#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MTOR	2475	broad.mit.edu	37	1	11300433	11300433	+	Silent	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:11300433C>A	ENST00000361445.4	-	11	1789	c.1713G>T	c.(1711-1713)acG>acT	p.T571T		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	571	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CAGGGAGGGTCGTGAGGCCAG	0.577																																							uc001asd.2		NA																	0				central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						c.(1711-1713)ACG>ACT		FK506 binding protein 12-rapamycin associated							106.0	102.0	103.0					1																	11300433		2203	4300	6503	SO:0001819	synonymous_variant	2475				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	g.chr1:11300433C>A	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1713G>T	1.37:g.11300433C>A							p.T571T	NM_004958	NP_004949	P42345	MTOR_HUMAN			11	1834	-			571					Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	37	c.1713G>T	CCDS127.1																																																																																				0.577	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		20	37	1	0	2.94398e-08	0.007413	4.7036e-08	20	37				
UBIAD1	29914	broad.mit.edu	37	1	11333865	11333865	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:11333865G>T	ENST00000376810.5	+	1	603	c.277G>T	c.(277-279)Gct>Tct	p.A93S	UBIAD1_ENST00000376804.2_Missense_Mutation_p.A93S	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	93					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		GGCTGTCCTGGCTGTGCACGG	0.562																																							uc001asg.2		NA																	0					0						c.(277-279)GCT>TCT		UbiA prenyltransferase domain containing 1							116.0	113.0	114.0					1																	11333865		2203	4300	6503	SO:0001583	missense	29914				menaquinone biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrion|nucleus	prenyltransferase activity	g.chr1:11333865G>T		CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.277G>T	1.37:g.11333865G>T	ENSP00000366006:p.Ala93Ser						p.A93S	NM_013319	NP_037451	Q9Y5Z9	UBIA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)	1	611	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	93			Helical; (Potential).		B3KQG3|Q53GX3|Q5THD4	Missense_Mutation	SNP	ENST00000376810.5	37	c.277G>T	CCDS129.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.749023	0.49257	.	.	ENSG00000120942	ENST00000376810;ENST00000376804	D;D	0.92545	-3.06;-3.06	5.03	5.03	0.67393	.	0.119066	0.56097	D	0.000025	D	0.86360	0.5914	N	0.17723	0.515	0.49483	D	0.999799	B	0.20459	0.045	B	0.25405	0.06	T	0.81482	-0.0913	10	0.18710	T	0.47	-8.7526	17.7165	0.88338	0.0:0.0:1.0:0.0	.	93	Q9Y5Z9	UBIA1_HUMAN	S	93	ENSP00000366006:A93S;ENSP00000366000:A93S	ENSP00000366000:A93S	A	+	1	0	UBIAD1	11256452	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.907000	0.69908	2.484000	0.83849	0.453000	0.30009	GCT		0.562	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005773.1	NM_013319		42	56	1	0	3.54909e-21	0.002852	7.18432e-21	42	56				
IGSF21	84966	broad.mit.edu	37	1	18703331	18703331	+	Missense_Mutation	SNP	G	G	T	rs201284891		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:18703331G>T	ENST00000251296.1	+	8	1522	c.1139G>T	c.(1138-1140)cGg>cTg	p.R380L	IGSF21_ENST00000473951.1_3'UTR	NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	380	Ig-like 2.					extracellular region (GO:0005576)		p.R380Q(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		ACGTGGACGCGGGTTGGGAGC	0.642																																							uc001bau.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(1138-1140)CGG>CTG		immunoglobin superfamily, member 21 precursor							46.0	47.0	47.0					1																	18703331		2203	4300	6503	SO:0001583	missense	84966					extracellular region		g.chr1:18703331G>T	AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.1139G>T	1.37:g.18703331G>T	ENSP00000251296:p.Arg380Leu					IGSF21_uc001bav.1_Missense_Mutation_p.R201L	p.R380L	NM_032880	NP_116269	Q96ID5	IGS21_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)	8	1522	+		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)	380			Ig-like 2.		Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	c.1139G>T	CCDS184.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798286	0.90538	.	.	ENSG00000117154	ENST00000251296	T	0.11495	2.77	5.31	5.31	0.75309	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.067227	0.64402	D	0.000010	T	0.21881	0.0527	M	0.73430	2.235	0.80722	D	1	D	0.53462	0.96	P	0.47626	0.552	T	0.01553	-1.1326	10	0.35671	T	0.21	-13.8719	17.5256	0.87799	0.0:0.0:1.0:0.0	.	380	Q96ID5	IGS21_HUMAN	L	380	ENSP00000251296:R380L	ENSP00000251296:R380L	R	+	2	0	IGSF21	18575918	1.000000	0.71417	0.979000	0.43373	0.942000	0.58702	7.491000	0.81471	2.460000	0.83146	0.591000	0.81541	CGG		0.642	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880		17	14	1	0	6.94344e-10	0.006122	1.19153e-09	17	14				
TAS1R2	80834	broad.mit.edu	37	1	19180775	19180775	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:19180775G>T	ENST00000375371.3	-	3	1210	c.1189C>A	c.(1189-1191)Cat>Aat	p.H397N	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	397					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGCAGGGCATGGGCCACAGCA	0.607																																							uc001bba.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1189-1191)CAT>AAT		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)						91.0	81.0	84.0					1																	19180775		2203	4300	6503	SO:0001583	missense	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19180775G>T		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1189C>A	1.37:g.19180775G>T	ENSP00000364520:p.His397Asn						p.H397N	NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	3	1190	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	397			Extracellular (Potential).		Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	c.1189C>A	CCDS187.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023770	0.35701	.	.	ENSG00000179002	ENST00000375371	D	0.84146	-1.81	4.31	3.4	0.38934	Extracellular ligand-binding receptor (1);	0.486591	0.17107	N	0.186748	D	0.90345	0.6979	M	0.77486	2.375	0.43342	D	0.995397	D	0.89917	1.0	D	0.75484	0.986	D	0.88899	0.3351	10	0.87932	D	0	.	6.4565	0.21932	0.2178:0.0:0.7822:0.0	.	397	Q8TE23	TS1R2_HUMAN	N	397	ENSP00000364520:H397N	ENSP00000364520:H397N	H	-	1	0	TAS1R2	19053362	1.000000	0.71417	0.995000	0.50966	0.141000	0.21300	2.971000	0.49248	1.032000	0.39892	0.462000	0.41574	CAT		0.607	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			10	18	1	0	3.07112e-06	0.000978	4.64006e-06	10	18				
ZBTB40	9923	broad.mit.edu	37	1	22839540	22839540	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:22839540G>A	ENST00000375647.4	+	12	2792	c.2585G>A	c.(2584-2586)cGc>cAc	p.R862H	ZBTB40_ENST00000404138.1_Missense_Mutation_p.R862H|ZBTB40_ENST00000374651.4_Missense_Mutation_p.R750H	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	862					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		ACCGGGGACCGCCCGTTCATG	0.577																																							uc001bft.2		NA																	0				ovary(1)	1						c.(2584-2586)CGC>CAC		zinc finger and BTB domain containing 40							81.0	67.0	72.0					1																	22839540		2203	4300	6503	SO:0001583	missense	9923				bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:22839540G>A	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2585G>A	1.37:g.22839540G>A	ENSP00000364798:p.Arg862His					ZBTB40_uc001bfu.2_Missense_Mutation_p.R862H|ZBTB40_uc009vqi.1_Missense_Mutation_p.R750H	p.R862H	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)	13	3096	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	862					O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	c.2585G>A	CCDS224.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639530	0.67244	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.20332	2.08;2.08;2.08	5.42	5.42	0.78866	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.52532	D	0.000073	T	0.58793	0.2147	M	0.93150	3.385	0.46609	D	0.999127	D;D	0.89917	1.0;1.0	D;D	0.79784	0.987;0.993	T	0.70648	-0.4814	10	0.87932	D	0	-19.2921	17.7835	0.88531	0.0:0.0:1.0:0.0	.	750;862	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	H	862;862;750	ENSP00000384527:R862H;ENSP00000364798:R862H;ENSP00000363782:R750H	ENSP00000363782:R750H	R	+	2	0	ZBTB40	22712127	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.671000	0.68095	2.525000	0.85131	0.591000	0.81541	CGC		0.577	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870		6	25	0	0	0	0.001168	0	6	25				
NFYC	4802	broad.mit.edu	37	1	41232320	41232320	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:41232320C>G	ENST00000308733.5	+	7	779	c.773C>G	c.(772-774)tCa>tGa	p.S258*	NFYC_ENST00000447388.3_Nonsense_Mutation_p.S258*|NFYC_ENST00000456393.2_Nonsense_Mutation_p.S258*|NFYC_ENST00000440226.3_Nonsense_Mutation_p.S258*|NFYC_ENST00000372652.1_Nonsense_Mutation_p.S258*|NFYC_ENST00000427410.2_Nonsense_Mutation_p.S220*|NFYC_ENST00000483091.1_3'UTR|NFYC_ENST00000425457.2_Nonsense_Mutation_p.S258*|NFYC_ENST00000372651.1_Nonsense_Mutation_p.S258*|NFYC_ENST00000372654.1_Nonsense_Mutation_p.S258*|NFYC_ENST00000372653.1_Nonsense_Mutation_p.S224*			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	258					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			CAGCCTGTATCAGGCACTCAA	0.537																																							uc001cge.2		NA																	0				breast(2)|kidney(1)	3						c.(772-774)TCA>TGA		nuclear transcription factor Y, gamma isoform 1							92.0	77.0	82.0					1																	41232320		2203	4300	6503	SO:0001587	stop_gained	4802				protein folding|regulation of transcription from RNA polymerase II promoter	CCAAT-binding factor complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr1:41232320C>G	U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.773C>G	1.37:g.41232320C>G	ENSP00000312617:p.Ser258*					NFYC_uc010ojm.1_Nonsense_Mutation_p.S164*|NFYC_uc001cfx.3_Nonsense_Mutation_p.S258*|NFYC_uc009vwd.2_Nonsense_Mutation_p.S258*|NFYC_uc001cfz.2_Nonsense_Mutation_p.S258*|NFYC_uc010ojn.1_Nonsense_Mutation_p.S220*|NFYC_uc001cfy.3_Nonsense_Mutation_p.S258*|NFYC_uc001cgc.2_Nonsense_Mutation_p.S224*|NFYC_uc001cgb.2_Nonsense_Mutation_p.S258*|NFYC_uc001cgd.3_Nonsense_Mutation_p.S258*	p.S258*	NM_001142588	NP_001136060	Q13952	NFYC_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)		7	781	+	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	258					B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Nonsense_Mutation	SNP	ENST00000308733.5	37	c.773C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.785908|5.785908	0.96937|0.96937	.|.	.|.	ENSG00000066136|ENSG00000066136	ENST00000372669;ENST00000414185|ENST00000427410;ENST00000447388;ENST00000425457;ENST00000456393;ENST00000372658;ENST00000372655;ENST00000372654;ENST00000372653;ENST00000372652;ENST00000372651;ENST00000440226;ENST00000308733	T|.	0.15834|.	2.39|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.76800|.	0.4038|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.80417|.	-0.1391|.	5|.	0.87932|0.87932	D|D	0|0	.|.	16.994|16.994	0.86361|0.86361	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	M|X	300;140|220;258;258;258;156;156;258;224;258;258;258;258	ENSP00000361754:I300M|.	ENSP00000361754:I300M|ENSP00000312617:S258X	I|S	+|+	3|2	3|0	NFYC|NFYC	41004907|41004907	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.246000|7.246000	0.78247|0.78247	2.604000|2.604000	0.88044|0.88044	0.556000|0.556000	0.70494|0.70494	ATC|TCA		0.537	NFYC-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000020802.1	NM_014223		7	29	0	0	0	0.006214	0	7	29				
CYP4X1	260293	broad.mit.edu	37	1	47489498	47489498	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:47489498C>G	ENST00000371901.3	+	1	259	c.9C>G	c.(7-9)ttC>ttG	p.F3L	CYP4X1_ENST00000538609.1_Intron	NM_178033.1	NP_828847.1	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X, polypeptide 1	3						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	17						CCATGGAATTCTCCTGGCTGG	0.697																																							uc001cqt.2		NA																	0				ovary(1)|skin(1)	2						c.(7-9)TTC>TTG		cytochrome P450, family 4, subfamily X,							29.0	36.0	33.0					1																	47489498		2202	4299	6501	SO:0001583	missense	260293					endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding	g.chr1:47489498C>G	AK091806	CCDS544.1	1p33	2008-02-05			ENSG00000186377	ENSG00000186377		"""Cytochrome P450s"""	20244	protein-coding gene	gene with protein product		614999				12176035	Standard	NM_178033		Approved	MGC40051	uc001cqt.3	Q8N118	OTTHUMG00000008017	ENST00000371901.3:c.9C>G	1.37:g.47489498C>G	ENSP00000360968:p.Phe3Leu					CYP4X1_uc001cqr.2_Intron|CYP4X1_uc001cqs.2_Intron	p.F3L	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN			1	259	+			3					G3V1U1|Q5VVE5|Q6ZN67|Q8NAZ3	Missense_Mutation	SNP	ENST00000371901.3	37	c.9C>G	CCDS544.1	.	.	.	.	.	.	.	.	.	.	c	11.93	1.784368	0.31593	.	.	ENSG00000186377	ENST00000371901	T	0.63744	-0.06	5.14	-1.86	0.07760	.	3.298030	0.00589	N	0.000344	T	0.36663	0.0975	N	0.08118	0	0.49299	D	0.999775	B	0.13145	0.007	B	0.09377	0.004	T	0.54583	-0.8272	10	0.02654	T	1	.	7.8057	0.29200	0.0:0.3187:0.482:0.1993	.	3	Q8N118	CP4X1_HUMAN	L	3	ENSP00000360968:F3L	ENSP00000360968:F3L	F	+	3	2	CYP4X1	47262085	0.000000	0.05858	0.385000	0.26158	0.246000	0.25737	-0.842000	0.04354	-0.046000	0.13446	0.650000	0.86243	TTC		0.697	CYP4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022017.1	NM_178033		3	29	0	0	0	0.000248	0	3	29				
PTGER3	5733	broad.mit.edu	37	1	71512943	71512943	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:71512943G>A	ENST00000306666.5	-	1	528	c.318C>T	c.(316-318)acC>acT	p.T106T	PTGER3_ENST00000414819.1_Silent_p.T106T|PTGER3_ENST00000354608.5_Silent_p.T106T|PTGER3_ENST00000351052.5_Silent_p.T106T|PTGER3_ENST00000460330.1_Silent_p.T106T|PTGER3_ENST00000370931.3_Silent_p.T106T|PTGER3_ENST00000370924.4_Silent_p.T106T|PTGER3_ENST00000370932.2_Silent_p.T106T|PTGER3_ENST00000356595.4_Silent_p.T106T|ZRANB2-AS1_ENST00000450461.1_RNA	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	106					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CGACCGGGGTGGTGAGAAGCT	0.642																																							uc001dfg.1		NA																	0				pancreas(1)|lung(1)|skin(1)	3						c.(316-318)ACC>ACT		prostaglandin E receptor 3, subtype EP3 isoform	Bimatoprost(DB00905)						38.0	38.0	38.0					1																	71512943		2194	4290	6484	SO:0001819	synonymous_variant	5733				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity	g.chr1:71512943G>A	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.318C>T	1.37:g.71512943G>A						PTGER3_uc001dfh.1_RNA|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_RNA|PTGER3_uc001dfk.1_Silent_p.T106T|PTGER3_uc001dfl.1_Silent_p.T106T|PTGER3_uc009wbm.1_Silent_p.T106T|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Silent_p.T106T|PTGER3_uc009wbn.1_Silent_p.T106T|PTGER3_uc009wbo.2_Silent_p.T106T|PTGER3_uc001dfo.2_Silent_p.T106T|PTGER3_uc001dfp.1_Silent_p.T106T|PTGER3_uc001dfq.2_Silent_p.T106T|uc001dfr.2_RNA	p.T106T	NM_198714	NP_942007	P43115	PE2R3_HUMAN			1	549	-			106			Helical; Name=2; (Potential).		B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Silent	SNP	ENST00000306666.5	37	c.318C>T	CCDS657.1																																																																																				0.642	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957		3	5	0	0	0	0.004672	0	3	5				
