-coding gene	gene with protein product							Standard	NM_018286		Approved	FLJ10970, FLJ37856	uc002iuj.4	Q9NV29		ENST00000575734.1:c.178T>C	17.37:g.53798254A>G	ENSP00000465638:p.Phe60Leu					TMEM100_uc002iuk.3_Missense_Mutation_p.F60L	p.F60L	NM_018286	NP_060756	Q9NV29	TM100_HUMAN			2	489	-			60			Helical; (Potential).		D3DTY7|I3L214|Q96FZ0	Missense_Mutation	SNP	ENST00000575734.1	37	c.178T>C	CCDS11587.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.205793	0.79127	.	.	ENSG00000166292	ENST00000299377;ENST00000424486	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.62024	0.2394	M	0.62016	1.91	0.58432	D	0.999999	P	0.46784	0.884	P	0.46208	0.507	T	0.64499	-0.6393	9	0.48119	T	0.1	.	15.3166	0.74085	1.0:0.0:0.0:0.0	.	60	Q9NV29	TM100_HUMAN	L	60	.	ENSP00000299377:F60L	F	-	1	0	TMEM100	51153253	1.000000	0.71417	0.991000	0.47740	0.767000	0.43475	7.098000	0.76974	2.207000	0.71202	0.533000	0.62120	TTT		0.537	TMEM100-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439266.2	NM_018286		30	104	0	0	0	0.007291	0	30	104				
C17orf58	284018	broad.mit.edu	37	17	65988130	65988130	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:65988130G>T	ENST00000449250.2	-	3	382	c.193C>A	c.(193-195)Cca>Aca	p.P65T	RP11-855A2.5_ENST00000580729.1_lincRNA|C17orf58_ENST00000536693.1_3'UTR|C17orf58_ENST00000334461.7_3'UTR			Q2M2W7	CQ058_HUMAN	chromosome 17 open reading frame 58	65										lung(2)	2	all_cancers(12;4.57e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCATCCCCTGGACGGAGGCGG	0.512																																							uc002jgi.3		NA																	0					0						c.(193-195)CCA>ACA		hypothetical protein LOC284018 isoform a							112.0	108.0	109.0					17																	65988130		1926	4121	6047	SO:0001583	missense	284018							g.chr17:65988130G>T	AK026583	CCDS42375.1, CCDS45765.1	17q24.2	2012-10-11			ENSG00000186665	ENSG00000186665			27568	protein-coding gene	gene with protein product						12477932	Standard	NM_181656		Approved		uc002jgi.4	Q2M2W7	OTTHUMG00000179782	ENST00000449250.2:c.193C>A	17.37:g.65988130G>T	ENSP00000402020:p.Pro65Thr					C17orf58_uc002jgj.3_3'UTR	p.P65T	NM_181655	NP_858041	Q2M2W7	CQ058_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		3	508	-	all_cancers(12;4.57e-10)		65					A8MQV2	Missense_Mutation	SNP	ENST00000449250.2	37	c.193C>A	CCDS45765.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816794	0.70912	.	.	ENSG00000186665	ENST00000449250	T	0.61274	0.12	4.63	4.63	0.57726	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	.	.	.	.	T	0.74673	0.3747	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.78460	-0.2195	8	0.72032	D	0.01	-3.2419	13.2566	0.60083	0.0:0.1595:0.8405:0.0	.	65	Q2M2W7	CQ058_HUMAN	T	65	ENSP00000402020:P65T	ENSP00000402020:P65T	P	-	1	0	C17orf58	63418592	1.000000	0.71417	0.089000	0.20774	0.982000	0.71751	5.450000	0.66626	2.120000	0.65058	0.555000	0.69702	CCA		0.512	C17orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448104.1	NM_181656		32	78	1	0	5.60225e-13	0.009535	6.82414e-13	32	78				
P4HB	5034	broad.mit.edu	37	17	79801962	79801962	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:79801962C>G	ENST00000331483.4	-	11	1675	c.1453G>C	c.(1453-1455)Gag>Cag	p.E485Q	P4HB_ENST00000439918.2_Missense_Mutation_p.E441Q|P4HB_ENST00000576390.1_Intron|RP11-498C9.2_ENST00000576784.1_RNA|P4HB_ENST00000472244.1_5'Flank	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	485					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			TCCAGGTCCTCGAGATCCTGG	0.602																																					Colon(49;444 983 1296 7887 42561)	Colon(49;444 983 1296 7887 42561)	uc002kbn.1		NA																	0					0						c.(1453-1455)GAG>CAG		prolyl 4-hydroxylase, beta subunit precursor							154.0	157.0	156.0					17																	79801962		2203	4300	6503	SO:0001583	missense	5034				cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr17:79801962C>G	J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.1453G>C	17.37:g.79801962C>G	ENSP00000327801:p.Glu485Gln					P4HB_uc002kbl.1_Missense_Mutation_p.E162Q|P4HB_uc002kbm.1_Missense_Mutation_p.E162Q	p.E485Q	NM_000918	NP_000909	P07237	PDIA1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)		11	1650	-	all_neural(118;0.0878)|Ovarian(332;0.12)		485					B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Missense_Mutation	SNP	ENST00000331483.4	37	c.1453G>C	CCDS11787.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.950600|3.950600	0.73787|0.73787	.|.	.|.	ENSG00000185624|ENSG00000185624	ENST00000331483;ENST00000537205;ENST00000436463|ENST00000415593	T|.	0.03889|.	3.77|.	5.47|5.47	5.47|5.47	0.80525|0.80525	Thioredoxin-like fold (1);|.	0.712120|.	0.13621|.	N|.	0.374419|.	T|T	0.47358|0.47358	0.1441|0.1441	N|N	0.08118|0.08118	0|0	0.58432|0.58432	D|D	0.99999|0.99999	D|.	0.56746|.	0.977|.	P|.	0.53006|.	0.715|.	T|T	0.43343|0.43343	-0.9397|-0.9397	10|5	0.33940|.	T|.	0.23|.	.|.	19.3135|19.3135	0.94202|0.94202	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	485|.	P07237|.	PDIA1_HUMAN|.	Q|P	485;428;469|250	ENSP00000327801:E485Q|.	ENSP00000327801:E485Q|.	E|R	-|-	1|2	0|0	P4HB|P4HB	77395251|77395251	0.999000|0.999000	0.42202|0.42202	0.197000|0.197000	0.23402|0.23402	0.709000|0.709000	0.40893|0.40893	5.250000|5.250000	0.65432|0.65432	2.576000|2.576000	0.86940|0.86940	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.602	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317250.3	NM_000918		6	298	0	0	0	0.001168	0	6	298				
ZNF521	25925	broad.mit.edu	37	18	22806582	22806582	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr18:22806582C>A	ENST00000361524.3	-	4	1448	c.1300G>T	c.(1300-1302)Gaa>Taa	p.E434*	ZNF521_ENST00000538137.2_Nonsense_Mutation_p.E434*|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Nonsense_Mutation_p.E214*	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	434					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGGGCCTGTTCTGGCTTATCT	0.413			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(1300-1302)GAA>TAA		zinc finger protein 521							85.0	88.0	87.0					18																	22806582		2203	4300	6503	SO:0001587	stop_gained	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22806582C>A	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1300G>T	18.37:g.22806582C>A	ENSP00000354794:p.Glu434*					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Nonsense_Mutation_p.E434*|ZNF521_uc002kvl.2_Nonsense_Mutation_p.E214*	p.E434*	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	1547	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		434					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Nonsense_Mutation	SNP	ENST00000361524.3	37	c.1300G>T	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	35	5.488872	0.96323	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-22.0015	16.0336	0.80603	0.0:0.8666:0.1334:0.0	.	.	.	.	X	434;468;434	.	ENSP00000354794:E434X	E	-	1	0	ZNF521	21060580	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	5.697000	0.68295	2.879000	0.98667	0.650000	0.86243	GAA		0.413	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		17	49	1	0	1.5739e-10	0.004007	1.82695e-10	17	49				
CDH2	1000	broad.mit.edu	37	18	25543371	25543371	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr18:25543371C>A	ENST00000269141.3	-	15	2887	c.2464G>T	c.(2464-2466)Gtc>Ttc	p.V822F	AC015933.2_ENST00000423367.1_RNA|CDH2_ENST00000399380.3_Missense_Mutation_p.V791F	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	822					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCAGATCGGACCGGATACTGG	0.522																																							uc002kwg.2		NA																	0				ovary(3)|lung(1)	4						c.(2464-2466)GTC>TTC		cadherin 2, type 1 preproprotein							85.0	69.0	75.0					18																	25543371		2203	4300	6503	SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25543371C>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2464G>T	18.37:g.25543371C>A	ENSP00000269141:p.Val822Phe					CDH2_uc010xbn.1_Missense_Mutation_p.V791F	p.V822F	NM_001792	NP_001783	P19022	CADH2_HUMAN			15	2923	-			822			Cytoplasmic (Potential).		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	c.2464G>T	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.877715	0.33162	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.77750	-1.12;-1.12	6.16	6.16	0.99307	Cadherin, cytoplasmic domain (1);	0.102661	0.64402	D	0.000002	T	0.73187	0.3555	L	0.38175	1.15	0.54753	D	0.999982	D;P	0.53151	0.958;0.695	P;B	0.49597	0.616;0.322	T	0.67252	-0.5717	10	0.10111	T	0.7	.	13.9788	0.64291	0.0:0.9314:0.0:0.0686	.	791;822	A8MWK3;P19022	.;CADH2_HUMAN	F	822;791	ENSP00000269141:V822F;ENSP00000382312:V791F	ENSP00000269141:V822F	V	-	1	0	CDH2	23797369	0.998000	0.40836	0.952000	0.39060	0.281000	0.26958	3.523000	0.53488	2.937000	0.99478	0.650000	0.86243	GTC		0.522	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		7	50	1	0	0.000157383	0.00308	0.000164033	7	50				
DSG1	1828	broad.mit.edu	37	18	28916510	28916510	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr18:28916510C>T	ENST00000257192.4	+	9	1411	c.1199C>T	c.(1198-1200)tCa>tTa	p.S400L		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	400	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			AATATGGGATCAAATGATAAA	0.388																																							uc002kwp.2		NA																	0				skin(3)|ovary(2)|central_nervous_system(2)	7						c.(1198-1200)TCA>TTA		desmoglein 1 preproprotein							89.0	81.0	84.0					18																	28916510		2203	4300	6503	SO:0001583	missense	1828				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding	g.chr18:28916510C>T	X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1199C>T	18.37:g.28916510C>T	ENSP00000257192:p.Ser400Leu						p.S400L	NM_001942	NP_001933	Q02413	DSG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00559)		9	1411	+			400			Extracellular (Potential).|Cadherin 4.		B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	c.1199C>T	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	C	7.926	0.739546	0.15642	.	.	ENSG00000134760	ENST00000257192	T	0.59638	0.25	5.57	-4.41	0.03590	Cadherin (2);Cadherin-like (1);	1.768690	0.03102	N	0.161245	T	0.27832	0.0685	N	0.01576	-0.805	0.09310	N	1	B	0.14438	0.01	B	0.20184	0.028	T	0.17167	-1.0378	10	0.30078	T	0.28	.	7.1049	0.25358	0.4265:0.3379:0.0:0.2356	.	400	Q02413	DSG1_HUMAN	L	400	ENSP00000257192:S400L	ENSP00000257192:S400L	S	+	2	0	DSG1	27170508	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.160000	0.10041	-0.703000	0.05049	-0.253000	0.11424	TCA		0.388	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942		8	41	0	0	0	0.004482	0	8	41				
SYT4	6860	broad.mit.edu	37	18	40854133	40854133	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr18:40854133C>T	ENST00000255224.3	-	2	629	c.261G>A	c.(259-261)gtG>gtA	p.V87V	SYT4_ENST00000590752.1_Silent_p.V69V|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	87					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						AATTCTTTGGCACAGCTGGCT	0.388																																					NSCLC(85;81 1419 2855 22820 35912)	NSCLC(85;81 1419 2855 22820 35912)	uc002law.2		NA																	0				skin(5)	5						c.(259-261)GTG>GTA		synaptotagmin IV							142.0	138.0	139.0					18																	40854133		2203	4300	6503	SO:0001819	synonymous_variant	6860					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr18:40854133C>T	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.261G>A	18.37:g.40854133C>T						SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Silent_p.V69V|SYT4_uc010dnh.2_Intron	p.V87V	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN			2	630	-			87			Cytoplasmic (Potential).		B4DEU3|Q9P2K4	Silent	SNP	ENST00000255224.3	37	c.261G>A	CCDS11922.1																																																																																				0.388	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783		16	48	0	0	0	0.003163	0	16	48				
BCL2	596	broad.mit.edu	37	18	60795972	60795972	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr18:60795972G>A	ENST00000398117.1	-	2	2067	c.606C>T	c.(604-606)taC>taT	p.Y202Y	BCL2_ENST00000333681.4_Silent_p.Y202Y|BCL2_ENST00000590515.1_5'UTR	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	202					actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	TGCTGGGGCCGTACAGTTCCA	0.542			T	IGH@	"""NHL, CLL"""																																		uc002lit.1		NA		Dom	yes		18	18q21.3	596	T	B-cell CLL/lymphoma 2			L	IGH@		NHL|CLL		0				central_nervous_system(1)	1						c.(604-606)TAC>TAT		B-cell lymphoma protein 2 alpha isoform	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)						40.0	37.0	38.0					18																	60795972		2203	4300	6503	SO:0001819	synonymous_variant	596				activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding	g.chr18:60795972G>A	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.606C>T	18.37:g.60795972G>A						BCL2_uc002liu.1_Silent_p.Y202Y	p.Y202Y	NM_000633	NP_000624	P10415	BCL2_HUMAN		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	3	1099	-		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)	202			BH2.		C9JHD5|P10416|Q13842|Q16197	Silent	SNP	ENST00000398117.1	37	c.606C>T	CCDS11981.1																																																																																				0.542	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657		12	21	0	0	0	0.010729	0	12	21				
ZNF236	7776	broad.mit.edu	37	18	74639027	74639027	+	Silent	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr18:74639027G>T	ENST00000253159.8	+	23	4254	c.4056G>T	c.(4054-4056)ggG>ggT	p.G1352G	ZNF236_ENST00000320610.9_Silent_p.G1354G	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1352					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TGACAGATGGGAGCCTGGCTA	0.438																																							uc002lmi.2		NA																	0				ovary(4)	4						c.(4054-4056)GGG>GGT		zinc finger protein 236							92.0	88.0	90.0					18																	74639027		1954	4132	6086	SO:0001819	synonymous_variant	7776				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:74639027G>T	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.4056G>T	18.37:g.74639027G>T						ZNF236_uc002lmj.2_RNA	p.G1352G	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)	23	4254	+		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)	1352					B2RTX9|Q9UL37	Silent	SNP	ENST00000253159.8	37	c.4056G>T	CCDS42447.1																																																																																				0.438	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			24	63	1	0	9.95505e-16	0.014323	1.25927e-15	24	63				
TJP3	27134	broad.mit.edu	37	19	3730104	3730104	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:3730104G>C	ENST00000541714.2	+	4	699	c.237G>C	c.(235-237)aaG>aaC	p.K79N	TJP3_ENST00000382008.3_Missense_Mutation_p.K79N|TJP3_ENST00000262968.9_Missense_Mutation_p.K98N|TJP3_ENST00000539908.2_Missense_Mutation_p.K43N|TJP3_ENST00000589378.1_Missense_Mutation_p.K88N|TJP3_ENST00000587686.1_Missense_Mutation_p.K98N	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	79	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATACTCAAGACCTGCACCA	0.592																																							uc010xhv.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(292-294)AAG>AAC		tight junction protein 3							126.0	112.0	117.0					19																	3730104		2203	4300	6503	SO:0001583	missense	27134					tight junction	protein binding	g.chr19:3730104G>C	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.237G>C	19.37:g.3730104G>C	ENSP00000439278:p.Lys79Asn					TJP3_uc010xhs.1_Missense_Mutation_p.K79N|TJP3_uc010xht.1_Missense_Mutation_p.K43N|TJP3_uc010xhu.1_Missense_Mutation_p.K88N|TJP3_uc010xhw.1_Missense_Mutation_p.K98N	p.K98N	NM_014428	NP_055243	O95049	ZO3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)	3	294	+			79			PDZ 1.		A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	ENST00000541714.2	37	c.294G>C	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946404	0.34377	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	3.67	3.67	0.42095	PDZ/DHR/GLGF (4);	0.059862	0.64402	D	0.000004	T	0.60418	0.2267	M	0.89214	3.015	0.39700	D	0.971166	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.79108	0.988;0.961;0.992;0.988	T	0.66555	-0.5894	10	0.72032	D	0.01	.	7.2643	0.26222	0.2076:0.0:0.7924:0.0	.	98;98;79;79	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	N	79;43;79;98	ENSP00000439278:K79N;ENSP00000439991:K43N;ENSP00000371438:K79N;ENSP00000262968:K98N	ENSP00000262968:K98N	K	+	3	2	TJP3	3681104	1.000000	0.71417	0.991000	0.47740	0.208000	0.24298	0.761000	0.26489	1.900000	0.55004	0.491000	0.48974	AAG		0.592	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1			17	64	0	0	0	0.00499	0	17	64				
MUC16	94025	broad.mit.edu	37	19	9020110	9020110	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:9020110T>C	ENST00000397910.4	-	21	37588	c.37385A>G	c.(37384-37386)cAt>cGt	p.H12462R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12464	SEA 3. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCAAGATGATGGATGCAGAT	0.537																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(37384-37386)CAT>CGT		mucin 16							137.0	121.0	126.0					19																	9020110		1933	4149	6082	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9020110T>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37385A>G	19.37:g.9020110T>C	ENSP00000381008:p.His12462Arg						p.H12462R	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			21	37589	-			12464			Extracellular (Potential).|SEA 3.		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.37385A>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	4.209	0.037527	0.08148	.	.	ENSG00000181143	ENST00000397910	T	0.38240	1.15	3.28	-2.76	0.05896	.	.	.	.	.	T	0.36386	0.0965	M	0.84683	2.71	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.41592	-0.9500	8	0.87932	D	0	.	3.9899	0.09532	0.5158:0.108:0.0:0.3762	.	12462	B5ME49	.	R	12462	ENSP00000381008:H12462R	ENSP00000381008:H12462R	H	-	2	0	MUC16	8881110	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.454000	0.21827	-0.960000	0.03613	-1.872000	0.00552	CAT		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		54	151	0	0	0	0.01441	0	54	151				
MUC16	94025	broad.mit.edu	37	19	9061355	9061355	+	Silent	SNP	A	A	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:9061355A>T	ENST00000397910.4	-	3	26294	c.26091T>A	c.(26089-26091)acT>acA	p.T8697T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8699	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGTCATCATAGTTTCTGGGA	0.483																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(26089-26091)ACT>ACA		mucin 16							106.0	100.0	102.0					19																	9061355		1971	4149	6120	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9061355A>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26091T>A	19.37:g.9061355A>T							p.T8697T	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	26295	-			8699			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.26091T>A	CCDS54212.1																																																																																				0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		19	54	0	0	0	0.014323	0	19	54				
MUC16	94025	broad.mit.edu	37	19	9069180	9069180	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:9069180G>C	ENST00000397910.4	-	3	18469	c.18266C>G	c.(18265-18267)tCa>tGa	p.S6089*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6091	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCTGTAGTTGAGTTCATCAC	0.488																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(18265-18267)TCA>TGA		mucin 16							77.0	85.0	82.0					19																	9069180		2119	4246	6365	SO:0001587	stop_gained	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9069180G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18266C>G	19.37:g.9069180G>C	ENSP00000381008:p.Ser6089*						p.S6089*	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	18470	-			6091			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	c.18266C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	57	29.407362	0.99975	.	.	ENSG00000181143	ENST00000397910	.	.	.	1.11	-0.0338	0.13899	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.5958	0.08005	0.2771:0.0:0.7229:0.0	.	.	.	.	X	6089	.	ENSP00000381008:S6089X	S	-	2	0	MUC16	8930180	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-0.365000	0.07573	0.042000	0.15717	0.163000	0.16589	TCA		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		5	67	0	0	0	0.014758	0	5	67				
CACNA1A	773	broad.mit.edu	37	19	13423508	13423508	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:13423508G>A	ENST00000360228.5	-	12	1642	c.1643C>T	c.(1642-1644)tCt>tTt	p.S548F	CACNA1A_ENST00000573710.2_Missense_Mutation_p.S549F	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	549					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GTTGAAGGAAGAGTGGAAGTA	0.428																																							uc010dze.2		NA																	0				large_intestine(2)	2						c.(1645-1647)TCT>TTT		calcium channel, alpha 1A subunit isoform 3	Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)						94.0	91.0	92.0					19																	13423508		1894	4102	5996	SO:0001583	missense	773				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding	g.chr19:13423508G>A	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1643C>T	19.37:g.13423508G>A	ENSP00000353362:p.Ser548Phe					CACNA1A_uc010dzc.2_Missense_Mutation_p.S74F|CACNA1A_uc002mwy.3_Missense_Mutation_p.S548F|CACNA1A_uc010xne.1_Missense_Mutation_p.S74F	p.S549F	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		12	1882	-			549			Cytoplasmic (Potential).|II.		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	c.1646C>T	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670252	0.67814	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.98792	-5.14	5.11	5.11	0.69529	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99342	0.9769	M	0.92219	3.285	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.998;0.996	D	0.98880	1.0769	10	0.87932	D	0	.	17.6776	0.88235	0.0:0.0:1.0:0.0	.	549;549;548	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	F	548;549;549;549	ENSP00000353362:S548F	ENSP00000317661:S549F	S	-	2	0	CACNA1A	13284508	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.529000	0.85273	0.650000	0.86243	TCT		0.428	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068		4	57	0	0	0	0.009096	0	4	57				
AKAP8L	26993	broad.mit.edu	37	19	15510160	15510160	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:15510160C>G	ENST00000397410.5	-	9	1240	c.1110G>C	c.(1108-1110)aaG>aaC	p.K370N	AKAP8L_ENST00000595879.1_5'UTR|AKAP8L_ENST00000595465.2_Missense_Mutation_p.K309N	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	370						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						TGTCCTGACTCTTCTTGCCTG	0.602																																							uc002naw.1		NA																	0				ovary(1)	1						c.(1108-1110)AAG>AAC		A kinase (PRKA) anchor protein 8-like							173.0	174.0	174.0					19																	15510160		2116	4237	6353	SO:0001583	missense	26993					cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding	g.chr19:15510160C>G	BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.1110G>C	19.37:g.15510160C>G	ENSP00000380557:p.Lys370Asn					AKAP8L_uc002nax.1_RNA|AKAP8L_uc010xoh.1_Missense_Mutation_p.K309N	p.K370N	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN			9	1209	-			370					B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Missense_Mutation	SNP	ENST00000397410.5	37	c.1110G>C	CCDS46005.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.650790	0.47362	.	.	ENSG00000011243	ENST00000397410	T	0.52983	0.64	5.67	5.67	0.87782	.	0.229030	0.43110	D	0.000605	T	0.45518	0.1346	N	0.14661	0.345	0.24237	N	0.995373	D;D	0.65815	0.995;0.995	P;P	0.57152	0.814;0.814	T	0.43196	-0.9406	10	0.62326	D	0.03	-26.8147	12.6249	0.56623	0.0:0.9205:0.0:0.0795	.	309;370	B4DJ74;Q9ULX6	.;AKP8L_HUMAN	N	370	ENSP00000380557:K370N	ENSP00000380557:K370N	K	-	3	2	AKAP8L	15371160	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.505000	0.35736	2.676000	0.91093	0.561000	0.74099	AAG		0.602	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461301.2	NM_014371		5	80	0	0	0	0.014758	0	5	80				
TMEM38A	79041	broad.mit.edu	37	19	16798999	16798999	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:16798999C>T	ENST00000187762.2	+	6	808	c.717C>T	c.(715-717)gcC>gcT	p.A239A		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	239						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						CCTTTGATGCCCTGGAGGGCT	0.622																																							uc002nes.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(715-717)GCC>GCT		transmembrane protein 38A							204.0	214.0	211.0					19																	16798999		2203	4300	6503	SO:0001819	synonymous_variant	79041					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity	g.chr19:16798999C>T	AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.717C>T	19.37:g.16798999C>T							p.A239A	NM_024074	NP_076979	Q9H6F2	TM38A_HUMAN			6	808	+			239			Cytoplasmic (Potential).		A8K9P9	Silent	SNP	ENST00000187762.2	37	c.717C>T	CCDS12349.1																																																																																				0.622	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462841.1	NM_024074		83	312	0	0	0	0.01441	0	83	312				
TSHZ3	57616	broad.mit.edu	37	19	31770648	31770648	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:31770648G>A	ENST00000240587.4	-	2	378	c.51C>T	c.(49-51)tcC>tcT	p.S17S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	17					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S17S(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TTAACTCTTCGGAAACATAGG	0.502																																							uc002nsy.3		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(49-51)TCC>TCT		zinc finger protein 537							40.0	41.0	41.0					19																	31770648		1933	4145	6078	SO:0001819	synonymous_variant	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31770648G>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.51C>T	19.37:g.31770648G>A							p.S17S	NM_020856	NP_065907	Q63HK5	TSH3_HUMAN			2	116	-	Esophageal squamous(110;0.226)		17					Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	c.51C>T	CCDS12421.2																																																																																				0.502	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		17	45	0	0	0	0.006122	0	17	45				
CEP89	84902	broad.mit.edu	37	19	33370214	33370214	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:33370214G>A	ENST00000305768.5	-	19	2294	c.2206C>T	c.(2206-2208)Ctc>Ttc	p.L736F	CTD-2085J24.4_ENST00000586628.2_lincRNA	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	736					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						GTGTCCTGGAGAAGTTCTCGG	0.512																																							uc002nty.2		NA																	0					0						c.(2206-2208)CTC>TTC		coiled-coil domain containing 123							170.0	166.0	168.0					19																	33370214		2203	4300	6503	SO:0001583	missense	84902					centrosome|spindle pole		g.chr19:33370214G>A	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.2206C>T	19.37:g.33370214G>A	ENSP00000306105:p.Leu736Phe					CCDC123_uc002ntx.2_Missense_Mutation_p.L489F|CCDC123_uc010edg.2_RNA	p.L736F	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN			19	2295	-	Esophageal squamous(110;0.137)		736					B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	c.2206C>T	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361405	0.61403	.	.	ENSG00000121289	ENST00000305768	T	0.52526	0.66	4.93	4.93	0.64822	.	0.000000	0.52532	D	0.000061	T	0.61451	0.2348	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.63699	-0.6578	10	0.66056	D	0.02	-8.8358	7.9562	0.30045	0.1775:0.0:0.8225:0.0	.	736	Q96ST8	CEP89_HUMAN	F	736	ENSP00000306105:L736F	ENSP00000306105:L736F	L	-	1	0	CEP89	38062054	1.000000	0.71417	0.562000	0.28370	0.042000	0.13812	2.960000	0.49161	2.440000	0.82611	0.561000	0.74099	CTC		0.512	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		19	165	0	0	0	0.007413	0	19	165				
ZFP30	22835	broad.mit.edu	37	19	38134173	38134173	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:38134173C>T	ENST00000351218.2	-	5	785	c.228G>A	c.(226-228)tgG>tgA	p.W76*	ZFP30_ENST00000589018.1_Nonsense_Mutation_p.W75*|ZFP30_ENST00000392144.1_Nonsense_Mutation_p.W76*|ZFP30_ENST00000514101.2_Nonsense_Mutation_p.W76*	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	76	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACCTAGAGTCCATCTTCTTT	0.468																																							uc002ogv.1		NA																	0					0						c.(226-228)TGG>TGA		zinc finger protein 30 homolog							254.0	248.0	250.0					19																	38134173		2203	4300	6503	SO:0001587	stop_gained	22835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38134173C>T	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.228G>A	19.37:g.38134173C>T	ENSP00000343581:p.Trp76*					ZFP30_uc002ogw.1_Nonsense_Mutation_p.W76*|ZFP30_uc002ogx.1_Nonsense_Mutation_p.W76*|ZFP30_uc010xtt.1_Nonsense_Mutation_p.W75*	p.W76*	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		5	744	-			76			KRAB.		Q58EY8	Nonsense_Mutation	SNP	ENST00000351218.2	37	c.228G>A	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	37	6.394983	0.97533	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	.	.	.	4.2	3.17	0.36434	.	1.439830	0.05028	N	0.474103	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	7.6581	0.28388	0.0:0.8877:0.0:0.1123	.	.	.	.	X	76;76;76;75	.	ENSP00000343581:W76X	W	-	3	0	ZFP30	42826013	0.018000	0.18449	0.853000	0.33588	0.740000	0.42216	0.424000	0.21330	1.359000	0.45940	0.591000	0.81541	TGG		0.468	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898		31	181	0	0	0	0.015359	0	31	181				
RYR1	6261	broad.mit.edu	37	19	38939051	38939051	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:38939051C>A	ENST00000359596.3	+	10	857	c.857C>A	c.(856-858)aCc>aAc	p.T286N	RYR1_ENST00000360985.3_Missense_Mutation_p.T286N|RYR1_ENST00000355481.4_Missense_Mutation_p.T286N			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	286	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CATGTCACTACCGGGCAGTAC	0.647																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(856-858)ACC>AAC		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						97.0	95.0	96.0					19																	38939051		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38939051C>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.857C>A	19.37:g.38939051C>A	ENSP00000352608:p.Thr286Asn					RYR1_uc002oiu.2_Missense_Mutation_p.T286N	p.T286N	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		10	987	+	all_cancers(60;7.91e-06)		286			MIR 4.|Cytoplasmic.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.857C>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.660408	0.29515	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97089	-4.24;-4.24;-4.24	4.54	4.54	0.55810	MIR motif (2);MIR (2);	0.000000	0.64402	U	0.000001	D	0.98295	0.9435	M	0.80183	2.485	0.53005	D	0.999962	D;D	0.89917	0.996;1.0	P;D	0.81914	0.889;0.995	D	0.99316	1.0905	10	0.87932	D	0	.	16.2096	0.82148	0.0:1.0:0.0:0.0	.	286;286	P21817-2;P21817	.;RYR1_HUMAN	N	286	ENSP00000352608:T286N;ENSP00000347667:T286N;ENSP00000354254:T286N	ENSP00000347667:T286N	T	+	2	0	RYR1	43630891	1.000000	0.71417	0.943000	0.38184	0.291000	0.27294	7.182000	0.77689	2.376000	0.81061	0.491000	0.48974	ACC		0.647	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			44	109	1	0	1.8453e-21	0.010771	2.36454e-21	44	109				