GPSM2	29899	broad.mit.edu	37	1	109441561	109441561	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:109441561C>T	ENST00000406462.2	+	8	1515	c.742C>T	c.(742-744)Ctt>Ttt	p.L248F	GPSM2_ENST00000264126.3_Missense_Mutation_p.L248F|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	248					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		ATATAGCAACCTTGGAAATGC	0.299																																							uc010ovc.1		NA																	0				central_nervous_system(1)	1						c.(742-744)CTT>TTT		LGN protein							52.0	57.0	55.0					1																	109441561		2202	4300	6502	SO:0001583	missense	29899				G-protein coupled receptor protein signaling pathway	cell cortex|nucleus	GTPase activator activity|identical protein binding	g.chr1:109441561C>T	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.742C>T	1.37:g.109441561C>T	ENSP00000385510:p.Leu248Phe					AKNAD1_uc010ovb.1_Intron|GPSM2_uc010ovd.1_Missense_Mutation_p.L248F|GPSM2_uc010ove.1_Missense_Mutation_p.L248F	p.L248F	NM_013296	NP_037428	P81274	GPSM2_HUMAN		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)	7	1238	+		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)	248			TPR 6.		Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	ENST00000406462.2	37	c.742C>T	CCDS792.2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782349	0.90282	.	.	ENSG00000121957	ENST00000406462;ENST00000264126	D;D	0.96365	-3.99;-3.99	5.94	5.94	0.96194	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.98485	0.9495	M	0.93106	3.38	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99139	1.0855	10	0.87932	D	0	-0.7995	15.4477	0.75243	0.0:0.9323:0.0:0.0677	.	248	P81274	GPSM2_HUMAN	F	248	ENSP00000385510:L248F;ENSP00000264126:L248F	ENSP00000264126:L248F	L	+	1	0	GPSM2	109243084	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.926000	0.63433	2.820000	0.97059	0.650000	0.86243	CTT		0.299	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032400.3	NM_013296		15	19	0	0	0	0.00245	0	15	19				
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:145367739A>G	ENST00000342960.5	+	83	10370	c.10335A>G	c.(10333-10335)aaA>aaG	p.K3445K	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	750						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K3445K(4)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.413																																							uc001end.3		NA																	4	Substitution - coding silent(4)		prostate(3)|kidney(1)		0						c.(10558-10560)AAA>AAG		hypothetical protein LOC100132406																																				SO:0001819	synonymous_variant	100132406							g.chr1:145367739A>G	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10335A>G	1.37:g.145367739A>G						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	p.K3520K	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	85	10595	+	all_hematologic(923;0.032)		3445					Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	c.10560A>G	CCDS53355.1																																																																																				0.413	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		6	120	0	0	0	0.001168	0	6	120				
CRNN	49860	broad.mit.edu	37	1	152383274	152383274	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:152383274C>T	ENST00000271835.3	-	3	346	c.284G>A	c.(283-285)gGa>gAa	p.G95E	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	95					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCGCAGGCTCCCTCAGCACT	0.562																																							uc001ezx.2		NA																	0				ovary(2)|skin(1)	3						c.(283-285)GGA>GAA		cornulin							103.0	116.0	112.0					1																	152383274		2203	4300	6503	SO:0001583	missense	49860				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding	g.chr1:152383274C>T	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.284G>A	1.37:g.152383274C>T	ENSP00000271835:p.Gly95Glu						p.G95E	NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	358	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		95					B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	37	c.284G>A	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.730870	0.30684	.	.	ENSG00000143536	ENST00000271835;ENST00000451038	T	0.04502	3.61	4.73	3.82	0.43975	.	0.000000	0.47455	D	0.000229	T	0.07007	0.0178	L	0.55834	1.745	0.19775	N	0.999959	D	0.89917	1.0	D	0.91635	0.999	T	0.13575	-1.0504	10	0.49607	T	0.09	.	9.0082	0.36124	0.0:0.8999:0.0:0.1001	.	95	Q9UBG3	CRNN_HUMAN	E	95	ENSP00000271835:G95E	ENSP00000271835:G95E	G	-	2	0	CRNN	150649898	0.022000	0.18835	0.051000	0.19133	0.110000	0.19582	0.753000	0.26376	1.224000	0.43551	-0.727000	0.03589	GGA		0.562	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190		16	314	0	0	0	0.006122	0	16	314				
KPRP	448834	broad.mit.edu	37	1	152732360	152732360	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:152732360C>A	ENST00000606109.1	+	1	324	c.296C>A	c.(295-297)gCa>gAa	p.A99E	KPRP_ENST00000368773.1_Missense_Mutation_p.A99E			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	99	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCAGGCTGCATCCCAATCT	0.542																																							uc001fal.1		NA																	0				ovary(4)|pancreas(1)	5						c.(295-297)GCA>GAA		keratinocyte proline-rich protein							226.0	208.0	214.0					1																	152732360		2203	4300	6503	SO:0001583	missense	448834					cytoplasm		g.chr1:152732360C>A	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.296C>A	1.37:g.152732360C>A	ENSP00000475216:p.Ala99Glu						p.A99E	NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	354	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		99			Gln-rich.			Missense_Mutation	SNP	ENST00000606109.1	37	c.296C>A	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857371	0.32791	.	.	ENSG00000203786	ENST00000368773	T	0.12672	2.66	5.7	4.77	0.60923	.	0.565881	0.14906	N	0.291558	T	0.04318	0.0119	N	0.22421	0.69	0.19775	N	0.999958	B	0.24426	0.103	B	0.25140	0.058	T	0.33828	-0.9853	10	0.72032	D	0.01	-0.306	12.2379	0.54526	0.17:0.83:0.0:0.0	.	99	Q5T749	KPRP_HUMAN	E	99	ENSP00000357762:A99E	ENSP00000357762:A99E	A	+	2	0	KPRP	150998984	0.004000	0.15560	0.746000	0.31095	0.084000	0.17831	2.075000	0.41538	1.509000	0.48786	0.655000	0.94253	GCA		0.542	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		74	245	1	0	9.53419e-23	0.00361	1.9585e-22	74	245				
NUP210L	91181	broad.mit.edu	37	1	153974346	153974346	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:153974346C>A	ENST00000368559.3	-	36	5117	c.5046G>T	c.(5044-5046)aaG>aaT	p.K1682N	NUP210L_ENST00000271854.3_Intron|NUP210L_ENST00000368553.1_Intron	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1682					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GCATTCCATTCTTGCTACGTT	0.478																																							uc001fdw.2		NA																	0				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11						c.(5044-5046)AAG>AAT		nucleoporin 210kDa-like isoform 1							129.0	126.0	127.0					1																	153974346		2010	4170	6180	SO:0001583	missense	91181					integral to membrane		g.chr1:153974346C>A	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.5046G>T	1.37:g.153974346C>A	ENSP00000357547:p.Lys1682Asn					NUP210L_uc009woq.2_Missense_Mutation_p.K591N|NUP210L_uc010peh.1_Intron	p.K1682N	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)		36	5118	-	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		1682					E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	c.5046G>T	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803219	0.31869	.	.	ENSG00000143552	ENST00000368559	T	0.05025	3.51	4.78	3.87	0.44632	.	0.231211	0.30519	N	0.009443	T	0.02649	0.0080	L	0.57536	1.79	0.80722	D	1	B	0.27498	0.18	B	0.26614	0.071	T	0.33854	-0.9852	10	0.22109	T	0.4	-34.2714	8.4574	0.32908	0.0:0.8953:0.0:0.1047	.	1682	Q5VU65	P210L_HUMAN	N	1682	ENSP00000357547:K1682N	ENSP00000357547:K1682N	K	-	3	2	NUP210L	152240970	0.998000	0.40836	0.997000	0.53966	0.995000	0.86356	1.895000	0.39778	1.222000	0.43521	0.561000	0.74099	AAG		0.478	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308		73	81	1	0	2.23852e-25	0.00361	4.71447e-25	73	81				
C1orf43	25912	broad.mit.edu	37	1	154192836	154192836	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:154192836C>T	ENST00000368521.5	-	1	246	c.48G>A	c.(46-48)gtG>gtA	p.V16V	UBAP2L_ENST00000343815.6_Intron|UBAP2L_ENST00000428931.1_5'Flank|C1orf43_ENST00000368518.1_Silent_p.V16V|C1orf43_ENST00000368519.1_Silent_p.V16V|C1orf43_ENST00000368516.1_Silent_p.V16V|C1orf43_ENST00000350592.3_Silent_p.V16V|C1orf43_ENST00000362076.4_Silent_p.V16V|UBAP2L_ENST00000271877.7_5'Flank	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43	16						integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					CGTAGGCCATCACCAGCACGA	0.602																																							uc001fei.2		NA																	0					0						c.(46-48)GTG>GTA		hypothetical protein LOC25912 isoform 3							169.0	154.0	159.0					1																	154192836		2203	4300	6503	SO:0001819	synonymous_variant	25912					integral to membrane	coenzyme binding|oxidoreductase activity	g.chr1:154192836C>T	AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.48G>A	1.37:g.154192836C>T						C1orf43_uc001feg.2_Silent_p.V16V|C1orf43_uc001feh.2_Silent_p.V16V|C1orf43_uc001fej.2_Silent_p.V16V|C1orf43_uc009wos.1_Silent_p.V16V|C1orf43_uc001fek.2_Silent_p.V16V|C1orf43_uc001fel.2_Silent_p.V16V|UBAP2L_uc009wot.2_Intron|UBAP2L_uc010pek.1_5'Flank|UBAP2L_uc001fep.3_5'Flank|UBAP2L_uc010pel.1_5'Flank|UBAP2L_uc001fen.1_5'Flank|UBAP2L_uc010pem.1_5'Flank	p.V16V	NM_001098616	NP_001092086	Q9BWL3	CA043_HUMAN			1	438	-	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)		16			Helical; (Potential).		A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	Silent	SNP	ENST00000368521.5	37	c.48G>A	CCDS41404.1																																																																																				0.602	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087664.2	NM_015449		33	137	0	0	0	0.002836	0	33	137				
UBAP2L	9898	broad.mit.edu	37	1	154233427	154233427	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:154233427G>T	ENST00000361546.2	+	22	2680	c.2638G>T	c.(2638-2640)Gcc>Tcc	p.A880S	UBAP2L_ENST00000343815.6_Missense_Mutation_p.A880S|UBAP2L_ENST00000428931.1_Missense_Mutation_p.A880S|SNORA58_ENST00000364259.1_RNA|UBAP2L_ENST00000271877.7_Missense_Mutation_p.A891S			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	880					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CACAACCTTGGCCCAACCCCA	0.597																																							uc001fep.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2638-2640)GCC>TCC		ubiquitin associated protein 2-like isoform a							77.0	77.0	77.0					1																	154233427		2203	4300	6503	SO:0001583	missense	9898				binding of sperm to zona pellucida		protein binding	g.chr1:154233427G>T	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.2638G>T	1.37:g.154233427G>T	ENSP00000355343:p.Ala880Ser					UBAP2L_uc009wot.2_Missense_Mutation_p.A880S|UBAP2L_uc010pek.1_Missense_Mutation_p.A872S|UBAP2L_uc010pel.1_Missense_Mutation_p.A890S|UBAP2L_uc010pen.1_Missense_Mutation_p.A794S|UBAP2L_uc001feq.2_Missense_Mutation_p.A76S|UBAP2L_uc001fer.2_Missense_Mutation_p.A76S	p.A880S	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		23	2805	+	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		880					B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	c.2638G>T	CCDS1063.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.1|23.1	4.380113|4.380113	0.82682|0.82682	.|.	.|.	ENSG00000143569|ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546|ENST00000433615;ENST00000428595	T;T;T;T|.	0.32515|.	1.45;1.45;1.45;1.45|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.44726|0.44726	0.1307|0.1307	N|N	0.25380|0.25380	0.74|0.74	0.80722|0.80722	D|D	1|1	P;D;D;D;D;D;B|.	0.67145|.	0.534;0.996;0.996;0.996;0.984;0.99;0.361|.	P;D;D;D;D;D;P|.	0.77557|.	0.542;0.99;0.986;0.986;0.956;0.971;0.464|.	T|T	0.33317|0.33317	-0.9873|-0.9873	10|5	0.49607|.	T|.	0.09|.	-13.0253|-13.0253	17.9549|17.9549	0.89065|0.89065	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	794;891;873;880;376;880;880|.	B4DZJ6;F8W726;Q14157-4;Q14157-1;C9JD99;Q14157-3;Q14157|.	.;.;.;.;.;.;UBP2L_HUMAN|.	S|V	880;880;376;376;891;880|210;158	ENSP00000345308:A880S;ENSP00000389445:A880S;ENSP00000271877:A891S;ENSP00000355343:A880S|.	ENSP00000271877:A891S|.	A|G	+|+	1|2	0|0	UBAP2L|UBAP2L	152500051|152500051	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.263000|9.263000	0.95617|0.95617	2.715000|2.715000	0.92844|0.92844	0.555000|0.555000	0.69702|0.69702	GCC|GGC		0.597	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847		22	83	1	0	3.28513e-13	0.003954	5.95608e-13	22	83				
OR6Y1	391112	broad.mit.edu	37	1	158516940	158516940	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:158516940C>A	ENST00000302617.3	-	1	955	c.956G>T	c.(955-957)gGa>gTa	p.G319V		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	319						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					AGCCCCATTTCCCTGGGGCCC	0.448																																							uc010pil.1		NA																	0				ovary(1)	1						c.(955-957)GGA>GTA		olfactory receptor, family 6, subfamily Y,							88.0	85.0	86.0					1																	158516940		2203	4300	6503	SO:0001583	missense	391112				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158516940C>A	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.956G>T	1.37:g.158516940C>A	ENSP00000304807:p.Gly319Val						p.G319V	NM_001005189	NP_001005189	Q8NGX8	OR6Y1_HUMAN			1	956	-	all_hematologic(112;0.0378)		319			Cytoplasmic (Potential).		Q6IFS0	Missense_Mutation	SNP	ENST00000302617.3	37	c.956G>T	CCDS30899.1	.	.	.	.	.	.	.	.	.	.	C	9.720	1.159394	0.21454	.	.	ENSG00000197532	ENST00000302617	T	0.06218	3.33	4.84	-2.79	0.05841	.	0.481828	0.15283	N	0.270553	T	0.01254	0.0041	L	0.29908	0.895	0.20873	N	0.999831	B	0.09022	0.002	B	0.09377	0.004	T	0.44205	-0.9343	10	0.33141	T	0.24	.	7.392	0.26915	0.1245:0.1229:0.0:0.7526	.	319	Q8NGX8	OR6Y1_HUMAN	V	319	ENSP00000304807:G319V	ENSP00000304807:G319V	G	-	2	0	OR6Y1	156783564	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	0.070000	0.14573	-0.612000	0.05701	-0.812000	0.03155	GGA		0.448	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189		23	89	1	0	2.89027e-11	0.002299	5.12869e-11	23	89				