CEACAM5	1048	broad.mit.edu	37	19	42222239	42222239	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:42222239G>T	ENST00000221992.6	+	6	1544	c.1430G>T	c.(1429-1431)tGc>tTc	p.C477F	CEACAM5_ENST00000398599.4_Missense_Mutation_p.C476F|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000405816.1_Missense_Mutation_p.C477F	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	477	Ig-like 5.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CTCTATACCTGCCAGGCCAAT	0.488																																							uc002ork.2		NA																	0				skin(2)	2						c.(1429-1431)TGC>TTC		carcinoembryonic antigen-related cell adhesion							78.0	66.0	70.0					19																	42222239		2203	4300	6503	SO:0001583	missense	1048					anchored to membrane|basolateral plasma membrane|integral to plasma membrane		g.chr19:42222239G>T	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1430G>T	19.37:g.42222239G>T	ENSP00000221992:p.Cys477Phe					CEACAM5_uc002orj.1_Missense_Mutation_p.C476F|CEACAM5_uc002orl.2_Missense_Mutation_p.C477F	p.C477F	NM_004363	NP_004354	P06731	CEAM5_HUMAN		OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)	6	1551	+			477			Ig-like 5.		H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	c.1430G>T	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582913	0.28268	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.58797	0.31;0.31	2.39	2.39	0.29439	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85617	0.5738	H	0.99927	4.965	0.09310	N	1	D;D	0.71674	0.998;0.988	D;D	0.83275	0.996;0.933	T	0.74346	-0.3695	9	0.62326	D	0.03	.	8.4077	0.32625	0.0:0.0:1.0:0.0	.	477;477	P06731;Q53G30	CEAM5_HUMAN;.	F	477;477;195	ENSP00000221992:C477F;ENSP00000385072:C477F	ENSP00000221992:C477F	C	+	2	0	CEACAM5	46914079	0.198000	0.23374	0.071000	0.20095	0.010000	0.07245	2.177000	0.42509	1.668000	0.50843	0.531000	0.56144	TGC		0.488	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363		16	67	1	0	1.52009e-12	0.003163	1.84405e-12	16	67				
ZNF234	10780	broad.mit.edu	37	19	44660836	44660836	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:44660836C>G	ENST00000426739.2	+	6	925	c.667C>G	c.(667-669)Cag>Gag	p.Q223E	ZNF234_ENST00000592437.1_Missense_Mutation_p.Q223E	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TCAAACTCATCAGAGAGTCCA	0.418																																							uc002oym.2		NA																	0					0						c.(667-669)CAG>GAG		zinc finger protein 234							133.0	135.0	135.0					19																	44660836		2203	4300	6503	SO:0001583	missense	10780				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44660836C>G	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.667C>G	19.37:g.44660836C>G	ENSP00000400878:p.Gln223Glu					ZNF234_uc002oyl.3_Missense_Mutation_p.Q223E	p.Q223E	NM_006630	NP_006621	Q14588	ZN234_HUMAN			6	974	+		Prostate(69;0.0435)	223			C2H2-type 3.		A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	c.667C>G	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.721209	0.30503	.	.	ENSG00000167380	ENST00000426739;ENST00000542402	T	0.07327	3.2	4.19	4.19	0.49359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07188	0.0182	N	0.13327	0.33	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.29912	-0.9996	9	0.66056	D	0.02	.	15.8671	0.79074	0.0:1.0:0.0:0.0	.	223	Q14588	ZN234_HUMAN	E	223;52	ENSP00000400878:Q223E	ENSP00000400878:Q223E	Q	+	1	0	ZNF226	49352676	0.000000	0.05858	0.515000	0.27774	0.949000	0.60115	1.103000	0.31062	2.330000	0.79161	0.586000	0.80456	CAG		0.418	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2			5	178	0	0	0	0.014758	0	5	178				
CD3EAP	10849	broad.mit.edu	37	19	45911398	45911398	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:45911398G>A	ENST00000309424.3	+	3	660	c.172G>A	c.(172-174)Ggg>Agg	p.G58R	ERCC1_ENST00000423698.2_3'UTR|PPP1R13L_ENST00000418234.2_5'Flank|ERCC1_ENST00000300853.3_3'UTR|CD3EAP_ENST00000589804.1_Missense_Mutation_p.G60R|ERCC1_ENST00000588738.1_5'Flank	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	58					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TAGCTTCAATGGGCGGCATGT	0.507																																							uc002pbq.1		NA																	0				large_intestine(2)|ovary(2)	4						c.(172-174)GGG>AGG		CD3E antigen, epsilon polypeptide associated							104.0	103.0	103.0					19																	45911398		2203	4300	6503	SO:0001583	missense	10849				rRNA transcription|transmembrane receptor protein tyrosine kinase signaling pathway	chromosome|RNA polymerase I transcription factor complex	DNA-directed RNA polymerase activity	g.chr19:45911398G>A	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.172G>A	19.37:g.45911398G>A	ENSP00000310966:p.Gly58Arg					PPP1R13L_uc002pbo.2_5'Flank|PPP1R13L_uc002pbp.2_5'Flank|CD3EAP_uc002pbr.1_Missense_Mutation_p.G60R	p.G58R	NM_012099	NP_036231	O15446	RPA34_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0251)	3	660	+		all_neural(266;0.224)|Ovarian(192;0.231)	58					Q32N11|Q7Z5U2|Q9UPF6	Missense_Mutation	SNP	ENST00000309424.3	37	c.172G>A	CCDS12661.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.262065	0.59431	.	.	ENSG00000117877	ENST00000309424	T	0.23754	1.89	4.94	4.94	0.65067	.	0.074858	0.53938	D	0.000050	T	0.47764	0.1463	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.48525	-0.9028	10	0.87932	D	0	-30.6828	13.6627	0.62376	0.0:0.0:1.0:0.0	.	60;58	O15446-2;O15446	.;RPA34_HUMAN	R	58	ENSP00000310966:G58R	ENSP00000310966:G58R	G	+	1	0	CD3EAP	50603238	0.998000	0.40836	0.780000	0.31762	0.560000	0.35617	4.171000	0.58236	2.287000	0.76781	0.462000	0.41574	GGG		0.507	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459538.1	NM_012099		38	99	0	0	0	0.021022	0	38	99				
FCGRT	2217	broad.mit.edu	37	19	50027842	50027842	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:50027842A>G	ENST00000221466.5	+	5	1166	c.680A>G	c.(679-681)tAc>tGc	p.Y227C	FCGRT_ENST00000599988.1_Intron|FCGRT_ENST00000594823.1_3'UTR|FCGRT_ENST00000596975.1_Missense_Mutation_p.Y135C|FCGRT_ENST00000426395.3_Missense_Mutation_p.Y227C	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	227	Alpha-3.|Ig-like C1-type.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		TTCTCCTTCTACCCTCCGGAG	0.652																																							uc002poe.2		NA																	0				ovary(1)	1						c.(679-681)TAC>TGC		Fc fragment of IgG, receptor, transporter, alpha							72.0	63.0	66.0					19																	50027842		2203	4300	6503	SO:0001583	missense	2217				antigen processing and presentation|female pregnancy|immune response	integral to membrane|MHC class I protein complex	IgG binding|receptor activity	g.chr19:50027842A>G	U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.680A>G	19.37:g.50027842A>G	ENSP00000221466:p.Tyr227Cys					FCGRT_uc002pod.2_RNA|FCGRT_uc002pog.2_Missense_Mutation_p.Y227C|FCGRT_uc002pof.1_Missense_Mutation_p.Y132C|FCGRT_uc010yax.1_3'UTR|FCGRT_uc002poh.1_Missense_Mutation_p.Y87C|FCGRT_uc002poi.2_5'Flank	p.Y227C	NM_001136019	NP_001129491	P55899	FCGRN_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)	5	1166	+		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)	227			Extracellular (Potential).|Alpha-3.		Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	37	c.680A>G	CCDS12770.1	.	.	.	.	.	.	.	.	.	.	A	14.83	2.651121	0.47362	.	.	ENSG00000104870	ENST00000221466;ENST00000426395	T;T	0.04317	3.65;3.65	4.37	2.06	0.26882	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.184673	0.26654	N	0.023189	T	0.24890	0.0604	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01570	-1.1322	10	0.87932	D	0	.	6.5495	0.22425	0.6117:0.0:0.0:0.3883	.	227	P55899	FCGRN_HUMAN	C	227	ENSP00000221466:Y227C;ENSP00000410798:Y227C	ENSP00000221466:Y227C	Y	+	2	0	FCGRT	54719654	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	0.597000	0.24059	0.799000	0.34018	0.379000	0.24179	TAC		0.652	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1			16	57	0	0	0	0.003163	0	16	57				
KLK8	11202	broad.mit.edu	37	19	51499449	51499449	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:51499449C>A	ENST00000600767.1	-	7	1138	c.649G>T	c.(649-651)Gtg>Ttg	p.V217L	CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000347619.4_Missense_Mutation_p.V76L|KLK8_ENST00000391806.2_Missense_Mutation_p.V262L|KLK8_ENST00000320838.5_Missense_Mutation_p.G31V|KLK8_ENST00000598195.1_5'UTR|KLK8_ENST00000291726.7_Missense_Mutation_p.V217L|KLK8_ENST00000593490.1_Missense_Mutation_p.G31V			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	217	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		CCATCACACACCAGGGGGCCT	0.572																																							uc002pur.1		NA																	0				central_nervous_system(1)	1						c.(649-651)GTG>TTG		kallikrein 8 isoform 1 preproprotein							111.0	90.0	97.0					19																	51499449		2203	4300	6503	SO:0001583	missense	11202				cell death|keratinocyte proliferation|memory|negative regulation of axon regeneration|negative regulation of myelination|neuron projection morphogenesis|proteolysis|regulation of synapse organization|response to wounding	cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity	g.chr19:51499449C>A	AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.649G>T	19.37:g.51499449C>A	ENSP00000472016:p.Val217Leu					KLK8_uc002puq.1_Missense_Mutation_p.V262L|KLK8_uc002pus.1_Missense_Mutation_p.V76L|KLK8_uc002put.1_Missense_Mutation_p.G31V|KLK8_uc002puu.1_Missense_Mutation_p.V217L|KLK9_uc002puv.1_RNA	p.V217L	NM_007196	NP_009127	O60259	KLK8_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)	6	828	-		all_neural(266;0.026)	217			Peptidase S1.		Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Missense_Mutation	SNP	ENST00000600767.1	37	c.649G>T	CCDS12813.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.82|11.82	1.751970|1.751970	0.31046|0.31046	.|.	.|.	ENSG00000129455|ENSG00000129455	ENST00000320838|ENST00000391806;ENST00000291726;ENST00000347619	.|D;D;D	.|0.89810	.|-2.57;-2.57;-2.57	4.66|4.66	4.66|4.66	0.58398|0.58398	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.|0.000000	.|0.39834	.|N	.|0.001254	D|D	0.94188|0.94188	0.8135|0.8135	.|.	.|.	.|.	0.54753|0.54753	D|D	0.999985|0.999985	D|D;D;D	0.89917|0.89917	1.0|1.0;0.998;0.99	D|D;D;D	0.97110|0.81914	1.0|0.995;0.98;0.921	D|D	0.94593|0.94593	0.7789|0.7789	7|9	0.87932|0.66056	D|D	0|0.02	.|.	15.4395|15.4395	0.75171|0.75171	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	31|76;217;262	O60259-4|O60259-3;O60259;O60259-2	.|.;KLK8_HUMAN;.	V|L	31|262;217;76	.|ENSP00000375682:V262L;ENSP00000291726:V217L;ENSP00000341555:V76L	ENSP00000325072:G31V|ENSP00000291726:V217L	G|V	-|-	2|1	0|0	KLK8|KLK8	56191261|56191261	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.522000|0.522000	0.34438|0.34438	2.437000|2.437000	0.44828|0.44828	2.569000|2.569000	0.86673|0.86673	0.563000|0.563000	0.77884|0.77884	GGT|GTG		0.572	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465032.2	NM_007196		32	82	1	0	1.08312e-15	0.009535	1.36427e-15	32	82				
ZNF525	170958	broad.mit.edu	37	19	53884844	53884844	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:53884844C>T	ENST00000355326.3	+	1	166	c.166C>T	c.(166-168)Cag>Tag	p.Q56*	ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000474037.1_Nonsense_Mutation_p.Q338*|ZNF525_ENST00000467003.1_Nonsense_Mutation_p.Q302*|ZNF525_ENST00000475179.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525	56					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						GACCTTTAGTCAGAAGTCATA	0.393																																							uc010eqn.2		NA																	0					0						c.(904-906)CAG>TAG		Homo sapiens cDNA FLJ39718 fis, clone SMINT2013695.																																				SO:0001587	stop_gained	170958							g.chr19:53884844C>T	AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000355326.3:c.166C>T	19.37:g.53884844C>T	ENSP00000408929:p.Gln56*					ZNF525_uc002qbl.2_Intron|ZNF765_uc010ydx.1_Intron	p.Q302*	NR_003699						4	1097	+								Q8TF23	Nonsense_Mutation	SNP	ENST00000355326.3	37	c.904C>T		.	.	.	.	.	.	.	.	.	.	C	9.684	1.150212	0.21371	.	.	ENSG00000203326	ENST00000474037;ENST00000467003;ENST00000355326	.	.	.	1.81	-3.63	0.04529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	5.9055	0.18998	0.3905:0.3738:0.2357:0.0	.	.	.	.	X	338;302;56	.	ENSP00000408929:Q56X	Q	+	1	0	ZNF525	58576656	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-5.962000	0.00088	-1.917000	0.01074	0.298000	0.19748	CAG		0.393	ZNF525-201	KNOWN	basic	protein_coding	protein_coding		NR_003699		4	58	0	0	0	0.009096	0	4	58				
GP6	51206	broad.mit.edu	37	19	55526339	55526339	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:55526339C>A	ENST00000417454.1	-	8	997	c.970G>T	c.(970-972)Ggt>Tgt	p.G324C	CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000333884.2_Missense_Mutation_p.G306C|GP6_ENST00000310373.3_Missense_Mutation_p.G325V|CTC-550B14.7_ENST00000586845.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)	324					blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		CCATCCTGACCCCCGTTTGAT	0.667																																							uc002qik.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(970-972)GGT>TGT		glycoprotein VI (platelet) isoform 2							25.0	30.0	28.0					19																	55526339		2006	4165	6171	SO:0001583	missense	51206				enzyme linked receptor protein signaling pathway|leukocyte migration|platelet activation	integral to plasma membrane	collagen binding|transmembrane receptor activity	g.chr19:55526339C>A	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.970G>T	19.37:g.55526339C>A	ENSP00000394922:p.Gly324Cys					GP6_uc002qil.2_Missense_Mutation_p.G325V|GP6_uc010esq.2_Missense_Mutation_p.G306C	p.G324C	NM_016363	NP_057447	Q9HCN6	GPVI_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)	8	998	-			324			Cytoplasmic (Potential).		Q9HCN7|Q9UIF2	Missense_Mutation	SNP	ENST00000417454.1	37	c.970G>T	CCDS46184.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.197|7.197	0.592697|0.592697	0.13875|0.13875	.|.	.|.	ENSG00000088053|ENSG00000088053	ENST00000417454;ENST00000333884|ENST00000310373	T;T|T	0.00515|0.00587	6.96;6.87|6.38	2.43|2.43	-3.07|-3.07	0.05363|0.05363	.|.	.|.	.|.	.|.	.|.	T|T	0.00412|0.00412	0.0013|0.0013	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B;B|B	0.02656|0.16396	0.0;0.0|0.017	B;B|B	0.01281|0.16289	0.0;0.0|0.015	T|T	0.47861|0.47861	-0.9084|-0.9084	8|8	0.46703|0.72032	T|D	0.11|0.01	.|.	0.4398|0.4398	0.00484|0.00484	0.2663:0.1818:0.1359:0.416|0.2663:0.1818:0.1359:0.416	.|.	306;324|325	Q9HCN6-2;Q9HCN6|Q9HCN6-3	.;GPVI_HUMAN|.	C|V	324;306|325	ENSP00000394922:G324C;ENSP00000334552:G306C|ENSP00000308782:G325V	ENSP00000334552:G306C|ENSP00000308782:G325V	G|G	-|-	1|2	0|0	GP6|GP6	60218151|60218151	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-2.685000|-2.685000	0.00834|0.00834	-0.925000|-0.925000	0.03775|0.03775	-1.334000|-1.334000	0.01262|0.01262	GGT|GGG		0.667	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1			9	16	1	0	0.000673444	0.008291	0.000696991	9	16				
ZIK1	284307	broad.mit.edu	37	19	58101402	58101402	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:58101402G>A	ENST00000597850.1	+	4	438	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	ZIK1_ENST00000307468.4_Missense_Mutation_p.M19I|ZIK1_ENST00000599456.1_Missense_Mutation_p.E20K|ZIK1_ENST00000536878.2_Missense_Mutation_p.E62K	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	75	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AACAGAGGATGAAGAGACACC	0.463																																							uc002qpg.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(223-225)GAA>AAA		zinc finger protein interacting with K protein							83.0	72.0	76.0					19																	58101402		2203	4300	6503	SO:0001583	missense	284307				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58101402G>A	AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.223G>A	19.37:g.58101402G>A	ENSP00000472867:p.Glu75Lys					ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.E20K|ZIK1_uc002qpi.2_Missense_Mutation_p.E62K|ZIK1_uc002qpj.2_5'UTR	p.E75K	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	4	320	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	75			KRAB.		O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	c.223G>A	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.411466	0.25465	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.00801	5.68	2.97	1.93	0.25924	Krueppel-associated box (3);	.	.	.	.	T	0.01029	0.0034	N	0.17379	0.485	0.09310	N	1	B;D	0.56521	0.1;0.976	B;P	0.50049	0.021;0.629	T	0.57877	-0.7735	9	0.30078	T	0.28	.	6.0217	0.19632	0.1443:0.0:0.8557:0.0	.	62;75	F5H435;Q3SY52	.;ZIK1_HUMAN	K	62;56;75	ENSP00000438487:E62K	ENSP00000303820:E75K	E	+	1	0	ZIK1	62793214	0.000000	0.05858	0.006000	0.13384	0.871000	0.50021	0.124000	0.15728	0.820000	0.34516	0.555000	0.69702	GAA		0.463	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879		7	37	0	0	0	0.001984	0	7	37				
NT5C1B	93034	broad.mit.edu	37	2	18764221	18764221	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:18764221C>G	ENST00000359846.2	-	7	1191	c.1114G>C	c.(1114-1116)Gat>Cat	p.D372H	NT5C1B_ENST00000460052.1_5'Flank|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.D372H|NT5C1B_ENST00000600945.1_Missense_Mutation_p.D372H|NT5C1B_ENST00000304081.4_Missense_Mutation_p.D312H|RNU6-1215P_ENST00000384441.1_RNA	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	372					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TCCTGTTCATCAGGATATAGA	0.438																																							uc002rcz.2		NA																	0				skin(2)|ovary(1)	3						c.(1114-1116)GAT>CAT		5' nucleotidase, cytosolic IB isoform 1							129.0	118.0	122.0					2																	18764221		2203	4300	6503	SO:0001583	missense	93034				purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding	g.chr2:18764221C>G	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.1114G>C	2.37:g.18764221C>G	ENSP00000352904:p.Asp372His					NT5C1B_uc002rcy.2_Missense_Mutation_p.D372H|NT5C1B_uc010exr.2_Missense_Mutation_p.D314H|NT5C1B_uc010yju.1_Missense_Mutation_p.D312H|NT5C1B_uc002rda.2_Missense_Mutation_p.D312H|NT5C1B_uc010yjv.1_Missense_Mutation_p.D389H|NT5C1B_uc010yjw.1_Missense_Mutation_p.D355H|NT5C1B_uc010exs.2_Missense_Mutation_p.D374H	p.D372H	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN			7	1218	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)	372					B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	37	c.1114G>C	CCDS33150.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.50|17.50	3.405694|3.405694	0.62288|0.62288	.|.	.|.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013|ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846|ENST00000418427	D|.	0.90133|.	-2.62|.	6.13|6.13	0.338|0.338	0.15974|0.15974	.|.	0.580802|.	0.19948|.	N|.	0.102490|.	T|.	0.73063|.	0.3539|.	M|M	0.83953|0.83953	2.67|2.67	0.38089|0.38089	D|D	0.936896|0.936896	P;P;D;P;P;P;P;P|.	0.57257|.	0.916;0.916;0.979;0.916;0.901;0.952;0.916;0.951|.	P;P;P;P;P;P;P;P|.	0.59761|.	0.824;0.824;0.863;0.756;0.824;0.784;0.824;0.672|.	T|.	0.75210|.	-0.3398|.	10|.	0.72032|.	D|.	0.01|.	-15.673|-15.673	11.5227|11.5227	0.50560|0.50560	0.0:0.6342:0.0:0.3658|0.0:0.6342:0.0:0.3658	.|.	355;389;312;355;314;312;372;372|.	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-2;Q96P26;Q96P26-4|.	.;.;.;.;.;.;5NT1B_HUMAN;.|.	H|S	372;314;312;372|26	ENSP00000412639:D314H|.	ENSP00000305979:D312H|.	D|X	-|-	1|2	0|2	NT5C1B-RDH14;NT5C1B|NT5C1B	18627702|18627702	0.896000|0.896000	0.30565|0.30565	0.971000|0.971000	0.41717|0.41717	0.863000|0.863000	0.49368|0.49368	1.377000|1.377000	0.34317|0.34317	0.111000|0.111000	0.17947|0.17947	-0.355000|-0.355000	0.07637|0.07637	GAT|TGA		0.438	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1			16	55	0	0	0	0.00499	0	16	55				
PUM2	23369	broad.mit.edu	37	2	20455932	20455932	+	Splice_Site	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:20455932C>T	ENST00000361078.2	-	16	2513		c.e16-1		PUM2_ENST00000338086.5_Splice_Site|PUM2_ENST00000319801.5_Splice_Site|PUM2_ENST00000536417.1_Splice_Site|PUM2_ENST00000403432.1_Splice_Site			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2						regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATTTCACTCTGCAAAAGAC	0.313																																							uc002rds.1		NA																	0				ovary(1)	1						c.e16-1		pumilio homolog 2							144.0	133.0	137.0					2																	20455932		2203	4300	6503	SO:0001630	splice_region_variant	23369				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding	g.chr2:20455932C>T	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.2491-1G>A	2.37:g.20455932C>T						PUM2_uc002rdq.1_Splice_Site_p.S208_splice|PUM2_uc002rdt.1_Splice_Site_p.S829_splice|PUM2_uc002rdr.2_Splice_Site_p.S689_splice|PUM2_uc010yjy.1_Splice_Site_p.S750_splice|PUM2_uc002rdu.1_Splice_Site_p.S829_splice|PUM2_uc010yjz.1_Splice_Site_p.S768_splice	p.S829_splice	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN			16	2508	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Splice_Site	SNP	ENST00000361078.2	37	c.2485_splice		.	.	.	.	.	.	.	.	.	.	C	24.7	4.564310	0.86335	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1605	0.93529	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PUM2	20319413	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.814000	0.86154	2.501000	0.84356	0.650000	0.86243	.		0.313	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	Intron	13	52	0	0	0	0.020292	0	13	52				
MRPL33	9553	broad.mit.edu	37	2	27997375	27997375	+	Silent	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:27997375T>A	ENST00000296102.3	+	3	187	c.126T>A	c.(124-126)acT>acA	p.T42T	MRPL33_ENST00000379666.3_Intron|MRPL33_ENST00000483992.1_Intron	NM_004891.3	NP_004882.1	O75394	RM33_HUMAN	mitochondrial ribosomal protein L33	42					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(172;0.155)					AAAAACTGACTCTTTTGCATT	0.458																																							uc002rlm.1		NA																	0					0						c.(124-126)ACT>ACA		mitochondrial ribosomal protein L33 isoform a							107.0	109.0	108.0					2																	27997375		2203	4300	6503	SO:0001819	synonymous_variant	9553				translation	mitochondrion|ribosome	structural constituent of ribosome	g.chr2:27997375T>A	AB051623	CCDS1761.1, CCDS33167.1	2p21	2012-09-13			ENSG00000243147	ENSG00000243147		"""Mitochondrial ribosomal proteins / large subunits"""	14487	protein-coding gene	gene with protein product		610059		C2orf1			Standard	NM_145330		Approved	RPL33L	uc002rlm.1	O75394	OTTHUMG00000097795	ENST00000296102.3:c.126T>A	2.37:g.27997375T>A						MRPL33_uc002rln.1_Intron	p.T42T	NM_004891	NP_004882	O75394	RM33_HUMAN			3	187	+	Acute lymphoblastic leukemia(172;0.155)		42					Q53RZ6|Q5FVE3|Q96Q50	Silent	SNP	ENST00000296102.3	37	c.126T>A	CCDS1761.1																																																																																				0.458	MRPL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215049.1	NM_004891		19	72	0	0	0	0.008871	0	19	72				
CRIM1	51232	broad.mit.edu	37	2	36691736	36691736	+	Missense_Mutation	SNP	G	G	A	rs199612229		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:36691736G>A	ENST00000280527.2	+	5	1296	c.929G>A	c.(928-930)cGc>cAc	p.R310H		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	310					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TCCACTCCCCGCATAGTCTCT	0.483																																							uc002rpd.2		NA																	0				ovary(2)|skin(1)	3						c.(928-930)CGC>CAC		cysteine-rich motor neuron 1 precursor		G	HIS/ARG	0,4406		0,0,2203	278.0	254.0	262.0		929	5.9	1.0	2		262	1,8599	1.2+/-3.3	0,1,4299	no	missense	CRIM1	NM_016441.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	310/1037	36691736	1,13005	2203	4300	6503	SO:0001583	missense	51232				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity	g.chr2:36691736G>A	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.929G>A	2.37:g.36691736G>A	ENSP00000280527:p.Arg310His						p.R310H	NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN			5	968	+		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)	310			Extracellular (Potential).		Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	c.929G>A	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780475	0.70222	0.0	1.16E-4	ENSG00000150938	ENST00000280527;ENST00000426856	T	0.04603	3.59	5.94	5.94	0.96194	.	0.128794	0.53938	D	0.000056	T	0.06280	0.0162	L	0.33485	1.01	0.42323	D	0.992262	D	0.60575	0.988	P	0.45506	0.483	T	0.27971	-1.0058	10	0.48119	T	0.1	-33.4706	12.5562	0.56254	0.0832:0.0:0.9168:0.0	.	310	Q9NZV1	CRIM1_HUMAN	H	310;202	ENSP00000280527:R310H	ENSP00000280527:R310H	R	+	2	0	CRIM1	36545240	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.397000	0.59690	2.820000	0.97059	0.650000	0.86243	CGC		0.483	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441		32	128	0	0	0	0.009535	0	32	128				
DHX57	90957	broad.mit.edu	37	2	39029995	39029995	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:39029995G>A	ENST00000295373.6	-	23	4005	c.3879C>T	c.(3877-3879)ttC>ttT	p.F1293F		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1293							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				AGTCTCGGATGAATACTCGAC	0.483																																					Melanoma(191;1090 2095 4375 23729 47341)	Melanoma(191;1090 2095 4375 23729 47341)	uc002rrf.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(3877-3879)TTC>TTT		DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57							211.0	198.0	202.0					2																	39029995		2203	4300	6503	SO:0001819	synonymous_variant	90957						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding	g.chr2:39029995G>A	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3879C>T	2.37:g.39029995G>A						DHX57_uc002rrd.3_Silent_p.F632F|DHX57_uc002rre.2_Silent_p.F726F	p.F1293F	NM_198963	NP_945314	Q6P158	DHX57_HUMAN			23	3978	-		all_hematologic(82;0.248)	1293					A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Silent	SNP	ENST00000295373.6	37	c.3879C>T	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	G	6.896	0.534880	0.13188	.	.	ENSG00000163214	ENST00000452978	.	.	.	5.64	3.82	0.43975	.	.	.	.	.	T	0.59770	0.2218	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55023	-0.8205	4	.	.	.	.	9.7417	0.40422	0.2142:0.0:0.7858:0.0	.	.	.	.	Y	572	.	.	H	-	1	0	DHX57	38883499	1.000000	0.71417	0.997000	0.53966	0.727000	0.41649	4.007000	0.57093	0.717000	0.32145	0.455000	0.32223	CAT		0.483	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646		5	151	0	0	0	0.014758	0	5	151				
SOS1	6654	broad.mit.edu	37	2	39281778	39281778	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:39281778T>A	ENST00000426016.1	-	6	783	c.697A>T	c.(697-699)Aat>Tat	p.N233Y	SOS1_ENST00000395038.2_Missense_Mutation_p.N233Y|SOS1_ENST00000402219.2_Missense_Mutation_p.N233Y|SOS1_ENST00000428721.2_Missense_Mutation_p.N176Y			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	233	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N233Y(5)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				AATTTTGAATTGGAGACAAAG	0.299									Noonan syndrome																														uc002rrk.3		NA																	5	Substitution - Missense(5)	p.N233Y(1)	endometrium(3)|lung(2)	ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10						c.(697-699)AAT>TAT		son of sevenless homolog 1							43.0	46.0	45.0					2																	39281778		2202	4288	6490	SO:0001583	missense	6654	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr2:39281778T>A	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.697A>T	2.37:g.39281778T>A	ENSP00000387784:p.Asn233Tyr					SOS1_uc010ynr.1_RNA|SOS1_uc002rrl.2_5'Flank	p.N233Y	NM_005633	NP_005624	Q07889	SOS1_HUMAN			5	738	-		all_hematologic(82;0.21)	233			DH.		A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	c.697A>T	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.275752	0.59649	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.88	5.88	0.94601	Dbl homology (DH) domain (5);	0.215296	0.48767	D	0.000180	D	0.94169	0.8129	L	0.54323	1.7	0.46336	D	0.998998	P	0.52577	0.954	P	0.53450	0.726	D	0.93644	0.6967	10	0.41790	T	0.15	.	16.2792	0.82664	0.0:0.0:0.0:1.0	.	233	Q07889	SOS1_HUMAN	Y	233;233;233;233;176	ENSP00000387784:N233Y;ENSP00000384675:N233Y;ENSP00000378479:N233Y;ENSP00000399992:N176Y	ENSP00000263879:N233Y	N	-	1	0	SOS1	39135282	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.589000	0.61006	2.243000	0.73865	0.533000	0.62120	AAT		0.299	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		17	21	0	0	0	0.004007	0	17	21				
PREPL	9581	broad.mit.edu	37	2	44553939	44553939	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:44553939G>T	ENST00000409936.1	-	11	2095	c.1658C>A	c.(1657-1659)aCa>aAa	p.T553K	PREPL_ENST00000410081.1_Missense_Mutation_p.T553K|PREPL_ENST00000409272.1_Missense_Mutation_p.T553K|PREPL_ENST00000409411.1_Missense_Mutation_p.T464K|PREPL_ENST00000260648.6_Missense_Mutation_p.T553K|PREPL_ENST00000378520.3_Missense_Mutation_p.T487K|PREPL_ENST00000378511.3_Missense_Mutation_p.T491K|PREPL_ENST00000409957.1_Missense_Mutation_p.T464K|PREPL_ENST00000541738.1_Missense_Mutation_p.T464K	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	553						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGTCAGGGTTGTTAGACTTGG	0.502																																							uc002ruf.2		NA																	0				ovary(1)	1						c.(1657-1659)ACA>AAA		prolyl endopeptidase-like isoform C							92.0	82.0	86.0					2																	44553939		2203	4300	6503	SO:0001583	missense	9581				proteolysis	cytosol	serine-type endopeptidase activity	g.chr2:44553939G>T	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.1658C>A	2.37:g.44553939G>T	ENSP00000386543:p.Thr553Lys					PREPL_uc002rug.2_Missense_Mutation_p.T487K|PREPL_uc002ruh.2_Missense_Mutation_p.T491K|PREPL_uc010fax.2_Missense_Mutation_p.T553K|PREPL_uc002rui.3_Missense_Mutation_p.T464K|PREPL_uc002ruj.1_Missense_Mutation_p.T464K|PREPL_uc002ruk.1_Missense_Mutation_p.T553K	p.T553K	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN			10	1693	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	553					A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	37	c.1658C>A	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759392	0.89932	.	.	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511	T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.76	5.76	0.90799	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60235	0.2253	M	0.78456	2.415	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.996	D;D;D	0.77557	0.99;0.941;0.96	T	0.62492	-0.6843	10	0.87932	D	0	-13.065	19.9699	0.97282	0.0:0.0:1.0:0.0	.	491;487;553	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	K	464;464;464;553;553;553;553;487;491	ENSP00000439626:T464K;ENSP00000387095:T464K;ENSP00000387241:T464K;ENSP00000386543:T553K;ENSP00000260648:T553K;ENSP00000386909:T553K;ENSP00000386509:T553K;ENSP00000367781:T487K;ENSP00000367772:T491K	ENSP00000260648:T553K	T	-	2	0	PREPL	44407443	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	9.434000	0.97515	2.730000	0.93505	0.591000	0.81541	ACA		0.502	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036		29	54	1	0	9.39395e-14	0.00632	1.15378e-13	29	54				