PEX19	5824	broad.mit.edu	37	1	160249886	160249886	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:160249886C>G	ENST00000368072.5	-	6	766	c.745G>C	c.(745-747)Gag>Cag	p.E249Q	PEX19_ENST00000532508.1_5'UTR|DCAF8_ENST00000608310.1_Missense_Mutation_p.E102Q|DCAF8_ENST00000556710.1_Missense_Mutation_p.E102Q|PEX19_ENST00000440949.3_Missense_Mutation_p.E159Q	NM_001193644.1|NM_002857.3	NP_001180573.1|NP_002848.1	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19	249					chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|establishment of protein localization to peroxisome (GO:0072663)|negative regulation of lipid binding (GO:1900131)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	ATPase binding (GO:0051117)|peroxisome membrane class-1 targeting sequence binding (GO:0036105)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)	11	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGCACCATCTCAAAACGAGCC	0.493																																							uc010pjc.1		NA																	0				skin(2)	2						c.(304-306)GAG>CAG		DDB1 and CUL4 associated factor 8							205.0	197.0	199.0					1																	160249886		2203	4300	6503	SO:0001583	missense	50717					CUL4 RING ubiquitin ligase complex	protein binding	g.chr1:160249886C>G	Y09048	CCDS1201.1	1q22	2008-07-18	2004-03-17	2004-03-19	ENSG00000162735	ENSG00000162735			9713	protein-coding gene	gene with protein product	"""housekeeping gene, 33kD"""	600279	"""peroxisomal farnesylated protein"""	PXF		9339377, 10051604	Standard	NM_002857		Approved	HK33, D1S2223E, PMP1, PMPI, PXMP1		P40855	OTTHUMG00000033112	ENST00000368072.5:c.745G>C	1.37:g.160249886C>G	ENSP00000357051:p.Glu249Gln					PEX19_uc010pje.1_RNA|PEX19_uc001fvs.2_Missense_Mutation_p.E249Q|PEX19_uc001fvt.2_Missense_Mutation_p.E159Q	p.E102Q	NM_015726	NP_056541	Q5TAQ9	DCAF8_HUMAN			4	576	-			Error:Variant_position_missing_in_Q5TAQ9_after_alignment					D3DVE7|Q5QNY4|Q8NI97	Missense_Mutation	SNP	ENST00000368072.5	37	c.304G>C	CCDS1201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.644977|4.644977	0.87859|0.87859	.|.	.|.	ENSG00000132716;ENSG00000258465;ENSG00000258465;ENSG00000162735;ENSG00000162735;ENSG00000162735;ENSG00000162735|ENSG00000162735	ENST00000555195;ENST00000556710;ENST00000485079;ENST00000368072;ENST00000429425;ENST00000440949;ENST00000392220|ENST00000495624	T;T|.	0.68765|.	-0.35;-0.35|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.49389|.	0.1554|.	L|L	0.31845|0.31845	0.965|0.965	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.994|.	D;P|.	0.79784|.	0.993;0.881|.	T|.	0.39603|.	-0.9606|.	10|.	0.26408|.	T|.	0.33|.	-5.5772|-5.5772	18.8114|18.8114	0.92059|0.92059	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	102;249|.	G3V3G9;P40855|.	.;PEX19_HUMAN|.	Q|S	102;102;119;249;229;159;229|86	ENSP00000451989:E102Q;ENSP00000451235:E102Q|.	ENSP00000357051:E249Q|.	E|X	-|-	1|2	0|2	RP11-574F21.3;PEX19;DCAF8|PEX19	158516510|158516510	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.890000|0.890000	0.51754|0.51754	6.588000|6.588000	0.74076|0.74076	2.733000|2.733000	0.93635|0.93635	0.655000|0.655000	0.94253|0.94253	GAG|TGA		0.493	PEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080642.2	NM_002857		8	277	0	0	0	0.00308	0	8	277				
TNN	63923	broad.mit.edu	37	1	175086284	175086284	+	Missense_Mutation	SNP	G	G	T	rs147066934		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:175086284G>T	ENST00000239462.4	+	10	2442	c.2329G>T	c.(2329-2331)Gtg>Ttg	p.V777L		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	777	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.V777L(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CACGGTGCACGTGTGGGCCCA	0.592																																							uc001gkl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2329-2331)GTG>TTG		tenascin N precursor							85.0	82.0	83.0					1																	175086284		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175086284G>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2329G>T	1.37:g.175086284G>T	ENSP00000239462:p.Val777Leu						p.V777L	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	10	2442	+		Breast(1374;0.000962)	777			Fibronectin type-III 6.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2329G>T	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	3.522	-0.097534	0.07010	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.72282	-0.64	5.37	5.37	0.77165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.218716	0.38605	N	0.001621	T	0.59742	0.2216	L	0.51422	1.61	0.43242	D	0.995152	B	0.28820	0.224	B	0.34418	0.182	T	0.52525	-0.8564	10	0.02654	T	1	.	8.1521	0.31148	0.0836:0.16:0.7565:0.0	.	777	Q9UQP3	TENN_HUMAN	L	777;600	ENSP00000239462:V777L	ENSP00000239462:V777L	V	+	1	0	TNN	173352907	0.940000	0.31905	0.961000	0.40146	0.614000	0.37383	1.629000	0.37071	2.677000	0.91161	0.655000	0.94253	GTG		0.592	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		21	88	1	0	2.4624e-09	0.008871	4.15716e-09	21	88				
CEP350	9857	broad.mit.edu	37	1	180000550	180000550	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:180000550A>C	ENST00000367607.3	+	15	4064	c.3646A>C	c.(3646-3648)Agc>Cgc	p.S1216R		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1216	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TGGGACCAGCAGCAAACTTTC	0.398																																							uc001gnt.2		NA																	0				ovary(4)	4						c.(3646-3648)AGC>CGC		centrosome-associated protein 350							46.0	47.0	47.0					1																	180000550		2203	4300	6503	SO:0001583	missense	9857					centrosome|nucleus|spindle		g.chr1:180000550A>C	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3646A>C	1.37:g.180000550A>C	ENSP00000356579:p.Ser1216Arg					CEP350_uc009wxl.2_Missense_Mutation_p.S1215R|CEP350_uc001gnu.2_Missense_Mutation_p.S1049R	p.S1216R	NM_014810	NP_055625	Q5VT06	CE350_HUMAN			15	4029	+			1216			Ser-rich.		O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	c.3646A>C	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	15.01	2.706535	0.48412	.	.	ENSG00000135837	ENST00000367607	T	0.59224	0.28	6.02	2.28	0.28536	.	0.358654	0.23828	N	0.044168	T	0.41696	0.1170	L	0.29908	0.895	0.24121	N	0.99581	P;P	0.45902	0.868;0.651	B;B	0.42386	0.386;0.157	T	0.20107	-1.0285	9	.	.	.	.	6.9267	0.24419	0.7404:0.1259:0.1337:0.0	.	1216;1216	E7EU22;Q5VT06	.;CE350_HUMAN	R	1216	ENSP00000356579:S1216R	.	S	+	1	0	CEP350	178267173	0.026000	0.19158	0.826000	0.32828	0.718000	0.41266	1.360000	0.34125	0.516000	0.28340	0.528000	0.53228	AGC		0.398	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		6	28	0	0	0	0.001168	0	6	28				
CACNA1E	777	broad.mit.edu	37	1	181721322	181721322	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:181721322G>T	ENST00000367573.2	+	27	3775	c.3775G>T	c.(3775-3777)Gtg>Ttg	p.V1259L	CACNA1E_ENST00000367567.4_Missense_Mutation_p.V866L|CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1259L|CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1240L|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1240L|CACNA1E_ENST00000357570.5_Missense_Mutation_p.V1210L|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V1191L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1259					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GTCTCTGCGGGTGCTCCGAGT	0.498																																							uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(3775-3777)GTG>TTG		calcium channel, voltage-dependent, R type,							121.0	120.0	120.0					1																	181721322		1926	4140	6066	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181721322G>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3775G>T	1.37:g.181721322G>T	ENSP00000356545:p.Val1259Leu					CACNA1E_uc009wxs.2_Missense_Mutation_p.V1147L|CACNA1E_uc001gox.1_Missense_Mutation_p.V485L|CACNA1E_uc009wxt.2_Missense_Mutation_p.V485L	p.V1259L	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			27	3940	+			1259			III.|Helical; Name=S4 of repeat III.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.3775G>T	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	36	5.731925	0.96856	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83	6.02	6.02	0.97574	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98748	0.9579	M	0.64170	1.965	0.80722	D	1	D;D;D	0.89917	0.985;1.0;0.996	D;D;D	0.80764	0.967;0.994;0.987	D	0.99846	1.1066	10	0.87932	D	0	.	20.1358	0.98028	0.0:0.0:1.0:0.0	.	1240;1259;1259	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	L	1259;1240;1210;1191;866;1240;1259	ENSP00000356542:V1259L;ENSP00000434814:V1240L;ENSP00000350183:V1210L;ENSP00000351101:V1191L;ENSP00000356539:V866L;ENSP00000353222:V1240L;ENSP00000356545:V1259L	ENSP00000350183:V1210L	V	+	1	0	CACNA1E	179987945	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	9.686000	0.98664	2.865000	0.98341	0.655000	0.94253	GTG		0.498	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		22	87	1	0	9.80776e-20	0.00632	1.94754e-19	22	87				
LAMC2	3918	broad.mit.edu	37	1	183212376	183212376	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:183212376G>T	ENST00000264144.4	+	23	3488	c.3423G>T	c.(3421-3423)atG>atT	p.M1141I		NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	1141	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						TGCGGCCCATGATGTCAGAGC	0.537																																							uc001gqa.2		NA																	0				skin(2)|ovary(1)	3						c.(3421-3423)ATG>ATT		laminin, gamma 2 isoform a precursor							84.0	81.0	82.0					1																	183212376		2203	4300	6503	SO:0001583	missense	3918				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding	g.chr1:183212376G>T	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.3423G>T	1.37:g.183212376G>T	ENSP00000264144:p.Met1141Ile						p.M1141I	NM_005562	NP_005553	Q13753	LAMC2_HUMAN			23	3737	+			1141			Potential.|Domain II and I.		Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	37	c.3423G>T	CCDS1352.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.29|11.29	1.594330|1.594330	0.28445|0.28445	.|.	.|.	ENSG00000058085|ENSG00000058085	ENST00000537180|ENST00000264144	.|T	.|0.77877	.|-1.13	5.02|5.02	3.12|3.12	0.35913|0.35913	.|.	.|0.667620	.|0.13615	.|N	.|0.374803	T|T	0.56307|0.56307	0.1976|0.1976	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.10296	.|0.003	.|B	.|0.04013	.|0.001	T|T	0.48854|0.48854	-0.8998|-0.8998	6|10	0.72032|0.54805	D|T	0.01|0.06	.|.	6.0918|6.0918	0.19999|0.19999	0.1568:0.0:0.6913:0.1519|0.1568:0.0:0.6913:0.1519	.|.	.|1141	.|Q13753	.|LAMC2_HUMAN	Y|I	984|1141	.|ENSP00000264144:M1141I	ENSP00000438496:D984Y|ENSP00000264144:M1141I	D|M	+|+	1|3	0|0	LAMC2|LAMC2	181478999|181478999	0.958000|0.958000	0.32768|0.32768	0.945000|0.945000	0.38365|0.38365	0.997000|0.997000	0.91878|0.91878	1.167000|1.167000	0.31847|0.31847	1.240000|1.240000	0.43803|0.43803	0.650000|0.650000	0.86243|0.86243	GAT|ATG		0.537	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562		56	60	1	0	5.99346e-17	0.00361	1.15174e-16	56	60				
RPS6KC1	26750	broad.mit.edu	37	1	213414361	213414361	+	Silent	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:213414361A>G	ENST00000366960.3	+	11	1692	c.1542A>G	c.(1540-1542)acA>acG	p.T514T	RPS6KC1_ENST00000366959.3_Silent_p.T502T|RPS6KC1_ENST00000543354.1_Silent_p.T217T|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543470.1_Silent_p.T302T	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	514					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		GTTATTTAACATTATGCAATG	0.398																																							uc010ptr.1		NA																	0				lung(4)|ovary(3)|breast(1)	8						c.(1540-1542)ACA>ACG		ribosomal protein S6 kinase, 52kDa, polypeptide							44.0	44.0	44.0					1																	213414361		2203	4299	6502	SO:0001819	synonymous_variant	26750				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity	g.chr1:213414361A>G	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.1542A>G	1.37:g.213414361A>G						RPS6KC1_uc001hkd.2_Silent_p.T502T|RPS6KC1_uc010pts.1_Silent_p.T302T|RPS6KC1_uc010ptt.1_Silent_p.T302T|RPS6KC1_uc010ptu.1_Silent_p.T333T|RPS6KC1_uc010ptv.1_Silent_p.T49T|RPS6KC1_uc001hke.2_Silent_p.T333T	p.T514T	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	11	1701	+			514					B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Silent	SNP	ENST00000366960.3	37	c.1542A>G	CCDS1513.1																																																																																				0.398	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424		23	28	0	0	0	0.003954	0	23	28				
USH2A	7399	broad.mit.edu	37	1	215987179	215987179	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:215987179G>T	ENST00000307340.3	-	49	10024	c.9638C>A	c.(9637-9639)cCg>cAg	p.P3213Q	USH2A_ENST00000366943.2_Missense_Mutation_p.P3213Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3213					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAGAACAAACGGGATATACTT	0.418										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(9637-9639)CCG>CAG		usherin isoform B							118.0	107.0	111.0					1																	215987179		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215987179G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9638C>A	1.37:g.215987179G>T	ENSP00000305941:p.Pro3213Gln	HNSCC(13;0.011)					p.P3213Q	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	49	10025	-			3213			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.9638C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266014	0.59540	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12569	2.67;2.67	5.8	4.88	0.63580	Fibronectin, type III (2);	0.366364	0.19544	U	0.111737	T	0.17066	0.0410	L	0.58428	1.81	0.09310	N	1	P	0.43857	0.819	B	0.43301	0.415	T	0.15350	-1.0440	10	0.72032	D	0.01	.	9.1167	0.36762	0.0768:0.1484:0.7748:0.0	.	3213	O75445	USH2A_HUMAN	Q	3213	ENSP00000305941:P3213Q;ENSP00000355910:P3213Q	ENSP00000305941:P3213Q	P	-	2	0	USH2A	214053802	0.992000	0.36948	0.021000	0.16686	0.145000	0.21501	2.426000	0.44731	2.746000	0.94184	0.591000	0.81541	CCG		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		27	62	1	0	1.33986e-20	0.004656	2.68617e-20	27	62				
USH2A	7399	broad.mit.edu	37	1	216373289	216373289	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:216373289G>T	ENST00000307340.3	-	17	3877	c.3491C>A	c.(3490-3492)tCt>tAt	p.S1164Y	USH2A_ENST00000366942.3_Missense_Mutation_p.S1164Y|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.S1164Y	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1164	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGTGTCACAGAGTCTGAGCC	0.448										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3490-3492)TCT>TAT		usherin isoform B							113.0	112.0	113.0					1																	216373289		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216373289G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3491C>A	1.37:g.216373289G>T	ENSP00000305941:p.Ser1164Tyr	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.S1164Y	p.S1164Y	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	17	3878	-			1164			Extracellular (Potential).|Fibronectin type-III 2.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.3491C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277370	0.59758	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.62788	0.0;0.0;0.0	6.02	5.11	0.69529	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.44483	D	0.000456	T	0.80989	0.4730	M	0.84846	2.72	0.46927	D	0.999256	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.989	D	0.84601	0.0672	10	0.87932	D	0	.	15.1449	0.72643	0.0673:0.0:0.9327:0.0	.	1164;1164	O75445-2;O75445	.;USH2A_HUMAN	Y	1164	ENSP00000305941:S1164Y;ENSP00000355910:S1164Y;ENSP00000355909:S1164Y	ENSP00000305941:S1164Y	S	-	2	0	USH2A	214439912	0.769000	0.28531	0.775000	0.31657	0.532000	0.34746	2.401000	0.44513	1.562000	0.49601	0.655000	0.94253	TCT		0.448	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		102	50	1	0	2.07245e-51	0.00361	4.828e-51	102	50				
DISP1	84976	broad.mit.edu	37	1	223178606	223178606	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:223178606G>T	ENST00000284476.6	+	8	4031	c.3867G>T	c.(3865-3867)caG>caT	p.Q1289H		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1289					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		CTTGCCAGCAGATGGGGGACT	0.532																																							uc001hnu.1		NA																	0					0						c.(3865-3867)CAG>CAT		dispatched A							106.0	97.0	100.0					1																	223178606		2203	4300	6503	SO:0001583	missense	84976				diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity	g.chr1:223178606G>T	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.3867G>T	1.37:g.223178606G>T	ENSP00000284476:p.Gln1289His						p.Q1289H	NM_032890	NP_116279	Q96F81	DISP1_HUMAN		GBM - Glioblastoma multiforme(131;0.102)	8	4014	+			1289					Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	c.3867G>T	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745594	0.49151	.	.	ENSG00000154309	ENST00000284476	D	0.93247	-3.19	5.95	4.06	0.47325	.	0.148288	0.46758	D	0.000280	D	0.88343	0.6411	L	0.34521	1.04	0.29621	N	0.846215	B	0.09022	0.002	B	0.04013	0.001	T	0.82717	-0.0319	10	0.66056	D	0.02	-12.8666	10.2929	0.43608	0.0705:0.135:0.7945:0.0	.	1289	Q96F81	DISP1_HUMAN	H	1289	ENSP00000284476:Q1289H	ENSP00000284476:Q1289H	Q	+	3	2	DISP1	221245229	1.000000	0.71417	0.674000	0.29902	0.578000	0.36192	4.143000	0.58051	0.834000	0.34852	-0.136000	0.14681	CAG		0.532	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890		63	173	1	0	4.09106e-26	0.00361	8.74858e-26	63	173				