PRKCE	5581	broad.mit.edu	37	2	46237565	46237565	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:46237565A>T	ENST00000306156.3	+	10	1673	c.1346A>T	c.(1345-1347)gAc>gTc	p.D449V	PRKCE_ENST00000394874.1_Missense_Mutation_p.D172V	NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	449	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	CAGGATGATGACGTGGACTGC	0.468																																							uc002rut.2		NA																	0				lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10						c.(1345-1347)GAC>GTC		protein kinase C, epsilon							164.0	160.0	161.0					2																	46237565		1929	3899	5828	SO:0001583	missense	5581				activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity	g.chr2:46237565A>T		CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.1346A>T	2.37:g.46237565A>T	ENSP00000306124:p.Asp449Val						p.D449V	NM_005400	NP_005391	Q02156	KPCE_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.171)		10	1543	+		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	449			Protein kinase.		B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	ENST00000306156.3	37	c.1346A>T	CCDS1824.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.802140	0.90538	.	.	ENSG00000171132	ENST00000306156;ENST00000394874	T;T	0.66280	-0.2;-0.2	5.55	5.55	0.83447	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68696	0.3029	N	0.25201	0.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73260	-0.4039	10	0.87932	D	0	.	15.8615	0.79026	1.0:0.0:0.0:0.0	.	449	Q02156	KPCE_HUMAN	V	449;172	ENSP00000306124:D449V;ENSP00000378341:D172V	ENSP00000306124:D449V	D	+	2	0	PRKCE	46091069	1.000000	0.71417	0.885000	0.34714	0.994000	0.84299	9.107000	0.94261	2.333000	0.79357	0.533000	0.62120	GAC		0.468	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2			18	62	0	0	0	0.007413	0	18	62				
GPR75	10936	broad.mit.edu	37	2	54080406	54080407	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:54080406_54080407GC>AA	ENST00000394705.2	-	2	1757_1758	c.1487_1488GC>TT	c.(1486-1488)aGC>aTT	p.S496I	ASB3_ENST00000498475.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ASB3_ENST00000406625.2_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	496					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGTTACATGGGCTGCTCTCCTC	0.46																																							uc002rxo.3		NA																	0				ovary(1)|skin(1)	2						c.(1486-1488)AGC>ATT		G protein-coupled receptor 75																																				SO:0001583	missense	10936					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:54080406_54080407GC>AA	AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.1487_1488delinsAA	2.37:g.54080406_54080407delinsAA	ENSP00000378195:p.Ser496Ile					ASB3_uc002rxi.3_Intron	p.S496I	NM_006794	NP_006785	O95800	GPR75_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		2	1758_1759	-			496			Cytoplasmic (Potential).		B2RC02|Q6NWR2	Missense_Mutation	DNP	ENST00000394705.2	37	c.1487_1488GC>TT	CCDS1849.1																																																																																				0.460	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2			51	158	0	0	0	0.004672	0	51	158				
CTNNA2	1496	broad.mit.edu	37	2	80620354	80620354	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:80620354G>T	ENST00000402739.4	+	7	1080	c.1075G>T	c.(1075-1077)Gga>Tga	p.G359*	CTNNA2_ENST00000540488.1_Nonsense_Mutation_p.G359*|CTNNA2_ENST00000343114.3_Nonsense_Mutation_p.G38*|CTNNA2_ENST00000541047.1_Nonsense_Mutation_p.G359*|CTNNA2_ENST00000466387.1_Nonsense_Mutation_p.G359*|CTNNA2_ENST00000496558.1_Nonsense_Mutation_p.G359*|CTNNA2_ENST00000361291.4_Nonsense_Mutation_p.G393*	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	359					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GAAAGAAAAAGGAGATCCTCT	0.279																																							uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(1075-1077)GGA>TGA		catenin, alpha 2 isoform 1							89.0	85.0	86.0					2																	80620354		1821	4075	5896	SO:0001587	stop_gained	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80620354G>T		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1075G>T	2.37:g.80620354G>T	ENSP00000384638:p.Gly359*					CTNNA2_uc010yse.1_Nonsense_Mutation_p.G359*|CTNNA2_uc010ysf.1_Nonsense_Mutation_p.G359*|CTNNA2_uc010ysg.1_Nonsense_Mutation_p.G359*|CTNNA2_uc010ysi.1_Translation_Start_Site	p.G359*	NM_004389	NP_004380	P26232	CTNA2_HUMAN			7	1080	+			359					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Nonsense_Mutation	SNP	ENST00000402739.4	37	c.1075G>T		.	.	.	.	.	.	.	.	.	.	G	41	9.074984	0.99057	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8137	0.96557	0.0:0.0:1.0:0.0	.	.	.	.	X	359;359;393;359;359;359;38;24	.	.	G	+	1	0	CTNNA2	80473865	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.949000	0.56668	2.780000	0.95670	0.655000	0.94253	GGA		0.279	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		17	58	1	0	3.51602e-12	0.008871	4.23065e-12	17	58				
UGGT1	56886	broad.mit.edu	37	2	128938565	128938565	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:128938565C>T	ENST00000259253.6	+	36	4049	c.4002C>T	c.(4000-4002)atC>atT	p.I1334I	UGGT1_ENST00000375990.3_Silent_p.I1310I	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1334	Glucosyltransferase. {ECO:0000250}.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AACAGCGTATCATCTGGGGTT	0.428																																							uc002tps.2		NA																	0				ovary(1)	1						c.(4000-4002)ATC>ATT		UDP-glucose ceramide glucosyltransferase-like 1							201.0	182.0	189.0					2																	128938565		2203	4300	6503	SO:0001819	synonymous_variant	56886				'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding	g.chr2:128938565C>T	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.4002C>T	2.37:g.128938565C>T						UGGT1_uc002tpr.2_Silent_p.I1310I	p.I1334I	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN			36	4180	+			1334			Glucosyltransferase (By similarity).		Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Silent	SNP	ENST00000259253.6	37	c.4002C>T	CCDS2154.1																																																																																				0.428	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120		4	88	0	0	0	0.009096	0	4	88				
NCKAP5	344148	broad.mit.edu	37	2	133540014	133540014	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:133540014G>T	ENST00000409261.1	-	14	4743	c.4370C>A	c.(4369-4371)aCc>aAc	p.T1457N	NCKAP5_ENST00000317721.6_Missense_Mutation_p.T1457N|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1457										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ATCAGTCGCGGTTGCAGAGGC	0.512																																							uc002ttp.2		NA																	0					0						c.(4369-4371)ACC>AAC		Nck-associated protein 5 isoform 1							53.0	52.0	52.0					2																	133540014		1928	4129	6057	SO:0001583	missense	344148						protein binding	g.chr2:133540014G>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4370C>A	2.37:g.133540014G>T	ENSP00000387128:p.Thr1457Asn					NCKAP5_uc002ttq.2_Intron	p.T1457N	NM_207363	NP_997246	O14513	NCKP5_HUMAN			14	4744	-			1457					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.4370C>A	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	9.201	1.028520	0.19512	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10288	2.89;2.89	5.18	4.3	0.51218	.	0.604547	0.13411	U	0.389863	T	0.11367	0.0277	L	0.29908	0.895	0.19300	N	0.999976	D	0.65815	0.995	P	0.52217	0.693	T	0.23833	-1.0177	10	0.39692	T	0.17	.	3.8738	0.09048	0.087:0.1615:0.5834:0.1681	.	1457	O14513	NCKP5_HUMAN	N	1457	ENSP00000387128:T1457N;ENSP00000380603:T1457N	ENSP00000380603:T1457N	T	-	2	0	NCKAP5	133256484	0.004000	0.15560	0.040000	0.18447	0.153000	0.21895	1.161000	0.31773	2.854000	0.98071	0.655000	0.94253	ACC		0.512	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		16	51	1	0	2.31682e-05	0.003163	2.48471e-05	16	51				
ARL6IP6	151188	broad.mit.edu	37	2	153575479	153575479	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:153575479C>T	ENST00000326446.5	+	1	1052	c.341C>T	c.(340-342)tCg>tTg	p.S114L	PRPF40A_ENST00000410080.1_5'Flank|PRPF40A_ENST00000486100.1_5'Flank	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6	114						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						ATTCTCTGCTCGCTGCTCTTC	0.587																																							uc002tyn.2		NA																	0					0						c.(340-342)TCG>TTG		ADP-ribosylation-like factor 6 interacting							73.0	70.0	71.0					2																	153575479		2199	4295	6494	SO:0001583	missense	151188					integral to membrane		g.chr2:153575479C>T	AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901	ENST00000326446.5:c.341C>T	2.37:g.153575479C>T	ENSP00000315357:p.Ser114Leu					ARL6IP6_uc002tym.2_Intron|ARL6IP6_uc002tyo.2_5'Flank|PRPF40A_uc002tyh.3_5'Flank|PRPF40A_uc010zcd.1_5'Flank|PRPF40A_uc002tyi.2_5'Flank|PRPF40A_uc002tyj.2_5'Flank|PRPF40A_uc002tyl.1_5'Flank	p.S114L	NM_152522	NP_689735	Q8N6S5	AR6P6_HUMAN			1	1057	+			114			Helical; (Potential).		B2RDS6|Q7Z4G7	Missense_Mutation	SNP	ENST00000326446.5	37	c.341C>T	CCDS2197.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727938	0.48833	.	.	ENSG00000177917	ENST00000326446	.	.	.	4.71	4.71	0.59529	.	0.315686	0.25657	N	0.029180	T	0.52996	0.1769	M	0.67953	2.075	0.41151	D	0.986023	P	0.39920	0.695	B	0.35899	0.213	T	0.61237	-0.7103	9	0.62326	D	0.03	-7.6192	10.96	0.47379	0.0:0.8109:0.1891:0.0	.	114	Q8N6S5	AR6P6_HUMAN	L	114	.	ENSP00000315357:S114L	S	+	2	0	ARL6IP6	153283725	1.000000	0.71417	0.988000	0.46212	0.895000	0.52256	2.409000	0.44583	2.449000	0.82847	0.655000	0.94253	TCG		0.587	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522		22	56	0	0	0	0.014323	0	22	56				
PPIG	9360	broad.mit.edu	37	2	170471176	170471176	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:170471176C>T	ENST00000260970.3	+	9	709	c.489C>T	c.(487-489)agC>agT	p.S163S	PPIG_ENST00000409714.3_Silent_p.S148S|PPIG_ENST00000462903.1_Silent_p.S163S|PPIG_ENST00000448752.2_Silent_p.S163S	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	163	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	ATGCAGCTAGCAAACCGTTTG	0.378																																							uc002uez.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(487-489)AGC>AGT		peptidylprolyl isomerase G	L-Proline(DB00172)						120.0	126.0	124.0					2																	170471176		2203	4300	6503	SO:0001819	synonymous_variant	9360				protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr2:170471176C>T	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.489C>T	2.37:g.170471176C>T						PPIG_uc010fpx.2_Silent_p.S148S|PPIG_uc010fpy.2_Silent_p.S159S|PPIG_uc002ufa.2_Silent_p.S163S|PPIG_uc002ufb.2_Silent_p.S163S|PPIG_uc002ufc.1_Silent_p.S163S|PPIG_uc002ufd.2_Silent_p.S163S	p.S163S	NM_004792	NP_004783	Q13427	PPIG_HUMAN			9	709	+			163			PPIase cyclophilin-type.		D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Silent	SNP	ENST00000260970.3	37	c.489C>T	CCDS2235.1																																																																																				0.378	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2			4	94	0	0	0	0.001168	0	4	94				
DNAH7	56171	broad.mit.edu	37	2	196729356	196729356	+	Silent	SNP	C	C	A	rs375086705		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:196729356C>A	ENST00000312428.6	-	41	7123	c.7023G>T	c.(7021-7023)ggG>ggT	p.G2341G		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2341	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCCCTCCAACCCCTACTAGGA	0.473																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(7021-7023)GGG>GGT		dynein, axonemal, heavy chain 7		C		0,3888		0,0,1944	86.0	85.0	85.0		7023	-9.5	0.0	2		85	1,8321		0,1,4160	no	coding-synonymous	DNAH7	NM_018897.2		0,1,6104	AA,AC,CC		0.012,0.0,0.0082		2341/4025	196729356	1,12209	1944	4161	6105	SO:0001819	synonymous_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196729356C>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.7023G>T	2.37:g.196729356C>A							p.G2341G	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN			41	7124	-			2341			ATP (Potential).|AAA 4 (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	c.7023G>T	CCDS42794.1																																																																																				0.473	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		20	49	1	0	2.94398e-08	0.007413	3.33877e-08	20	49				
SMARCAL1	50485	broad.mit.edu	37	2	217347624	217347624	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:217347624C>T	ENST00000357276.4	+	18	3119	c.2789C>T	c.(2788-2790)tCa>tTa	p.S930L	AC098820.4_ENST00000414135.1_RNA|AC098820.3_ENST00000453157.1_RNA|SMARCAL1_ENST00000358207.5_Missense_Mutation_p.S930L	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	930					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GATGAAAGCTCATTGACAGCC	0.448									Schimke Immuno-Osseous Dysplasia																														uc002vgc.3		NA																	0				ovary(3)|breast(3)|skin(1)	7						c.(2788-2790)TCA>TTA		SWI/SNF-related matrix-associated							104.0	112.0	109.0					2																	217347624		2203	4300	6503	SO:0001583	missense	50485	Schimke_Immuno-Osseous_Dysplasia	Familial Cancer Database	SIOD	chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity	g.chr2:217347624C>T	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2789C>T	2.37:g.217347624C>T	ENSP00000349823:p.Ser930Leu					SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.S930L|SMARCAL1_uc010fvg.2_Missense_Mutation_p.S908L	p.S930L	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)	18	3119	+		Renal(323;0.0458)	930					A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	c.2789C>T	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	9.068	0.996268	0.19043	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;D	0.85773	-2.02;-2.02;-2.03	4.16	2.28	0.28536	.	0.890009	0.09550	N	0.787037	T	0.66982	0.2845	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.51787	-0.8661	10	0.10902	T	0.67	-0.2103	6.4917	0.22119	0.1781:0.727:0.0:0.0949	.	930	Q9NZC9	SMAL1_HUMAN	L	930;930;772	ENSP00000349823:S930L;ENSP00000350940:S930L;ENSP00000375974:S772L	ENSP00000349823:S930L	S	+	2	0	SMARCAL1	217055869	0.000000	0.05858	0.000000	0.03702	0.426000	0.31534	-0.429000	0.06982	0.464000	0.27142	0.563000	0.77884	TCA		0.448	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2			6	157	0	0	0	0.001984	0	6	157				
ATG9A	79065	broad.mit.edu	37	2	220090255	220090255	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:220090255G>A	ENST00000409618.1	-	6	691	c.252C>T	c.(250-252)gtC>gtT	p.V84V	ATG9A_ENST00000396761.2_Silent_p.V84V|ATG9A_ENST00000409422.1_Silent_p.V23V|ATG9A_ENST00000361242.4_Silent_p.V84V|ATG9A_ENST00000488833.1_5'Flank|AC068946.1_ENST00000408417.1_RNA			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	84					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCACGCAGCTGACCAGGAAGG	0.537																																							uc002vke.1		NA																	0				skin(1)	1						c.(250-252)GTC>GTT		APG9 autophagy 9-like 1							93.0	98.0	96.0					2																	220090255		2060	4220	6280	SO:0001819	synonymous_variant	79065				autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane		g.chr2:220090255G>A	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.252C>T	2.37:g.220090255G>A						ATG9A_uc002vkd.1_RNA|ATG9A_uc002vkf.1_Silent_p.V84V	p.V84V	NM_001077198	NP_001070666	Q7Z3C6	ATG9A_HUMAN		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	6	438	-		Renal(207;0.0474)	84			Helical; (Potential).		Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Silent	SNP	ENST00000409618.1	37	c.252C>T	CCDS42820.1																																																																																				0.537	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085		20	57	0	0	0	0.008871	0	20	57				
RTP5	285093	broad.mit.edu	37	2	242814574	242814574	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr2:242814574C>T	ENST00000343216.3	+	2	895	c.867C>T	c.(865-867)ctC>ctT	p.L289L		NM_173821.2	NP_776182.2																					AGGGCTTCCTCTTCAAAGGCC	0.677																																							uc010fzu.1		NA																	0				ovary(1)	1						c.(865-867)CTC>CTT		hypothetical protein LOC285093							42.0	47.0	45.0					2																	242814574		1906	4113	6019	SO:0001819	synonymous_variant	285093					integral to membrane		g.chr2:242814574C>T																												ENST00000343216.3:c.867C>T	2.37:g.242814574C>T							p.L289L	NM_173821	NP_776182	Q14D33	CB085_HUMAN			2	890	+			289						Silent	SNP	ENST00000343216.3	37	c.867C>T	CCDS42843.1																																																																																				0.677	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1			13	99	0	0	0	0.013537	0	13	99				
SLC4A11	83959	broad.mit.edu	37	20	3209242	3209242	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr20:3209242G>A	ENST00000380056.3	-	17	2399	c.2352C>T	c.(2350-2352)ctC>ctT	p.L784L	SLC4A11_ENST00000539553.2_Silent_p.L768L|SLC4A11_ENST00000488544.1_5'Flank|SLC4A11_ENST00000380059.3_Silent_p.L811L	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	784	Membrane (bicarbonate transporter).			L -> R (in Ref. 5; AAI10541). {ECO:0000305}.	bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						AGAGGCCATAGAGCACGGGCT	0.667																																					NSCLC(190;922 2139 10266 10292 38692)	NSCLC(190;922 2139 10266 10292 38692)	uc002wig.2		NA																	0				ovary(1)	1						c.(2350-2352)CTC>CTT		solute carrier family 4 member 11							77.0	69.0	72.0					20																	3209242		2203	4300	6503	SO:0001819	synonymous_variant	83959				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity	g.chr20:3209242G>A	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.2352C>T	20.37:g.3209242G>A						SLC4A11_uc010zqe.1_Silent_p.L811L|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Silent_p.L768L	p.L784L	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN			17	2400	-			784	L -> R (in Ref. 3; AAI10541).		Helical; (Potential).|Membrane (bicarbonate transporter).		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Silent	SNP	ENST00000380056.3	37	c.2352C>T	CCDS13052.1																																																																																				0.667	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			4	88	0	0	0	0.009096	0	4	88				
CDC25B	994	broad.mit.edu	37	20	3782967	3782967	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr20:3782967G>A	ENST00000245960.5	+	11	1835	c.1138G>A	c.(1138-1140)Gag>Aag	p.E380K	CDC25B_ENST00000340833.4_Missense_Mutation_p.E339K|CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000344256.6_Missense_Mutation_p.E316K|CDC25B_ENST00000439880.2_Missense_Mutation_p.E366K|CDC25B_ENST00000379598.5_Missense_Mutation_p.E289K	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	380					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						GTGTCACGATGAGATCGAGAA	0.582																																							uc002wjn.2		NA																	0				lung(3)|ovary(2)	5						c.(1138-1140)GAG>AAG		cell division cycle 25B isoform 1							70.0	67.0	68.0					20																	3782967		2203	4300	6503	SO:0001583	missense	994				cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of cell proliferation	cytosol|microtubule organizing center|nucleoplasm	protein binding|protein tyrosine phosphatase activity	g.chr20:3782967G>A		CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1138G>A	20.37:g.3782967G>A	ENSP00000245960:p.Glu380Lys					CDC25B_uc010zqk.1_Missense_Mutation_p.E316K|CDC25B_uc010zql.1_Missense_Mutation_p.E302K|CDC25B_uc010zqm.1_Missense_Mutation_p.E289K|CDC25B_uc002wjl.2_Missense_Mutation_p.E268K|CDC25B_uc002wjm.2_Missense_Mutation_p.E268K|CDC25B_uc002wjo.2_Missense_Mutation_p.E366K|CDC25B_uc002wjp.2_Missense_Mutation_p.E339K|CDC25B_uc002wjq.2_Missense_Mutation_p.E180K|CDC25B_uc010gbc.2_5'Flank	p.E380K	NM_021873	NP_068659	P30305	MPIP2_HUMAN			11	1916	+			380					D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	ENST00000245960.5	37	c.1138G>A	CCDS13067.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764531	0.49574	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	4.81	3.87	0.44632	.	0.581161	0.17317	N	0.178643	T	0.29028	0.0721	M	0.61703	1.905	0.31527	N	0.661657	B;B;B;B;B;P	0.37207	0.126;0.112;0.126;0.031;0.103;0.587	B;B;B;B;B;B	0.42959	0.097;0.15;0.097;0.036;0.059;0.403	T	0.23940	-1.0174	10	0.28530	T	0.3	-16.4922	7.6713	0.28460	0.1942:0.0:0.8058:0.0	.	289;302;316;339;366;380	B4DQZ3;B4DRC3;B4DIG0;P30305-3;P30305-2;P30305	.;.;.;.;.;MPIP2_HUMAN	K	316;289;380;366;339	ENSP00000339125:E316K;ENSP00000368918:E289K;ENSP00000245960:E380K;ENSP00000405972:E366K;ENSP00000339170:E339K	ENSP00000245960:E380K	E	+	1	0	CDC25B	3730967	1.000000	0.71417	0.997000	0.53966	0.887000	0.51463	3.808000	0.55598	1.184000	0.42957	0.558000	0.71614	GAG		0.582	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077779.2	NM_021874		4	92	0	0	0	0.014758	0	4	92				
VSX1	30813	broad.mit.edu	37	20	25057043	25057043	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr20:25057043C>G	ENST00000376709.4	-	5	1215	c.952G>C	c.(952-954)Gag>Cag	p.E318Q	VSX1_ENST00000429762.3_Intron|VSX1_ENST00000424574.1_Intron|VSX1_ENST00000444511.2_Intron|VSX1_ENST00000451258.1_Intron	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	318					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						AAGCCATTCTCAGGGCTCACT	0.542																																							uc002wuf.2		NA																	0					0						c.(952-954)GAG>CAG		visual system homeobox 1 isoform a							97.0	97.0	97.0					20																	25057043		2203	4300	6503	SO:0001583	missense	30813				response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:25057043C>G	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.952G>C	20.37:g.25057043C>G	ENSP00000365899:p.Glu318Gln					VSX1_uc002wue.2_Intron|VSX1_uc010gdd.1_Intron|VSX1_uc010gde.1_Intron|VSX1_uc010gdf.1_Intron	p.E318Q	NM_014588	NP_055403	Q9NZR4	VSX1_HUMAN			5	987	-			318					B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	37	c.952G>C	CCDS13168.1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.423753	0.25639	.	.	ENSG00000100987	ENST00000376709	D	0.92752	-3.1	4.17	2.0	0.26442	.	0.849184	0.10751	N	0.638350	D	0.87665	0.6234	L	0.51422	1.61	0.09310	N	1	B	0.30482	0.281	B	0.27076	0.076	T	0.78081	-0.2343	10	0.41790	T	0.15	.	7.7535	0.28911	0.0:0.7633:0.0:0.2367	.	318	Q9NZR4	VSX1_HUMAN	Q	318	ENSP00000365899:E318Q	ENSP00000365899:E318Q	E	-	1	0	VSX1	25005043	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.100000	0.15231	0.937000	0.37394	0.655000	0.94253	GAG		0.542	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3			9	90	0	0	0	0.004482	0	9	90				
MYH7B	57644	broad.mit.edu	37	20	33584527	33584527	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr20:33584527C>G	ENST00000262873.7	+	28	3450	c.3358C>G	c.(3358-3360)Caa>Gaa	p.Q1120E		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1078						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TGATGCTGCTCAAGACAAGCA	0.622																																							uc002xbi.1		NA																	0				ovary(1)|breast(1)	2						c.(3358-3360)CAA>GAA		myosin, heavy polypeptide 7B, cardiac muscle,							31.0	35.0	34.0					20																	33584527		2197	4299	6496	SO:0001583	missense	57644					membrane|myosin filament	actin binding|ATP binding|motor activity	g.chr20:33584527C>G	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3358C>G	20.37:g.33584527C>G	ENSP00000262873:p.Gln1120Glu						p.Q1120E	NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00691)		28	3450	+			1078			Potential.		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	c.3358C>G	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576037	0.28092	.	.	ENSG00000078814	ENST00000262873	T	0.80994	-1.44	4.4	3.43	0.39272	Myosin tail (1);	0.482992	0.15498	N	0.259181	T	0.67011	0.2848	N	0.24115	0.695	0.29250	N	0.872068	B	0.12013	0.005	B	0.01281	0.0	T	0.62950	-0.6745	10	0.72032	D	0.01	.	7.5884	0.28006	0.3284:0.5384:0.1332:0.0	.	1078	A7E2Y1	MYH7B_HUMAN	E	1120	ENSP00000262873:Q1120E	ENSP00000262873:Q1120E	Q	+	1	0	MYH7B	33048188	1.000000	0.71417	0.808000	0.32385	0.253000	0.25986	4.498000	0.60373	1.174000	0.42811	0.561000	0.74099	CAA		0.622	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884		3	42	0	0	0	0.009096	0	3	42				
LBP	3929	broad.mit.edu	37	20	36997691	36997691	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr20:36997691C>G	ENST00000217407.2	+	10	1195	c.1034C>G	c.(1033-1035)tCt>tGt	p.S345C		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	345					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TCAGTGCCCTCTGCTCCGCTC	0.512																																							uc002xic.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1033-1035)TCT>TGT		lipopolysaccharide-binding protein precursor							123.0	121.0	122.0					20																	36997691		2203	4300	6503	SO:0001583	missense	3929				acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding	g.chr20:36997691C>G		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.1034C>G	20.37:g.36997691C>G	ENSP00000217407:p.Ser345Cys						p.S345C	NM_004139	NP_004130	P18428	LBP_HUMAN			10	1069	+		Myeloproliferative disorder(115;0.00878)	345					B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	ENST00000217407.2	37	c.1034C>G	CCDS13304.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518767	0.27211	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.09350	2.99	5.54	2.54	0.30619	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.410761	0.25753	N	0.028539	T	0.17109	0.0411	M	0.70842	2.15	0.09310	N	1	B	0.28933	0.228	B	0.41510	0.359	T	0.18713	-1.0328	10	0.56958	D	0.05	-0.6705	5.6228	0.17467	0.1457:0.637:0.1405:0.0768	.	345	P18428	LBP_HUMAN	C	345	ENSP00000217407:S345C	ENSP00000217407:S345C	S	+	2	0	LBP	36431105	0.001000	0.12720	0.001000	0.08648	0.213000	0.24496	0.901000	0.28445	0.435000	0.26365	-0.181000	0.13052	TCT		0.512	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139		49	126	0	0	0	0.01441	0	49	126				
LPIN3	64900	broad.mit.edu	37	20	39977393	39977393	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr20:39977393G>A	ENST00000373257.3	+	4	514	c.423G>A	c.(421-423)cgG>cgA	p.R141R		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	141					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				CCACTGGGCGGAGGAAGAGGC	0.627																																							uc002xjx.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(421-423)CGG>CGA		lipin 3							34.0	34.0	34.0					20																	39977393		2203	4300	6503	SO:0001819	synonymous_variant	64900				fatty acid metabolic process	nucleus	phosphatidate phosphatase activity	g.chr20:39977393G>A	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.423G>A	20.37:g.39977393G>A						LPIN3_uc010ggh.2_Silent_p.R141R|LPIN3_uc010zwf.1_RNA	p.R141R	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN			4	514	+		Myeloproliferative disorder(115;0.000739)	141			Nuclear localization signal (Potential).		B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Silent	SNP	ENST00000373257.3	37	c.423G>A	CCDS33469.1																																																																																				0.627	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896		4	29	0	0	0	0.009096	0	4	29				
KCNQ2	3785	broad.mit.edu	37	20	62044851	62044851	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr20:62044851G>A	ENST00000359125.2	-	15	1889	c.1715C>T	c.(1714-1716)tCa>tTa	p.S572L	KCNQ2_ENST00000370224.1_Missense_Mutation_p.S544L|KCNQ2_ENST00000360480.3_Missense_Mutation_p.S544L|KCNQ2_ENST00000354587.3_Missense_Mutation_p.S544L|KCNQ2_ENST00000359689.1_Missense_Mutation_p.S572L|KCNQ2_ENST00000357249.2_Missense_Mutation_p.S554L|KCNQ2_ENST00000344462.4_Missense_Mutation_p.S541L	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	572					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GTGGCCGGCTGAGTACTGCTC	0.627																																							uc002yey.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1714-1716)TCA>TTA		potassium voltage-gated channel KQT-like protein	Amitriptyline(DB00321)						104.0	91.0	95.0					20																	62044851		2203	4300	6503	SO:0001583	missense	3785				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:62044851G>A	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1715C>T	20.37:g.62044851G>A	ENSP00000352035:p.Ser572Leu					KCNQ2_uc002yez.1_Missense_Mutation_p.S541L|KCNQ2_uc002yfa.1_Missense_Mutation_p.S554L|KCNQ2_uc002yfb.1_Missense_Mutation_p.S544L	p.S572L	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		15	1892	-	all_cancers(38;1.24e-11)		572			Cytoplasmic (Potential).		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	c.1715C>T	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	g	33	5.265635	0.95399	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222	D;D;D;D;D;D;D;D;D;D	0.99814	-6.89;-6.89;-6.89;-6.89;-6.89;-6.89;-6.89;-6.89;-6.89;-6.89	4.99	4.99	0.66335	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.081384	0.52532	D	0.000073	D	0.99789	0.9911	M	0.87269	2.87	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	D	0.97010	0.9735	10	0.87932	D	0	-42.78	18.2551	0.90017	0.0:0.0:1.0:0.0	.	544;554;541;572	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	L	554;572;542;544;572;541;544;532;544;544	ENSP00000349789:S554L;ENSP00000352035:S572L;ENSP00000359246:S542L;ENSP00000346601:S544L;ENSP00000352718:S572L;ENSP00000399612:S541L;ENSP00000353668:S544L;ENSP00000339611:S532L;ENSP00000359244:S544L;ENSP00000359242:S544L	ENSP00000339611:S532L	S	-	2	0	KCNQ2	61515295	1.000000	0.71417	0.954000	0.39281	0.876000	0.50452	7.782000	0.85680	2.323000	0.78572	0.556000	0.70494	TCA		0.627	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109		4	79	0	0	0	0.014758	0	4	79				
SON	6651	broad.mit.edu	37	21	34925451	34925451	+	Missense_Mutation	SNP	T	T	C	rs146846126	byFrequency	TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr21:34925451T>C	ENST00000356577.4	+	3	4389	c.3914T>C	c.(3913-3915)aTg>aCg	p.M1305T	SON_ENST00000300278.4_Missense_Mutation_p.M1305T|SON_ENST00000290239.6_Missense_Mutation_p.M1305T|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.M1305T	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1305					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCTCCTGTTATGTCAGAGACA	0.463													T|||	4	0.000798722	0.0023	0.0	5008	,	,		22533	0.0		0.001	False		,,,				2504	0.0						uc002yse.1		NA																	0				ovary(4)|skin(2)	6						c.(3913-3915)ATG>ACG		SON DNA-binding protein isoform F							92.0	84.0	87.0					21																	34925451		2203	4300	6503	SO:0001583	missense	6651				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding	g.chr21:34925451T>C	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3914T>C	21.37:g.34925451T>C	ENSP00000348984:p.Met1305Thr					SON_uc002ysb.1_Missense_Mutation_p.M1305T|SON_uc002ysc.2_Missense_Mutation_p.M1305T|SON_uc002ysd.2_Missense_Mutation_p.M296T|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Missense_Mutation_p.M296T	p.M1305T	NM_138927	NP_620305	P18583	SON_HUMAN			3	3963	+			1305					D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	c.3914T>C	CCDS13629.1	3|3	0.0013736263736263737|0.0013736263736263737	2|2	0.0040650406504065045|0.0040650406504065045	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	T|T	0.680|0.680	-0.798541|-0.798541	0.02841|0.02841	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.12879	.|2.82;2.82;2.81;2.64	5.44|5.44	0.221|0.221	0.15283|0.15283	.|.	.|1.065100	.|0.07166	.|N	.|0.851607	T|T	0.08802|0.08802	0.0218|0.0218	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.16802	.|0.011;0.019;0.0;0.011;0.006	.|B;B;B;B;B	.|0.16722	.|0.016;0.007;0.0;0.016;0.009	T|T	0.42766|0.42766	-0.9432|-0.9432	5|10	.|0.24483	.|T	.|0.36	.|.	5.5673|5.5673	0.17177|0.17177	0.0:0.149:0.271:0.58|0.0:0.149:0.271:0.58	.|.	.|1305;1305;986;1305;1305	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	R|T	300|1305	.|ENSP00000348984:M1305T;ENSP00000290239:M1305T;ENSP00000300278:M1305T;ENSP00000371095:M1305T	.|ENSP00000290239:M1305T	C|M	+|+	1|2	0|0	SON|SON	33847321|33847321	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.195000|0.195000	0.23768|0.23768	-0.119000|-0.119000	0.10676|0.10676	-0.093000|-0.093000	0.12396|0.12396	-0.256000|-0.256000	0.11100|0.11100	TGT|ATG		0.463	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		20	54	0	0	0	0.007413	0	20	54				
PEX26	55670	broad.mit.edu	37	22	18566424	18566424	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr22:18566424C>T	ENST00000329627.7	+	4	799	c.593C>T	c.(592-594)gCc>gTc	p.A198V	PEX26_ENST00000428061.2_Missense_Mutation_p.A198V|PEX26_ENST00000399744.3_Missense_Mutation_p.A198V	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	198					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						GTACTTCAGGCCATTCACACA	0.597																																							uc002znp.3		NA																	0				skin(1)	1						c.(592-594)GCC>GTC		peroxisome biogenesis factor 26							87.0	81.0	83.0					22																	18566424		2203	4300	6503	SO:0001583	missense	55670				protein import into peroxisome matrix|protein import into peroxisome membrane	integral to peroxisomal membrane	protein C-terminus binding|protein complex binding	g.chr22:18566424C>T	AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.593C>T	22.37:g.18566424C>T	ENSP00000331106:p.Ala198Val					TUBA8_uc002znr.2_Intron|PEX26_uc002znq.3_Missense_Mutation_p.A198V|PEX26_uc002znt.2_Missense_Mutation_p.A198V	p.A198V	NM_017929	NP_060399	Q7Z412	PEX26_HUMAN			4	802	+			198			Cytoplasmic (Potential).		F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Missense_Mutation	SNP	ENST00000329627.7	37	c.593C>T	CCDS13750.1	.	.	.	.	.	.	.	.	.	.	C	5.679	0.309839	0.10733	.	.	ENSG00000215193	ENST00000329627;ENST00000399744;ENST00000428061;ENST00000399746	D;D;D	0.94000	-3.33;-3.33;-3.33	5.46	3.36	0.38483	.	0.788789	0.11172	U	0.591954	D	0.88804	0.6536	L	0.55481	1.735	0.25119	N	0.990654	B;B	0.15930	0.005;0.015	B;B	0.16722	0.003;0.016	T	0.72683	-0.4219	10	0.02654	T	1	-4.1235	8.5441	0.33410	0.1515:0.7713:0.0:0.0771	.	198;198	F6UBB5;Q7Z412	.;PEX26_HUMAN	V	198	ENSP00000331106:A198V;ENSP00000382648:A198V;ENSP00000412441:A198V	ENSP00000331106:A198V	A	+	2	0	PEX26	16946424	0.996000	0.38824	0.638000	0.29380	0.056000	0.15407	1.150000	0.31639	0.773000	0.33404	0.555000	0.69702	GCC		0.597	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314644.3	NM_017929		11	49	0	0	0	0.008291	0	11	49				
PI4KA	5297	broad.mit.edu	37	22	21075604	21075604	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr22:21075604C>T	ENST00000572273.1	-	43	5154	c.4924G>A	c.(4924-4926)Gag>Aag	p.E1642K	PI4KA_ENST00000255882.6_Missense_Mutation_p.E1700K|PI4KA_ENST00000414196.3_Missense_Mutation_p.E452K|AC007308.6_ENST00000430719.1_RNA			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1642	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TGGTGGCCCTCTTCATCTAGA	0.517																																					GBM(136;1332 1831 3115 23601 50806)	GBM(136;1332 1831 3115 23601 50806)	uc002zsz.3		NA																	0				lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4						c.(4924-4926)GAG>AAG		phosphatidylinositol 4-kinase type 3 alpha							156.0	134.0	141.0					22																	21075604		2203	4300	6503	SO:0001583	missense	5297				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding	g.chr22:21075604C>T	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.4924G>A	22.37:g.21075604C>T	ENSP00000458238:p.Glu1642Lys					PI4KA_uc010gsp.2_Missense_Mutation_p.E35K|PI4KA_uc002zsy.3_Missense_Mutation_p.E452K	p.E1642K	NM_058004	NP_477352	P42356	PI4KA_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		43	5155	-	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	1642					Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37	c.4924G>A		.	.	.	.	.	.	.	.	.	.	C	35	5.511803	0.96402	.	.	ENSG00000241973	ENST00000255882;ENST00000414196;ENST00000399213	T;T	0.63744	-0.06;-0.06	5.12	5.12	0.69794	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80633	0.4660	M	0.80183	2.485	0.80722	D	1	D;D	0.71674	0.992;0.998	D;D	0.76575	0.955;0.988	T	0.82172	-0.0589	10	0.51188	T	0.08	-28.5603	18.5538	0.91075	0.0:1.0:0.0:0.0	.	35;1642	A8MTF1;P42356	.;PI4KA_HUMAN	K	1642;452;35	ENSP00000402981:E452K;ENSP00000382162:E35K	ENSP00000255882:E1642K	E	-	1	0	PI4KA	19405604	1.000000	0.71417	0.998000	0.56505	0.885000	0.51271	7.627000	0.83176	2.389000	0.81357	0.591000	0.81541	GAG		0.517	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004		4	94	0	0	0	0.009096	0	4	94				
NKTR	4820	broad.mit.edu	37	3	42679594	42679594	+	Missense_Mutation	SNP	G	G	A	rs372647974	byFrequency	TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:42679594G>A	ENST00000232978.8	+	13	2586	c.2398G>A	c.(2398-2400)Gag>Aag	p.E800K	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	800	Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AAAGTATAGCGAGAGCAGATC	0.428													G|||	2	0.000399361	0.0	0.0	5008	,	,		19867	0.0		0.0	False		,,,				2504	0.002						uc003clo.2		NA																	0				ovary(2)|skin(1)	3						c.(2398-2400)GAG>AAG		natural killer-tumor recognition sequence		G	LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	97.0	100.0	99.0		2398	4.7	0.8	3		99	0,8600		0,0,4300	no	missense	NKTR	NM_005385.3	56	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	800/1463	42679594	2,13004	2203	4300	6503	SO:0001583	missense	4820				protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr3:42679594G>A		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2398G>A	3.37:g.42679594G>A	ENSP00000232978:p.Glu800Lys					NKTR_uc003clm.1_Missense_Mutation_p.E547K|NKTR_uc003clp.2_Missense_Mutation_p.E547K|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Missense_Mutation_p.E690K|NKTR_uc003clr.1_Missense_Mutation_p.E547K|NKTR_uc003cls.2_Missense_Mutation_p.E500K	p.E800K	NM_005385	NP_005376	P30414	NKTR_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.24)	13	2545	+			800			Arg/Ser-rich.			Missense_Mutation	SNP	ENST00000232978.8	37	c.2398G>A	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496673	0.26861	4.54E-4	0.0	ENSG00000114857	ENST00000232978	T	0.12465	2.68	5.58	4.69	0.59074	.	0.352416	0.33040	N	0.005358	T	0.16214	0.0390	L	0.56769	1.78	0.80722	D	1	P;P	0.47841	0.901;0.84	B;B	0.37601	0.254;0.062	T	0.02991	-1.1085	10	0.87932	D	0	-16.5266	16.2825	0.82703	0.0:0.1328:0.8671:0.0	.	500;800	Q6M1B8;P30414	.;NKTR_HUMAN	K	800	ENSP00000232978:E800K	ENSP00000232978:E800K	E	+	1	0	NKTR	42654598	0.454000	0.25728	0.805000	0.32314	0.203000	0.24098	2.410000	0.44592	1.316000	0.45131	0.591000	0.81541	GAG		0.428	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385		4	84	0	0	0	0.009096	0	4	84				
NDUFAF3	25915	broad.mit.edu	37	3	49060179	49060179	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:49060179C>T	ENST00000326925.6	+	3	1449	c.315C>T	c.(313-315)ttC>ttT	p.F105F	MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000313778.5_5'Flank|NDUFAF3_ENST00000395458.2_Silent_p.F48F|DALRD3_ENST00000440857.1_5'Flank|DALRD3_ENST00000496568.1_5'Flank|NDUFAF3_ENST00000326912.4_Silent_p.F48F|NDUFAF3_ENST00000451378.2_Silent_p.F48F|MIR191_ENST00000384873.1_RNA	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3	105					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						TTTCCCTCTTCTGGTTGCTGG	0.582																																							uc003cvq.2		NA																	0					0						c.(313-315)TTC>TTT		NADH dehydrogenase (ubiquinone) 1 alpha							149.0	156.0	153.0					3																	49060179		2203	4300	6503	SO:0001819	synonymous_variant	25915				mitochondrial respiratory chain complex I assembly	mitochondrial inner membrane|nucleus	protein binding	g.chr3:49060179C>T		CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773	ENST00000326925.6:c.315C>T	3.37:g.49060179C>T						DALRD3_uc003cvm.1_5'Flank|DALRD3_uc010hko.1_5'Flank|uc011bcb.1_5'Flank|MIR425_hsa-mir-425|MI0001448_5'Flank|NDUFAF3_uc003cvn.2_Silent_p.F48F|uc003cvo.1_5'Flank|MIR191_hsa-mir-191|MI0000465_5'Flank|NDUFAF3_uc003cvp.2_Silent_p.F48F|NDUFAF3_uc003cvr.2_Silent_p.F48F|NDUFAF3_uc003cvs.2_Silent_p.F48F	p.F105F	NM_199069	NP_951032	Q9BU61	NDUF3_HUMAN			3	819	+			105						Silent	SNP	ENST00000326925.6	37	c.315C>T	CCDS2784.1																																																																																				0.582	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345683.2	NM_199069		24	223	0	0	0	0.016522	0	24	223				
CDHR4	389118	broad.mit.edu	37	3	49837234	49837234	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:49837234G>A	ENST00000412678.2	-	1	20	c.12C>T	c.(10-12)ctC>ctT	p.L4L	CDHR4_ENST00000343366.4_Silent_p.L4L|CDHR4_ENST00000487256.1_Silent_p.L4L	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	4					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						CGAGGAGCCTGAGCAGCACCA	0.552																																							uc010hkz.2		NA																	0					0						c.(10-12)CTC>CTT		cadherin-like 29 precursor							82.0	92.0	88.0					3																	49837234		2118	4240	6358	SO:0001819	synonymous_variant	389118				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr3:49837234G>A		CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.12C>T	3.37:g.49837234G>A						CDHR4_uc003cxp.2_Silent_p.L4L|CDHR4_uc011bcw.1_Silent_p.L4L	p.L4L	NM_001007540	NP_001007541	A6H8M9	CDHR4_HUMAN			1	21	-			4					Q6UXT0	Silent	SNP	ENST00000412678.2	37	c.12C>T	CCDS46829.1																																																																																				0.552	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350387.1	NM_001007540		3	59	0	0	0	0.009096	0	3	59				
DOCK3	1795	broad.mit.edu	37	3	51418609	51418609	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:51418609C>T	ENST00000266037.9	+	53	5735	c.5712C>T	c.(5710-5712)tcC>tcT	p.S1904S		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1904					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTGGGCACTCCTCGGAGGCCC	0.607																																							uc011bds.1		NA																	0					0						c.(5710-5712)TCC>TCT		dedicator of cytokinesis 3							58.0	70.0	66.0					3																	51418609		2188	4285	6473	SO:0001819	synonymous_variant	1795					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr3:51418609C>T	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5712C>T	3.37:g.51418609C>T							p.S1904S	NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)	53	5735	+			1904					O15017	Silent	SNP	ENST00000266037.9	37	c.5712C>T	CCDS46835.1																																																																																				0.607	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947		27	91	0	0	0	0.021523	0	27	91				
CD47	961	broad.mit.edu	37	3	107798948	107798948	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:107798948G>A	ENST00000361309.5	-	2	395	c.290C>T	c.(289-291)tCt>tTt	p.S97F	CD47_ENST00000355354.7_Missense_Mutation_p.S97F	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule	97	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			CATCTTCAAAGAGGCATCTCC	0.393																																							uc003dwt.1		NA																	0				ovary(1)	1						c.(289-291)TCT>TTT		CD47 antigen isoform 1 precursor							213.0	186.0	195.0					3																	107798948		1888	4117	6005	SO:0001583	missense	961				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity	g.chr3:107798948G>A		CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000361309.5:c.290C>T	3.37:g.107798948G>A	ENSP00000355361:p.Ser97Phe					CD47_uc003dwu.1_Missense_Mutation_p.S97F|CD47_uc003dwv.1_Missense_Mutation_p.S97F|CD47_uc003dww.1_Missense_Mutation_p.S97F	p.S97F	NM_001777	NP_001768	Q08722	CD47_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)		2	470	-			97			Extracellular (Potential).|Ig-like V-type.		A8K198|D3DN59|Q53Y71|Q96A60	Missense_Mutation	SNP	ENST00000361309.5	37	c.290C>T	CCDS43126.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945256	0.53079	.	.	ENSG00000196776	ENST00000355354;ENST00000361309	T;T	0.03717	3.83;3.83	6.04	6.04	0.98038	Immunoglobulin-like (1);CD47 immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.080526	0.53938	D	0.000042	T	0.19446	0.0467	M	0.73962	2.25	0.43819	D	0.996385	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.00002	-1.2617	10	0.87932	D	0	.	17.496	0.87717	0.0:0.0:1.0:0.0	.	97;97;97;97	Q08722-2;Q08722-3;E9PB22;Q08722	.;.;.;CD47_HUMAN	F	97	ENSP00000347512:S97F;ENSP00000355361:S97F	ENSP00000347512:S97F	S	-	2	0	CD47	109281638	1.000000	0.71417	0.998000	0.56505	0.071000	0.16799	5.804000	0.69135	2.873000	0.98535	0.561000	0.74099	TCT		0.393	CD47-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000102793.1	NM_001777		9	102	0	0	0	0.004482	0	9	102				
DRD3	1814	broad.mit.edu	37	3	113850152	113850152	+	Silent	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:113850152T>A	ENST00000460779.1	-	7	1108	c.819A>T	c.(817-819)ggA>ggT	p.G273G	DRD3_ENST00000467632.1_Silent_p.G273G|DRD3_ENST00000383673.2_Silent_p.G273G|DRD3_ENST00000295881.7_Silent_p.G273G	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	273					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCAACTCTCCTCCTCTTTCTT	0.527																																							uc003ebd.2		NA																	0				ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(817-819)GGA>GGT		dopamine receptor D3 isoform a	Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)						167.0	173.0	171.0					3																	113850152		2203	4300	6503	SO:0001819	synonymous_variant	1814				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding	g.chr3:113850152T>A		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.819A>T	3.37:g.113850152T>A						DRD3_uc010hqn.1_Silent_p.G273G|DRD3_uc003ebb.1_Silent_p.G273G|DRD3_uc003ebc.1_Silent_p.G273G	p.G273G	NM_000796	NP_000787	P35462	DRD3_HUMAN			7	1242	-			273			Cytoplasmic.		A1A4V5|Q4VBM8	Silent	SNP	ENST00000460779.1	37	c.819A>T	CCDS2978.1																																																																																				0.527	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3		40	135	0	0	0	0.006999	0	40	135				
UBXN7	26043	broad.mit.edu	37	3	196094967	196094967	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:196094967C>G	ENST00000296328.4	-	8	840	c.766G>C	c.(766-768)Gga>Cga	p.G256R	UBXN7_ENST00000428095.1_Missense_Mutation_p.G94R|UBXN7_ENST00000535858.1_Missense_Mutation_p.G108R	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	256						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CCCAGAAATCCCGTCACTTGG	0.398																																							uc003fwm.3		NA																	0				ovary(2)|pancreas(1)	3						c.(766-768)GGA>CGA		UBX domain containing 7							112.0	103.0	106.0					3																	196094967		1854	4096	5950	SO:0001583	missense	26043						protein binding	g.chr3:196094967C>G	AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.766G>C	3.37:g.196094967C>G	ENSP00000296328:p.Gly256Arg					UBXN7_uc003fwn.3_Missense_Mutation_p.G108R|UBXN7_uc010iae.2_Missense_Mutation_p.G94R	p.G256R	NM_015562	NP_056377	O94888	UBXN7_HUMAN			8	841	-			256					D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	37	c.766G>C	CCDS43191.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602310	0.66445	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	T;T;T	0.40756	1.02;1.02;1.02	5.29	5.29	0.74685	UAS (1);	0.000000	0.85682	D	0.000000	T	0.41534	0.1163	N	0.14661	0.345	0.80722	D	1	D	0.58970	0.984	P	0.55455	0.776	T	0.15178	-1.0446	10	0.19590	T	0.45	-18.2622	19.1204	0.93360	0.0:1.0:0.0:0.0	.	256	O94888	UBXN7_HUMAN	R	256;94;108	ENSP00000296328:G256R;ENSP00000397256:G94R;ENSP00000440716:G108R	ENSP00000296328:G256R	G	-	1	0	UBXN7	197579364	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	4.972000	0.63756	2.734000	0.93682	0.655000	0.94253	GGA		0.398	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353		15	69	0	0	0	0.020292	0	15	69				
ACOX3	8310	broad.mit.edu	37	4	8398816	8398816	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:8398816C>A	ENST00000356406.5	-	9	981	c.904G>T	c.(904-906)Ggg>Tgg	p.G302W	ACOX3_ENST00000503233.1_Missense_Mutation_p.G302W|ACOX3_ENST00000413009.2_Missense_Mutation_p.G302W	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	302					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						GACAGGCTCCCCAGGGACGCT	0.647																																							uc010idk.2		NA																	0				central_nervous_system(1)	1						c.(904-906)GGG>TGG		acyl-Coenzyme A oxidase 3 isoform a							41.0	40.0	40.0					4																	8398816		2203	4300	6503	SO:0001583	missense	8310				bile acid metabolic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|pristanoyl-CoA oxidase activity	g.chr4:8398816C>A	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.904G>T	4.37:g.8398816C>A	ENSP00000348775:p.Gly302Trp					ACOX3_uc003glc.3_Missense_Mutation_p.G302W|ACOX3_uc003gld.3_Missense_Mutation_p.G302W|ACOX3_uc003gle.1_Missense_Mutation_p.G207W	p.G302W	NM_003501	NP_003492	O15254	ACOX3_HUMAN			9	1049	-			302					Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	37	c.904G>T	CCDS3401.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625610	0.46840	.	.	ENSG00000087008	ENST00000413009;ENST00000356406;ENST00000503233	D;D;D	0.96104	-3.91;-3.91;-3.91	5.0	4.15	0.48705	Acyl-CoA dehydrogenase/oxidase C-terminal (1);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.176250	0.50627	D	0.000119	D	0.98362	0.9456	H	0.96691	3.865	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.81914	0.981;0.992;0.995	D	0.98742	1.0717	10	0.87932	D	0	-23.5873	12.4605	0.55729	0.0:0.9163:0.0:0.0837	.	302;302;302	B2R856;O15254-2;O15254	.;.;ACOX3_HUMAN	W	302	ENSP00000413994:G302W;ENSP00000348775:G302W;ENSP00000421625:G302W	ENSP00000348775:G302W	G	-	1	0	ACOX3	8449716	0.999000	0.42202	0.565000	0.28409	0.015000	0.08874	3.956000	0.56722	1.090000	0.41315	0.609000	0.83330	GGG		0.647	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4			21	41	1	0	0.00152264	0.010504	0.00157039	21	41				
TBC1D19	55296	broad.mit.edu	37	4	26741526	26741526	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:26741526G>A	ENST00000264866.4	+	17	1436	c.1158G>A	c.(1156-1158)ttG>ttA	p.L386L	TBC1D19_ENST00000511789.1_Silent_p.L321L	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	386	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				CTTCCAAATTGTATCAGATAT	0.303																																							uc003gsf.3		NA																	0				breast(1)	1						c.(1156-1158)TTG>TTA		TBC1 domain family, member 19							195.0	184.0	187.0					4																	26741526		2202	4299	6501	SO:0001819	synonymous_variant	55296					intracellular	Rab GTPase activator activity	g.chr4:26741526G>A	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1158G>A	4.37:g.26741526G>A						TBC1D19_uc010iew.2_Silent_p.L386L|TBC1D19_uc011bxu.1_Silent_p.L321L	p.L386L	NM_018317	NP_060787	Q8N5T2	TBC19_HUMAN			17	1428	+		Breast(46;0.0503)	386			Rab-GAP TBC.		B9A6M0|Q9NUX1	Silent	SNP	ENST00000264866.4	37	c.1158G>A	CCDS3439.1																																																																																				0.303	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317		23	67	0	0	0	0.01892	0	23	67				
CWH43	80157	broad.mit.edu	37	4	48996650	48996650	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:48996650A>G	ENST00000226432.4	+	5	709	c.526A>G	c.(526-528)Aaa>Gaa	p.K176E	CWH43_ENST00000513409.1_Missense_Mutation_p.K149E	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	176					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						TGACTGCAGTAAACCTGAAGA	0.428																																							uc003gyv.2		NA																	0				skin(2)|ovary(1)	3						c.(526-528)AAA>GAA		cell wall biogenesis 43 C-terminal homolog							79.0	86.0	83.0					4																	48996650		2203	4300	6503	SO:0001583	missense	80157				GPI anchor biosynthetic process	integral to membrane		g.chr4:48996650A>G		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.526A>G	4.37:g.48996650A>G	ENSP00000226432:p.Lys176Glu					CWH43_uc011bzl.1_Missense_Mutation_p.K149E	p.K176E	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN			5	708	+			176					B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	c.526A>G	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	A	1.174	-0.640040	0.03557	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.42513	1.55;0.97	4.71	2.2	0.27929	.	0.111603	0.39020	N	0.001481	T	0.26666	0.0652	L	0.41236	1.265	0.09310	N	1	B	0.14438	0.01	B	0.18561	0.022	T	0.13282	-1.0515	9	.	.	.	.	2.5225	0.04683	0.6109:0.1565:0.0823:0.1503	.	176	Q9H720	PG2IP_HUMAN	E	176;149	ENSP00000226432:K176E;ENSP00000422802:K149E	.	K	+	1	0	CWH43	48691407	0.001000	0.12720	0.001000	0.08648	0.015000	0.08874	1.028000	0.30128	0.368000	0.24481	0.482000	0.46254	AAA		0.428	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087		39	73	0	0	0	0.006999	0	39	73				
LPHN3	23284	broad.mit.edu	37	4	62598706	62598706	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:62598706G>T	ENST00000514591.1	+	7	958	c.629G>T	c.(628-630)gGa>gTa	p.G210V	LPHN3_ENST00000504896.1_Missense_Mutation_p.G210V|LPHN3_ENST00000512091.2_Missense_Mutation_p.G210V|LPHN3_ENST00000507625.1_Missense_Mutation_p.G278V|LPHN3_ENST00000514996.1_Missense_Mutation_p.G210V|LPHN3_ENST00000508693.1_Missense_Mutation_p.G278V|LPHN3_ENST00000506700.1_Missense_Mutation_p.G210V|LPHN3_ENST00000509896.1_Missense_Mutation_p.G278V|LPHN3_ENST00000506720.1_Missense_Mutation_p.G278V|LPHN3_ENST00000507164.1_Missense_Mutation_p.G278V|LPHN3_ENST00000511324.1_Missense_Mutation_p.G278V|LPHN3_ENST00000508946.1_Missense_Mutation_p.G210V|LPHN3_ENST00000506746.1_Missense_Mutation_p.G278V|LPHN3_ENST00000545650.1_Missense_Mutation_p.G210V|LPHN3_ENST00000514157.1_Missense_Mutation_p.G210V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	210	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GATGGCACAGGATTTGTAGTG	0.448																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(628-630)GGA>GTA		latrophilin 3 precursor							80.0	75.0	77.0					4																	62598706		1909	4121	6030	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62598706G>T	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.629G>T	4.37:g.62598706G>T	ENSP00000422533:p.Gly210Val					LPHN3_uc003hcq.3_Missense_Mutation_p.G210V|LPHN3_uc010ihg.1_Missense_Mutation_p.G278V|LPHN3_uc003hcs.1_Missense_Mutation_p.G39V	p.G210V	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			5	802	+			210			Extracellular (Potential).|Olfactomedin-like.		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.629G>T	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752800	0.69648	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.97291	0.9114	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.98380	1.0558	10	0.87932	D	0	.	17.8426	0.88719	0.0:0.0:1.0:0.0	.	210;278;210	E9PE04;E7EN28;Q9HAR2-2	.;.;.	V	210;210;278;278;210;210;210;210;210;278;278;278;210;210;210;278;278;210	ENSP00000423388:G210V;ENSP00000422533:G210V;ENSP00000423787:G278V;ENSP00000425033:G278V;ENSP00000424120:G210V;ENSP00000439831:G210V;ENSP00000421476:G278V;ENSP00000424030:G278V;ENSP00000421372:G278V;ENSP00000425201:G210V;ENSP00000423434:G210V;ENSP00000421627:G210V;ENSP00000420931:G278V;ENSP00000425884:G278V;ENSP00000424258:G210V	ENSP00000280009:G210V	G	+	2	0	LPHN3	62281301	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	2.458000	0.83093	0.557000	0.71058	GGA		0.448	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			9	45	1	0	2.52707e-12	0.006214	3.05311e-12	9	45				
TECRL	253017	broad.mit.edu	37	4	65165722	65165722	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:65165722C>A	ENST00000381210.3	-	8	854	c.744G>T	c.(742-744)agG>agT	p.R248S	TECRL_ENST00000513125.1_5'UTR|TECRL_ENST00000507440.1_Missense_Mutation_p.R248S	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	248					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						CTGTGATTTGCCTGTTTCCAA	0.308																																							uc003hcv.2		NA																	0					0						c.(742-744)AGG>AGT		steroid 5 alpha-reductase 2-like 2							139.0	152.0	148.0					4																	65165722		2203	4299	6502	SO:0001583	missense	253017				lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors	g.chr4:65165722C>A	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.744G>T	4.37:g.65165722C>A	ENSP00000370607:p.Arg248Ser						p.R248S	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN			8	853	-			248						Missense_Mutation	SNP	ENST00000381210.3	37	c.744G>T	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	C	6.365	0.435474	0.12045	.	.	ENSG00000205678	ENST00000507440;ENST00000381210	T;T	0.28454	1.61;1.61	5.21	-2.25	0.06888	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (1);	0.272597	0.35207	N	0.003367	T	0.13884	0.0336	L	0.33485	1.01	0.34533	D	0.70945	P	0.43231	0.801	B	0.38106	0.265	T	0.37126	-0.9719	10	0.17832	T	0.49	-7.2262	2.2624	0.04070	0.1278:0.2768:0.1257:0.4697	.	248	Q5HYJ1	TECRL_HUMAN	S	248	ENSP00000426043:R248S;ENSP00000370607:R248S	ENSP00000370607:R248S	R	-	3	2	TECRL	64848317	0.459000	0.25768	0.934000	0.37439	0.950000	0.60333	-0.776000	0.04674	-0.775000	0.04584	0.460000	0.39030	AGG		0.308	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		37	76	1	0	9.62906e-15	0.00623	1.19255e-14	37	76				
MEPE	56955	broad.mit.edu	37	4	88766956	88766956	+	Silent	SNP	T	T	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:88766956T>C	ENST00000424957.3	+	4	1009	c.936T>C	c.(934-936)aaT>aaC	p.N312N	MEPE_ENST00000361056.3_Silent_p.N312N|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000497649.2_Silent_p.N288N|MEPE_ENST00000395102.4_Silent_p.N343N|MEPE_ENST00000560249.1_Silent_p.N199N|MEPE_ENST00000540395.1_Silent_p.N199N	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	312					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		GAGAAGAAAATGGTGGAAATA	0.443																																							uc003hqy.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(934-936)AAT>AAC		matrix, extracellular phosphoglycoprotein with							63.0	64.0	64.0					4																	88766956		2203	4300	6503	SO:0001819	synonymous_variant	56955				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr4:88766956T>C	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.936T>C	4.37:g.88766956T>C						MEPE_uc010ikn.2_Silent_p.N199N	p.N312N	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000432)	4	975	+		Hepatocellular(203;0.114)	312					A1A4X9|A8MTA3|D2CFR4|F5H5C5	Silent	SNP	ENST00000424957.3	37	c.936T>C	CCDS3625.1																																																																																				0.443	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1			27	53	0	0	0	0.00632	0	27	53				
BMPR1B	658	broad.mit.edu	37	4	96035971	96035971	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:96035971C>T	ENST00000515059.1	+	5	527	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W	BMPR1B_ENST00000440890.2_Missense_Mutation_p.R112W|BMPR1B_ENST00000264568.4_Missense_Mutation_p.R82W|BMPR1B_ENST00000394931.1_Missense_Mutation_p.R82W|BMPR1B_ENST00000502683.1_Missense_Mutation_p.R82W	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	82					BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		TTTTCAGTGTCGGGTAAGGTA	0.423																																							uc003htm.3		NA																	0				lung(4)|skin(2)|stomach(1)|breast(1)	8						c.(244-246)CGG>TGG		bone morphogenetic protein receptor, type IB							222.0	218.0	219.0					4																	96035971		2203	4299	6502	SO:0001583	missense	658				BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity	g.chr4:96035971C>T	D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.244C>T	4.37:g.96035971C>T	ENSP00000426617:p.Arg82Trp					BMPR1B_uc010ilb.2_Missense_Mutation_p.R82W|BMPR1B_uc003htn.3_Missense_Mutation_p.R82W	p.R82W	NM_001203	NP_001194	O00238	BMR1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)	5	518	+		Hepatocellular(203;0.114)	82			Extracellular (Potential).		B2R953|B4DSV1|P78366	Missense_Mutation	SNP	ENST00000515059.1	37	c.244C>T	CCDS3642.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679909	0.47886	.	.	ENSG00000138696	ENST00000515059;ENST00000506363;ENST00000512312;ENST00000509540;ENST00000440890;ENST00000502683;ENST00000264568;ENST00000394931	D;D;D;D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57;-4.57;-4.57;-4.57;-4.57	5.6	4.73	0.59995	TGF-beta receptor/activin receptor, type I/II (1);	0.000000	0.85682	D	0.000000	D	0.96519	0.8864	M	0.72118	2.19	0.58432	D	0.999998	B	0.21688	0.059	B	0.24269	0.052	D	0.95005	0.8146	10	0.44086	T	0.13	.	13.7002	0.62604	0.2805:0.7195:0.0:0.0	.	82	O00238	BMR1B_HUMAN	W	82;82;82;82;112;82;82;82	ENSP00000426617:R82W;ENSP00000421144:R82W;ENSP00000425444:R82W;ENSP00000421671:R82W;ENSP00000401907:R112W;ENSP00000424693:R82W;ENSP00000264568:R82W;ENSP00000378389:R82W	ENSP00000264568:R82W	R	+	1	2	BMPR1B	96254994	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	2.507000	0.45442	1.458000	0.47871	0.644000	0.83932	CGG		0.423	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253609.3	NM_001203		34	125	0	0	0	0.010818	0	34	125				