HEATR1	55127	broad.mit.edu	37	1	236751262	236751262	+	Missense_Mutation	SNP	T	T	C	rs149485004	byFrequency	TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:236751262T>C	ENST00000366582.3	-	13	1726	c.1612A>G	c.(1612-1614)Ata>Gta	p.I538V	HEATR1_ENST00000366581.2_Missense_Mutation_p.I538V	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	538					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AAAGCACTTATAGCCGACAAA	0.348																																							uc001hyd.1		NA																	0				ovary(2)|skin(1)	3						c.(1612-1614)ATA>GTA		protein BAP28		T	VAL/ILE	0,4406		0,0,2203	125.0	116.0	119.0		1612	-11.7	0.0	1	dbSNP_134	119	5,8591	4.3+/-15.6	0,5,4293	yes	missense	HEATR1	NM_018072.5	29	0,5,6496	CC,CT,TT		0.0582,0.0,0.0385	benign	538/2145	236751262	5,12997	2203	4298	6501	SO:0001583	missense	55127				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding	g.chr1:236751262T>C	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1612A>G	1.37:g.236751262T>C	ENSP00000355541:p.Ile538Val						p.I538V	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)		13	1737	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	538					Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	c.1612A>G	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	T	0.694	-0.793480	0.02862	0.0	5.82E-4	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66460	-0.21;-0.17	5.84	-11.7	0.00046	Armadillo-like helical (1);Armadillo-type fold (1);	0.726361	0.12860	N	0.433227	T	0.27134	0.0665	N	0.00707	-1.245	0.32082	N	0.592982	B	0.02656	0.0	B	0.04013	0.001	T	0.51012	-0.8759	10	0.38643	T	0.18	.	14.2954	0.66308	0.0:0.2916:0.4751:0.2333	.	538	Q9H583	HEAT1_HUMAN	V	538	ENSP00000355541:I538V;ENSP00000355540:I538V	ENSP00000355540:I538V	I	-	1	0	HEATR1	234817885	0.000000	0.05858	0.000000	0.03702	0.241000	0.25554	-3.189000	0.00565	-3.406000	0.00170	-0.842000	0.03052	ATA		0.348	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		37	18	0	0	0	0.005524	0	37	18				
ZP4	57829	broad.mit.edu	37	1	238048735	238048735	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:238048735G>T	ENST00000366570.4	-	8	1274	c.1116C>A	c.(1114-1116)agC>agA	p.S372R	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	372	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GGGGGTCAGTGCTGGGTGTTG	0.532																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	0				ovary(2)|skin(1)	3						c.(1114-1116)AGC>AGA		zona pellucida glycoprotein 4 preproprotein							66.0	69.0	68.0					1																	238048735		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048735G>T	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1116C>A	1.37:g.238048735G>T	ENSP00000355529:p.Ser372Arg					LOC100130331_uc010pyc.1_Intron	p.S372R	NM_021186	NP_067009	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		8	1116	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	372			ZP.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.1116C>A	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	G	6.959	0.546929	0.13312	.	.	ENSG00000116996	ENST00000366570	D	0.83419	-1.72	4.98	0.304	0.15796	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	1.033030	0.07654	N	0.932404	T	0.81931	0.4927	L	0.61218	1.895	0.09310	N	1	B	0.24675	0.109	B	0.37387	0.248	T	0.71965	-0.4433	10	0.59425	D	0.04	-2.4395	4.9862	0.14190	0.378:0.1713:0.4507:0.0	.	372	Q12836	ZP4_HUMAN	R	372	ENSP00000355529:S372R	ENSP00000355529:S372R	S	-	3	2	ZP4	236115358	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-0.150000	0.10189	0.148000	0.19059	0.655000	0.94253	AGC		0.532	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			23	69	1	0	1.22574e-08	0.002299	1.99661e-08	23	69				
EXO1	9156	broad.mit.edu	37	1	242013757	242013757	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:242013757C>G	ENST00000366548.3	+	4	623	c.30C>G	c.(28-30)atC>atG	p.I10M	EXO1_ENST00000493702.1_3'UTR|EXO1_ENST00000348581.5_Missense_Mutation_p.I10M|EXO1_ENST00000518483.1_Missense_Mutation_p.I10M	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	10	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TACAATTTATCAAAGAAGCTT	0.388								Editing and processing nucleases																															uc001hzh.2		NA																	0				ovary(2)|lung(2)|skin(1)	5						c.(28-30)ATC>ATG	Direct_reversal_of_damage|Editing_and_processing_nucleases	exonuclease 1 isoform b							111.0	111.0	111.0					1																	242013757		2203	4300	6503	SO:0001583	missense	9156				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity	g.chr1:242013757C>G	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.30C>G	1.37:g.242013757C>G	ENSP00000355506:p.Ile10Met					EXO1_uc001hzi.2_Missense_Mutation_p.I10M|EXO1_uc001hzj.2_Missense_Mutation_p.I10M|EXO1_uc009xgq.2_Missense_Mutation_p.I10M	p.I10M	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0107)		4	570	+	Ovarian(103;0.103)	all_cancers(173;0.0555)	10			N-domain.		O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	37	c.30C>G	CCDS1620.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.547332	0.65311	.	.	ENSG00000174371	ENST00000519225;ENST00000366548;ENST00000423131;ENST00000523590;ENST00000348581;ENST00000366547;ENST00000518483;ENST00000437497;ENST00000450748	T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	5.39	4.42	0.53409	XPG N-terminal (2);	0.116625	0.64402	D	0.000017	T	0.71813	0.3384	L	0.60904	1.88	0.54753	D	0.999988	P;P;P	0.49961	0.93;0.857;0.93	P;P;P	0.53006	0.715;0.592;0.715	T	0.74575	-0.3620	10	0.59425	D	0.04	-0.0755	13.5939	0.61978	0.0:0.8447:0.1553:0.0	.	10;10;10	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	M	10	ENSP00000355506:I10M;ENSP00000415531:I10M;ENSP00000430082:I10M;ENSP00000311873:I10M;ENSP00000430251:I10M;ENSP00000412041:I10M;ENSP00000406652:I10M	ENSP00000311873:I10M	I	+	3	3	EXO1	240080380	0.986000	0.35501	1.000000	0.80357	0.919000	0.55068	0.284000	0.18864	2.543000	0.85770	0.563000	0.77884	ATC		0.388	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027		5	86	0	0	0	0.001168	0	5	86				
OR2G6	391211	broad.mit.edu	37	1	248685673	248685673	+	Silent	SNP	G	G	T	rs552819557		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:248685673G>T	ENST00000343414.4	+	1	758	c.726G>T	c.(724-726)tcG>tcT	p.S242S		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGACCTGTTCGTCTCACCTGG	0.463																																							uc001ien.1		NA																	0				ovary(2)|skin(1)	3						c.(724-726)TCG>TCT		olfactory receptor, family 2, subfamily G,							112.0	113.0	113.0					1																	248685673		2203	4300	6503	SO:0001819	synonymous_variant	391211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248685673G>T		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.726G>T	1.37:g.248685673G>T							p.S242S	NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	726	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	242			Helical; Name=6; (Potential).		B2RP33	Silent	SNP	ENST00000343414.4	37	c.726G>T	CCDS31119.1																																																																																				0.463	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842		28	103	1	0	1.39806e-14	0.008361	2.63796e-14	28	103				
WDR37	22884	broad.mit.edu	37	10	1130413	1130413	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:1130413G>T	ENST00000358220.1	+	6	611	c.467G>T	c.(466-468)cGg>cTg	p.R156L	WDR37_ENST00000381329.1_Missense_Mutation_p.R156L|WDR37_ENST00000263150.4_Missense_Mutation_p.R156L			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	156										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ATCGGCCACCGGGACGGCATC	0.597																																							uc001igf.1		NA																	0					0						c.(466-468)CGG>CTG		WD repeat domain 37							74.0	66.0	68.0					10																	1130413		2203	4300	6503	SO:0001583	missense	22884							g.chr10:1130413G>T	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.467G>T	10.37:g.1130413G>T	ENSP00000350954:p.Arg156Leu					WDR37_uc001ige.2_Missense_Mutation_p.R156L|WDR37_uc009xhm.1_Missense_Mutation_p.R156L|WDR37_uc009xhn.1_RNA|WDR37_uc001igg.1_RNA	p.R156L	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN		Epithelial(11;0.134)	6	640	+		all_epithelial(10;0.0449)|Colorectal(49;0.142)	156			WD 1.		A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	c.467G>T	CCDS7057.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200278	0.94997	.	.	ENSG00000047056	ENST00000358220;ENST00000381329;ENST00000263150;ENST00000436154	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74831	0.3768	M	0.66560	2.04	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.79108	0.97;0.97;0.992	T	0.68044	-0.5513	10	0.25106	T	0.35	.	19.9993	0.97404	0.0:0.0:1.0:0.0	.	156;156;156	A8K976;Q9Y2I8;E7EQ49	.;WDR37_HUMAN;.	L	156;156;156;123	ENSP00000350954:R156L;ENSP00000370730:R156L;ENSP00000263150:R156L;ENSP00000404346:R123L	ENSP00000263150:R156L	R	+	2	0	WDR37	1120413	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	8.991000	0.93514	2.823000	0.97156	0.650000	0.86243	CGG		0.597	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023		19	30	1	0	5.03518e-11	0.007413	8.85937e-11	19	30				
ITGA8	8516	broad.mit.edu	37	10	15760819	15760819	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:15760819G>T	ENST00000378076.3	-	2	642	c.289C>A	c.(289-291)Cct>Act	p.P97T		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	97					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.P97T(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GCGGGCCAAGGACAGTAATAG	0.572																																							uc001ioc.1		NA																	1	Substitution - Missense(1)	p.P97T(1)	lung(1)	ovary(3)|lung(3)	6						c.(289-291)CCT>ACT		integrin, alpha 8 precursor							122.0	107.0	112.0					10																	15760819		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15760819G>T	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.289C>A	10.37:g.15760819G>T	ENSP00000367316:p.Pro97Thr					ITGA8_uc010qcb.1_Missense_Mutation_p.P97T	p.P97T	NM_003638	NP_003629	P53708	ITA8_HUMAN			2	289	-			97			Extracellular (Potential).|FG-GAP 1.		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.289C>A	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874910	0.72180	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	D	0.92048	-2.96	4.79	4.79	0.61399	.	0.109132	0.64402	D	0.000005	D	0.94866	0.8341	M	0.79123	2.44	0.54753	D	0.999984	D;D	0.76494	0.999;0.997	D;P	0.66847	0.947;0.886	D	0.94611	0.7804	10	0.66056	D	0.02	.	9.8435	0.41013	0.0782:0.1422:0.7795:0.0	.	97;97	F5H818;P53708	.;ITA8_HUMAN	T	97	ENSP00000367316:P97T	ENSP00000367316:P97T	P	-	1	0	ITGA8	15800825	1.000000	0.71417	0.861000	0.33841	0.995000	0.86356	5.991000	0.70602	2.492000	0.84095	0.561000	0.74099	CCT		0.572	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		28	45	1	0	3.80469e-20	0.001786	7.59118e-20	28	45				
PLXDC2	84898	broad.mit.edu	37	10	20436785	20436785	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:20436785A>G	ENST00000377252.4	+	6	1578	c.737A>G	c.(736-738)cAg>cGg	p.Q246R	PLXDC2_ENST00000377242.3_Missense_Mutation_p.Q197R|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	246					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TTCACATTCCAGGCAACCCTG	0.438																																							uc001iqg.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(736-738)CAG>CGG		plexin domain containing 2 precursor							102.0	84.0	90.0					10																	20436785		2203	4300	6503	SO:0001583	missense	84898					integral to membrane		g.chr10:20436785A>G	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.737A>G	10.37:g.20436785A>G	ENSP00000366460:p.Gln246Arg					PLXDC2_uc001iqh.1_Missense_Mutation_p.Q197R|PLXDC2_uc009xkc.1_RNA	p.Q246R	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN			6	1374	+			246			Extracellular (Potential).		Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	c.737A>G	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350039	0.82132	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	T;T	0.78126	-1.15;-1.15	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.88647	0.6493	M	0.85945	2.785	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.99	D	0.90571	0.4522	10	0.72032	D	0.01	.	14.7091	0.69215	1.0:0.0:0.0:0.0	.	197;246	Q6UX71-2;Q6UX71	.;PXDC2_HUMAN	R	246;197;109;232	ENSP00000366460:Q246R;ENSP00000366450:Q197R	ENSP00000366446:Q109R	Q	+	2	0	PLXDC2	20476791	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.076000	0.94009	1.941000	0.56285	0.460000	0.39030	CAG		0.438	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812		3	36	0	0	0	0.004672	0	3	36				
PLXDC2	84898	broad.mit.edu	37	10	20508007	20508007	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:20508007G>A	ENST00000377252.4	+	12	2129	c.1288G>A	c.(1288-1290)Gca>Aca	p.A430T	PLXDC2_ENST00000377242.3_Missense_Mutation_p.A381T|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	430					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TACCAAGATAGCACTACATCT	0.284																																							uc001iqg.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1288-1290)GCA>ACA		plexin domain containing 2 precursor							90.0	88.0	89.0					10																	20508007		2201	4298	6499	SO:0001583	missense	84898					integral to membrane		g.chr10:20508007G>A	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.1288G>A	10.37:g.20508007G>A	ENSP00000366460:p.Ala430Thr					PLXDC2_uc001iqh.1_Missense_Mutation_p.A381T|PLXDC2_uc009xkc.1_RNA	p.A430T	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN			12	1925	+			430			Extracellular (Potential).		Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	c.1288G>A	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.477064	0.63849	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	T;T	0.44482	0.92;0.92	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.53753	0.1816	M	0.63428	1.95	0.58432	D	0.999999	D;D	0.65815	0.995;0.993	P;P	0.57152	0.814;0.726	T	0.45977	-0.9224	10	0.14656	T	0.56	.	16.056	0.80805	0.0:0.0:1.0:0.0	.	381;430	Q6UX71-2;Q6UX71	.;PXDC2_HUMAN	T	430;381;293;416	ENSP00000366460:A430T;ENSP00000366450:A381T	ENSP00000366446:A293T	A	+	1	0	PLXDC2	20548013	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.958000	0.70330	2.512000	0.84698	0.561000	0.74099	GCA		0.284	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812		5	12	0	0	0	0.000602	0	5	12				
FZD8	8325	broad.mit.edu	37	10	35930182	35930182	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:35930182T>A	ENST00000374694.1	-	1	180	c.176A>T	c.(175-177)cAc>cTc	p.H59L	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	59	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						TTGCGTGTCGTGGTTGAACTG	0.607																																							uc001iyz.1		NA																	0					0						c.(175-177)CAC>CTC		frizzled 8 precursor							150.0	113.0	125.0					10																	35930182		2203	4300	6503	SO:0001583	missense	8325				axonogenesis|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|T cell differentiation in thymus|vasculature development	cell projection|Golgi apparatus|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr10:35930182T>A	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.176A>T	10.37:g.35930182T>A	ENSP00000363826:p.His59Leu						p.H59L	NM_031866	NP_114072	Q9H461	FZD8_HUMAN			1	181	-			59			FZ.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000374694.1	37	c.176A>T	CCDS7192.1	.	.	.	.	.	.	.	.	.	.	T	16.28	3.078085	0.55753	.	.	ENSG00000177283	ENST00000374694	T	0.57273	0.41	3.92	3.92	0.45320	Frizzled domain (5);	0.146541	0.44285	U	0.000468	T	0.70605	0.3243	M	0.85945	2.785	0.54753	D	0.999983	D	0.60575	0.988	D	0.65573	0.936	T	0.74112	-0.3770	10	0.59425	D	0.04	.	9.7468	0.40451	0.1542:0.0:0.0:0.8458	.	59	Q9H461	FZD8_HUMAN	L	59	ENSP00000363826:H59L	ENSP00000363826:H59L	H	-	2	0	FZD8	35970188	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.810000	0.86072	1.560000	0.49568	0.379000	0.24179	CAC		0.607	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866		12	19	0	0	0	0.001368	0	12	19				