INPP4B	8821	broad.mit.edu	37	4	143007365	143007365	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:143007365C>A	ENST00000513000.1	-	25	2852	c.2419G>T	c.(2419-2421)Gaa>Taa	p.E807*	INPP4B_ENST00000509777.1_Nonsense_Mutation_p.E807*|INPP4B_ENST00000308502.4_Nonsense_Mutation_p.E807*|INPP4B_ENST00000262992.4_Nonsense_Mutation_p.E807*|INPP4B_ENST00000508116.1_Nonsense_Mutation_p.E807*	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	807					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					AGGAGATTTTCTAGCAATGCT	0.328																																							uc003iix.3		NA																	0				ovary(1)|lung(1)	2						c.(2419-2421)GAA>TAA		inositol polyphosphate-4-phosphatase, type II,							85.0	88.0	87.0					4																	143007365		2201	4297	6498	SO:0001587	stop_gained	8821				signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity	g.chr4:143007365C>A	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2419G>T	4.37:g.143007365C>A	ENSP00000425487:p.Glu807*					INPP4B_uc003iiw.3_Nonsense_Mutation_p.E807*|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_Nonsense_Mutation_p.E622*|INPP4B_uc011cho.1_RNA	p.E807*	NM_003866	NP_003857	O15327	INP4B_HUMAN			25	3014	-	all_hematologic(180;0.158)		807					Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Nonsense_Mutation	SNP	ENST00000513000.1	37	c.2419G>T	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	38	7.143783	0.98092	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	.	.	.	5.87	5.87	0.94306	.	0.103621	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	X	807;807;807;678;807;807;622;622;807;678	.	ENSP00000262992:E807X	E	-	1	0	INPP4B	143226815	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.488000	0.66869	2.941000	0.99782	0.655000	0.94253	GAA		0.328	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866		9	38	1	0	2.17888e-05	0.006214	2.35382e-05	9	38				
GUCY1B3	2983	broad.mit.edu	37	4	156680962	156680962	+	Silent	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr4:156680962G>T	ENST00000264424.8	+	2	109	c.27G>T	c.(25-27)ctG>ctT	p.L9L	GUCY1B3_ENST00000507146.1_5'UTR|GUCY1B3_ENST00000505154.1_Intron|GUCY1B3_ENST00000502959.1_Silent_p.L9L|GUCY1B3_ENST00000505764.1_5'UTR|GUCY1B3_ENST00000513437.1_5'UTR|GUCY1B3_ENST00000503520.1_Silent_p.L9L	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	9					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		ATCACGCCCTGGAGTTGCTGG	0.637																																							uc003ipc.2		NA																	0					0						c.(25-27)CTG>CTT		guanylate cyclase 1, soluble, beta 3							57.0	62.0	60.0					4																	156680962		1988	4162	6150	SO:0001819	synonymous_variant	2983				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity	g.chr4:156680962G>T	AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.27G>T	4.37:g.156680962G>T						GUCY1B3_uc011cio.1_Silent_p.L9L|GUCY1B3_uc011cip.1_5'UTR|GUCY1B3_uc003ipd.2_Intron|GUCY1B3_uc010iqf.2_Silent_p.L9L|GUCY1B3_uc010iqg.2_5'UTR|GUCY1B3_uc011ciq.1_5'UTR	p.L9L	NM_000857	NP_000848	Q02153	GCYB1_HUMAN		COAD - Colon adenocarcinoma(41;0.148)	2	194	+	all_hematologic(180;0.24)	Renal(120;0.0854)	9					B7Z426|Q86WY5	Silent	SNP	ENST00000264424.8	37	c.27G>T	CCDS47154.1																																																																																				0.637	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365770.2			10	35	1	0	1.58986e-06	0.008291	1.76255e-06	10	35				
NIPBL	25836	broad.mit.edu	37	5	37063937	37063937	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:37063937G>A	ENST00000282516.8	+	46	8405	c.7906G>A	c.(7906-7908)Gaa>Aaa	p.E2636K	NIPBL_ENST00000448238.2_Missense_Mutation_p.E2636K	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2636					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGAAGAAGAAGAAGGGGAGGT	0.388																																							uc003jkl.3		NA																	0				ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9						c.(7906-7908)GAA>AAA		delangin isoform A							57.0	54.0	55.0					5																	37063937		2203	4300	6503	SO:0001583	missense	25836				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding	g.chr5:37063937G>A	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.7906G>A	5.37:g.37063937G>A	ENSP00000282516:p.Glu2636Lys					NIPBL_uc003jkk.3_Missense_Mutation_p.E2636K|NIPBL_uc003jkn.2_Missense_Mutation_p.E329K	p.E2636K	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)		46	8405	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		2636					Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	c.7906G>A	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.805598	0.90623	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.93426	-3.22;-3.22	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.91841	0.7418	M	0.64997	1.995	0.80722	D	1	P;P;P	0.42692	0.682;0.682;0.787	B;B;B	0.37601	0.129;0.129;0.254	D	0.91023	0.4858	10	0.32370	T	0.25	-17.1667	19.3937	0.94596	0.0:0.0:1.0:0.0	.	2636;2636;2636	Q6IEH8;Q6KC79;Q6KC79-2	.;NIPBL_HUMAN;.	K	2636	ENSP00000282516:E2636K;ENSP00000406266:E2636K	ENSP00000282516:E2636K	E	+	1	0	NIPBL	37099694	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.583000	0.87209	0.591000	0.81541	GAA		0.388	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		11	27	0	0	0	0.010729	0	11	27				
MIER3	166968	broad.mit.edu	37	5	56219601	56219601	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:56219601G>A	ENST00000381199.3	-	12	1122	c.1112C>T	c.(1111-1113)tCa>tTa	p.S371L	SETD9_ENST00000541720.1_Intron|MIER3_ENST00000381213.3_Missense_Mutation_p.S370L|MIER3_ENST00000381226.3_Missense_Mutation_p.S376L|MIER3_ENST00000409421.1_Missense_Mutation_p.S308L			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		AGTTAAGGCTGAAGCATTTAC	0.408																																							uc003jrd.1		NA																	0					0						c.(1111-1113)TCA>TTA		mesoderm induction early response 1, family							148.0	146.0	147.0					5																	56219601		2203	4300	6503	SO:0001583	missense	166968				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr5:56219601G>A	BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.1112C>T	5.37:g.56219601G>A	ENSP00000370596:p.Ser371Leu					MIER3_uc003jqz.1_Missense_Mutation_p.S308L|MIER3_uc003jra.1_Missense_Mutation_p.S370L|MIER3_uc003jrb.1_Missense_Mutation_p.S195L|MIER3_uc003jrc.1_Missense_Mutation_p.S376L	p.S371L	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)	12	1137	-		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)	371					B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	ENST00000381199.3	37	c.1112C>T		.	.	.	.	.	.	.	.	.	.	G	20.7	4.038878	0.75617	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.98	5.98	0.97165	.	0.240585	0.44285	D	0.000474	T	0.50154	0.1599	L	0.52759	1.655	0.54753	D	0.999981	B;B;P	0.36315	0.319;0.241;0.547	B;B;B	0.38755	0.193;0.058;0.281	T	0.46233	-0.9206	10	0.49607	T	0.09	-0.0395	20.4496	0.99125	0.0:0.0:1.0:0.0	.	371;376;370	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	L	376;370;371;308	ENSP00000370624:S376L;ENSP00000370611:S370L;ENSP00000370596:S371L;ENSP00000386584:S308L	ENSP00000370596:S371L	S	-	2	0	MIER3	56255358	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.957000	0.93082	2.838000	0.97847	0.563000	0.77884	TCA		0.408	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000132523.2	NM_152622		21	95	0	0	0	0.012319	0	21	95				
FAM151B	167555	broad.mit.edu	37	5	79817926	79817926	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:79817926C>G	ENST00000282226.4	+	5	795	c.640C>G	c.(640-642)Cag>Gag	p.Q214E	FAM151B_ENST00000511718.1_3'UTR	NM_205548.2	NP_991111.2	Q6UXP7	F151B_HUMAN	family with sequence similarity 151, member B	214										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	7		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		GTCTTGTTCTCAGTTACTTTG	0.378																																							uc003kgv.1		NA																	0					0						c.(640-642)CAG>GAG		hypothetical protein LOC167555							163.0	144.0	151.0					5																	79817926		2203	4300	6503	SO:0001583	missense	167555							g.chr5:79817926C>G		CCDS4051.1	5q14.1	2007-12-18	2007-12-18		ENSG00000152380	ENSG00000152380			33716	protein-coding gene	gene with protein product							Standard	NM_205548		Approved	UNQ9217	uc003kgv.2	Q6UXP7	OTTHUMG00000131303	ENST00000282226.4:c.640C>G	5.37:g.79817926C>G	ENSP00000282226:p.Gln214Glu					FAM151B_uc010jal.1_RNA	p.Q214E	NM_205548	NP_991111	Q6UXP7	F151B_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)	5	783	+		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)	214					A2RRE4	Missense_Mutation	SNP	ENST00000282226.4	37	c.640C>G	CCDS4051.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089753	0.36855	.	.	ENSG00000152380	ENST00000282226	T	0.12672	2.66	5.77	2.85	0.33270	.	0.268095	0.43747	N	0.000537	T	0.10337	0.0253	L	0.39514	1.22	0.48901	D	0.999725	B	0.20550	0.046	B	0.22601	0.04	T	0.11299	-1.0593	10	0.10902	T	0.67	-10.8588	10.2337	0.43270	0.0:0.5455:0.3783:0.0763	.	214	Q6UXP7	F151B_HUMAN	E	214	ENSP00000282226:Q214E	ENSP00000282226:Q214E	Q	+	1	0	FAM151B	79853682	0.999000	0.42202	0.934000	0.37439	0.984000	0.73092	2.599000	0.46231	0.772000	0.33382	0.655000	0.94253	CAG		0.378	FAM151B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254072.1	NM_205548		3	58	0	0	0	0.004672	0	3	58				
GPR98	84059	broad.mit.edu	37	5	90015943	90015943	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:90015943G>T	ENST00000405460.2	+	44	9622	c.9526G>T	c.(9526-9528)Gga>Tga	p.G3176*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3176					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAATCCAACTGGAGGTGCTAG	0.408																																							uc003kju.2		NA																	0				ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(9526-9528)GGA>TGA		G protein-coupled receptor 98 precursor							117.0	112.0	114.0					5																	90015943		1820	4072	5892	SO:0001587	stop_gained	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:90015943G>T	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.9526G>T	5.37:g.90015943G>T	ENSP00000384582:p.Gly3176*					GPR98_uc003kjt.2_Nonsense_Mutation_p.G882*|GPR98_uc003kjv.2_Nonsense_Mutation_p.G776*	p.G3176*	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	44	9622	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	3176			Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	ENST00000405460.2	37	c.9526G>T	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	52	19.266960	0.99917	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0822	0.97779	0.0:0.0:1.0:0.0	.	.	.	.	X	3176	.	ENSP00000296619:G3176X	G	+	1	0	GPR98	90051699	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.749000	0.91619	2.826000	0.97356	0.563000	0.77884	GGA		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		6	105	1	0	3.59834e-05	0.001168	3.81759e-05	6	105				
GIN1	54826	broad.mit.edu	37	5	102432327	102432327	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:102432327C>T	ENST00000399004.2	-	7	1306	c.1212G>A	c.(1210-1212)ctG>ctA	p.L404L	GIN1_ENST00000508629.1_Intron	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	404					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		TGTTGTCTCTCAGGACAGCAC	0.413																																							uc003koa.1		NA																	0				ovary(1)|skin(1)	2						c.(1210-1212)CTG>CTA		zinc finger, H2C2 domain containing							229.0	215.0	219.0					5																	102432327		1875	4113	5988	SO:0001819	synonymous_variant	54826				DNA integration		DNA binding	g.chr5:102432327C>T	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.1212G>A	5.37:g.102432327C>T						GIN1_uc003kob.1_Silent_p.L257L|GIN1_uc003koc.1_Intron	p.L404L	NM_017676	NP_060146	Q9NXP7	GIN1_HUMAN		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)	7	1294	-		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)	404					B2RXF7|B4DIV4|Q6AI03|Q96BR2	Silent	SNP	ENST00000399004.2	37	c.1212G>A	CCDS43349.1																																																																																				0.413	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676		5	175	0	0	0	0.014758	0	5	175				
MEGF10	84466	broad.mit.edu	37	5	126770413	126770413	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:126770413C>A	ENST00000274473.6	+	16	2142	c.1875C>A	c.(1873-1875)agC>agA	p.S625R	MEGF10_ENST00000503335.2_Missense_Mutation_p.S625R	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	625	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ATCGCTGCAGCCAGACATGCC	0.567																																							uc003kuh.3		NA																	0				ovary(4)	4						c.(1873-1875)AGC>AGA		multiple EGF-like-domains 10 precursor							62.0	57.0	58.0					5																	126770413		2203	4300	6503	SO:0001583	missense	84466				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup		g.chr5:126770413C>A	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1875C>A	5.37:g.126770413C>A	ENSP00000274473:p.Ser625Arg					MEGF10_uc003kui.3_Missense_Mutation_p.S625R	p.S625R	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)	16	2237	+		Prostate(80;0.165)	625			Extracellular (Potential).|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.		Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	c.1875C>A	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361750	0.61403	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.37752	1.18;1.18	5.82	4.04	0.47022	EGF-like, laminin (1);Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	T	0.45115	0.1326	L	0.41079	1.255	0.58432	D	0.999994	D	0.63880	0.993	D	0.66497	0.944	T	0.26467	-1.0102	10	0.35671	T	0.21	-35.4312	10.0006	0.41927	0.0:0.7929:0.0:0.2071	.	625	Q96KG7	MEG10_HUMAN	R	625	ENSP00000423354:S625R;ENSP00000274473:S625R	ENSP00000274473:S625R	S	+	3	2	MEGF10	126798312	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.750000	0.26334	1.480000	0.48289	0.467000	0.42956	AGC		0.567	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446		8	45	1	0	2.17888e-05	0.006214	2.35382e-05	8	45				
SLC12A2	6558	broad.mit.edu	37	5	127503468	127503468	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:127503468C>T	ENST00000262461.2	+	18	2821	c.2632C>T	c.(2632-2634)Cgt>Tgt	p.R878C	SLC12A2_ENST00000343225.4_Missense_Mutation_p.R878C	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	878					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TGGTCTTGGTCGTATGAAGCC	0.333																																							uc003kus.2		NA																	0				ovary(3)	3						c.(2632-2634)CGT>TGT		solute carrier family 12	Bumetanide(DB00887)|Potassium Chloride(DB00761)						126.0	125.0	125.0					5																	127503468		2203	4300	6503	SO:0001583	missense	6558				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity	g.chr5:127503468C>T		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2632C>T	5.37:g.127503468C>T	ENSP00000262461:p.Arg878Cys					SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Missense_Mutation_p.R878C|SLC12A2_uc003kut.1_Missense_Mutation_p.R85C	p.R878C	NM_001046	NP_001037	P55011	S12A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	18	2796	+		all_cancers(142;0.0972)|Prostate(80;0.151)	878			Extracellular (Potential).		Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	37	c.2632C>T	CCDS4144.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885466	0.72410	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.91631	-2.88;-2.88	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.96592	0.8888	M	0.88906	2.99	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.984;0.999;0.964	D	0.97308	0.9935	10	0.87932	D	0	.	16.8137	0.85727	0.0:1.0:0.0:0.0	.	878;92;878	P55011-3;Q59GB7;P55011	.;.;S12A2_HUMAN	C	878	ENSP00000262461:R878C;ENSP00000340878:R878C	ENSP00000262461:R878C	R	+	1	0	SLC12A2	127531367	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.773000	0.47686	2.503000	0.84419	0.591000	0.81541	CGT		0.333	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046		7	46	0	0	0	0.00308	0	7	46				
FBN2	2201	broad.mit.edu	37	5	127595242	127595242	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:127595242C>T	ENST00000508053.1	-	71	9618	c.8644G>A	c.(8644-8646)Gag>Aag	p.E2882K	FBN2_ENST00000262464.4_Missense_Mutation_p.E2882K			P35556	FBN2_HUMAN	fibrillin 2	2882					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTCTTAAGCTCCTTCTTCTTG	0.502																																							uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(8644-8646)GAG>AAG		fibrillin 2 precursor							209.0	190.0	196.0					5																	127595242		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127595242C>T	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8644G>A	5.37:g.127595242C>T	ENSP00000424571:p.Glu2882Lys						p.E2882K	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	65	9083	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	2882					B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.8644G>A	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591499	0.46214	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.84944	-1.92;-1.92	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000008	D	0.83124	0.5186	L	0.51422	1.61	0.37484	D	0.916115	B	0.15473	0.013	B	0.10450	0.005	T	0.78996	-0.1983	10	0.37606	T	0.19	.	19.5617	0.95375	0.0:1.0:0.0:0.0	.	2882	P35556	FBN2_HUMAN	K	2882	ENSP00000262464:E2882K;ENSP00000424571:E2882K	ENSP00000262464:E2882K	E	-	1	0	FBN2	127623141	0.657000	0.27393	1.000000	0.80357	0.991000	0.79684	1.475000	0.35409	2.859000	0.98148	0.591000	0.81541	GAG		0.502	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		5	125	0	0	0	0.001168	0	5	125				
PCDH1	5097	broad.mit.edu	37	5	141248806	141248806	+	Silent	SNP	G	G	A	rs113157473	byFrequency	TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:141248806G>A	ENST00000394536.3	-	2	370	c.231C>T	c.(229-231)ctC>ctT	p.L77L	PCDH1_ENST00000287008.3_Silent_p.L77L|PCDH1_ENST00000456271.1_Silent_p.L77L|PCDH1_ENST00000503492.1_Silent_p.L77L|PCDH1_ENST00000536585.1_Silent_p.L55L	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	77	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		AGTCGGCTGCGAGGCTCCCAA	0.597																																					Ovarian(132;1609 1739 4190 14731 45037)	Ovarian(132;1609 1739 4190 14731 45037)	uc003llq.2		NA																	0				ovary(5)	5						c.(229-231)CTC>CTT		protocadherin 1 isoform 1 precursor							39.0	38.0	38.0					5																	141248806		2203	4300	6503	SO:0001819	synonymous_variant	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141248806G>A	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.231C>T	5.37:g.141248806G>A						PCDH1_uc003llp.2_Silent_p.L77L|PCDH1_uc011dbf.1_Silent_p.L55L	p.L77L	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	2	348	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	77			Extracellular (Potential).|Cadherin 1.		Q8IUP2	Silent	SNP	ENST00000394536.3	37	c.231C>T	CCDS43375.1																																																																																				0.597	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		6	24	0	0	0	0.001168	0	6	24				
FAT2	2196	broad.mit.edu	37	5	150885619	150885619	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:150885619G>T	ENST00000261800.5	-	23	12569	c.12557C>A	c.(12556-12558)tCc>tAc	p.S4186Y		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	4186					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCGTTCCTGGAGTAAGTAGG	0.607																																							uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(12556-12558)TCC>TAC		FAT tumor suppressor 2 precursor							61.0	73.0	69.0					5																	150885619		2135	4241	6376	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150885619G>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.12557C>A	5.37:g.150885619G>T	ENSP00000261800:p.Ser4186Tyr					GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.S793Y	p.S4186Y	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		23	12570	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	4186			Cytoplasmic (Potential).		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.12557C>A	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	8.457	0.854458	0.17106	.	.	ENSG00000086570	ENST00000261800	T	0.71934	-0.61	5.02	4.09	0.47781	.	0.645972	0.14615	N	0.308763	T	0.52517	0.1739	L	0.36672	1.1	0.09310	N	1	P;P	0.47302	0.454;0.893	B;B	0.36666	0.107;0.23	T	0.48468	-0.9033	10	0.35671	T	0.21	.	5.0816	0.14659	0.1015:0.0:0.5515:0.347	.	4186;1291	Q9NYQ8;E9PDJ8	FAT2_HUMAN;.	Y	4186	ENSP00000261800:S4186Y	ENSP00000261800:S4186Y	S	-	2	0	FAT2	150865812	1.000000	0.71417	0.995000	0.50966	0.053000	0.15095	2.332000	0.43903	2.329000	0.79093	0.561000	0.74099	TCC		0.607	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		44	123	1	0	6.4771e-29	0.010771	8.59741e-29	44	123				
ITK	3702	broad.mit.edu	37	5	156672899	156672899	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:156672899T>A	ENST00000422843.3	+	15	1675	c.1523T>A	c.(1522-1524)cTg>cAg	p.L508Q	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	508	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	AGGTTCGTTCTGGATGATCAG	0.537			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	Esophageal Squamous(70;1378 1469 8785 19883)	uc003lwo.1		NA		Dom	yes		5	5q31-q32	3702	T	IL2-inducible T-cell kinase			L	SYK		peripheral T-cell lymphoma		0				lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26						c.(1522-1524)CTG>CAG		IL2-inducible T-cell kinase							115.0	113.0	113.0					5																	156672899		2203	4300	6503	SO:0001583	missense	3702				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr5:156672899T>A	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1523T>A	5.37:g.156672899T>A	ENSP00000398655:p.Leu508Gln						p.L508Q	NM_005546	NP_005537	Q08881	ITK_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		15	1605	+	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	508			Protein kinase.		B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	c.1523T>A	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370535	0.82573	.	.	ENSG00000113263	ENST00000422843	D	0.81996	-1.56	5.78	5.78	0.91487	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.058590	0.64402	D	0.000001	D	0.86070	0.5845	L	0.28054	0.825	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.88058	0.2792	10	0.87932	D	0	.	16.1138	0.81283	0.0:0.0:0.0:1.0	.	508	Q08881	ITK_HUMAN	Q	508	ENSP00000398655:L508Q	ENSP00000398655:L508Q	L	+	2	0	ITK	156605477	1.000000	0.71417	0.999000	0.59377	0.600000	0.36913	7.887000	0.87295	2.220000	0.72140	0.533000	0.62120	CTG		0.537	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			33	62	0	0	0	0.009535	0	33	62				
TENM2	57451	broad.mit.edu	37	5	167673932	167673932	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:167673932C>T	ENST00000518659.1	+	27	6027	c.5988C>T	c.(5986-5988)gtC>gtT	p.V1996V	TENM2_ENST00000520394.1_Silent_p.V1757V|TENM2_ENST00000403607.2_Silent_p.V1820V|TENM2_ENST00000519204.1_Silent_p.V1875V|TENM2_ENST00000545108.1_Silent_p.V1995V	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1996					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										ATGCTTCGGTCATCTTTGACT	0.537																																							uc010jjd.2		NA																	0				ovary(6)|central_nervous_system(4)	10						c.(5959-5961)GTC>GTT		odz, odd Oz/ten-m homolog 2							86.0	88.0	87.0					5																	167673932		2030	4190	6220	SO:0001819	synonymous_variant	57451							g.chr5:167673932C>T	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5988C>T	5.37:g.167673932C>T						ODZ2_uc003lzr.3_Silent_p.V1757V|ODZ2_uc003lzt.3_Silent_p.V1360V|ODZ2_uc010jje.2_Silent_p.V1251V	p.V1987V	NM_001122679	NP_001116151			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	27	5961	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Silent	SNP	ENST00000518659.1	37	c.5961C>T																																																																																					0.537	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		6	143	0	0	0	0.001168	0	6	143				
WWC1	23286	broad.mit.edu	37	5	167855100	167855100	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:167855100G>A	ENST00000265293.4	+	12	2375	c.1873G>A	c.(1873-1875)Gag>Aag	p.E625K	WWC1_ENST00000521089.1_Missense_Mutation_p.E625K	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	625					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CGTATCGGACGAGTCAGTGGC	0.577																																							uc003lzu.2		NA																	0				ovary(2)|skin(2)|breast(1)	5						c.(1873-1875)GAG>AAG		WW and C2 domain containing 1 isoform 3							87.0	81.0	83.0					5																	167855100		2203	4300	6503	SO:0001583	missense	23286				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity	g.chr5:167855100G>A	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.1873G>A	5.37:g.167855100G>A	ENSP00000265293:p.Glu625Lys					WWC1_uc003lzv.2_Missense_Mutation_p.E625K|WWC1_uc011den.1_Missense_Mutation_p.E625K|WWC1_uc003lzw.2_Missense_Mutation_p.E424K	p.E625K	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)	12	1966	+	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	625					B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	ENST00000265293.4	37	c.1873G>A	CCDS4366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.262710|4.262710	0.80358|0.80358	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000265293;ENST00000521089|ENST00000393895;ENST00000524228	T;T|.	0.20069|.	2.1;2.1|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82323|0.82323	0.5012|0.5012	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;0.999;1.0|.	D;D;D;D|.	0.83275|.	0.994;0.922;0.942;0.996|.	T|T	0.83078|0.83078	-0.0139|-0.0139	10|5	0.72032|.	D|.	0.01|.	.|.	19.0978|19.0978	0.93260|0.93260	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	625;531;531;625|.	Q8IX03-2;F5H498;B3KX05;Q8IX03|.	.;.;.;KIBRA_HUMAN|.	K|Q	625|586;401	ENSP00000265293:E625K;ENSP00000427772:E625K|.	ENSP00000265293:E625K|.	E|R	+|+	1|2	0|0	WWC1|WWC1	167787678|167787678	1.000000|1.000000	0.71417|0.71417	0.963000|0.963000	0.40424|0.40424	0.149000|0.149000	0.21700|0.21700	8.823000|8.823000	0.92018|0.92018	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GAG|CGA		0.577	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238		8	22	0	0	0	0.006214	0	8	22				
TRIM41	90933	broad.mit.edu	37	5	180660418	180660418	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr5:180660418C>T	ENST00000315073.5	+	4	1856	c.1146C>T	c.(1144-1146)atC>atT	p.I382I	CTC-338M12.7_ENST00000499096.2_RNA|TRIM41_ENST00000351937.5_Silent_p.I382I	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	382					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCAGGACATCAAGGAGACTT	0.517																																							uc003mne.1		NA																	0					0						c.(1144-1146)ATC>ATT		tripartite motif-containing 41 isoform 1							280.0	278.0	278.0					5																	180660418		2203	4300	6503	SO:0001819	synonymous_variant	90933					cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding	g.chr5:180660418C>T	AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.1146C>T	5.37:g.180660418C>T						uc003mnb.1_5'Flank|TRIM41_uc003mnc.1_3'UTR|TRIM41_uc003mnd.1_Silent_p.I382I|TRIM41_uc003mnf.1_Intron|TRIM41_uc010jlq.1_3'UTR|TRIM41_uc003mng.1_5'UTR	p.I382I	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		4	1840	+	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	382					B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Silent	SNP	ENST00000315073.5	37	c.1146C>T	CCDS4466.1																																																																																				0.517	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627		25	223	0	0	0	0.008361	0	25	223				
HIST1H2BB	3018	broad.mit.edu	37	6	26043780	26043780	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:26043780C>T	ENST00000357905.2	-	1	105	c.106G>A	c.(106-108)Gag>Aag	p.E36K	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	36					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						GAATAGCTCTCCTTGCGGCTG	0.507																																							uc003nfu.2		NA																	0					0						c.(106-108)GAG>AAG		histone cluster 1, H2bb							189.0	178.0	182.0					6																	26043780		2203	4300	6503	SO:0001583	missense	3018				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:26043780C>T	AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.106G>A	6.37:g.26043780C>T	ENSP00000350580:p.Glu36Lys					HIST1H3C_uc003nfv.2_5'Flank	p.E36K	NM_021062	NP_066406	P33778	H2B1B_HUMAN			1	106	-			36					Q4KN36	Missense_Mutation	SNP	ENST00000357905.2	37	c.106G>A	CCDS4575.1	.	.	.	.	.	.	.	.	.	.	c	15.17	2.753000	0.49362	.	.	ENSG00000196226	ENST00000357905	T	0.22743	1.94	5.14	4.27	0.50696	Histone-fold (2);Histone core (1);	0.000000	0.64402	U	0.000019	T	0.40119	0.1104	M	0.91354	3.2	0.43191	D	0.995024	D	0.69078	0.997	P	0.60173	0.87	T	0.55354	-0.8154	10	0.72032	D	0.01	.	13.1916	0.59715	0.0:0.9222:0.0:0.0778	.	36	P33778	H2B1B_HUMAN	K	36	ENSP00000350580:E36K	ENSP00000350580:E36K	E	-	1	0	HIST1H2BB	26151759	1.000000	0.71417	0.997000	0.53966	0.002000	0.02628	7.779000	0.85648	1.273000	0.44346	-0.150000	0.13652	GAG		0.507	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040083.1	NM_021062		49	183	0	0	0	0.01441	0	49	183				
PGBD1	84547	broad.mit.edu	37	6	28268747	28268747	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:28268747G>C	ENST00000405948.2	+	7	1536	c.1116G>C	c.(1114-1116)gaG>gaC	p.E372D	PGBD1_ENST00000259883.3_Missense_Mutation_p.E372D	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	372						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						ATGAGCCTGAGATCCAGCCTG	0.443																																							uc003nky.2		NA																	0				ovary(4)	4						c.(1114-1116)GAG>GAC		piggyBac transposable element derived 1							74.0	79.0	77.0					6																	28268747		2203	4300	6503	SO:0001583	missense	84547				viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity	g.chr6:28268747G>C	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1116G>C	6.37:g.28268747G>C	ENSP00000385213:p.Glu372Asp					PGBD1_uc003nkz.2_Missense_Mutation_p.E372D	p.E372D	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN			7	1486	+			372					Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	c.1116G>C	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	G	6.784	0.513573	0.12944	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.01438	4.89;4.89	4.54	1.7	0.24286	.	1.098120	0.07084	N	0.837562	T	0.00468	0.0015	L	0.29908	0.895	0.22017	N	0.999418	B	0.09022	0.002	B	0.08055	0.003	T	0.45264	-0.9273	10	0.39692	T	0.17	-23.2544	4.4806	0.11766	0.2036:0.1857:0.6107:0.0	.	372	Q96JS3	PGBD1_HUMAN	D	372	ENSP00000385213:E372D;ENSP00000259883:E372D	ENSP00000259883:E372D	E	+	3	2	PGBD1	28376726	0.233000	0.23772	0.240000	0.24138	0.868000	0.49771	0.484000	0.22308	0.240000	0.21263	-0.136000	0.14681	GAG		0.443	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2			10	77	0	0	0	0.006214	0	10	77				
C6orf47	57827	broad.mit.edu	37	6	31627555	31627555	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:31627555T>G	ENST00000375911.1	-	1	994	c.170A>C	c.(169-171)aAg>aCg	p.K57T	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	57						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						GTCCTTAGTCTTGGGATGCCC	0.567																																							uc003nvm.1		NA																	0				ovary(1)	1						c.(169-171)AAG>ACG		G4 protein							55.0	53.0	54.0					6																	31627555		1510	2709	4219	SO:0001583	missense	57827							g.chr6:31627555T>G	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.170A>C	6.37:g.31627555T>G	ENSP00000365076:p.Lys57Thr						p.K57T	NM_021184	NP_067007	O95873	CF047_HUMAN			1	995	-			57					B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Missense_Mutation	SNP	ENST00000375911.1	37	c.170A>C	CCDS34399.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141800	0.37825	.	.	ENSG00000204439	ENST00000375911;ENST00000538106	T	0.38401	1.14	5.44	5.44	0.79542	.	0.135302	0.33670	N	0.004667	T	0.31734	0.0806	L	0.60455	1.87	0.09310	N	1	D	0.53619	0.961	P	0.51324	0.666	T	0.18555	-1.0333	10	0.66056	D	0.02	-9.8095	11.8174	0.52218	0.0:0.0:0.0:1.0	.	57	O95873	CF047_HUMAN	T	57	ENSP00000365076:K57T	ENSP00000365076:K57T	K	-	2	0	C6orf47	31735534	0.397000	0.25270	0.568000	0.28447	0.024000	0.10985	3.427000	0.52785	2.288000	0.76882	0.533000	0.62120	AAG		0.567	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184		9	46	0	0	0	0.008291	0	9	46				
KIFC1	3833	broad.mit.edu	37	6	33373211	33373211	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:33373211G>C	ENST00000428849.2	+	7	1789	c.1339G>C	c.(1339-1341)Gag>Cag	p.E447Q		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	447	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						TGTGGCTCAGGAGCTGAGTGG	0.617																																							uc003oef.3		NA																	0					0						c.(1339-1341)GAG>CAG		kinesin family member C1							38.0	38.0	38.0					6																	33373211		2203	4300	6503	SO:0001583	missense	3833				blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity	g.chr6:33373211G>C	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1339G>C	6.37:g.33373211G>C	ENSP00000393963:p.Glu447Gln					KIFC1_uc011drf.1_Missense_Mutation_p.E439Q	p.E447Q	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN			7	1789	+			447			Kinesin-motor.		O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	ENST00000428849.2	37	c.1339G>C	CCDS34430.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094166	0.36952	.	.	ENSG00000237649	ENST00000428849	T	0.75704	-0.96	5.08	4.13	0.48395	Kinesin, motor domain (4);	0.243492	0.41712	D	0.000834	T	0.65637	0.2710	L	0.31845	0.965	0.43782	D	0.996311	P;D	0.57257	0.863;0.979	P;P	0.60173	0.606;0.87	T	0.61412	-0.7068	10	0.23302	T	0.38	-17.6042	10.3127	0.43718	0.1035:0.0:0.8965:0.0	.	439;447	B4E063;Q9BW19	.;KIFC1_HUMAN	Q	447	ENSP00000393963:E447Q	ENSP00000393963:E447Q	E	+	1	0	KIFC1	33481189	1.000000	0.71417	0.988000	0.46212	0.349000	0.29174	3.659000	0.54489	2.640000	0.89533	0.655000	0.94253	GAG		0.617	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263		5	49	0	0	0	0.014758	0	5	49				
KIFC1	3833	broad.mit.edu	37	6	33374114	33374114	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:33374114C>T	ENST00000428849.2	+	8	2128	c.1678C>T	c.(1678-1680)Ccc>Tcc	p.P560S		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	560	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GTGTGGGGCCCCCCTCAGTCT	0.642																																							uc003oef.3		NA																	0					0						c.(1678-1680)CCC>TCC		kinesin family member C1							82.0	96.0	92.0					6																	33374114		2203	4300	6503	SO:0001583	missense	3833				blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity	g.chr6:33374114C>T	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1678C>T	6.37:g.33374114C>T	ENSP00000393963:p.Pro560Ser					KIFC1_uc011drf.1_Missense_Mutation_p.P552S	p.P560S	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN			8	2128	+			560			Kinesin-motor.		O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	ENST00000428849.2	37	c.1678C>T	CCDS34430.1	.	.	.	.	.	.	.	.	.	.	c	2.667	-0.278488	0.05679	.	.	ENSG00000237649	ENST00000428849	T	0.73789	-0.78	5.22	2.42	0.29668	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	0.394256	0.28459	N	0.015268	T	0.11793	0.0287	N	0.00104	-2.125	0.23823	N	0.996747	B;B	0.09022	0.002;0.001	B;B	0.12156	0.007;0.007	T	0.46925	-0.9156	10	0.10111	T	0.7	-6.2409	10.2663	0.43457	0.0:0.7564:0.0:0.2436	.	552;560	B4E063;Q9BW19	.;KIFC1_HUMAN	S	560	ENSP00000393963:P560S	ENSP00000393963:P560S	P	+	1	0	KIFC1	33482092	0.002000	0.14202	0.813000	0.32504	0.487000	0.33371	0.211000	0.17474	0.370000	0.24538	-1.144000	0.01866	CCC		0.642	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263		64	187	0	0	0	0.01441	0	64	187				
SNRPC	6631	broad.mit.edu	37	6	34741263	34741263	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:34741263G>T	ENST00000244520.5	+	6	534	c.396G>T	c.(394-396)atG>atT	p.M132I	SNRPC_ENST00000374018.1_Missense_Mutation_p.M91I|SNRPC_ENST00000374017.3_Missense_Mutation_p.M153I|SNRPC_ENST00000474635.1_3'UTR	NM_003093.2	NP_003084.1			small nuclear ribonucleoprotein polypeptide C											endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	6						ATATGCCAATGATGCCTGGGC	0.557																																					NSCLC(131;576 1831 5287 11175 13324)	NSCLC(131;576 1831 5287 11175 13324)	uc003ojt.1		NA																	0				pancreas(1)	1						c.(394-396)ATG>ATT		small nuclear ribonucleoprotein polypeptide C							56.0	53.0	54.0					6																	34741263		2203	4300	6503	SO:0001583	missense	6631				spliceosomal snRNP assembly	Cajal body|U1 snRNP	protein homodimerization activity|single-stranded RNA binding|zinc ion binding	g.chr6:34741263G>T		CCDS34436.1	6p21	2014-03-06			ENSG00000124562	ENSG00000124562			11157	protein-coding gene	gene with protein product		603522				2971157, 8532530	Standard	NR_029472		Approved	U1-C, Yhc1	uc003ojt.2	P09234	OTTHUMG00000014555	ENST00000244520.5:c.396G>T	6.37:g.34741263G>T	ENSP00000244520:p.Met132Ile						p.M132I	NM_003093	NP_003084	P09234	RU1C_HUMAN			6	411	+			132						Missense_Mutation	SNP	ENST00000244520.5	37	c.396G>T	CCDS34436.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248285	0.80024	.	.	ENSG00000124562	ENST00000244520;ENST00000374018;ENST00000374017	T;T;T	0.51325	0.71;0.71;0.71	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	M	0.69823	2.125	0.80722	D	1	P	0.35872	0.525	B	0.42214	0.38	T	0.48559	-0.9025	10	0.46703	T	0.11	.	19.9933	0.97376	0.0:0.0:1.0:0.0	.	132	P09234	RU1C_HUMAN	I	132;91;153	ENSP00000244520:M132I;ENSP00000363130:M91I;ENSP00000363129:M153I	ENSP00000244520:M132I	M	+	3	0	SNRPC	34849241	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.330000	0.96422	2.744000	0.94065	0.542000	0.68232	ATG		0.557	SNRPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040255.1	NM_003093		6	56	1	0	3.59834e-05	0.001168	3.81759e-05	6	56				
FAM83B	222584	broad.mit.edu	37	6	54805720	54805720	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:54805720C>G	ENST00000306858.7	+	5	2067	c.1951C>G	c.(1951-1953)Cta>Gta	p.L651V	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	651										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GACAGAAAATCTAAAGAATCA	0.338																																							uc003pck.2		NA																	0				ovary(6)	6						c.(1951-1953)CTA>GTA		hypothetical protein LOC222584							53.0	55.0	54.0					6																	54805720		2201	4300	6501	SO:0001583	missense	222584							g.chr6:54805720C>G	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1951C>G	6.37:g.54805720C>G	ENSP00000304078:p.Leu651Val						p.L651V	NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN			5	2067	+	Lung NSC(77;0.0178)|Renal(3;0.122)		651					Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	c.1951C>G	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	C	8.260	0.811012	0.16537	.	.	ENSG00000168143	ENST00000306858	T	0.33654	1.4	5.55	1.55	0.23275	.	1.743360	0.02693	N	0.110849	T	0.12860	0.0312	L	0.54323	1.7	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.10917	-1.0609	10	0.17369	T	0.5	0.8018	5.9246	0.19101	0.2201:0.3973:0.3206:0.062	.	651	Q5T0W9	FA83B_HUMAN	V	651	ENSP00000304078:L651V	ENSP00000304078:L651V	L	+	1	2	FAM83B	54913679	0.000000	0.05858	0.003000	0.11579	0.979000	0.70002	-0.755000	0.04782	0.058000	0.16222	0.655000	0.94253	CTA		0.338	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		9	54	0	0	0	0.006214	0	9	54				
LACE1	246269	broad.mit.edu	37	6	108843517	108843517	+	Silent	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:108843517C>G	ENST00000368977.4	+	13	1521	c.1335C>G	c.(1333-1335)ctC>ctG	p.L445L		NM_145315.3	NP_660358.2	Q8WV93	LACE1_HUMAN	lactation elevated 1	445						mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)		CAGAAGGACTCTCCATGTTTA	0.358																																							uc003psj.2		NA																	0				central_nervous_system(1)	1						c.(1333-1335)CTC>CTG		lactation elevated 1							73.0	67.0	69.0					6																	108843517		2203	4300	6503	SO:0001819	synonymous_variant	246269						ATP binding	g.chr6:108843517C>G	AF520418	CCDS5067.1	6q22.1	2006-11-10			ENSG00000135537	ENSG00000135537			16411	protein-coding gene	gene with protein product	"""ATPase family gene 1 homolog (S. cerevisiae)"""					12079282	Standard	XM_005266885		Approved	AFG1	uc003psj.3	Q8WV93	OTTHUMG00000015324	ENST00000368977.4:c.1335C>G	6.37:g.108843517C>G							p.L445L	NM_145315	NP_660358	Q8WV93	LACE1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)	13	1521	+		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)	445					Q8N6A3	Silent	SNP	ENST00000368977.4	37	c.1335C>G	CCDS5067.1	.	.	.	.	.	.	.	.	.	.	C	8.482	0.860055	0.17178	.	.	ENSG00000135537	ENST00000421954	.	.	.	5.86	1.36	0.22044	.	.	.	.	.	T	0.36717	0.0977	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19386	-1.0307	4	.	.	.	-9.2566	5.8283	0.18566	0.0:0.456:0.277:0.267	.	.	.	.	C	313	.	.	S	+	2	0	LACE1	108950210	0.060000	0.20803	0.980000	0.43619	0.996000	0.88848	-0.770000	0.04705	0.295000	0.22570	0.655000	0.94253	TCT		0.358	LACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041719.4	NM_145315		3	51	0	0	0	0.004672	0	3	51				
ZBTB24	9841	broad.mit.edu	37	6	109787446	109787446	+	Missense_Mutation	SNP	C	C	A	rs144754453	byFrequency	TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:109787446C>A	ENST00000230122.3	-	7	1869	c.1702G>T	c.(1702-1704)Ggt>Tgt	p.G568C	MICAL1_ENST00000368952.4_5'Flank	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	568					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		TGGCTAGGACCGGGCATGAAA	0.488																																							uc003ptl.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1702-1704)GGT>TGT		zinc finger and BTB domain containing 24 isoform							124.0	120.0	122.0					6																	109787446		2203	4300	6503	SO:0001583	missense	9841				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:109787446C>A	AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1702G>T	6.37:g.109787446C>A	ENSP00000230122:p.Gly568Cys					MICAL1_uc011eaq.1_5'Flank|ZBTB24_uc011ear.1_RNA|ZBTB24_uc010kds.1_Missense_Mutation_p.G512C|ZBTB24_uc010kdt.1_RNA	p.G568C	NM_014797	NP_055612	O43167	ZBT24_HUMAN		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)	7	1870	-		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)	568					Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	37	c.1702G>T	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699060	0.48307	.	.	ENSG00000112365	ENST00000230122	T	0.11169	2.8	5.23	3.43	0.39272	.	0.465304	0.24271	N	0.039996	T	0.06325	0.0163	N	0.19112	0.55	0.09310	N	1	D	0.67145	0.996	P	0.58970	0.849	T	0.13791	-1.0496	10	0.72032	D	0.01	-13.9951	7.8953	0.29702	0.0:0.7412:0.0:0.2588	.	568	O43167	ZBT24_HUMAN	C	568	ENSP00000230122:G568C	ENSP00000230122:G568C	G	-	1	0	ZBTB24	109894139	0.009000	0.17119	0.025000	0.17156	0.813000	0.45954	1.088000	0.30877	1.548000	0.49413	0.655000	0.94253	GGT		0.488	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797		29	67	1	0	4.59853e-10	0.005443	5.31705e-10	29	67				
GPR6	2830	broad.mit.edu	37	6	110301347	110301347	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:110301347C>T	ENST00000275169.3	+	1	1050	c.1032C>T	c.(1030-1032)ctC>ctT	p.L344L	GPR6_ENST00000414000.2_Silent_p.L359L	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	344					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		GGCTCCTGCTCTGTGGCTGTT	0.597																																							uc011eaw.1		NA																	0					0						c.(1030-1032)CTC>CTT		G protein-coupled receptor 6							108.0	111.0	110.0					6																	110301347		2203	4300	6503	SO:0001819	synonymous_variant	2830					integral to plasma membrane		g.chr6:110301347C>T		CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.1032C>T	6.37:g.110301347C>T						GPR6_uc011eav.1_Silent_p.L359L|GPR6_uc003ptu.2_Silent_p.L344L	p.L344L	NM_005284	NP_005275	P46095	GPR6_HUMAN		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)	2	1212	+		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)	344			Cytoplasmic (Potential).		B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Silent	SNP	ENST00000275169.3	37	c.1032C>T	CCDS5079.1																																																																																				0.597	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041774.1			37	139	0	0	0	0.005524	0	37	139				
TAAR1	134864	broad.mit.edu	37	6	132966648	132966648	+	Silent	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:132966648G>A	ENST00000275216.1	-	1	494	c.495C>T	c.(493-495)ttC>ttT	p.F165F		NM_138327.1	NP_612200.1	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	165					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)	18	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)|Dextroamphetamine(DB01576)|Methamphetamine(DB01577)|Propylhexedrine(DB06714)	CAGCGCCTTTGAAGTTTAGCT	0.388																																							uc003qdm.1		NA																	0					0						c.(493-495)TTC>TTT		trace amine associated receptor 1	Amphetamine(DB00182)						66.0	69.0	68.0					6																	132966648		2202	4299	6501	SO:0001819	synonymous_variant	134864					plasma membrane		g.chr6:132966648G>A	AY180374	CCDS5158.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146399	ENSG00000146399		"""GPCR / Class A : Trace amine associated receptors"""	17734	protein-coding gene	gene with protein product		609333	"""trace amine receptor 1"""	TRAR1		11459929, 15718104	Standard	NM_138327		Approved	TAR1, TA1	uc003qdm.1	Q96RJ0	OTTHUMG00000015583	ENST00000275216.1:c.495C>T	6.37:g.132966648G>A							p.F165F	NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	1	495	-	Breast(56;0.135)		165			Extracellular (Potential).		Q2M1W5|Q3MIH8|Q5VUQ1	Silent	SNP	ENST00000275216.1	37	c.495C>T	CCDS5158.1																																																																																				0.388	TAAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042259.1	NM_138327		7	52	0	0	0	0.001984	0	7	52				
SYNE1	23345	broad.mit.edu	37	6	152668295	152668295	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:152668295G>T	ENST00000367255.5	-	73	12578	c.11977C>A	c.(11977-11979)Caa>Aaa	p.Q3993K	SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q3922K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q3993K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q3922K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3993					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTGCACATTGGCCAATCAAA	0.448										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(11977-11979)CAA>AAA		spectrin repeat containing, nuclear envelope 1							171.0	147.0	155.0					6																	152668295		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152668295G>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11977C>A	6.37:g.152668295G>T	ENSP00000356224:p.Gln3993Lys	HNSCC(10;0.0054)				SYNE1_uc003qot.3_Missense_Mutation_p.Q3922K|SYNE1_uc003qou.3_Missense_Mutation_p.Q3993K|SYNE1_uc010kja.1_Missense_Mutation_p.Q698K	p.Q3993K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	73	12579	-		Ovarian(120;0.0955)	3993			Spectrin 10.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.11977C>A	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637119	0.29157	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.52983	0.74;1.36;0.64;1.36	5.91	5.91	0.95273	.	0.106560	0.41605	D	0.000860	T	0.16514	0.0397	L	0.44542	1.39	0.50813	D	0.999899	B;B;B;B	0.27823	0.19;0.19;0.19;0.001	B;B;B;B	0.20955	0.032;0.032;0.032;0.001	T	0.04128	-1.0975	10	0.02654	T	1	.	9.9453	0.41604	0.0713:0.1396:0.7891:0.0	.	3993;3993;3993;3922	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	3993;3922;3993;3922	ENSP00000356224:Q3993K;ENSP00000396024:Q3922K;ENSP00000265368:Q3993K;ENSP00000390975:Q3922K	ENSP00000265368:Q3993K	Q	-	1	0	SYNE1	152709988	1.000000	0.71417	0.884000	0.34674	0.959000	0.62525	3.636000	0.54317	2.793000	0.96121	0.655000	0.94253	CAA		0.448	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		12	29	1	0	3.07112e-06	0.010729	3.37937e-06	12	29				
UNC93A	54346	broad.mit.edu	37	6	167728877	167728877	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:167728877C>G	ENST00000230256.3	+	8	1486	c.1311C>G	c.(1309-1311)atC>atG	p.I437M	UNC93A_ENST00000366829.2_Missense_Mutation_p.I395M	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	437						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AGAACCCGATCAGACCCCACG	0.537																																							uc003qvq.2		NA																	0					0						c.(1309-1311)ATC>ATG		unc-93 homolog A isoform 1							187.0	202.0	197.0					6																	167728877		2203	4300	6503	SO:0001583	missense	54346					integral to membrane|plasma membrane		g.chr6:167728877C>G	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.1311C>G	6.37:g.167728877C>G	ENSP00000230256:p.Ile437Met					UNC93A_uc003qvr.2_Missense_Mutation_p.I395M	p.I437M	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)	8	1486	+		Breast(66;7.62e-05)|Ovarian(120;0.105)	437					B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	ENST00000230256.3	37	c.1311C>G	CCDS5300.1	.	.	.	.	.	.	.	.	.	.	C	5.979	0.364532	0.11296	.	.	ENSG00000112494	ENST00000230256;ENST00000366829	T;T	0.04809	3.55;3.55	3.86	0.876	0.19138	Major facilitator superfamily domain, general substrate transporter (1);	3.677010	0.02413	N	0.081866	T	0.01061	0.0035	N	0.22421	0.69	0.09310	N	1	B;B	0.23990	0.095;0.001	B;B	0.18561	0.022;0.003	T	0.45483	-0.9258	10	0.40728	T	0.16	0.1598	2.2705	0.04089	0.1587:0.3845:0.3122:0.1446	.	395;437	Q4QQJ4;Q86WB7	.;UN93A_HUMAN	M	437;395	ENSP00000230256:I437M;ENSP00000355794:I395M	ENSP00000230256:I437M	I	+	3	3	UNC93A	167648867	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.307000	0.19296	0.230000	0.21059	-0.371000	0.07208	ATC		0.537	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974		46	217	0	0	0	0.013114	0	46	217				
IL6	3569	broad.mit.edu	37	7	22766891	22766891	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:22766891T>G	ENST00000404625.1	+	2	469	c.10T>G	c.(10-12)Ttc>Gtc	p.F4V	IL6_ENST00000406575.1_Missense_Mutation_p.F4V|IL6_ENST00000401651.1_5'UTR|IL6_ENST00000401630.3_Missense_Mutation_p.F4V|IL6_ENST00000420258.2_Missense_Mutation_p.F4V|IL6_ENST00000407492.1_5'UTR|AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000258743.5_Missense_Mutation_p.F4V			P05231	IL6_HUMAN	interleukin 6	4					acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	TATGAACTCCTTCTCCACAAG	0.597											OREG0017891	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(47;342 1214 13936 33513)	Esophageal Squamous(47;342 1214 13936 33513)	uc011jyn.1		NA																	0					0						c.(10-12)TTC>GTC		interleukin 6 precursor	Arsenic trioxide(DB01169)|Bicalutamide(DB01128)|Ginseng(DB01404)|Simvastatin(DB00641)						57.0	55.0	56.0					7																	22766891		2203	4300	6503	SO:0001583	missense	3569				acute-phase response|cellular response to hydrogen peroxide|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|defense response to virus|endocrine pancreas development|glucagon secretion|hepatic immune response|interleukin-6-mediated signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of chemokine biosynthetic process|negative regulation of collagen biosynthetic process|negative regulation of fat cell differentiation|negative regulation of lipid storage|neuron projection development|neutrophil apoptosis|platelet activation|positive regulation of acute inflammatory response|positive regulation of anti-apoptosis|positive regulation of B cell activation|positive regulation of chemokine production|positive regulation of immunoglobulin secretion|positive regulation of interleukin-6 production|positive regulation of osteoblast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of smooth muscle cell proliferation|positive regulation of T cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of translation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of vascular endothelial growth factor production|response to glucocorticoid stimulus|response to peptidoglycan	extracellular space|interleukin-6 receptor complex	cytokine activity|growth factor activity|interleukin-6 receptor binding	g.chr7:22766891T>G	M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.10T>G	7.37:g.22766891T>G	ENSP00000385675:p.Phe4Val		OREG0017891	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	758	uc010kun.1_Intron|IL6_uc011jyo.1_Missense_Mutation_p.F4V|IL6_uc011jyp.1_5'UTR|IL6_uc003svj.3_Missense_Mutation_p.F4V|IL6_uc011jyq.1_Missense_Mutation_p.F4V	p.F4V	NM_000600	NP_000591	P05231	IL6_HUMAN			2	469	+			4					Q9UCU2|Q9UCU3|Q9UCU4	Missense_Mutation	SNP	ENST00000404625.1	37	c.10T>G	CCDS5375.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.437914	0.01098	.	.	ENSG00000136244	ENST00000404625;ENST00000426291;ENST00000258743;ENST00000420258;ENST00000401630;ENST00000406575	T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;0.61;1.89;-0.45	5.55	0.5	0.16919	.	0.555805	0.17174	N	0.184141	T	0.48926	0.1527	L	0.34521	1.04	0.09310	N	1	B;B;B	0.16802	0.0;0.019;0.002	B;B;B	0.14023	0.0;0.01;0.004	T	0.33904	-0.9850	10	0.48119	T	0.1	-0.004	5.0406	0.14456	0.0:0.4235:0.2675:0.309	.	4;4;4	B4DNQ5;B5MC14;P05231	.;.;IL6_HUMAN	V	4	ENSP00000385675:F4V;ENSP00000405150:F4V;ENSP00000258743:F4V;ENSP00000405994:F4V;ENSP00000384928:F4V;ENSP00000385227:F4V	ENSP00000258743:F4V	F	+	1	0	IL6	22733416	0.001000	0.12720	0.312000	0.25196	0.082000	0.17680	-0.456000	0.06754	-0.336000	0.08438	-0.765000	0.03448	TTC		0.597	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250225.2	NM_000600		19	43	0	0	0	0.007413	0	19	43				
AOAH	313	broad.mit.edu	37	7	36713594	36713594	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:36713594T>C	ENST00000258749.5	-	3	643	c.244A>G	c.(244-246)Acc>Gcc	p.T82A	AOAH_ENST00000431169.1_Missense_Mutation_p.T82A|AOAH_ENST00000535891.1_Missense_Mutation_p.T50A	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	82	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						AAATAGCAGGTGGTTTTCAAG	0.333																																							uc003tfh.3		NA																	0				skin(1)	1						c.(244-246)ACC>GCC		acyloxyacyl hydrolase precursor							95.0	88.0	91.0					7																	36713594		2203	4300	6503	SO:0001583	missense	313				inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity	g.chr7:36713594T>C	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.244A>G	7.37:g.36713594T>C	ENSP00000258749:p.Thr82Ala					AOAH_uc010kxf.2_Missense_Mutation_p.T82A|AOAH_uc011kba.1_Missense_Mutation_p.T50A	p.T82A	NM_001637	NP_001628	P28039	AOAH_HUMAN			3	645	-			82			Saposin B-type.		A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	37	c.244A>G	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	T	1.617	-0.522399	0.04141	.	.	ENSG00000136250	ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647;ENST00000435386	T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72	5.14	1.46	0.22682	Saposin-like (2);Saposin-like type B, 2 (1);Saposin B (2);	0.495986	0.21436	N	0.074579	T	0.37839	0.1018	.	.	.	0.27775	N	0.943349	B;B;B	0.22746	0.002;0.074;0.002	B;B;B	0.17979	0.015;0.02;0.005	T	0.30238	-0.9985	9	0.05436	T	0.98	.	3.3141	0.07027	0.1698:0.1827:0.0:0.6475	.	50;82;82	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	A	50;82;82;82;50	ENSP00000441101:T50A;ENSP00000258749:T82A;ENSP00000405683:T82A;ENSP00000416051:T50A	ENSP00000258749:T82A	T	-	1	0	AOAH	36680119	0.954000	0.32549	0.372000	0.25991	0.899000	0.52679	0.704000	0.25661	0.161000	0.19458	0.528000	0.53228	ACC		0.333	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637		8	18	0	0	0	0.00308	0	8	18				
ADCY1	107	broad.mit.edu	37	7	45632476	45632476	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:45632476G>T	ENST00000297323.7	+	2	780	c.758G>T	c.(757-759)cGa>cTa	p.R253L	ADCY1_ENST00000432715.1_Missense_Mutation_p.R28L	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	253					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ATTGAGGACCGACTGAGGCTG	0.592																																							uc003tne.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(757-759)CGA>CTA		adenylate cyclase 1	Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						110.0	101.0	104.0					7																	45632476		2203	4300	6503	SO:0001583	missense	107				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding	g.chr7:45632476G>T	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.758G>T	7.37:g.45632476G>T	ENSP00000297323:p.Arg253Leu					ADCY1_uc003tnd.2_Missense_Mutation_p.R28L	p.R253L	NM_021116	NP_066939	Q08828	ADCY1_HUMAN			2	776	+			253			Cytoplasmic (Potential).		A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	c.758G>T	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	G	30	5.055467	0.93793	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.83591	-1.74;-1.68	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.91590	0.7343	M	0.87097	2.86	0.80722	D	1	P;D	0.71674	0.838;0.998	B;D	0.65874	0.346;0.939	D	0.92953	0.6382	10	0.72032	D	0.01	.	16.2739	0.82634	0.0:0.0:1.0:0.0	.	253;28	Q08828;C9J1J0	ADCY1_HUMAN;.	L	28;253;253	ENSP00000392721:R28L;ENSP00000297323:R253L	ENSP00000297323:R253L	R	+	2	0	ADCY1	45599001	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.501000	0.81600	2.412000	0.81896	0.484000	0.47621	CGA		0.592	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		33	50	1	0	9.78485e-24	0.013726	1.27031e-23	33	50				
POM121L12	285877	broad.mit.edu	37	7	53104099	53104099	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:53104099C>T	ENST00000408890.4	+	1	751	c.735C>T	c.(733-735)ctC>ctT	p.L245L		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	245										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCTGGAGCCTCAGTTTTTGTG	0.647																																							uc003tpz.2		NA																	0					0						c.(733-735)CTC>CTT		POM121 membrane glycoprotein-like 12							48.0	56.0	53.0					7																	53104099		1999	4147	6146	SO:0001819	synonymous_variant	285877							g.chr7:53104099C>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.735C>T	7.37:g.53104099C>T							p.L245L	NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN			1	751	+			245					Q8NDI9	Silent	SNP	ENST00000408890.4	37	c.735C>T	CCDS43584.1																																																																																				0.647	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		17	67	0	0	0	0.006122	0	17	67				
WBSCR28	135886	broad.mit.edu	37	7	73280063	73280063	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:73280063G>C	ENST00000320531.2	+	3	694	c.658G>C	c.(658-660)Gag>Cag	p.E220Q		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	220						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				GGCTGCCTTTGAGCACACGAC	0.632																																							uc003tzk.2		NA																	0				breast(1)	1						c.(658-660)GAG>CAG		hypothetical protein LOC135886							132.0	144.0	140.0					7																	73280063		2170	4265	6435	SO:0001583	missense	135886					integral to membrane		g.chr7:73280063G>C	BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.658G>C	7.37:g.73280063G>C	ENSP00000316775:p.Glu220Gln					RFC2_uc011kfa.1_Intron|WBSCR28_uc003tzl.2_Missense_Mutation_p.E119Q	p.E220Q	NM_182504	NP_872310	Q6UE05	WBS28_HUMAN			3	694	+		Lung NSC(55;0.159)	220					Q6UE04|Q8NHP4	Missense_Mutation	SNP	ENST00000320531.2	37	c.658G>C	CCDS43597.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997678	0.74818	.	.	ENSG00000175877	ENST00000320531	T	0.27890	1.64	4.15	4.15	0.48705	.	0.186239	0.26251	N	0.025442	T	0.42517	0.1206	L	0.36672	1.1	0.24971	N	0.991668	D	0.76494	0.999	D	0.68943	0.961	T	0.16571	-1.0398	10	0.87932	D	0	-14.5053	12.2132	0.54391	0.0:0.0:1.0:0.0	.	220	Q6UE05	WBS28_HUMAN	Q	220	ENSP00000316775:E220Q	ENSP00000316775:E220Q	E	+	1	0	WBSCR28	72917999	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.446000	0.60014	2.325000	0.78763	0.644000	0.83932	GAG		0.632	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348130.1	NM_182504		30	233	0	0	0	0.00632	0	30	233				
SMURF1	57154	broad.mit.edu	37	7	98655126	98655126	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:98655126C>G	ENST00000361125.1	-	4	571	c.252G>C	c.(250-252)aaG>aaC	p.K84N	SMURF1_ENST00000480055.1_5'UTR|SMURF1_ENST00000361368.2_Missense_Mutation_p.K84N	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	84	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			TGTGAATTTTCTTATGGTTCC	0.408																																							uc003upu.1		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(250-252)AAG>AAC		Smad ubiquitination regulatory factor 1 isoform							126.0	131.0	130.0					7																	98655126		2203	4300	6503	SO:0001583	missense	57154				BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity	g.chr7:98655126C>G	AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.252G>C	7.37:g.98655126C>G	ENSP00000354621:p.Lys84Asn					SMURF1_uc003upv.1_Missense_Mutation_p.K84N|SMURF1_uc003upt.2_Missense_Mutation_p.K84N	p.K84N	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)		4	572	-	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		84			C2.		A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	ENST00000361125.1	37	c.252G>C	CCDS34690.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.869278	0.91587	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	T;T	0.65732	-0.17;-0.17	6.02	6.02	0.97574	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.040549	0.85682	D	0.000000	T	0.68146	0.2969	L	0.28400	0.85	0.80722	D	1	D;D;D	0.59767	0.968;0.986;0.986	P;D;P	0.63192	0.69;0.912;0.884	T	0.69800	-0.5047	10	0.72032	D	0.01	.	15.5958	0.76578	0.0:0.9329:0.0:0.0671	.	84;84;84	Q9HCE7-2;Q9HCE7;B9EGV3	.;SMUF1_HUMAN;.	N	84	ENSP00000355326:K84N;ENSP00000354621:K84N	ENSP00000354621:K84N	K	-	3	2	SMURF1	98493062	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.669000	0.46825	2.865000	0.98341	0.655000	0.94253	AAG		0.408	SMURF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335001.2	NM_020429		9	59	0	0	0	0.004482	0	9	59				