C10orf71	118461	broad.mit.edu	37	10	50530874	50530874	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:50530874G>T	ENST00000374144.3	+	3	572	c.284G>T	c.(283-285)tGg>tTg	p.W95L	C10orf71_ENST00000323868.4_Missense_Mutation_p.W95L			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	95										endometrium(1)	1						CATTCGGGCTGGGCGGCCACC	0.577																																							uc010qgp.1		NA																	0					0						c.(283-285)TGG>TTG		hypothetical protein LOC118461 isoform 2							91.0	102.0	99.0					10																	50530874		1963	4148	6111	SO:0001583	missense	118461							g.chr10:50530874G>T	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.284G>T	10.37:g.50530874G>T	ENSP00000363259:p.Trp95Leu						p.W95L	NM_199459	NP_955629	Q711Q0	CJ071_HUMAN			3	623	+			95					A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	c.284G>T	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939236	0.52972	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.16897	2.31;3.48	4.93	4.93	0.64822	.	0.000000	0.45361	D	0.000380	T	0.40498	0.1119	M	0.66939	2.045	0.44142	D	0.996939	D	0.89917	1.0	D	0.79108	0.992	T	0.11518	-1.0584	10	0.36615	T	0.2	.	17.1233	0.86707	0.0:0.0:1.0:0.0	.	95	Q711Q0-3	.	L	95	ENSP00000318713:W95L;ENSP00000363259:W95L	ENSP00000318713:W95L	W	+	2	0	C10orf71	50200880	1.000000	0.71417	0.997000	0.53966	0.084000	0.17831	4.360000	0.59455	2.283000	0.76528	0.455000	0.32223	TGG		0.577	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459		30	41	1	0	1.45844e-13	0.002836	2.6674e-13	30	41				
BICC1	80114	broad.mit.edu	37	10	60546724	60546724	+	Silent	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:60546724A>G	ENST00000373886.3	+	5	433	c.429A>G	c.(427-429)gaA>gaG	p.E143E		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	143	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CACATACAGAACATTCACATG	0.368																																							uc001jki.1		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(427-429)GAA>GAG		bicaudal C homolog 1							119.0	109.0	112.0					10																	60546724		2203	4300	6503	SO:0001819	synonymous_variant	80114				multicellular organismal development		RNA binding	g.chr10:60546724A>G	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.429A>G	10.37:g.60546724A>G							p.E143E	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN			5	429	+			143			KH 1.			Silent	SNP	ENST00000373886.3	37	c.429A>G	CCDS31206.1																																																																																				0.368	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044		8	24	0	0	0	0.00308	0	8	24				
FAM13C	220965	broad.mit.edu	37	10	61043179	61043179	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:61043179T>A	ENST00000373868.2	-	6	623	c.536A>T	c.(535-537)aAg>aTg	p.K179M	FAM13C_ENST00000442566.3_Missense_Mutation_p.K200M|FAM13C_ENST00000277705.6_Missense_Mutation_p.K200M|RP11-443O13.3_ENST00000433249.1_RNA|FAM13C_ENST00000468840.2_Missense_Mutation_p.K96M|FAM13C_ENST00000419214.2_Missense_Mutation_p.K179M|FAM13C_ENST00000373867.3_Missense_Mutation_p.K96M|FAM13C_ENST00000435852.2_Missense_Mutation_p.K179M|FAM13C_ENST00000422313.2_Missense_Mutation_p.K179M	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	179										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CGCCGGGTCCTTGACTCCATG	0.532																																							uc001jkn.2		NA																	0				ovary(2)	2						c.(535-537)AAG>ATG		hypothetical protein LOC220965 isoform 1							158.0	154.0	156.0					10																	61043179		2203	4300	6503	SO:0001583	missense	220965							g.chr10:61043179T>A	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.536A>T	10.37:g.61043179T>A	ENSP00000362975:p.Lys179Met					FAM13C_uc001jko.2_Missense_Mutation_p.K179M|FAM13C_uc010qid.1_Missense_Mutation_p.K96M|FAM13C_uc010qie.1_Missense_Mutation_p.K96M|FAM13C_uc010qif.1_Missense_Mutation_p.K201M|FAM13C_uc001jkp.2_Missense_Mutation_p.K96M	p.K179M	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN			7	670	-			179					B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	37	c.536A>T	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	T	14.37	2.514769	0.44763	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T;T;T	0.79352	-1.26;0.77;-1.21;-1.21;0.73;-1.26;0.73;0.72	4.85	4.85	0.62838	.	0.000000	0.64402	D	0.000010	D	0.86176	0.5870	M	0.66939	2.045	0.44207	D	0.997036	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.991;0.998;0.998;0.999	D	0.86509	0.1808	10	0.46703	T	0.11	-17.3696	14.7254	0.69341	0.0:0.0:0.0:1.0	.	179;96;179;179;179	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	M	96;179;200;200;179;96;179;179	ENSP00000362974:K96M;ENSP00000362975:K179M;ENSP00000395661:K200M;ENSP00000277705:K200M;ENSP00000391993:K179M;ENSP00000423896:K96M;ENSP00000392302:K179M;ENSP00000400241:K179M	ENSP00000277705:K200M	K	-	2	0	FAM13C	60713185	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	3.156000	0.50708	1.934000	0.56057	0.460000	0.39030	AAG		0.532	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2			56	69	0	0	0	0.00361	0	56	69				
COL17A1	1308	broad.mit.edu	37	10	105792028	105792028	+	Silent	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:105792028G>T	ENST00000353479.5	-	56	4749	c.4459C>A	c.(4459-4461)Cgg>Agg	p.R1487R	COL17A1_ENST00000369733.3_Silent_p.R1405R	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1487	Nonhelical region (NC1).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CTCCTTCTCCGCCCAGCATAG	0.498																																							uc001kxr.2		NA																	0				ovary(4)|pancreas(1)	5						c.(4459-4461)CGG>AGG		alpha 1 type XVII collagen							93.0	78.0	83.0					10																	105792028		2203	4300	6503	SO:0001819	synonymous_variant	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105792028G>T	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4459C>A	10.37:g.105792028G>T						COL17A1_uc001kxq.2_RNA	p.R1487R	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	56	4628	-		Colorectal(252;0.103)|Breast(234;0.122)	1487			Extracellular (Potential).|Nonhelical region (NC1).		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	ENST00000353479.5	37	c.4459C>A	CCDS7554.1																																																																																				0.498	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		15	18	1	0	7.93312e-07	0.00245	1.21622e-06	15	18				
SORCS3	22986	broad.mit.edu	37	10	107016584	107016584	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:107016584G>C	ENST00000369701.3	+	25	3572	c.3345G>C	c.(3343-3345)ttG>ttC	p.L1115F		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1115					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AAGCTCCATTGGTGGACTCCA	0.458																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	0				ovary(6)|skin(3)|central_nervous_system(1)	10						c.(3343-3345)TTG>TTC		VPS10 domain receptor protein SORCS 3 precursor							147.0	123.0	131.0					10																	107016584		2203	4300	6503	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:107016584G>C	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3345G>C	10.37:g.107016584G>C	ENSP00000358715:p.Leu1115Phe						p.L1115F	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	25	3572	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	1115			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.3345G>C	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599535	0.66332	.	.	ENSG00000156395	ENST00000369701	T	0.16743	2.32	5.93	1.81	0.25067	.	0.000000	0.64402	D	0.000002	T	0.27629	0.0679	L	0.55481	1.735	0.51233	D	0.999912	D	0.76494	0.999	D	0.75484	0.986	T	0.04767	-1.0928	9	.	.	.	.	3.4465	0.07482	0.1589:0.1023:0.5555:0.1833	.	1115	Q9UPU3	SORC3_HUMAN	F	1115	ENSP00000358715:L1115F	.	L	+	3	2	SORCS3	107006574	0.997000	0.39634	0.979000	0.43373	0.888000	0.51559	0.336000	0.19823	0.863000	0.35553	0.655000	0.94253	TTG		0.458	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		13	16	0	0	0	0.001368	0	13	16				
EMX2	2018	broad.mit.edu	37	10	119305203	119305203	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:119305203G>A	ENST00000553456.3	+	2	1291	c.467G>A	c.(466-468)cGg>cAg	p.R156Q	EMX2_ENST00000442245.4_Intron|EMX2_ENST00000546446.1_3'UTR|EMX2OS_ENST00000551288.1_RNA	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	156					anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		AAGCCCAAGCGGATCCGAACC	0.607																																							uc001ldh.3		NA																	0					0						c.(466-468)CGG>CAG		empty spiracles homeobox 2 isoform 1							65.0	55.0	59.0					10																	119305203		2203	4300	6503	SO:0001583	missense	2018					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:119305203G>A	AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.467G>A	10.37:g.119305203G>A	ENSP00000450962:p.Arg156Gln					EMX2OS_uc001ldg.2_5'Flank|EMX2_uc001ldi.3_Intron	p.R156Q	NM_004098	NP_004089	Q04743	EMX2_HUMAN		all cancers(201;0.0133)	2	1290	+		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)	156			Homeobox.		G3V305|Q96NN8|Q9BQF4	Missense_Mutation	SNP	ENST00000553456.3	37	c.467G>A	CCDS7601.1	.	.	.	.	.	.	.	.	.	.	G	37	6.447252	0.97572	.	.	ENSG00000170370	ENST00000369201	.	.	.	5.9	5.9	0.94986	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84892	0.0837	9	0.87932	D	0	-15.123	20.2806	0.98513	0.0:0.0:1.0:0.0	.	156	Q04743	EMX2_HUMAN	Q	156	.	ENSP00000358202:R156Q	R	+	2	0	EMX2	119295193	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.795000	0.96236	0.643000	0.83706	CGG		0.607	EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050569.4	NM_004098		4	29	0	0	0	0.000602	0	4	29				
RGS10	6001	broad.mit.edu	37	10	121285608	121285608	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr10:121285608C>G	ENST00000369101.3	-	2	194	c.167G>C	c.(166-168)aGt>aCt	p.S56T	RGS10_ENST00000392865.1_Missense_Mutation_p.S50T|RGS10_ENST00000369103.2_Missense_Mutation_p.S64T|RGS10_ENST00000469575.1_5'Flank			O43665	RGS10_HUMAN	regulator of G-protein signaling 10	56	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|large_intestine(1)|lung(3)	6		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)		ATTTTCTTCACTGAATTCCTT	0.299																																							uc001lee.2		NA																	0					0						c.(166-168)AGT>ACT		regulator of G-protein signaling 10 isoform b							74.0	82.0	79.0					10																	121285608		2201	4297	6498	SO:0001583	missense	6001				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|protein binding|signal transducer activity	g.chr10:121285608C>G	AF045229	CCDS31294.1, CCDS41572.1	10q25	2007-08-14	2007-08-14		ENSG00000148908	ENSG00000148908		"""Regulators of G-protein signaling"""	9992	protein-coding gene	gene with protein product		602856	"""regulator of G-protein signalling 10"""			8774883	Standard	NM_002925		Approved		uc001leg.3	O43665	OTTHUMG00000019150	ENST00000369101.3:c.167G>C	10.37:g.121285608C>G	ENSP00000358097:p.Ser56Thr					RGS10_uc001lef.2_Missense_Mutation_p.S50T|RGS10_uc001leg.2_Missense_Mutation_p.S64T	p.S56T	NM_002925	NP_002916	O43665	RGS10_HUMAN		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)	2	167	-		Lung NSC(174;0.094)|all_lung(145;0.123)	56			RGS.		A8K408|B1AMR8|Q6IAZ6|Q96GN0	Missense_Mutation	SNP	ENST00000369101.3	37	c.167G>C		.	.	.	.	.	.	.	.	.	.	C	19.70	3.875668	0.72180	.	.	ENSG00000148908	ENST00000392865;ENST00000369103;ENST00000369101	T;T;T	0.03094	4.05;4.05;4.05	5.49	5.49	0.81192	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.065101	0.64402	D	0.000006	T	0.20373	0.0490	M	0.91510	3.215	0.58432	D	0.999993	B;B;B	0.27140	0.169;0.091;0.111	P;B;P	0.45856	0.461;0.362;0.495	T	0.00888	-1.1526	10	0.87932	D	0	-2.4426	16.6545	0.85224	0.0:1.0:0.0:0.0	.	64;50;56	O43665-3;O43665-2;O43665	.;.;RGS10_HUMAN	T	50;64;56	ENSP00000376605:S50T;ENSP00000358099:S64T;ENSP00000358097:S56T	ENSP00000358097:S56T	S	-	2	0	RGS10	121275598	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.656000	0.67988	2.746000	0.94184	0.460000	0.39030	AGT		0.299	RGS10-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050655.1	NM_002925		16	35	0	0	0	0.00499	0	16	35				
OR52R1	119695	broad.mit.edu	37	11	4825267	4825267	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:4825267G>T	ENST00000356069.2	-	1	343	c.344C>A	c.(343-345)tCt>tAt	p.S115Y	MMP26_ENST00000380390.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.S194Y|MMP26_ENST00000477339.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAGCACCCCAGACTCCACAGA	0.527																																							uc010qym.1		NA																	0				skin(1)	1						c.(580-582)TCT>TAT		olfactory receptor, family 52, subfamily R,							136.0	125.0	129.0					11																	4825267		2201	4298	6499	SO:0001583	missense	119695				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4825267G>T	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.344C>A	11.37:g.4825267G>T	ENSP00000348368:p.Ser115Tyr						p.S194Y	NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	581	-		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)	115			Helical; Name=3; (Potential).		Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	c.581C>A	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	G	17.42	3.383910	0.61845	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00416	7.51;7.51	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000250	T	0.01765	0.0056	M	0.89785	3.06	0.30055	N	0.811385	D	0.89917	1.0	D	0.91635	0.999	T	0.03077	-1.1075	10	0.87932	D	0	.	17.9523	0.89057	0.0:0.0:1.0:0.0	.	115	Q8NGF1	O52R1_HUMAN	Y	115;194	ENSP00000348368:S115Y;ENSP00000369742:S194Y	ENSP00000348368:S115Y	S	-	2	0	OR52R1	4781843	0.938000	0.31826	0.997000	0.53966	0.971000	0.66376	2.654000	0.46699	2.826000	0.97356	0.650000	0.86243	TCT		0.527	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177		38	40	1	0	7.61001e-30	0.005524	1.6702e-29	38	40				
TRIM22	10346	broad.mit.edu	37	11	5730492	5730492	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:5730492G>T	ENST00000379965.3	+	8	1388	c.1111G>T	c.(1111-1113)Gta>Tta	p.V371L	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	371	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		GATCCTGGGCGTACACAGTAA	0.393																																					GBM(104;491 2336 5222)	GBM(104;491 2336 5222)	uc001mbr.2		NA																	0					0						c.(1111-1113)GTA>TTA		tripartite motif-containing 22							134.0	128.0	130.0					11																	5730492		1844	4103	5947	SO:0001583	missense	10346				immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr11:5730492G>T	X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.1111G>T	11.37:g.5730492G>T	ENSP00000369299:p.Val371Leu					TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Missense_Mutation_p.V367L|TRIM22_uc010qzm.1_Missense_Mutation_p.V199L|TRIM22_uc009yeu.2_Missense_Mutation_p.V182L|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	p.V371L	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)	8	1388	+		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	371			B30.2/SPRY.		Q05CQ0|Q15521	Missense_Mutation	SNP	ENST00000379965.3	37	c.1111G>T	CCDS41612.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.090091	0.55968	.	.	ENSG00000132274	ENST00000379965;ENST00000545338;ENST00000455293	T	0.72835	-0.69	3.78	0.474	0.16768	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.76449	0.3989	M	0.65975	2.015	0.24977	N	0.991625	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.79784	0.993;0.97;0.979	T	0.61831	-0.6982	9	0.39692	T	0.17	.	2.5289	0.04698	0.0988:0.162:0.4124:0.3268	.	293;367;371	F8WAP8;Q8IYM9-2;Q8IYM9	.;.;TRI22_HUMAN	L	371;182;293	ENSP00000369299:V371L	ENSP00000369299:V371L	V	+	1	0	TRIM22	5687068	0.532000	0.26346	0.226000	0.23910	0.251000	0.25915	0.827000	0.27421	-0.009000	0.14296	-0.499000	0.04595	GTA		0.393	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2	NM_006074		24	32	1	0	1.64293e-13	0.00333	2.99172e-13	24	32				