SLC26A4	5172	broad.mit.edu	37	7	107342395	107342395	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:107342395G>C	ENST00000265715.3	+	17	2151	c.1927G>C	c.(1927-1929)Gag>Cag	p.E643Q	SLC26A4_ENST00000543100.1_Missense_Mutation_p.E212Q|SLC26A4_ENST00000541474.1_Missense_Mutation_p.E204Q|SLC26A4_ENST00000544569.1_Missense_Mutation_p.E230Q	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	643	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTGGAACTCTGAGCTTCCAGT	0.428									Pendred syndrome																														uc003vep.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(1927-1929)GAG>CAG		pendrin							127.0	111.0	117.0					7																	107342395		2203	4300	6503	SO:0001583	missense	5172	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity	g.chr7:107342395G>C	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1927G>C	7.37:g.107342395G>C	ENSP00000265715:p.Glu643Gln					SLC26A4_uc011kmb.1_Missense_Mutation_p.E230Q|SLC26A4_uc011kmc.1_Missense_Mutation_p.E204Q|SLC26A4_uc011kmd.1_Missense_Mutation_p.E212Q	p.E643Q	NM_000441	NP_000432	O43511	S26A4_HUMAN			17	2151	+			643			STAS.|Cytoplasmic (Potential).		B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	c.1927G>C	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673303	0.88445	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.95171	-3.25;-3.54;-3.59;-3.63	5.89	5.89	0.94794	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.056145	0.64402	D	0.000002	D	0.96297	0.8792	L	0.58669	1.825	0.52099	D	0.99994	D;D;B	0.57257	0.979;0.977;0.149	P;P;B	0.60068	0.849;0.868;0.091	D	0.95850	0.8874	10	0.56958	D	0.05	.	20.2576	0.98430	0.0:0.0:1.0:0.0	.	204;230;643	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	Q	643;204;230;212	ENSP00000265715:E643Q;ENSP00000439743:E204Q;ENSP00000437427:E230Q;ENSP00000441209:E212Q	ENSP00000265715:E643Q	E	+	1	0	SLC26A4	107129631	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.820000	0.75267	2.783000	0.95769	0.655000	0.94253	GAG		0.428	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441		6	56	0	0	0	0.001168	0	6	56				
TAS2R16	50833	broad.mit.edu	37	7	122635339	122635339	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:122635339C>T	ENST00000249284.2	-	1	415	c.350G>A	c.(349-351)tGg>tAg	p.W117*		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCACCTCAGCCAGAGAAAGAT	0.398																																							uc003vkl.1		NA																	0				ovary(1)|skin(1)	2						c.(349-351)TGG>TAG		taste receptor T2R16							80.0	77.0	78.0					7																	122635339		2203	4300	6503	SO:0001587	stop_gained	50833				detection of chemical stimulus involved in sensory perception of bitter taste	endoplasmic reticulum|external side of plasma membrane|trans-Golgi network	bitter taste receptor activity|protein binding	g.chr7:122635339C>T	AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.350G>A	7.37:g.122635339C>T	ENSP00000249284:p.Trp117*						p.W117*	NM_016945	NP_058641	Q9NYV7	T2R16_HUMAN			1	416	-			117			Cytoplasmic (Potential).		A4D0X2|Q502V3|Q549U8|Q645W1	Nonsense_Mutation	SNP	ENST00000249284.2	37	c.350G>A	CCDS5785.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547536	0.65311	.	.	ENSG00000128519	ENST00000249284	.	.	.	4.41	2.47	0.30058	.	0.406531	0.24757	N	0.035855	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1965	0.37231	0.3957:0.6043:0.0:0.0	.	.	.	.	X	117	.	ENSP00000249284:W117X	W	-	2	0	TAS2R16	122422575	1.000000	0.71417	0.997000	0.53966	0.538000	0.34931	1.603000	0.36794	0.524000	0.28502	0.655000	0.94253	TGG		0.398	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347409.1	NM_016945		7	34	0	0	0	0.001984	0	7	34				
SLC37A3	84255	broad.mit.edu	37	7	140043315	140043315	+	Missense_Mutation	SNP	G	G	A	rs573227005		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:140043315G>A	ENST00000326232.9	-	13	1426	c.1223C>T	c.(1222-1224)gCg>gTg	p.A408V	SLC37A3_ENST00000447932.2_Missense_Mutation_p.A392V|SLC37A3_ENST00000340308.3_Intron	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	408					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					ACCCAAGTCCGCAGAAATAGC	0.453																																					Esophageal Squamous(133;211 1716 4665 11387 37873)	Esophageal Squamous(133;211 1716 4665 11387 37873)	uc003vvo.2		NA																	0				ovary(3)	3						c.(1222-1224)GCG>GTG		solute carrier family 37 (glycerol-3-phosphate							84.0	75.0	78.0					7																	140043315		2203	4300	6503	SO:0001583	missense	84255				carbohydrate transport|transmembrane transport	integral to membrane		g.chr7:140043315G>A	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.1223C>T	7.37:g.140043315G>A	ENSP00000321498:p.Ala408Val					SLC37A3_uc003vvn.2_Missense_Mutation_p.A8V|SLC37A3_uc003vvp.2_Intron|SLC37A3_uc010lnh.2_Missense_Mutation_p.A392V	p.A408V	NM_207113	NP_996996	Q8NCC5	SPX3_HUMAN			13	1389	-	Melanoma(164;0.0142)		408					Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	37	c.1223C>T	CCDS5859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.528251|4.528251	0.85706|0.85706	.|.	.|.	ENSG00000157800|ENSG00000157800	ENST00000447932;ENST00000326232;ENST00000498469|ENST00000485538;ENST00000477006	T;T;T|.	0.59638|.	0.25;0.38;0.25|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.213426|.	0.48286|.	D|.	0.000188|.	D|D	0.83243|0.83243	0.5212|0.5212	M|M	0.85373|0.85373	2.75|2.75	0.80722|0.80722	D|D	1|1	P;D;D|.	0.55605|.	0.927;0.971;0.972|.	P;P;B|.	0.51701|.	0.677;0.514;0.425|.	D|D	0.84451|0.84451	0.0588|0.0588	10|5	0.46703|.	T|.	0.11|.	-29.9947|-29.9947	19.451|19.451	0.94867|0.94867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	392;408;20|.	Q8NCC5-2;Q8NCC5;B3KX37|.	.;SPX3_HUMAN;.|.	V|W	392;408;47|6;46	ENSP00000397481:A392V;ENSP00000321498:A408V;ENSP00000418158:A47V|.	ENSP00000321498:A408V|.	A|R	-|-	2|1	0|2	SLC37A3|SLC37A3	139689784|139689784	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	9.751000|9.751000	0.98889|0.98889	2.593000|2.593000	0.87608|0.87608	0.655000|0.655000	0.94253|0.94253	GCG|CGG		0.453	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295		24	52	0	0	0	0.014323	0	24	52				
ABCB8	11194	broad.mit.edu	37	7	150730745	150730745	+	Missense_Mutation	SNP	G	G	T	rs375303002		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:150730745G>T	ENST00000297504.6	+	3	266	c.200G>T	c.(199-201)cGg>cTg	p.R67L	ABCB8_ENST00000498578.1_Missense_Mutation_p.R50L|ABCB8_ENST00000477719.1_Missense_Mutation_p.R50L|ABCB8_ENST00000542328.1_Intron|ABCB8_ENST00000356058.4_Missense_Mutation_p.R87L|ABCB8_ENST00000493338.1_3'UTR|ABCB8_ENST00000358849.4_Missense_Mutation_p.R50L|ABCB8_ENST00000477092.1_Missense_Mutation_p.R50L			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	67					transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	GCCCACCTGCGGTCCCAGCTC	0.677																																							uc003wil.3		NA																	0				breast(2)|upper_aerodigestive_tract(1)	3						c.(199-201)CGG>CTG		ATP-binding cassette, sub-family B, member 8							42.0	45.0	44.0					7																	150730745		2203	4299	6502	SO:0001583	missense	11194					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr7:150730745G>T	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.200G>T	7.37:g.150730745G>T	ENSP00000297504:p.Arg67Leu					ABCB8_uc003wii.2_Missense_Mutation_p.R87L|ABCB8_uc003wij.3_Missense_Mutation_p.R50L|ABCB8_uc010lpw.1_Intron|ABCB8_uc010lpx.2_Missense_Mutation_p.R50L|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Missense_Mutation_p.R50L	p.R67L	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	293	+			67					A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37	c.200G>T		.	.	.	.	.	.	.	.	.	.	G	8.949	0.967781	0.18659	.	.	ENSG00000197150	ENST00000461373;ENST00000358849;ENST00000360651;ENST00000297504;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	D;D;D;D;D;D	0.91407	-2.7;-2.71;-2.84;-1.97;-2.23;-2.1	3.51	1.61	0.23674	.	0.439888	0.25081	N	0.033291	T	0.81716	0.4881	L	0.29908	0.895	0.21325	N	0.999721	P;P;P;P;B	0.44690	0.589;0.589;0.841;0.719;0.023	B;B;B;B;B	0.41466	0.149;0.149;0.358;0.149;0.008	T	0.72083	-0.4397	10	0.33141	T	0.24	-4.7789	5.0366	0.14438	0.1193:0.2133:0.6674:0.0	.	50;67;50;50;87	A5D8W3;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.;ABCB8_HUMAN;.;.;.	L	87;50;50;67;50;87;50;50	ENSP00000351717:R50L;ENSP00000297504:R67L;ENSP00000418271:R50L;ENSP00000348353:R87L;ENSP00000419891:R50L;ENSP00000419558:R50L	ENSP00000297504:R67L	R	+	2	0	ABCB8	150361678	0.003000	0.15002	0.142000	0.22268	0.238000	0.25445	0.455000	0.21843	0.445000	0.26639	0.561000	0.74099	CGG		0.677	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188		20	60	1	0	1.01871e-10	0.008871	1.18716e-10	20	60				
DLGAP2	9228	broad.mit.edu	37	8	1497705	1497705	+	Silent	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:1497705C>T	ENST00000421627.2	+	2	980	c.846C>T	c.(844-846)gaC>gaT	p.D282D		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	361					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TGACGCCCGACGCCAAGTACC	0.647																																							uc003wpl.2		NA																	0					0						c.(844-846)GAC>GAT		discs large-associated protein 2							26.0	30.0	28.0					8																	1497705		2161	4275	6436	SO:0001819	synonymous_variant	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497705C>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.846C>T	8.37:g.1497705C>T						DLGAP2_uc003wpm.2_Silent_p.D282D	p.D282D	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	943	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	361					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	c.846C>T	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	0.030	-1.339180	0.01287	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.3	-6.51	0.01878	.	.	.	.	.	T	0.38134	0.1029	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37753	-0.9692	4	.	.	.	-10.0145	3.5557	0.07863	0.1768:0.1667:0.0886:0.5679	.	.	.	.	M	299	.	.	T	+	2	0	DLGAP2	1485112	0.626000	0.27120	0.000000	0.03702	0.028000	0.11728	-0.263000	0.08670	-2.123000	0.00823	-1.731000	0.00696	ACG		0.647	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		16	27	0	0	0	0.003163	0	16	27				
PIWIL2	55124	broad.mit.edu	37	8	22147834	22147834	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:22147834C>T	ENST00000454009.2	+	10	1665	c.1156C>T	c.(1156-1158)Cgg>Tgg	p.R386W	PIWIL2_ENST00000521356.1_Missense_Mutation_p.R386W|PIWIL2_ENST00000356766.6_Missense_Mutation_p.R386W	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	386	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TAAGGTCATTCGGAATGACTG	0.473																																							uc003xbn.2		NA																	0				skin(1)	1						c.(1156-1158)CGG>TGG		piwi-like 2							166.0	133.0	144.0					8																	22147834		2203	4300	6503	SO:0001583	missense	55124				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding	g.chr8:22147834C>T	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.1156C>T	8.37:g.22147834C>T	ENSP00000406956:p.Arg386Trp					PIWIL2_uc011kzf.1_Missense_Mutation_p.R386W|PIWIL2_uc010ltv.2_Missense_Mutation_p.R386W	p.R386W	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN		Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)	10	1304	+			386			PAZ.		A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Missense_Mutation	SNP	ENST00000454009.2	37	c.1156C>T	CCDS6029.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045236	0.55110	.	.	ENSG00000197181	ENST00000356766;ENST00000521356;ENST00000454009	T;T;T	0.15952	2.38;2.38;2.38	5.63	4.73	0.59995	Argonaute/Dicer protein, PAZ (1);	0.000000	0.85682	D	0.000000	T	0.52008	0.1708	H	0.94306	3.52	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.978	T	0.66248	-0.5971	10	0.87932	D	0	-15.227	13.2624	0.60113	0.2874:0.7126:0.0:0.0	.	386;386	E7ECA4;Q8TC59	.;PIWL2_HUMAN	W	386	ENSP00000349208:R386W;ENSP00000428267:R386W;ENSP00000406956:R386W	ENSP00000349208:R386W	R	+	1	2	PIWIL2	22203779	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	1.775000	0.38584	1.463000	0.47967	0.655000	0.94253	CGG		0.473	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375438.1			3	22	0	0	0	0.004672	0	3	22				
PURG	29942	broad.mit.edu	37	8	30889608	30889608	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:30889608C>G	ENST00000475541.1	-	1	1623	c.691G>C	c.(691-693)Gag>Cag	p.E231Q	PURG_ENST00000339382.2_Missense_Mutation_p.E231Q|WRN_ENST00000298139.5_5'Flank	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	231						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		TCACGAAACTCAATCATTCCT	0.493																																							uc003xin.2		NA																	0					0						c.(691-693)GAG>CAG		purine-rich element binding protein G isoform A							135.0	112.0	120.0					8																	30889608		2203	4300	6503	SO:0001583	missense	29942					nucleus	DNA binding	g.chr8:30889608C>G	AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.691G>C	8.37:g.30889608C>G	ENSP00000418721:p.Glu231Gln					WRN_uc003xio.3_5'Flank|PURG_uc003xim.1_Missense_Mutation_p.E231Q	p.E231Q	NM_013357	NP_037489	Q9UJV8	PURG_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)	1	710	-			231			By similarity.		Q8TE64	Missense_Mutation	SNP	ENST00000475541.1	37	c.691G>C	CCDS6081.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141811	0.77775	.	.	ENSG00000172733	ENST00000339382;ENST00000475541	T;T	0.48522	0.81;0.81	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.70360	0.3215	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	T	0.70753	-0.4786	10	0.41790	T	0.15	-11.565	18.4618	0.90741	0.0:1.0:0.0:0.0	.	231;231	Q9UJV8;Q9UJV8-2	PURG_HUMAN;.	Q	231	ENSP00000345168:E231Q;ENSP00000418721:E231Q	ENSP00000345168:E231Q	E	-	1	0	PURG	31009150	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.438000	0.82558	0.655000	0.94253	GAG		0.493	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348565.1	NM_013357		5	81	0	0	0	0.014758	0	5	81				
SLC10A5	347051	broad.mit.edu	37	8	82606523	82606523	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:82606523C>G	ENST00000518568.1	-	1	1886	c.685G>C	c.(685-687)Gat>Cat	p.D229H		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	229						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						AAATCTCCATCTAGAAGCAGA	0.458																																							uc011lfs.1		NA																	0					0						c.(685-687)GAT>CAT		solute carrier family 10 (sodium/bile acid							99.0	103.0	102.0					8																	82606523		2203	4300	6503	SO:0001583	missense	347051					integral to membrane	bile acid:sodium symporter activity	g.chr8:82606523C>G		CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.685G>C	8.37:g.82606523C>G	ENSP00000428612:p.Asp229His						p.D229H	NM_001010893	NP_001010893	Q5PT55	NTCP5_HUMAN			1	685	-			229			Cytoplasmic (Potential).		B2RN26	Missense_Mutation	SNP	ENST00000518568.1	37	c.685G>C	CCDS34915.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930289	0.73327	.	.	ENSG00000253598	ENST00000518568	T	0.12039	2.72	6.1	6.1	0.99115	.	0.221624	0.31472	N	0.007589	T	0.18964	0.0455	L	0.31157	0.91	0.47341	D	0.999397	P	0.46142	0.873	P	0.49140	0.601	T	0.00166	-1.1965	10	0.42905	T	0.14	-7.7369	18.2085	0.89863	0.0:1.0:0.0:0.0	.	229	Q5PT55	NTCP5_HUMAN	H	229	ENSP00000428612:D229H	ENSP00000428612:D229H	D	-	1	0	SLC10A5	82769078	0.983000	0.35010	0.793000	0.32043	0.624000	0.37722	3.668000	0.54554	2.902000	0.99343	0.650000	0.86243	GAT		0.458	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493		8	164	0	0	0	0.00308	0	8	164				
ATP6V1C1	528	broad.mit.edu	37	8	104066182	104066182	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:104066182C>T	ENST00000395862.3	+	7	703	c.544C>T	c.(544-546)Ctc>Ttc	p.L182F	ATP6V1C1_ENST00000521514.1_Missense_Mutation_p.L107F|ATP6V1C1_ENST00000518738.1_Missense_Mutation_p.L182F|ATP6V1C1_ENST00000518857.1_Missense_Mutation_p.L107F	NM_001695.4	NP_001686.1	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1	182					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			TTCAGAGTATCTCGTCACATT	0.318																																							uc003ykz.3		NA																	0					0						c.(544-546)CTC>TTC		ATPase, H+ transporting, lysosomal V1 subunit							154.0	149.0	150.0					8																	104066182		2203	4299	6502	SO:0001583	missense	528				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr8:104066182C>T	X69151	CCDS6296.1	8p22.3	2011-05-24	2006-01-13	2002-05-10	ENSG00000155097	ENSG00000155097	3.6.3.14	"""ATPases / V-type"""	856	protein-coding gene	gene with protein product		603097	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 42kD"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1"""	ATP6D, ATP6C		8250920, 14580332	Standard	NM_001695		Approved	VATC, Vma5	uc003ykz.4	P21283	OTTHUMG00000164761	ENST00000395862.3:c.544C>T	8.37:g.104066182C>T	ENSP00000379203:p.Leu182Phe					ATP6V1C1_uc010mbz.2_Missense_Mutation_p.L107F|ATP6V1C1_uc003yla.2_Missense_Mutation_p.L182F|ATP6V1C1_uc011lhl.1_Missense_Mutation_p.L107F	p.L182F	NM_001695	NP_001686	P21283	VATC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)		7	789	+	Lung NSC(17;0.000427)|all_lung(17;0.000533)		182						Missense_Mutation	SNP	ENST00000395862.3	37	c.544C>T	CCDS6296.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418906	0.83559	.	.	ENSG00000155097	ENST00000518857;ENST00000395862;ENST00000521514;ENST00000518738	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.84875	0.5569	H	0.95043	3.615	0.80722	D	1	P	0.38048	0.616	P	0.56398	0.797	D	0.87200	0.2240	10	0.72032	D	0.01	.	10.4505	0.44520	0.0:0.8804:0.0:0.1196	.	182	P21283	VATC1_HUMAN	F	107;182;107;182	ENSP00000428204:L107F;ENSP00000379203:L182F;ENSP00000430129:L107F;ENSP00000430282:L182F	ENSP00000379203:L182F	L	+	1	0	ATP6V1C1	104135358	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	5.995000	0.70631	2.563000	0.86464	0.655000	0.94253	CTC		0.318	ATP6V1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380101.1	NM_001695		12	65	0	0	0	0.010729	0	12	65				
TRPS1	7227	broad.mit.edu	37	8	116426349	116426349	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:116426349G>T	ENST00000220888.5	-	6	3907	c.3748C>A	c.(3748-3750)Cat>Aat	p.H1250N	TRPS1_ENST00000520276.1_Missense_Mutation_p.H1254N|TRPS1_ENST00000519076.1_Missense_Mutation_p.H1004N|TRPS1_ENST00000395715.3_Missense_Mutation_p.H1263N			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1250	Transcriptional repressor domain. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GTGCAAAGATGCTGGCATATG	0.433									Langer-Giedion syndrome																														uc003ynz.2		NA																	0				ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(3748-3750)CAT>AAT		zinc finger transcription factor TRPS1							177.0	168.0	171.0					8																	116426349		1989	4167	6156	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116426349G>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3748C>A	8.37:g.116426349G>T	ENSP00000220888:p.His1250Asn					TRPS1_uc011lhy.1_Missense_Mutation_p.H1254N|TRPS1_uc003yny.2_Missense_Mutation_p.H1263N|TRPS1_uc010mcy.2_Missense_Mutation_p.H1250N	p.H1250N	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		6	4207	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		1250			C2H2-type 7.|Transcriptional repressor domain (By similarity).		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.3748C>A		.	.	.	.	.	.	.	.	.	.	G	15.29	2.789850	0.50102	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.43	5.43	0.79202	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.47691	0.1459	L	0.46157	1.445	0.80722	D	1	P;P;P	0.42409	0.779;0.671;0.779	B;B;B	0.44278	0.445;0.259;0.445	T	0.51608	-0.8684	10	0.87932	D	0	.	13.535	0.61643	0.0748:0.0:0.9252:0.0	.	1254;1250;1263	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	N	1263;1250;1004;1254	ENSP00000379065:H1263N;ENSP00000220888:H1250N;ENSP00000428910:H1004N;ENSP00000428680:H1254N	ENSP00000220888:H1250N	H	-	1	0	TRPS1	116495525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.457000	0.73505	2.525000	0.85131	0.655000	0.94253	CAT		0.433	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		57	98	1	0	2.78941e-39	0.01441	3.73604e-39	57	98				
ADCY8	114	broad.mit.edu	37	8	131955663	131955663	+	Silent	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:131955663G>T	ENST00000286355.5	-	4	3379	c.1287C>A	c.(1285-1287)acC>acA	p.T429T	RP11-737F9.1_ENST00000523318.1_RNA|ADCY8_ENST00000377928.3_Silent_p.T429T	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	429					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GAGCAGACAAGGTCGTGGAGA	0.453										HNSCC(32;0.087)																													uc003ytd.3		NA																	0				skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(1285-1287)ACC>ACA		adenylate cyclase 8							59.0	56.0	57.0					8																	131955663		2203	4300	6503	SO:0001819	synonymous_variant	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:131955663G>T	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1287C>A	8.37:g.131955663G>T		HNSCC(32;0.087)				ADCY8_uc010mds.2_Silent_p.T429T	p.T429T	NM_001115	NP_001106	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		4	1543	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		429			Cytoplasmic (Potential).			Silent	SNP	ENST00000286355.5	37	c.1287C>A	CCDS6363.1																																																																																				0.453	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			5	40	1	0	1.23904e-05	0.014758	1.35334e-05	5	40				
PLEC	5339	broad.mit.edu	37	8	144992837	144992837	+	Nonsense_Mutation	SNP	C	C	A	rs201007788		TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:144992837C>A	ENST00000322810.4	-	32	11732	c.11563G>T	c.(11563-11565)Gag>Tag	p.E3855*	PLEC_ENST00000345136.3_Nonsense_Mutation_p.E3718*|PLEC_ENST00000357649.2_Nonsense_Mutation_p.E3722*|PLEC_ENST00000398774.2_Nonsense_Mutation_p.E3686*|PLEC_ENST00000527096.1_Nonsense_Mutation_p.E3741*|PLEC_ENST00000354958.2_Nonsense_Mutation_p.E3696*|PLEC_ENST00000354589.3_Nonsense_Mutation_p.E3718*|PLEC_ENST00000436759.2_Nonsense_Mutation_p.E3745*|PLEC_ENST00000356346.3_Nonsense_Mutation_p.E3704*	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3855	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.E3745K(1)|p.E3718K(1)|p.E3855K(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGGGCCACCTCGGCACTCAGC	0.652																																							uc003zaf.1		NA																	3	Substitution - Missense(3)		cervix(3)	large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(11563-11565)GAG>TAG		plectin isoform 1							25.0	31.0	29.0					8																	144992837		1927	4061	5988	SO:0001587	stop_gained	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144992837C>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11563G>T	8.37:g.144992837C>A	ENSP00000323856:p.Glu3855*					PLEC_uc003zab.1_Nonsense_Mutation_p.E3718*|PLEC_uc003zac.1_Nonsense_Mutation_p.E3722*|PLEC_uc003zad.2_Nonsense_Mutation_p.E3718*|PLEC_uc003zae.1_Nonsense_Mutation_p.E3686*|PLEC_uc003zag.1_Nonsense_Mutation_p.E3696*|PLEC_uc003zah.2_Nonsense_Mutation_p.E3704*|PLEC_uc003zaj.2_Nonsense_Mutation_p.E3745*	p.E3855*	NM_201380	NP_958782	Q15149	PLEC_HUMAN			32	11733	-			3855			Globular 2.|Plectin 17.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Nonsense_Mutation	SNP	ENST00000322810.4	37	c.11563G>T	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	53	20.689288	0.99933	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	.	.	.	3.78	3.78	0.43462	.	0.090535	0.42548	U	0.000691	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	14.8963	0.70646	0.0:1.0:0.0:0.0	.	.	.	.	X	3718;3722;3718;3686;3855;3696;3704;3745;3741	.	ENSP00000323856:E3855X	E	-	1	0	PLEC	145064825	1.000000	0.71417	0.915000	0.36163	0.900000	0.52787	7.551000	0.82182	2.103000	0.63969	0.297000	0.19635	GAG		0.652	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		19	61	1	0	4.96729e-08	0.008871	5.56939e-08	19	61				
TAF1L	138474	broad.mit.edu	37	9	32633780	32633780	+	Missense_Mutation	SNP	G	G	A	rs143756087	byFrequency	TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:32633780G>A	ENST00000242310.4	-	1	1887	c.1798C>T	c.(1798-1800)Cgg>Tgg	p.R600W	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	600					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AAGGTGCCCCGAAGACCCTGT	0.488																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(1798-1800)CGG>TGG		TBP-associated factor RNA polymerase 1-like		G	TRP/ARG	3,4403	6.2+/-15.9	0,3,2200	156.0	165.0	162.0		1798	-0.1	0.9	9	dbSNP_134	162	0,8600		0,0,4300	yes	missense	TAF1L	NM_153809.2	101	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	probably-damaging	600/1827	32633780	3,13003	2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32633780G>A	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1798C>T	9.37:g.32633780G>A	ENSP00000418379:p.Arg600Trp					uc003zrh.1_RNA	p.R600W	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	1888	-			600					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.1798C>T	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016477	0.35606	6.81E-4	0.0	ENSG00000122728	ENST00000242310	T	0.19806	2.12	1.04	-0.0701	0.13748	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.055177	0.64402	N	0.000001	T	0.42899	0.1223	M	0.86953	2.85	0.46416	D	0.999032	D	0.89917	1.0	D	0.77557	0.99	T	0.19192	-1.0313	10	0.72032	D	0.01	.	5.2437	0.15485	0.2318:0.0:0.7682:0.0	.	600	Q8IZX4	TAF1L_HUMAN	W	600	ENSP00000418379:R600W	ENSP00000418379:R600W	R	-	1	2	TAF1L	32623780	1.000000	0.71417	0.857000	0.33713	0.175000	0.22909	2.891000	0.48617	-0.423000	0.07394	-1.098000	0.02139	CGG		0.488	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			9	213	0	0	0	0.008291	0	9	213				
SPATA31A6	389730	broad.mit.edu	37	9	43630649	43630649	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:43630649G>T	ENST00000332857.6	-	1	81	c.53C>A	c.(52-54)gCc>gAc	p.A18D	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	18					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGAGCTGGGGGCGTTTAGCGA	0.478																																							uc011lrb.1		NA																	0					0						c.(52-54)GCC>GAC		hypothetical protein LOC389730																																				SO:0001583	missense	389730					integral to membrane		g.chr9:43630649G>T		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.53C>A	9.37:g.43630649G>T	ENSP00000329825:p.Ala18Asp						p.A18D	NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN			1	82	-			18						Missense_Mutation	SNP	ENST00000332857.6	37	c.53C>A	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	G	7.948	0.744141	0.15710	.	.	ENSG00000185775	ENST00000332857	T	0.03860	3.78	0.109	0.109	0.14578	.	1.320200	0.05412	N	0.542605	T	0.02929	0.0087	N	0.14661	0.345	0.09310	N	1	P	0.40302	0.712	B	0.32864	0.154	T	0.40831	-0.9542	9	0.72032	D	0.01	.	.	.	.	.	18	Q5VVP1	F75A6_HUMAN	D	18	ENSP00000329825:A18D	ENSP00000329825:A18D	A	-	2	0	FAM75A6	43570645	0.036000	0.19791	0.086000	0.20670	0.344000	0.29017	0.835000	0.27531	0.181000	0.19994	0.184000	0.17185	GCC		0.478	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		45	125	1	0	9.39024e-22	0.009718	1.20848e-21	45	125				
APBA1	320	broad.mit.edu	37	9	72130977	72130977	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:72130977C>A	ENST00000265381.4	-	2	1372	c.1150G>T	c.(1150-1152)Gac>Tac	p.D384Y		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	384	LIN-2/CASK binding.|Pro-rich.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GGGCTAATGTCCTGGCGCATG	0.617																																							uc004ahh.2		NA																	0				lung(1)	1						c.(1150-1152)GAC>TAC		amyloid beta A4 precursor protein-binding,							137.0	114.0	122.0					9																	72130977		2203	4300	6503	SO:0001583	missense	320				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle		g.chr9:72130977C>A	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1150G>T	9.37:g.72130977C>A	ENSP00000265381:p.Asp384Tyr						p.D384Y	NM_001163	NP_001154	Q02410	APBA1_HUMAN			2	1426	-			384			LIN-2/CASK binding.|Pro-rich.		O14914|O60570|Q5VYR8	Missense_Mutation	SNP	ENST00000265381.4	37	c.1150G>T	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350242	0.61183	.	.	ENSG00000107282	ENST00000265381	T	0.05717	3.4	5.95	5.95	0.96441	.	0.048508	0.85682	D	0.000000	T	0.18341	0.0440	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.00193	-1.1934	10	0.59425	D	0.04	-25.8675	20.3932	0.98965	0.0:1.0:0.0:0.0	.	384	Q02410	APBA1_HUMAN	Y	384	ENSP00000265381:D384Y	ENSP00000265381:D384Y	D	-	1	0	APBA1	71320797	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	GAC		0.617	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163		32	100	1	0	7.11191e-15	0.013726	8.84506e-15	32	100				
SEMA4D	10507	broad.mit.edu	37	9	91994133	91994133	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:91994133G>A	ENST00000450295.1	-	16	2851	c.2075C>T	c.(2074-2076)tCc>tTc	p.S692F	SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000438547.2_Missense_Mutation_p.S692F|SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000422704.2_Missense_Mutation_p.S692F|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000356444.2_Missense_Mutation_p.S692F|SEMA4D_ENST00000343780.4_Intron			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	692					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.S692C(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GATGGCCCCGGAGGAGGTGGC	0.602																																							uc004aqo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(2074-2076)TCC>TTC		semaphorin 4D isoform 1							60.0	64.0	63.0					9																	91994133		2203	4300	6503	SO:0001583	missense	10507				anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding	g.chr9:91994133G>A	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.2075C>T	9.37:g.91994133G>A	ENSP00000416523:p.Ser692Phe					SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Missense_Mutation_p.S690F	p.S692F	NM_006378	NP_006369	Q92854	SEM4D_HUMAN			18	2647	-			692			Extracellular (Potential).		B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	ENST00000450295.1	37	c.2075C>T	CCDS6685.1	.	.	.	.	.	.	.	.	.	.	G	4.957	0.177809	0.09443	.	.	ENSG00000187764	ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	4.02	2.16	0.27623	.	1.539240	0.03858	N	0.273493	T	0.60248	0.2254	N	0.14661	0.345	0.09310	N	1	B	0.25521	0.128	B	0.20577	0.03	T	0.47787	-0.9090	10	0.13853	T	0.58	.	5.9822	0.19413	0.1761:0.1548:0.6691:0.0	.	692	Q92854	SEM4D_HUMAN	F	692	ENSP00000416523:S692F;ENSP00000405102:S692F;ENSP00000348822:S692F;ENSP00000388768:S692F	ENSP00000348822:S692F	S	-	2	0	SEMA4D	91183953	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	0.035000	0.13797	0.483000	0.27608	0.561000	0.74099	TCC		0.602	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378		24	86	0	0	0	0.016522	0	24	86				