OR52E4	390081	broad.mit.edu	37	11	5905530	5905530	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:5905530C>A	ENST00000316987.2	+	1	30	c.8C>A	c.(7-9)tCt>tAt	p.S3Y		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAATGCCTTCTATCAATGAC	0.428																																							uc010qzs.1		NA																	0				ovary(2)	2						c.(7-9)TCT>TAT		olfactory receptor, family 52, subfamily E,							147.0	145.0	146.0					11																	5905530		2201	4296	6497	SO:0001583	missense	390081				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5905530C>A	AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.8C>A	11.37:g.5905530C>A	ENSP00000321426:p.Ser3Tyr					TRIM5_uc001mbq.1_Intron	p.S3Y	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	8	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	3			Extracellular (Potential).		Q6IFG0	Missense_Mutation	SNP	ENST00000316987.2	37	c.8C>A	CCDS31401.1	.	.	.	.	.	.	.	.	.	.	C	6.869	0.529773	0.13127	.	.	ENSG00000180974	ENST00000316987	T	0.37058	1.22	5.15	2.11	0.27256	.	0.470865	0.17625	N	0.167596	T	0.25158	0.0611	M	0.62016	1.91	0.09310	N	1	B	0.33477	0.413	B	0.32211	0.142	T	0.24657	-1.0154	10	0.02654	T	1	.	4.7548	0.13078	0.1702:0.6471:0.0:0.1827	.	3	Q8NGH9	O52E4_HUMAN	Y	3	ENSP00000321426:S3Y	ENSP00000321426:S3Y	S	+	2	0	OR52E4	5862106	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	-0.055000	0.11807	0.740000	0.32651	0.643000	0.83706	TCT		0.428	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165		44	70	1	0	8.86878e-18	0.00361	1.72817e-17	44	70				
INSC	387755	broad.mit.edu	37	11	15222462	15222462	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:15222462C>T	ENST00000379554.3	+	7	973	c.927C>T	c.(925-927)tgC>tgT	p.C309C	INSC_ENST00000424273.1_Intron|INSC_ENST00000447214.2_Intron|INSC_ENST00000528567.1_Silent_p.C262C|INSC_ENST00000525218.1_Intron|INSC_ENST00000379556.3_Silent_p.C262C|INSC_ENST00000530161.1_Silent_p.C262C	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	309					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						CCTCCATCTGCTGCGTGGAAG	0.632																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(925-927)TGC>TGT		inscuteable isoform a							41.0	43.0	43.0					11																	15222462		2093	4228	6321	SO:0001819	synonymous_variant	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15222462C>T	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.927C>T	11.37:g.15222462C>T						INSC_uc001mlz.2_Silent_p.C262C|INSC_uc001mma.2_Silent_p.C262C|INSC_uc010rcs.1_Silent_p.C297C|INSC_uc001mmb.2_Silent_p.C262C|INSC_uc001mmc.2_Intron	p.C309C	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN			7	973	+			309					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Silent	SNP	ENST00000379554.3	37	c.927C>T	CCDS41621.1																																																																																				0.632	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		4	2	0	0	0	0.000248	0	4	2				
INSC	387755	broad.mit.edu	37	11	15260597	15260597	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:15260597C>G	ENST00000379554.3	+	11	1557	c.1511C>G	c.(1510-1512)gCa>gGa	p.A504G	INSC_ENST00000424273.1_Missense_Mutation_p.A415G|INSC_ENST00000447214.2_3'UTR|INSC_ENST00000528567.1_Missense_Mutation_p.A457G|INSC_ENST00000525218.1_Missense_Mutation_p.A415G|INSC_ENST00000379556.3_Missense_Mutation_p.A457G|INSC_ENST00000530161.1_Missense_Mutation_p.A457G	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	504					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						CCAGATGTGGCACGGGAGGCC	0.617																																							uc001mly.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(1510-1512)GCA>GGA		inscuteable isoform a							45.0	47.0	46.0					11																	15260597		2088	4211	6299	SO:0001583	missense	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15260597C>G	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1511C>G	11.37:g.15260597C>G	ENSP00000368872:p.Ala504Gly					INSC_uc001mlz.2_Missense_Mutation_p.A457G|INSC_uc001mma.2_Missense_Mutation_p.A457G|INSC_uc010rcs.1_Missense_Mutation_p.A492G|INSC_uc001mmb.2_Missense_Mutation_p.A457G|INSC_uc001mmc.2_Missense_Mutation_p.A415G	p.A504G	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN			11	1557	+			504					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	c.1511C>G	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	C	32	5.149660	0.94645	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67	5.66	5.66	0.87406	Armadillo-like helical (1);Armadillo-type fold (1);	0.057261	0.64402	D	0.000002	T	0.68238	0.2979	M	0.61703	1.905	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.998;0.999;0.999	D;D;D;D	0.78314	0.991;0.971;0.98;0.98	T	0.68300	-0.5445	10	0.59425	D	0.04	-14.0066	19.7365	0.96208	0.0:1.0:0.0:0.0	.	492;415;457;504	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	G	504;457;415;457;457;415	ENSP00000368872:A504G;ENSP00000368874:A457G;ENSP00000389161:A415G;ENSP00000435022:A457G;ENSP00000436194:A457G;ENSP00000436113:A415G	ENSP00000368872:A504G	A	+	2	0	INSC	15217173	1.000000	0.71417	0.986000	0.45419	0.987000	0.75469	5.395000	0.66291	2.672000	0.90937	0.655000	0.94253	GCA		0.617	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		13	20	0	0	0	0.001368	0	13	20				
SLC17A6	57084	broad.mit.edu	37	11	22399051	22399051	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:22399051G>T	ENST00000263160.3	+	12	1951	c.1514G>T	c.(1513-1515)tGg>tTg	p.W505L		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	505					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						AAACAACCCTGGGCAGACCCG	0.403																																							uc001mqk.2		NA																	0				ovary(3)|breast(1)	4						c.(1513-1515)TGG>TTG		solute carrier family 17 (sodium-dependent							63.0	69.0	67.0					11																	22399051		2202	4300	6502	SO:0001583	missense	57084				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr11:22399051G>T	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1514G>T	11.37:g.22399051G>T	ENSP00000263160:p.Trp505Leu						p.W505L	NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN			12	1927	+			505			Cytoplasmic (Potential).		A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	c.1514G>T	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030510	0.75504	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.57436	0.4	5.85	5.85	0.93711	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.79633	0.4479	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82770	-0.0293	10	0.87932	D	0	.	20.1588	0.98128	0.0:0.0:1.0:0.0	.	505	Q9P2U8	VGLU2_HUMAN	L	505;393	ENSP00000263160:W505L	ENSP00000263160:W505L	W	+	2	0	SLC17A6	22355627	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.770000	0.95276	0.563000	0.77884	TGG		0.403	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		9	17	1	0	7.48243e-07	0.006214	1.15136e-06	9	17				
EXT2	2132	broad.mit.edu	37	11	44254029	44254029	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:44254029G>A	ENST00000343631.3	+	11	1918	c.1789G>A	c.(1789-1791)Gca>Aca	p.A597T	EXT2_ENST00000395673.3_Missense_Mutation_p.A630T|EXT2_ENST00000533608.1_Missense_Mutation_p.A597T|EXT2_ENST00000358681.4_Missense_Mutation_p.A607T			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	597					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						GCTCACTGGGGCAGCTTTTTA	0.463			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																														uc001mxz.2		NA	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	Mis|N|F|S	multiple exostoses type 2 gene			M		exostoses|osteosarcoma			0				lung(2)|breast(2)|skin(1)	5						c.(1789-1791)GCA>ACA		exostosin 2 isoform 2							75.0	69.0	71.0					11																	44254029		2203	4299	6502	SO:0001583	missense	2132	Hereditary_Multiple_Exostoses	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity	g.chr11:44254029G>A		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.1789G>A	11.37:g.44254029G>A	ENSP00000342656:p.Ala597Thr					EXT2_uc010rfo.1_Missense_Mutation_p.A625T|EXT2_uc001mxy.2_Missense_Mutation_p.A610T|EXT2_uc009ykt.2_Missense_Mutation_p.A607T|EXT2_uc001mya.2_Missense_Mutation_p.A630T	p.A597T	NM_207122	NP_997005	Q93063	EXT2_HUMAN			11	2123	+			597			Lumenal (Potential).		B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	ENST00000343631.3	37	c.1789G>A	CCDS7908.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.816513	0.90790	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	5.15	5.15	0.70609	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.054287	0.64402	D	0.000001	D	0.96112	0.8733	M	0.93898	3.47	0.80722	D	1	D;D;D;D;P	0.89917	1.0;0.974;0.968;1.0;0.95	D;D;P;D;P	0.91635	0.999;0.943;0.906;0.999;0.908	D	0.97168	0.9842	10	0.87932	D	0	-1.6713	18.6208	0.91321	0.0:0.0:1.0:0.0	.	597;607;607;597;610	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	T	597;607;630;597	ENSP00000431173:A597T;ENSP00000351509:A607T;ENSP00000379032:A630T;ENSP00000342656:A597T	ENSP00000342656:A597T	A	+	1	0	EXT2	44210605	1.000000	0.71417	0.904000	0.35570	0.640000	0.38277	9.751000	0.98889	2.396000	0.81511	0.585000	0.79938	GCA		0.463	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390074.1	NM_000401		12	18	0	0	0	0.001368	0	12	18				
MS4A13	503497	broad.mit.edu	37	11	60296836	60296836	+	Splice_Site	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:60296836A>G	ENST00000378186.2	+	6	629		c.e6-1		MS4A13_ENST00000378185.2_Splice_Site|MS4A13_ENST00000437058.2_Splice_Site|MS4A13_ENST00000527948.1_Intron	NM_001012417.2	NP_001012417.2	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 13							integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(2)|skin(2)	8						TTTTGGTTATAGAAACTTGGG	0.343																																							uc001nps.2		NA																	0					0						c.e6-2		membrane-spanning 4-domains, subfamily A, member							128.0	129.0	129.0					11																	60296836		2203	4300	6503	SO:0001630	splice_region_variant	503497					integral to membrane		g.chr11:60296836A>G	AY324188	CCDS31571.1, CCDS41653.1, CCDS60801.1	11q12.2	2005-12-05	2005-12-05		ENSG00000204979	ENSG00000204979			16674	protein-coding gene	gene with protein product							Standard	NM_001012417		Approved		uc001nps.3	Q5J8X5	OTTHUMG00000167615	ENST00000378186.2:c.307-1A>G	11.37:g.60296836A>G						MS4A13_uc009ync.2_Splice_Site_p.K63_splice|MS4A13_uc009ynd.2_Splice_Site_p.K44_splice	p.K103_splice	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN			6	630	+								E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Splice_Site	SNP	ENST00000378186.2	37	c.307_splice	CCDS31571.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.027025	0.54683	.	.	ENSG00000204979	ENST00000378186;ENST00000378185;ENST00000437058	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1465	0.42767	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MS4A13	60053412	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	3.473000	0.53122	2.162000	0.67917	0.397000	0.26171	.		0.343	MS4A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395408.1	NM_001012417	Intron	11	23	0	0	0	0.000978	0	11	23				
DAGLA	747	broad.mit.edu	37	11	61495745	61495745	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:61495745G>A	ENST00000257215.5	+	7	873	c.757G>A	c.(757-759)Gcc>Acc	p.A253T		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	253					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CAAGCGCAACGCCGTGCTGGA	0.647																																							uc001nsa.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(757-759)GCC>ACC		neural stem cell-derived dendrite regulator							105.0	92.0	97.0					11																	61495745		2202	4299	6501	SO:0001583	missense	747				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity	g.chr11:61495745G>A	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.757G>A	11.37:g.61495745G>A	ENSP00000257215:p.Ala253Thr						p.A253T	NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN		READ - Rectum adenocarcinoma(4;0.219)	7	868	+			253			Cytoplasmic (Potential).		A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	c.757G>A	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.898758	0.52227	.	.	ENSG00000134780	ENST00000257215	T	0.24350	1.86	4.74	4.74	0.60224	.	0.118554	0.56097	D	0.000030	T	0.17408	0.0418	N	0.17082	0.46	0.80722	D	1	P	0.52842	0.956	B	0.39299	0.296	T	0.04078	-1.0979	10	0.35671	T	0.21	-29.1885	18.1135	0.89543	0.0:0.0:1.0:0.0	.	253	Q9Y4D2	DGLA_HUMAN	T	253	ENSP00000257215:A253T	ENSP00000257215:A253T	A	+	1	0	DAGLA	61252321	1.000000	0.71417	0.911000	0.35937	0.915000	0.54546	3.548000	0.53670	2.341000	0.79615	0.555000	0.69702	GCC		0.647	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133		24	51	0	0	0	0.005443	0	24	51				
TENM4	26011	broad.mit.edu	37	11	78440614	78440614	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:78440614G>A	ENST00000278550.7	-	22	3675	c.3213C>T	c.(3211-3213)taC>taT	p.Y1071Y		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1071					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GGACAGATTTGTAGCCAGGGG	0.567																																							uc001ozl.3		NA																	0				ovary(2)|pancreas(2)	4						c.(3211-3213)TAC>TAT		odz, odd Oz/ten-m homolog 4							70.0	77.0	75.0					11																	78440614		2004	4170	6174	SO:0001819	synonymous_variant	26011				signal transduction	integral to membrane		g.chr11:78440614G>A	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3213C>T	11.37:g.78440614G>A							p.Y1071Y	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN			22	3676	-			1071			Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	c.3213C>T	CCDS44688.1																																																																																				0.567	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			22	25	0	0	0	0.001882	0	22	25				
RAB30	27314	broad.mit.edu	37	11	82693351	82693351	+	Silent	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:82693351A>G	ENST00000533486.1	-	6	752	c.468T>C	c.(466-468)tcT>tcC	p.S156S	RP11-659G9.3_ENST00000527550.1_RNA|RAB30_ENST00000527633.1_Silent_p.S156S|RAB30_ENST00000260056.2_Silent_p.S156S|RAB30_ENST00000534141.1_Missense_Mutation_p.L155P	NM_014488.3	NP_055303.2	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	156					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cis-Golgi network (GO:0005801)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						CCACATTATCAGATTCCTTGG	0.473																																							uc001ozu.2		NA																	0					0						c.(466-468)TCT>TCC		RAB30, member RAS oncogene family							147.0	129.0	135.0					11																	82693351		2203	4300	6503	SO:0001819	synonymous_variant	27314				protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity	g.chr11:82693351A>G	U57092	CCDS8264.1	11q12-q14	2008-07-21				ENSG00000137502		"""RAB, member RAS oncogene"""	9770	protein-coding gene	gene with protein product		605693				8863739, 9792283	Standard	NM_014488		Approved		uc001ozu.3	Q15771		ENST00000533486.1:c.468T>C	11.37:g.82693351A>G						RAB30_uc009yve.2_Silent_p.S154S|RAB30_uc010rst.1_Silent_p.S154S|RAB30_uc001ozv.2_Missense_Mutation_p.L153P	p.S156S	NM_014488	NP_055303	Q15771	RAB30_HUMAN			6	729	-			156					Q6FGK1|Q6MZH2|Q96CI8	Silent	SNP	ENST00000533486.1	37	c.468T>C	CCDS8264.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.167772	0.38315	.	.	ENSG00000137502	ENST00000534141	T	0.66280	-0.2	5.96	-8.56	0.00904	.	.	.	.	.	T	0.31263	0.0791	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13308	-1.0514	7	.	.	.	.	0.9081	0.01288	0.3654:0.2717:0.1368:0.2261	.	155	Q6MZH2	.	P	155	ENSP00000434974:L155P	.	L	-	2	0	RAB30	82370999	0.000000	0.05858	0.872000	0.34217	0.999000	0.98932	-1.850000	0.01670	-1.394000	0.02077	0.533000	0.62120	CTG		0.473	RAB30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392141.1	NM_014488		3	57	0	0	0	0.000248	0	3	57				
MMP13	4322	broad.mit.edu	37	11	102815025	102815025	+	Silent	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:102815025G>T	ENST00000260302.3	-	10	1414	c.1386C>A	c.(1384-1386)gtC>gtA	p.V462V		NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	462	Interaction with collagen.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	TTGCTGGCATGACGCGAACAA	0.358																																							uc001phl.2		NA																	0		p.V462I(1)		ovary(2)|skin(1)	3						c.(1384-1386)GTC>GTA		matrix metalloproteinase 13 preproprotein							136.0	149.0	145.0					11																	102815025		2202	4299	6501	SO:0001819	synonymous_variant	4322				collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding	g.chr11:102815025G>T	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.1386C>A	11.37:g.102815025G>T							p.V462V	NM_002427	NP_002418	P45452	MMP13_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0144)	10	1414	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	462			Hemopexin-like 4.		A8K846|B2RCZ3|Q6NWN6	Silent	SNP	ENST00000260302.3	37	c.1386C>A	CCDS8324.1																																																																																				0.358	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427		56	85	1	0	4.73848e-44	0.00361	1.08568e-43	56	85				
DDI1	414301	broad.mit.edu	37	11	103907842	103907842	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:103907842G>A	ENST00000302259.3	+	1	535	c.292G>A	c.(292-294)Ggc>Agc	p.G98S	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	98							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		AGACTTCAGTGGCATTGCGGT	0.642																																							uc001phr.2		NA																	0				large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(292-294)GGC>AGC		DDI1, DNA-damage inducible 1, homolog 1							134.0	132.0	133.0					11																	103907842		2202	4299	6501	SO:0001583	missense	414301				proteolysis		aspartic-type endopeptidase activity	g.chr11:103907842G>A		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.292G>A	11.37:g.103907842G>A	ENSP00000302805:p.Gly98Ser					PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	p.G98S	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)	1	535	+		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)	98					Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	c.292G>A	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	G	1.541	-0.541837	0.04053	.	.	ENSG00000170967	ENST00000302259	T	0.20598	2.06	5.02	1.15	0.20763	.	0.404164	0.27340	N	0.019809	T	0.10337	0.0253	L	0.27975	0.815	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.37009	-0.9724	10	0.07030	T	0.85	-14.4441	6.752	0.23491	0.4512:0.0:0.5488:0.0	.	98	Q8WTU0	DDI1_HUMAN	S	98	ENSP00000302805:G98S	ENSP00000302805:G98S	G	+	1	0	DDI1	103413052	0.995000	0.38212	0.002000	0.10522	0.000000	0.00434	2.683000	0.46943	0.420000	0.25954	-0.119000	0.15052	GGC		0.642	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711		43	54	0	0	0	0.002222	0	43	54				
CEP164	22897	broad.mit.edu	37	11	117253620	117253620	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:117253620G>T	ENST00000278935.3	+	14	1833	c.1686G>T	c.(1684-1686)aaG>aaT	p.K562N	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	562	Glu-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CTGAGGAGAAGGTGGCGGTCA	0.642																																							uc001prc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1684-1686)AAG>AAT		centrosomal protein 164kDa							58.0	46.0	50.0					11																	117253620		2201	4296	6497	SO:0001583	missense	22897				cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus		g.chr11:117253620G>T	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.1686G>T	11.37:g.117253620G>T	ENSP00000278935:p.Lys562Asn					CEP164_uc001prb.2_Missense_Mutation_p.K565N|CEP164_uc010rxk.1_Missense_Mutation_p.K536N|CEP164_uc001prf.2_RNA|CEP164_uc009yzp.1_RNA|CEP164_uc001prg.1_5'Flank	p.K562N	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)	14	1833	+	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	562			Glu-rich.		Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	c.1686G>T	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	G	9.876	1.200163	0.22121	.	.	ENSG00000110274	ENST00000278935;ENST00000529538	T	0.59638	0.25	4.13	2.23	0.28157	.	0.436569	0.19595	N	0.110535	T	0.50292	0.1607	L	0.60455	1.87	0.20821	N	0.999841	P;P;P	0.48016	0.845;0.904;0.904	B;P;P	0.44394	0.261;0.448;0.448	T	0.35375	-0.9791	10	0.23891	T	0.37	-18.08	6.7431	0.23447	0.2122:0.0:0.7878:0.0	.	536;562;565	E9PI34;Q9UPV0;Q9UPV0-2	.;CE164_HUMAN;.	N	562;536	ENSP00000278935:K562N	ENSP00000278935:K562N	K	+	3	2	CEP164	116758830	0.022000	0.18835	0.898000	0.35279	0.376000	0.30014	0.931000	0.28871	0.665000	0.31066	0.655000	0.94253	AAG		0.642	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956		13	14	1	0	5.50884e-06	0.001368	8.26326e-06	13	14				
DSCAML1	57453	broad.mit.edu	37	11	117387188	117387188	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:117387188C>A	ENST00000321322.6	-	8	1958	c.1957G>T	c.(1957-1959)Gtc>Ttc	p.V653F	DSCAML1_ENST00000527706.1_Missense_Mutation_p.V383F	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	593	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTACCTTTGACGGCTACGTGA	0.617																																							uc001prh.1		NA																	0				ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1957-1959)GTC>TTC		Down syndrome cell adhesion molecule like 1							87.0	70.0	76.0					11																	117387188		2201	4296	6497	SO:0001583	missense	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117387188C>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1957G>T	11.37:g.117387188C>A	ENSP00000315465:p.Val653Phe						p.V653F	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	8	1959	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	593			Extracellular (Potential).		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	c.1957G>T	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077282	0.76415	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	D;D	0.85955	-2.05;-2.05	3.95	3.95	0.45737	Immunoglobulin-like fold (1);	.	.	.	.	D	0.93132	0.7813	M	0.93638	3.44	0.80722	D	1	D	0.56035	0.974	P	0.58331	0.837	D	0.95254	0.8362	9	0.87932	D	0	.	16.528	0.84336	0.0:1.0:0.0:0.0	.	593	Q8TD84	DSCL1_HUMAN	F	383;653;360	ENSP00000434335:V383F;ENSP00000315465:V653F	ENSP00000315465:V653F	V	-	1	0	DSCAML1	116892398	1.000000	0.71417	0.977000	0.42913	0.544000	0.35116	7.575000	0.82447	2.202000	0.70862	0.462000	0.41574	GTC		0.617	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		9	19	1	0	6.40141e-05	0.000978	9.33353e-05	9	19				
FOXR1	283150	broad.mit.edu	37	11	118851416	118851416	+	Silent	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:118851416C>A	ENST00000317011.3	+	5	1053	c.828C>A	c.(826-828)atC>atA	p.I276I		NM_181721.2	NP_859072.1	Q6PIV2	FOXR1_HUMAN	forkhead box R1	276					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		TAGAAAGTATCCAACAGTGCA	0.612																																							uc001pui.2		NA																	0				skin(1)	1						c.(826-828)ATC>ATA		forkhead box R1							27.0	30.0	29.0					11																	118851416		2199	4294	6493	SO:0001819	synonymous_variant	283150				embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr11:118851416C>A	AB094092	CCDS31688.1	11q23.3	2008-02-05			ENSG00000176302	ENSG00000176302		"""Forkhead boxes"""	29980	protein-coding gene	gene with protein product		615755				15067358	Standard	XM_005271514		Approved	DLNB13, FOXN5	uc001pui.3	Q6PIV2	OTTHUMG00000166347	ENST00000317011.3:c.828C>A	11.37:g.118851416C>A						FOXR1_uc001puj.2_RNA|FOXR1_uc001puk.2_Silent_p.I107I	p.I276I	NM_181721	NP_859072	Q6PIV2	FOXR1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)	5	1053	+	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)	276					B0YJ15|Q08AS8|Q86UT9|Q8IXX2	Silent	SNP	ENST00000317011.3	37	c.828C>A	CCDS31688.1																																																																																				0.612	FOXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389312.1	NM_181721		14	14	1	0	1.5842e-08	0.001855	2.56051e-08	14	14				
SPA17	53340	broad.mit.edu	37	11	124564341	124564341	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:124564341G>A	ENST00000532692.1	+	4	1876	c.455G>A	c.(454-456)tGa>tAa	p.*152*	SPA17_ENST00000524614.1_Intron|SPA17_ENST00000227135.2_Silent_p.*152*|SIAE_ENST00000525730.1_5'UTR			Q15506	SP17_HUMAN	sperm autoantigenic protein 17	0					binding of sperm to zona pellucida (GO:0007339)|epithelial cilium movement (GO:0003351)|single fertilization (GO:0007338)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|primary cilium (GO:0072372)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	5	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0223)		GAAAACAAGTGAGGACACTGG	0.388																																							uc001qap.2		NA																	0					0						c.(454-456)TGA>TAA		sperm autoantigenic protein 17							86.0	86.0	86.0					11																	124564341		2201	4299	6500	SO:0001819	synonymous_variant	53340				binding of sperm to zona pellucida|ciliary or flagellar motility|signal transduction|spermatogenesis	cytoplasm|flagellum|membrane|motile cilium|primary cilium	cAMP-dependent protein kinase regulator activity	g.chr11:124564341G>A	AF334735	CCDS8450.1	11q24.2	2009-03-12			ENSG00000064199	ENSG00000064199			11210	protein-coding gene	gene with protein product	"""cancer/testis antigen 22"""	608621				8688458	Standard	NM_017425		Approved	SP17, CT22	uc001qap.3	Q15506	OTTHUMG00000165927	ENST00000532692.1:c.455G>A	11.37:g.124564341G>A							p.*152*	NM_017425	NP_059121	Q15506	SP17_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0223)	5	591	+	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	152					B2R4F2|Q9BXF7	Silent	SNP	ENST00000532692.1	37	c.455G>A	CCDS8450.1																																																																																				0.388	SPA17-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387075.1	NM_017425		13	60	0	0	0	0.001368	0	13	60				
OVCH1	341350	broad.mit.edu	37	12	29648354	29648354	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr12:29648354C>A	ENST00000318184.5	-	4	317	c.318G>T	c.(316-318)gaG>gaT	p.E106D		NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	106	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					AGAGGCTGTACTCCCCAGAAG	0.378																																							uc001rix.1		NA																	0				ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(316-318)GAG>GAT		ovochymase 1 precursor							94.0	86.0	88.0					12																	29648354		1824	4084	5908	SO:0001583	missense	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29648354C>A	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.318G>T	12.37:g.29648354C>A	ENSP00000326708:p.Glu106Asp						p.E106D	NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN			4	318	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		106			Peptidase S1 1.			Missense_Mutation	SNP	ENST00000318184.5	37	c.318G>T		.	.	.	.	.	.	.	.	.	.	c	3.604	-0.081039	0.07141	.	.	ENSG00000187950	ENST00000318184	D	0.89196	-2.48	2.89	1.01	0.19927	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.77274	0.4106	N	0.20610	0.595	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.59830	-0.7380	9	0.17369	T	0.5	.	6.7951	0.23721	0.2021:0.6022:0.1957:0.0	.	106	Q7RTY7	OVCH1_HUMAN	D	106	ENSP00000326708:E106D	ENSP00000326708:E106D	E	-	3	2	OVCH1	29539621	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-0.159000	0.10056	0.269000	0.21961	-0.121000	0.15023	GAG		0.378	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		19	32	1	0	2.94398e-08	0.007413	4.7036e-08	19	32				
ALX1	8092	broad.mit.edu	37	12	85677598	85677598	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr12:85677598G>T	ENST00000316824.3	+	2	630	c.475G>T	c.(475-477)Gtg>Ttg	p.V159L		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	159					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		TTACCCGGATGTGTATGTCAG	0.493																																							uc001tae.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(475-477)GTG>TTG		cartilage paired-class homeoprotein 1							110.0	112.0	112.0					12																	85677598		2203	4300	6503	SO:0001583	missense	8092				brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:85677598G>T	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.475G>T	12.37:g.85677598G>T	ENSP00000315417:p.Val159Leu						p.V159L	NM_006982	NP_008913	Q15699	ALX1_HUMAN		GBM - Glioblastoma multiforme(134;0.134)	2	479	+			159			Homeobox.		Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	37	c.475G>T	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	G	34	5.380549	0.95945	.	.	ENSG00000180318	ENST00000316824	D	0.95342	-3.68	5.63	5.63	0.86233	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95472	0.8529	L	0.61387	1.9	0.80722	D	1	P	0.42961	0.795	P	0.48952	0.596	D	0.95190	0.8307	10	0.59425	D	0.04	.	20.0401	0.97581	0.0:0.0:1.0:0.0	.	159	Q15699	ALX1_HUMAN	L	159	ENSP00000315417:V159L	ENSP00000315417:V159L	V	+	1	0	ALX1	84201729	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	9.813000	0.99286	2.805000	0.96524	0.655000	0.94253	GTG		0.493	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982		32	48	1	0	1.30293e-26	0.003271	2.81515e-26	32	48				
POLR3B	55703	broad.mit.edu	37	12	106772119	106772119	+	Missense_Mutation	SNP	G	G	A	rs545766074		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr12:106772119G>A	ENST00000228347.4	+	8	793	c.571G>A	c.(571-573)Gtg>Atg	p.V191M	POLR3B_ENST00000539066.1_Missense_Mutation_p.V133M	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	191					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						CAGGATCATCGTGGAGGCTGA	0.408																																							uc001tlp.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(571-573)GTG>ATG		DNA-directed RNA polymerase III B isoform 1							159.0	149.0	153.0					12																	106772119		2203	4300	6503	SO:0001583	missense	55703				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding	g.chr12:106772119G>A	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.571G>A	12.37:g.106772119G>A	ENSP00000228347:p.Val191Met					POLR3B_uc001tlq.2_Missense_Mutation_p.V133M	p.V191M	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN			8	793	+			191					A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	c.571G>A	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960296	0.92791	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	T;T	0.68765	-0.35;-0.35	5.73	5.73	0.89815	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.85159	0.5633	M	0.89163	3.01	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	D	0.87308	0.2310	10	0.87932	D	0	-13.5466	19.49	0.95047	0.0:0.0:1.0:0.0	.	191	Q9NW08	RPC2_HUMAN	M	191;191;133	ENSP00000228347:V191M;ENSP00000445721:V133M	ENSP00000228347:V191M	V	+	1	0	POLR3B	105296249	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	9.703000	0.98714	2.704000	0.92352	0.650000	0.86243	GTG		0.408	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082		7	93	0	0	0	0.001984	0	7	93				