TGFBR1	7046	broad.mit.edu	37	9	101900314	101900314	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:101900314C>G	ENST00000374994.4	+	4	865	c.748C>G	c.(748-750)Caa>Gaa	p.Q250E	TGFBR1_ENST00000374990.2_Missense_Mutation_p.Q173E|TGFBR1_ENST00000552516.1_Missense_Mutation_p.Q254E|TGFBR1_ENST00000550253.1_Missense_Mutation_p.Q181E	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	250	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				AGAGATTTATCAAACTGTAAT	0.393																																							uc004azc.2		NA																	0				lung(2)|ovary(1)	3						c.(748-750)CAA>GAA		transforming growth factor, beta receptor I							152.0	149.0	150.0					9																	101900314		2203	4300	6503	SO:0001583	missense	7046				activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding	g.chr9:101900314C>G		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.748C>G	9.37:g.101900314C>G	ENSP00000364133:p.Gln250Glu					TGFBR1_uc004azd.2_Missense_Mutation_p.Q173E|TGFBR1_uc011lvc.1_Missense_Mutation_p.Q181E	p.Q250E	NM_004612	NP_004603	P36897	TGFR1_HUMAN			4	824	+		Acute lymphoblastic leukemia(62;0.0559)	250			Protein kinase.|Cytoplasmic (Potential).		Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	37	c.748C>G	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797212	0.90538	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000549021;ENST00000550253	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.59	5.59	0.84812	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69160	0.3080	L	0.28740	0.885	0.80722	D	1	D;D	0.65815	0.995;0.965	D;P	0.67548	0.952;0.584	T	0.65973	-0.6038	9	.	.	.	.	18.3707	0.90406	0.0:1.0:0.0:0.0	.	173;250	P36897-3;P36897	.;TGFR1_HUMAN	E	250;250;173;254;104;181	ENSP00000364133:Q250E;ENSP00000364129:Q173E;ENSP00000447297:Q254E;ENSP00000449028:Q104E;ENSP00000450052:Q181E	.	Q	+	1	0	TGFBR1	100940135	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	7.773000	0.85462	2.642000	0.89623	0.650000	0.86243	CAA		0.393	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3			15	51	0	0	0	0.003163	0	15	51				
C5	727	broad.mit.edu	37	9	123785720	123785720	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:123785720G>A	ENST00000223642.1	-	10	1107	c.1078C>T	c.(1078-1080)Cct>Tct	p.P360S		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	360					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	AGGAAAAGAGGAGTAGCAACC	0.438																																							uc004bkv.2		NA																	0				ovary(2)	2						c.(1078-1080)CCT>TCT		complement component 5 preproprotein	Eculizumab(DB01257)						207.0	201.0	203.0					9																	123785720		2203	4300	6503	SO:0001583	missense	727				activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity	g.chr9:123785720G>A	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.1078C>T	9.37:g.123785720G>A	ENSP00000223642:p.Pro360Ser					C5_uc010mvm.1_Missense_Mutation_p.P360S|C5_uc010mvn.1_Missense_Mutation_p.P360S	p.P360S	NM_001735	NP_001726	P01031	CO5_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	10	1108	-			360					Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	c.1078C>T	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609647	0.46527	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.32272	1.46	5.64	2.81	0.32909	.	0.166887	0.56097	N	0.000038	T	0.32376	0.0827	M	0.69463	2.115	0.50171	D	0.999859	D;P	0.59357	0.985;0.788	B;B	0.43360	0.417;0.163	T	0.22243	-1.0222	10	0.66056	D	0.02	.	10.2397	0.43305	0.2151:0.0:0.7849:0.0	.	431;360	Q59GS8;P01031	.;CO5_HUMAN	S	360;431	ENSP00000223642:P360S	ENSP00000223642:P360S	P	-	1	0	C5	122825541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.622000	0.54217	0.863000	0.35553	0.650000	0.86243	CCT		0.438	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735		13	149	0	0	0	0.020292	0	13	149				
LAMC3	10319	broad.mit.edu	37	9	133951336	133951336	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:133951336C>T	ENST00000361069.4	+	21	3746	c.3613C>T	c.(3613-3615)Cgg>Tgg	p.R1205W	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1205	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AGAGACCCAGCGGGACCTGGA	0.632																																							uc004caa.1		NA																	0				ovary(2)|pancreas(1)	3						c.(3613-3615)CGG>TGG		laminin, gamma 3 precursor							37.0	35.0	36.0					9																	133951336		2203	4300	6503	SO:0001583	missense	10319				cell adhesion	basement membrane|membrane	structural molecule activity	g.chr9:133951336C>T	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3613C>T	9.37:g.133951336C>T	ENSP00000354360:p.Arg1205Trp						p.R1205W	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)	21	3711	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	1205			Domain II and I.|Potential.		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	c.3613C>T	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	C	8.369	0.834922	0.16820	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.28454	1.61	4.84	3.93	0.45458	.	1.368680	0.04690	N	0.413868	T	0.40473	0.1118	L	0.47716	1.5	0.09310	N	1	D	0.65815	0.995	P	0.48677	0.586	T	0.36768	-0.9734	10	0.72032	D	0.01	.	11.9148	0.52759	0.1744:0.8256:0.0:0.0	.	1205	Q9Y6N6	LAMC3_HUMAN	W	1205	ENSP00000354360:R1205W	ENSP00000347156:R1205W	R	+	1	2	LAMC3	132941157	0.000000	0.05858	0.526000	0.27913	0.070000	0.16714	-0.158000	0.10070	1.153000	0.42468	0.485000	0.47835	CGG		0.632	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059		3	28	0	0	0	0.004672	0	3	28				
PRRC2B	84726	broad.mit.edu	37	9	134350175	134350175	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:134350175G>C	ENST00000357304.4	+	15	2714	c.2659G>C	c.(2659-2661)Gag>Cag	p.E887Q	PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	887							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						CCATGGTGTTGAGCGGGAGAC	0.587																																							uc004can.3		NA																	0					0						c.(2659-2661)GAG>CAG		HLA-B associated transcript 2-like							16.0	18.0	17.0					9																	134350175		2008	4175	6183	SO:0001583	missense	84726						protein binding	g.chr9:134350175G>C	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.2659G>C	9.37:g.134350175G>C	ENSP00000349856:p.Glu887Gln					BAT2L1_uc010mzj.1_Missense_Mutation_p.E470Q|BAT2L1_uc004cao.3_Missense_Mutation_p.E245Q	p.E887Q	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN			15	2714	+			887					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	c.2659G>C	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	G	3.264	-0.150599	0.06585	.	.	ENSG00000130723	ENST00000357304;ENST00000418650;ENST00000456307	T;T	0.10668	2.85;2.85	5.61	3.77	0.43336	.	.	.	.	.	T	0.07098	0.0180	N	0.24115	0.695	0.19575	N	0.999969	P;B	0.41848	0.763;0.201	B;B	0.33521	0.165;0.034	T	0.23904	-1.0175	9	0.52906	T	0.07	.	10.0609	0.42275	0.2184:0.0:0.7816:0.0	.	183;887	Q5H9R5;Q5JSZ5	.;PRC2B_HUMAN	Q	887;183;156	ENSP00000349856:E887Q;ENSP00000400608:E156Q	ENSP00000349856:E887Q	E	+	1	0	PRRC2B	133339996	0.995000	0.38212	0.187000	0.23214	0.011000	0.07611	2.277000	0.43417	1.368000	0.46115	0.655000	0.94253	GAG		0.587	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				10	31	0	0	0	0.006214	0	10	31				
LCN15	389812	broad.mit.edu	37	9	139652378	139652378	+	IGR	SNP	T	T	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr9:139652378T>G	ENST00000316144.5	-	0	762				LCN8_ENST00000482893.1_5'Flank|LCN15_ENST00000482511.1_5'Flank|LCN8_ENST00000371688.3_Missense_Mutation_p.E2A	NM_203347.1	NP_976222.1	Q6UWW0	LCN15_HUMAN	lipocalin 15						lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)|transporter activity (GO:0005215)			endometrium(1)|lung(1)	2						GTCCAGCTCCTCCATGGCTGC	0.687																																							uc004cjb.1		NA																	0				pancreas(1)	1						c.(4-6)GAG>GCG		lipocalin 8							74.0	58.0	64.0					9																	139652378		2203	4300	6503	SO:0001628	intergenic_variant	138307				transport	extracellular region	binding	g.chr9:139652378T>G		CCDS7006.1	9q34.3	2011-10-24			ENSG00000177984	ENSG00000177984		"""Lipocalins"""	33777	protein-coding gene	gene with protein product							Standard	NM_203347		Approved	UNQ2541, PRO6093	uc004cjd.3	Q6UWW0	OTTHUMG00000020943		9.37:g.139652378T>G						LCN8_uc004cja.2_5'Flank|LCN8_uc004cjc.1_Missense_Mutation_p.E2A	p.E2A	NM_178469	NP_848564	Q6JVE9	LCN8_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)	1	354	-	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)	Error:Variant_position_missing_in_Q6JVE9_after_alignment						Missense_Mutation	SNP	ENST00000316144.5	37	c.5A>C	CCDS7006.1	.	.	.	.	.	.	.	.	.	.	T	0.504	-0.869726	0.02570	.	.	ENSG00000204001	ENST00000371688	T	0.12039	2.72	2.56	-5.11	0.02901	.	.	.	.	.	T	0.05914	0.0154	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.39563	-0.9608	8	0.21014	T	0.42	.	4.2975	0.10908	0.3662:0.0:0.1215:0.5123	.	2	Q6JVE9-2	.	A	2	ENSP00000360753:E2A	ENSP00000360753:E2A	E	-	2	0	LCN8	138772199	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.508000	0.06344	-1.538000	0.01734	-0.536000	0.04276	GAG		0.687	LCN15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055114.2	NM_203347		14	21	0	0	0	0.003163	0	14	21				
GPR64	10149	broad.mit.edu	37	X	19022898	19022898	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chrX:19022898G>C	ENST00000379869.3	-	23	2102	c.1939C>G	c.(1939-1941)Ctt>Gtt	p.L647V	GPR64_ENST00000357544.3_Missense_Mutation_p.L617V|GPR64_ENST00000357991.3_Missense_Mutation_p.L644V|GPR64_ENST00000379878.3_Missense_Mutation_p.L631V|GPR64_ENST00000360279.4_Missense_Mutation_p.L625V|GPR64_ENST00000379873.2_Missense_Mutation_p.L647V|GPR64_ENST00000379876.1_Missense_Mutation_p.L623V|GPR64_ENST00000356606.4_Missense_Mutation_p.L633V|GPR64_ENST00000354791.3_Missense_Mutation_p.L631V|GPR64_ENST00000340581.3_Missense_Mutation_p.L528V	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	647					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					TAGGTTACAAGAGTCACTGAC	0.418																																							uc004cyx.2		NA																	0					0						c.(1939-1941)CTT>GTT		G protein-coupled receptor 64 isoform 1							157.0	157.0	157.0					X																	19022898		2203	4300	6503	SO:0001583	missense	10149				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity	g.chrX:19022898G>C	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1939C>G	X.37:g.19022898G>C	ENSP00000369198:p.Leu647Val					GPR64_uc004cyy.2_Missense_Mutation_p.L644V|GPR64_uc004cyz.2_Missense_Mutation_p.L633V|GPR64_uc004czb.2_Missense_Mutation_p.L647V|GPR64_uc004czc.2_Missense_Mutation_p.L631V|GPR64_uc004czd.2_Missense_Mutation_p.L623V|GPR64_uc004cze.2_Missense_Mutation_p.L617V|GPR64_uc004czf.2_Missense_Mutation_p.L609V|GPR64_uc004cza.2_Missense_Mutation_p.L625V|GPR64_uc004cyw.2_Missense_Mutation_p.L631V|GPR64_uc010nfj.2_Missense_Mutation_p.L528V	p.L647V	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN			23	2103	-	Hepatocellular(33;0.183)		647			Helical; Name=1; (Potential).		B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	ENST00000379869.3	37	c.1939C>G	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640561	0.67244	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581	T;T;T;T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54	6.03	5.16	0.70880	GPCR, family 2-like (1);	0.148603	0.31279	N	0.007934	T	0.51381	0.1671	L	0.53729	1.69	0.53005	D	0.999968	B;P;D;P;P;D;D;D;D;P;D	0.89917	0.226;0.898;1.0;0.931;0.931;1.0;1.0;0.998;0.998;0.859;1.0	B;P;D;P;P;D;D;D;D;P;D	0.91635	0.349;0.721;0.999;0.881;0.881;0.996;0.999;0.993;0.993;0.888;0.999	T	0.47736	-0.9094	10	0.40728	T	0.16	.	16.3641	0.83307	0.0:0.1283:0.8717:0.0	.	528;609;617;623;631;647;625;633;644;647;631	Q14CE0;Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;.;GPR64_HUMAN;.	V	647;631;631;623;617;647;625;644;633;528	ENSP00000369202:L647V;ENSP00000369207:L631V;ENSP00000346845:L631V;ENSP00000369205:L623V;ENSP00000350152:L617V;ENSP00000369198:L647V;ENSP00000353421:L625V;ENSP00000350680:L644V;ENSP00000349015:L633V;ENSP00000344972:L528V	ENSP00000344972:L528V	L	-	1	0	GPR64	18932819	1.000000	0.71417	0.993000	0.49108	0.939000	0.58152	5.090000	0.64498	1.285000	0.44548	-0.229000	0.12294	CTT		0.418	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2			7	112	0	0	0	0.00308	0	7	112				
KLHL34	257240	broad.mit.edu	37	X	21675838	21675838	+	Silent	SNP	G	G	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chrX:21675838G>T	ENST00000379499.2	-	1	610	c.69C>A	c.(67-69)cgC>cgA	p.R23R		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	23						extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						AGCCCTCGGCGCGCAGGGCCT	0.647																																							uc004czz.1		NA																	0				ovary(1)	1						c.(67-69)CGC>CGA		kelch-like 34							12.0	15.0	14.0					X																	21675838		2064	4014	6078	SO:0001819	synonymous_variant	257240							g.chrX:21675838G>T	AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.69C>A	X.37:g.21675838G>T							p.R23R	NM_153270	NP_695002	Q8N239	KLH34_HUMAN			1	611	-			23						Silent	SNP	ENST00000379499.2	37	c.69C>A	CCDS14199.1																																																																																				0.647	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270		13	7	1	0	0.000151284	0.016723	0.000158234	13	7				
ATRX	546	broad.mit.edu	37	X	76778855	76778855	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chrX:76778855G>C	ENST00000373344.5	-	31	6938	c.6724C>G	c.(6724-6726)Cag>Gag	p.Q2242E	ATRX_ENST00000395603.3_Missense_Mutation_p.Q2204E|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2242	Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTATGTATCTGAAGGAGCTCT	0.378			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		0				haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(6724-6726)CAG>GAG		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						171.0	155.0	160.0					X																	76778855		2203	4296	6499	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76778855G>C	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6724C>G	X.37:g.76778855G>C	ENSP00000362441:p.Gln2242Glu					ATRX_uc004ecq.3_Missense_Mutation_p.Q2204E|ATRX_uc004eco.3_Missense_Mutation_p.Q2027E	p.Q2242E	NM_000489	NP_000480	P46100	ATRX_HUMAN			31	6956	-			2242					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.6724C>G	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.524155	0.44866	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92249	-2.99;-3.0	5.46	5.46	0.80206	.	0.076460	0.53938	U	0.000056	D	0.89757	0.6807	N	0.13140	0.3	0.80722	D	1	D;B	0.58620	0.983;0.156	P;B	0.57720	0.826;0.037	D	0.86332	0.1699	10	0.07325	T	0.83	0.2437	18.4022	0.90520	0.0:0.0:1.0:0.0	.	2204;2242	P46100-4;P46100	.;ATRX_HUMAN	E	2242;2204	ENSP00000362441:Q2242E;ENSP00000378967:Q2204E	ENSP00000362441:Q2242E	Q	-	1	0	ATRX	76665511	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.476000	0.97823	2.287000	0.76781	0.538000	0.68166	CAG		0.378	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		3	67	0	0	0	0.004672	0	3	67				
RGAG1	57529	broad.mit.edu	37	X	109695638	109695638	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chrX:109695638C>G	ENST00000465301.2	+	3	2039	c.1793C>G	c.(1792-1794)tCa>tGa	p.S598*	RGAG1_ENST00000540313.1_Nonsense_Mutation_p.S598*	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	598										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GACACAGCCTCAGGAGTGATG	0.502																																							uc004eor.1		NA																	0				lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1792-1794)TCA>TGA		retrotransposon gag domain containing 1							112.0	89.0	97.0					X																	109695638		2203	4300	6503	SO:0001587	stop_gained	57529							g.chrX:109695638C>G	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1793C>G	X.37:g.109695638C>G	ENSP00000419786:p.Ser598*					RGAG1_uc011msr.1_Nonsense_Mutation_p.S598*	p.S598*	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN			3	2039	+			598					Q9P2M8	Nonsense_Mutation	SNP	ENST00000465301.2	37	c.1793C>G	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.085990	0.55861	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	.	.	.	3.84	-1.02	0.10135	.	1.110750	0.07234	N	0.862993	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	0.0945	8.7274	0.34478	0.0:0.5333:0.0:0.4667	.	.	.	.	X	598	.	.	S	+	2	0	RGAG1	109582294	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.244000	0.08903	-0.401000	0.07644	0.544000	0.68410	TCA		0.502	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		30	33	0	0	0	0.008361	0	30	33				
CYP4B1	1580	broad.mit.edu	37	1	47264795	47264796	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr1:47264795_47264796insCT	ENST00000271153.4	+	1	78_79	c.42_43insCT	c.(43-45)ctgfs	p.L15fs	CYP4B1_ENST00000371919.4_Frame_Shift_Ins_p.L15fs|CYP4B1_ENST00000546128.1_Intron|CYP4B1_ENST00000371923.4_Frame_Shift_Ins_p.L15fs			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	15					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	CCTCCTTGGGCCTGTGGGCTTC	0.579																																							uc001cqm.3		NA																	0				ovary(1)|skin(1)	2						c.(40-45)GGCCTGfs		cytochrome P450, family 4, subfamily B,																																				SO:0001589	frameshift_variant	1580				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr1:47264795_47264796insCT	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.43_44dupCT	1.37:g.47264796_47264797dupCT	ENSP00000271153:p.Leu15fs					CYP4B1_uc009vyl.1_5'UTR|CYP4B1_uc001cqn.3_Frame_Shift_Ins_p.G14fs|CYP4B1_uc009vym.2_Frame_Shift_Ins_p.G14fs|CYP4B1_uc010omk.1_5'UTR	p.G14fs	NM_000779	NP_000770	P13584	CP4B1_HUMAN			1	126_127	+	Acute lymphoblastic leukemia(166;0.155)		14_15					Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Frame_Shift_Ins	INS	ENST00000271153.4	37	c.42_43insCT	CCDS542.1																																																																																				0.579	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779		11	35	NA	NA	NA	NA	NA	11	35	---	---	---	---
KITLG	4254	broad.mit.edu	37	12	88912534	88912534	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr12:88912534delT	ENST00000228280.5	-	4	485	c.303delA	c.(301-303)atafs	p.I101fs	KITLG_ENST00000357116.4_Intron|KITLG_ENST00000347404.5_Frame_Shift_Del_p.I101fs|KITLG_ENST00000378535.4_5'UTR	NM_000899.4	NP_000890.1	P21583	SCF_HUMAN	KIT ligand	101					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|negative regulation of mast cell apoptotic process (GO:0033026)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of myeloid leukocyte differentiation (GO:0002763)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	stem cell factor receptor binding (GO:0005173)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)	9						CAAGTTTGTCTATGATGGAAT	0.368									Testicular Cancer, Familial Clustering of																														uc001tav.2		NA																	0				ovary(1)	1						c.(301-303)ATAfs		KIT ligand isoform b precursor							129.0	123.0	125.0					12																	88912534		2203	4300	6503	SO:0001589	frameshift_variant	4254	Testicular_Cancer_Familial_Clustering_of	Familial Cancer Database		cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding	g.chr12:88912534delT	M59964	CCDS31867.1, CCDS31868.1	12q22	2010-11-23			ENSG00000049130	ENSG00000049130			6343	protein-coding gene	gene with protein product	"""mast cell growth factor"", ""stem cell factor"", ""steel factor"", ""familial progressive hyperpigmentation 2"""	184745		MGF		2208279, 1707188, 19375057	Standard	NM_003994		Approved	SCF, SF, Kitl, KL-1, FPH2	uc001tav.3	P21583	OTTHUMG00000169888	ENST00000228280.5:c.303delA	12.37:g.88912534delT	ENSP00000228280:p.Ile101fs					KITLG_uc009zsn.2_Frame_Shift_Del_p.I29fs|KITLG_uc001taw.2_Frame_Shift_Del_p.I101fs|KITLG_uc009zso.1_Intron	p.I101fs	NM_000899	NP_000890	P21583	SCF_HUMAN			4	486	-			101			Extracellular (Potential).		A0AV09|A8K2Q4|B7ZLM4|Q16487|Q68DZ2|Q7M4N8|Q9UQK7	Frame_Shift_Del	DEL	ENST00000228280.5	37	c.303delA	CCDS31868.1																																																																																				0.368	KITLG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406424.2	NM_003994		20	52	NA	NA	NA	NA	NA	20	52	---	---	---	---
MYH1	4619	broad.mit.edu	37	17	10408226	10408226	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr17:10408226delT	ENST00000226207.5	-	22	2686	c.2592delA	c.(2590-2592)aaafs	p.K864fs	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	864					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CCAGCTCTTCTTTGGTTTTCT	0.438																																							uc002gmo.2		NA																	0				ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(2590-2592)AAAfs		myosin, heavy chain 1, skeletal muscle, adult							153.0	140.0	144.0					17																	10408226		2203	4300	6503	SO:0001589	frameshift_variant	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10408226delT		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2592delA	17.37:g.10408226delT	ENSP00000226207:p.Lys864fs					uc002gml.1_Intron	p.K864fs	NM_005963	NP_005954	P12882	MYH1_HUMAN			22	2686	-			864			Potential.		Q14CA4|Q9Y622	Frame_Shift_Del	DEL	ENST00000226207.5	37	c.2592delA	CCDS11155.1																																																																																				0.438	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		43	95	NA	NA	NA	NA	NA	43	95	---	---	---	---
STK11	6794	broad.mit.edu	37	19	1206999	1207000	+	Frame_Shift_Ins	INS	-	-	G			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr19:1206999_1207000insG	ENST00000326873.7	+	1	1260_1261	c.87_88insG	c.(88-90)gacfs	p.D30fs	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	30					activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCACCGCATCGACTCCACCGA	0.639		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		23	Whole gene deletion(20)|Unknown(2)|Deletion - Frameshift(1)	p.0?(19)|p.?(3)	cervix(15)|lung(3)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(85-90)ATCGACfs		serine/threonine protein kinase 11																																				SO:0001589	frameshift_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1206999_1207000insG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.88dupG	19.37:g.1207000_1207000dupG	ENSP00000324856:p.Asp30fs	TSP Lung(3;<1E-08)					p.I29fs	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	1	1202_1203	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	29_30					B2RBX7|E7EW76	Frame_Shift_Ins	INS	ENST00000326873.7	37	c.87_88insG	CCDS45896.1																																																																																				0.639	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		23	22	NA	NA	NA	NA	NA	23	22	---	---	---	---
SYN2	6854	broad.mit.edu	37	3	12209961	12209961	+	RNA	DEL	A	A	-			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:12209961delA	ENST00000432424.2	+	0	1313							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						CAAAGATGGGAAAGACTACAT	0.483																																							uc003bwm.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1141-1143)AAAfs		synapsin II isoform IIa							100.0	105.0	103.0					3																	12209961		2201	4299	6500			6854				neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity	g.chr3:12209961delA		CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12209961delA						SYN2_uc003bwl.1_Frame_Shift_Del_p.K381fs|SYN2_uc003bwn.2_Frame_Shift_Del_p.K55fs	p.K381fs	NM_133625	NP_598328	Q92777	SYN2_HUMAN			13	1305	+			381					A8MY98	Frame_Shift_Del	DEL	ENST00000432424.2	37	c.1141delA																																																																																					0.483	SYN2-002	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000339528.3	NM_133625		7	31	NA	NA	NA	NA	NA	7	31	---	---	---	---
SLC22A13	9390	broad.mit.edu	37	3	38315780	38315780	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:38315780delT	ENST00000311856.4	+	2	445	c.396delT	c.(394-396)gatfs	p.D132fs	SLC22A13_ENST00000450935.2_Frame_Shift_Del_p.D91fs	NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	132					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		TGGTTTGTGATCGGAAGCACC	0.572																																							uc003chz.3		NA																	0				skin(1)	1						c.(394-396)GATfs		solute carrier family 22 (organic anion							180.0	159.0	166.0					3																	38315780		2203	4300	6503	SO:0001589	frameshift_variant	9390					integral to plasma membrane	organic cation transmembrane transporter activity	g.chr3:38315780delT	AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.396delT	3.37:g.38315780delT	ENSP00000310241:p.Asp132fs					SLC22A13_uc011aym.1_RNA|SLC22A13_uc011ayn.1_Frame_Shift_Del_p.D132fs	p.D132fs	NM_004256	NP_004247	Q9Y226	S22AD_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)	2	450	+			132			Extracellular (Potential).		B2RCV9|Q8IYG1	Frame_Shift_Del	DEL	ENST00000311856.4	37	c.396delT	CCDS2676.1																																																																																				0.572	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253746.2	NM_004256		26	100	NA	NA	NA	NA	NA	26	100	---	---	---	---
AMOTL2	51421	broad.mit.edu	37	3	134089682	134089683	+	Frame_Shift_Ins	INS	-	-	A			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr3:134089682_134089683insA	ENST00000422605.2	-	2	759_760	c.593_594insT	c.(592-594)ggcfs	p.G198fs	AMOTL2_ENST00000511759.1_Intron|AMOTL2_ENST00000514516.1_Frame_Shift_Ins_p.G256fs|AMOTL2_ENST00000513145.1_Frame_Shift_Ins_p.G198fs|AMOTL2_ENST00000249883.5_Frame_Shift_Ins_p.G198fs			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	198					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						CAGCAGGGGGGCCCCTCAGTGG	0.668																																							uc003eqf.2		NA																	0				large_intestine(1)	1						c.(766-768)GGCfs		angiomotin like 2																																				SO:0001589	frameshift_variant	51421							g.chr3:134089682_134089683insA	AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.593_594insT	3.37:g.134089682_134089683insA	ENSP00000409999:p.Gly198fs					AMOTL2_uc003eqg.1_Frame_Shift_Ins_p.G198fs|AMOTL2_uc003eqh.1_Frame_Shift_Ins_p.G198fs	p.G256fs	NM_016201	NP_057285	Q9Y2J4	AMOL2_HUMAN			2	884_885	-			198					A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Frame_Shift_Ins	INS	ENST00000422605.2	37	c.767_768insT																																																																																					0.668	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358149.1	NM_016201		28	53	NA	NA	NA	NA	NA	28	53	---	---	---	---
NCOA7	135112	broad.mit.edu	37	6	126210672	126210673	+	Frame_Shift_Ins	INS	-	-	T			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr6:126210672_126210673insT	ENST00000368357.3	+	10	1824_1825	c.1472_1473insT	c.(1471-1476)gatatafs	p.I492fs	NCOA7_ENST00000229634.9_Frame_Shift_Ins_p.I377fs|NCOA7_ENST00000392477.2_Frame_Shift_Ins_p.I492fs	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	492					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		GAGAAGCAAGATATAATGCCAG	0.436																																							uc010kes.2		NA																	0				lung(2)|ovary(1)	3						c.(1471-1473)GATfs		nuclear receptor coactivator 7 isoform 1																																				SO:0001589	frameshift_variant	135112				cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chr6:126210672_126210673insT	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.1473dupT	6.37:g.126210673_126210673dupT	ENSP00000357341:p.Ile492fs					NCOA7_uc003qae.3_Frame_Shift_Ins_p.D491fs|NCOA7_uc003qah.2_Frame_Shift_Ins_p.D480fs|NCOA7_uc003qai.2_Frame_Shift_Ins_p.D491fs|NCOA7_uc010ket.2_Frame_Shift_Ins_p.D376fs	p.D491fs	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)	11	1921_1922	+			491					B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Frame_Shift_Ins	INS	ENST00000368357.3	37	c.1472_1473insT	CCDS5132.1																																																																																				0.436	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748		19	34	NA	NA	NA	NA	NA	19	34	---	---	---	---
ADAM22	53616	broad.mit.edu	37	7	87772416	87772417	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr7:87772416_87772417insCA	ENST00000265727.7	+	15	1375_1376	c.1296_1297insCA	c.(1297-1299)tgcfs	p.C433fs	ADAM22_ENST00000315984.7_Frame_Shift_Ins_p.C433fs|ADAM22_ENST00000398209.3_Frame_Shift_Ins_p.C433fs|ADAM22_ENST00000398201.4_Frame_Shift_Ins_p.C433fs|ADAM22_ENST00000398204.4_Frame_Shift_Ins_p.C433fs			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	433	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GAGGTGGTGCCTGCCTTTTCAA	0.312																																							uc003ujn.2		NA																	0				ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.(1294-1299)GCCTGCfs		ADAM metallopeptidase domain 22 isoform 1																																				SO:0001589	frameshift_variant	53616				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding	g.chr7:87772416_87772417insCA	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	Exception_encountered	7.37:g.87772416_87772417insCA	ENSP00000265727:p.Cys433fs					ADAM22_uc003ujk.1_Frame_Shift_Ins_p.A432fs|ADAM22_uc003ujl.1_Frame_Shift_Ins_p.A432fs|ADAM22_uc003ujm.2_Frame_Shift_Ins_p.A432fs|ADAM22_uc003ujo.2_Frame_Shift_Ins_p.A432fs|ADAM22_uc003ujp.1_Frame_Shift_Ins_p.A484fs	p.A432fs	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		15	1375_1376	+	Esophageal squamous(14;0.00202)		432_433			Peptidase M12B.|Extracellular (Potential).		O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Frame_Shift_Ins	INS	ENST00000265727.7	37	c.1296_1297insCA	CCDS47637.1																																																																																				0.312	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723		36	105	NA	NA	NA	NA	NA	36	105	---	---	---	---
SLC26A7	115111	broad.mit.edu	37	8	92346585	92346585	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7152-01A-11D-2036-08	TCGA-78-7152-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c9fa520a-1690-41d8-b3ca-03167816f6f9	99629441-f559-4b02-a416-757e40c92eb6	g.chr8:92346585delG	ENST00000276609.3	+	6	944	c.705delG	c.(703-705)ttgfs	p.L236fs	SLC26A7_ENST00000309536.2_Frame_Shift_Del_p.L236fs|SLC26A7_ENST00000523719.1_Frame_Shift_Del_p.L236fs	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TTTTATCCTTGCTGAGCATTG	0.323																																							uc003yex.2		NA																	0				ovary(2)	2						c.(703-705)TTGfs		solute carrier family 26, member 7 isoform a							162.0	152.0	155.0					8																	92346585		2202	4300	6502	SO:0001589	frameshift_variant	115111					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity	g.chr8:92346585delG	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.705delG	8.37:g.92346585delG	ENSP00000276609:p.Leu236fs					SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Frame_Shift_Del_p.L235fs|SLC26A7_uc003yfa.2_Frame_Shift_Del_p.L235fs	p.L235fs	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00802)		7	983	+			235			Helical; (Potential).			Frame_Shift_Del	DEL	ENST00000276609.3	37	c.705delG	CCDS6254.1																																																																																				0.323	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1			14	61	NA	NA	NA	NA	NA	14	61	---	---	---	---