TMEM132B	114795	broad.mit.edu	37	12	126138920	126138920	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr12:126138920G>C	ENST00000299308.3	+	9	2909	c.2901G>C	c.(2899-2901)gaG>gaC	p.E967D	TMEM132B_ENST00000535886.1_Missense_Mutation_p.E479D	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	967						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CATCAGAGGAGTGCACAACCA	0.512																																							uc001uhe.1		NA																	0				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(2899-2901)GAG>GAC		transmembrane protein 132B							68.0	66.0	67.0					12																	126138920		1916	4128	6044	SO:0001583	missense	114795					integral to membrane		g.chr12:126138920G>C	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2901G>C	12.37:g.126138920G>C	ENSP00000299308:p.Glu967Asp					TMEM132B_uc001uhf.1_Missense_Mutation_p.E479D	p.E967D	NM_052907	NP_443139	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	9	2909	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		967			Cytoplasmic (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	c.2901G>C	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116198	0.37339	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.11495	3.55;2.77	5.3	4.4	0.53042	.	0.000000	0.64402	D	0.000009	T	0.15955	0.0384	M	0.67569	2.06	0.50171	D	0.999855	P	0.49559	0.925	P	0.47162	0.54	T	0.00350	-1.1797	10	0.48119	T	0.1	.	8.1154	0.30940	0.2261:0.0:0.7739:0.0	.	967	Q14DG7	T132B_HUMAN	D	967;479	ENSP00000299308:E967D;ENSP00000440436:E479D	ENSP00000299308:E967D	E	+	3	2	TMEM132B	124704873	0.998000	0.40836	1.000000	0.80357	0.935000	0.57460	0.600000	0.24104	2.485000	0.83878	0.655000	0.94253	GAG		0.512	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		16	19	0	0	0	0.004007	0	16	19				
ELF1	1997	broad.mit.edu	37	13	41525519	41525519	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr13:41525519C>T	ENST00000239882.3	-	4	621	c.307G>A	c.(307-309)Gag>Aag	p.E103K	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.E103K	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	103					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		AGGAGTGCCTCAGCAGCCTCA	0.368																																							uc001uxs.2		NA																	0				ovary(1)	1						c.(307-309)GAG>AAG		E74-like factor 1 (ets domain transcription							107.0	98.0	101.0					13																	41525519		2203	4300	6503	SO:0001583	missense	1997				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr13:41525519C>T	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.307G>A	13.37:g.41525519C>T	ENSP00000239882:p.Glu103Lys					ELF1_uc010tfc.1_Missense_Mutation_p.E103K|ELF1_uc010acd.2_5'UTR	p.E103K	NM_172373	NP_758961	P32519	ELF1_HUMAN		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)	4	680	-		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)	103					B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	c.307G>A	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	C	36	5.696241	0.96802	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.57595	0.39;0.39	5.66	5.66	0.87406	.	0.058576	0.64402	D	0.000003	T	0.74535	0.3729	M	0.74647	2.275	0.58432	D	0.999992	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.76468	-0.2948	10	0.87932	D	0	.	19.7468	0.96255	0.0:1.0:0.0:0.0	.	103;103	E9PDQ9;P32519	.;ELF1_HUMAN	K	103	ENSP00000405580:E103K;ENSP00000239882:E103K	ENSP00000239882:E103K	E	-	1	0	ELF1	40423519	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.100000	0.76989	2.678000	0.91216	0.563000	0.77884	GAG		0.368	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373		8	66	0	0	0	0.008291	0	8	66				
MLNR	2862	broad.mit.edu	37	13	49795193	49795193	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr13:49795193G>A	ENST00000218721.1	+	1	720	c.720G>A	c.(718-720)gcG>gcA	p.A240A	MLNR_ENST00000398307.1_Silent_p.A240A	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	240					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		CGAGCCCCGCGCAGCTGGGCG	0.731																																							uc010tgj.1		NA																	0					0						c.(718-720)GCG>GCA		motilin receptor							30.0	33.0	32.0					13																	49795193		2134	4196	6330	SO:0001819	synonymous_variant	2862				digestion	integral to plasma membrane	growth hormone-releasing hormone receptor activity	g.chr13:49795193G>A	AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.720G>A	13.37:g.49795193G>A							p.A240A	NM_001507	NP_001498	O43193	MTLR_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)	1	720	+		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	240			Extracellular (Potential).			Silent	SNP	ENST00000218721.1	37	c.720G>A	CCDS9414.1																																																																																				0.731	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507		14	28	0	0	0	0.003163	0	14	28				
DIS3	22894	broad.mit.edu	37	13	73345120	73345120	+	Silent	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr13:73345120T>C	ENST00000377767.4	-	13	1777	c.1677A>G	c.(1675-1677)gcA>gcG	p.A559A	DIS3_ENST00000377780.4_Silent_p.A529A|DIS3_ENST00000545453.1_Silent_p.A397A	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	559					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TACATGAAAATGCCAGCCTGT	0.318										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(1675-1677)GCA>GCG		DIS3 mitotic control isoform a							68.0	65.0	66.0					13																	73345120		2203	4300	6503	SO:0001819	synonymous_variant	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73345120T>C	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1677A>G	13.37:g.73345120T>C		Multiple Myeloma(4;0.011)				DIS3_uc001viy.3_Silent_p.A529A|DIS3_uc001viz.2_RNA	p.A559A	NM_014953	NP_055768	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	13	2051	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	559					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Silent	SNP	ENST00000377767.4	37	c.1677A>G	CCDS9447.1																																																																																				0.318	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		4	6	0	0	0	0.000248	0	4	6				
TPP2	7174	broad.mit.edu	37	13	103292686	103292686	+	Silent	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr13:103292686A>T	ENST00000376065.4	+	16	2016	c.1980A>T	c.(1978-1980)cgA>cgT	p.R660R	TPP2_ENST00000376052.3_Silent_p.R660R	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	660					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTCAAATTCGAAGGCATTTTA	0.333																																							uc001vpi.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1978-1980)CGA>CGT		tripeptidyl peptidase II							89.0	86.0	87.0					13																	103292686		2203	4300	6503	SO:0001819	synonymous_variant	7174				proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity	g.chr13:103292686A>T	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.1980A>T	13.37:g.103292686A>T							p.R660R	NM_003291	NP_003282	P29144	TPP2_HUMAN			16	2083	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		660					Q5VZU8	Silent	SNP	ENST00000376065.4	37	c.1980A>T	CCDS9502.1																																																																																				0.333	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2			6	12	0	0	0	0.004482	0	6	12				
SOX1	6656	broad.mit.edu	37	13	112722025	112722025	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr13:112722025C>A	ENST00000330949.1	+	1	113	c.53C>A	c.(52-54)gCc>gAc	p.A18D		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	18					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		GGCGCCCAGGCCCCCACGAAC	0.796																																							uc001vsb.1		NA																	0					0						c.(52-54)GCC>GAC		SRY (sex determining region Y)-box 1							6.0	8.0	7.0					13																	112722025		1838	3920	5758	SO:0001583	missense	6656				chromatin organization	nucleus	core promoter sequence-specific DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr13:112722025C>A		CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.53C>A	13.37:g.112722025C>A	ENSP00000330218:p.Ala18Asp						p.A18D	NM_005986	NP_005977	O00570	SOX1_HUMAN		OV - Ovarian serous cystadenocarcinoma(48;0.132)	1	113	+	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)	18					Q5W0Q1	Missense_Mutation	SNP	ENST00000330949.1	37	c.53C>A	CCDS9523.1	.	.	.	.	.	.	.	.	.	.	c	14.25	2.478199	0.44044	.	.	ENSG00000182968	ENST00000330949	D	0.97161	-4.27	3.66	2.81	0.32909	.	0.510004	0.13344	U	0.394958	D	0.90000	0.6878	N	0.08118	0	0.27135	N	0.961807	B	0.24186	0.099	B	0.14578	0.011	T	0.81745	-0.0792	10	0.19590	T	0.45	.	8.6002	0.33740	0.0:0.8047:0.0:0.1953	.	18	O00570	SOX1_HUMAN	D	18	ENSP00000330218:A18D	ENSP00000330218:A18D	A	+	2	0	SOX1	111770026	1.000000	0.71417	0.039000	0.18376	0.913000	0.54294	2.454000	0.44979	0.761000	0.33130	0.450000	0.29827	GCC		0.796	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045817.3	NM_005986		5	4	1	0	1.23904e-05	0.000602	1.84528e-05	5	4				
METTL17	64745	broad.mit.edu	37	14	21461276	21461276	+	Splice_Site	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr14:21461276G>A	ENST00000339374.6	+	6	761		c.e6-1		RP11-84C10.4_ENST00000557335.1_RNA|METTL17_ENST00000382985.4_Splice_Site|METTL17_ENST00000556670.2_Splice_Site	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17						translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						TATTTCTTCAGATCCGGGCTC	0.423																																							uc001vyn.2		NA																	0					0						c.e6-1		methyltransferase 11 domain containing 1 isoform							157.0	146.0	150.0					14																	21461276		2203	4300	6503	SO:0001630	splice_region_variant	64745				translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity	g.chr14:21461276G>A	AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.529-1G>A	14.37:g.21461276G>A						METT11D1_uc001vym.2_Splice_Site_p.I177_splice|METT11D1_uc001vyo.2_Splice_Site_p.I177_splice|METT11D1_uc001vyp.2_Splice_Site_p.I19_splice|METT11D1_uc001vyq.2_Splice_Site_p.I19_splice	p.I177_splice	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)	6	726	+	all_cancers(95;0.00267)							Q9BSH1|Q9BZH2|Q9BZH3	Splice_Site	SNP	ENST00000339374.6	37	c.529_splice	CCDS9562.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052871	0.36181	.	.	ENSG00000165792	ENST00000339374;ENST00000382985;ENST00000553564;ENST00000554751;ENST00000555670	.	.	.	5.29	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0714	0.59064	0.0:0.0:0.8379:0.1621	.	.	.	.	.	-1	.	.	.	+	.	.	METTL17	20531116	1.000000	0.71417	0.989000	0.46669	0.480000	0.33159	5.417000	0.66423	1.213000	0.43380	0.591000	0.81541	.		0.423	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734	Intron	49	66	0	0	0	0.00361	0	49	66				
MYH7	4625	broad.mit.edu	37	14	23886369	23886369	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr14:23886369G>T	ENST00000355349.3	-	32	4674	c.4512C>A	c.(4510-4512)aaC>aaA	p.N1504K	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1504					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CACCCTGCAGGTTTTTGTTCT	0.592																																							uc001wjx.2		NA																	0				ovary(3)|skin(1)	4						c.(4510-4512)AAC>AAA		myosin, heavy chain 7, cardiac muscle, beta							111.0	121.0	118.0					14																	23886369		2203	4300	6503	SO:0001583	missense	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23886369G>T	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4512C>A	14.37:g.23886369G>T	ENSP00000347507:p.Asn1504Lys						p.N1504K	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	32	4618	-	all_cancers(95;2.54e-05)		1504			Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	c.4512C>A	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750384	0.69533	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.81078	-1.45	5.27	3.46	0.39613	Myosin tail (1);	.	.	.	.	D	0.87740	0.6253	M	0.80616	2.505	0.45354	D	0.998349	D	0.54397	0.966	D	0.63192	0.912	D	0.88033	0.2776	9	0.87932	D	0	.	11.055	0.47913	0.2075:0.0:0.7925:0.0	.	1504	P12883	MYH7_HUMAN	K	1504;1509	ENSP00000347507:N1504K	ENSP00000347507:N1504K	N	-	3	2	MYH7	22956209	1.000000	0.71417	0.999000	0.59377	0.883000	0.51084	1.705000	0.37867	0.810000	0.34279	0.591000	0.81541	AAC		0.592	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		62	84	1	0	2.94687e-45	0.00361	6.78921e-45	62	84				
FAM179B	23116	broad.mit.edu	37	14	45501514	45501514	+	Silent	SNP	A	A	G	rs368459264		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr14:45501514A>G	ENST00000361577.3	+	11	3961	c.3747A>G	c.(3745-3747)ctA>ctG	p.L1249L	FAM179B_ENST00000382233.2_3'UTR|FAM179B_ENST00000361462.2_Silent_p.L1249L|KLHL28_ENST00000553817.1_Intron	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1249										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						TGTCAGAACTACGACCATTCT	0.398																																							uc001wvv.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)	3						c.(3745-3747)CTA>CTG		hypothetical protein LOC23116							74.0	69.0	71.0					14																	45501514		2203	4300	6503	SO:0001819	synonymous_variant	23116						binding	g.chr14:45501514A>G	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3747A>G	14.37:g.45501514A>G						FAM179B_uc001wvw.2_Silent_p.L1249L|FAM179B_uc010anc.2_RNA	p.L1249L	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN			11	3956	+			1249					Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	c.3747A>G	CCDS9681.1																																																																																				0.398	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		9	12	0	0	0	0.006214	0	9	12				
GPHB5	122876	broad.mit.edu	37	14	63784522	63784522	+	RNA	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr14:63784522G>A	ENST00000539258.1	-	0	98							Q86YW7	GPHB5_HUMAN	glycoprotein hormone beta 5						regulation of thyroid hormone mediated signaling pathway (GO:0002155)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)		CAGCCAGAAGGAGGAGGGCCA	0.577																																							uc010apu.2		NA																	0				breast(1)	1						c.(40-42)CTC>CTT		glycoprotein beta 5							43.0	46.0	45.0					14																	63784522		2030	4172	6202			122876					extracellular region	hormone activity	g.chr14:63784522G>A	AF467770	CCDS73643.1	14q23.3	2006-09-25				ENSG00000179600			18055	protein-coding gene	gene with protein product		609652					Standard	NM_145171		Approved	ZLUT1, GPB5	uc021rud.1	Q86YW7			14.37:g.63784522G>A						GPHB5_uc001xgc.2_Silent_p.L4L	p.L14L	NM_145171	NP_660154	Q86YW7	GPHB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)	1	42	-			14					Q6NTD0|Q8NFW2	Silent	SNP	ENST00000539258.1	37	c.42C>T																																																																																					0.577	GPHB5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000400582.1	NM_145171		17	24	0	0	0	0.00499	0	17	24				
EFCAB11	90141	broad.mit.edu	37	14	90420982	90420982	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr14:90420982G>C	ENST00000316738.7	-	1	51	c.23C>G	c.(22-24)gCc>gGc	p.A8G	TDP1_ENST00000335725.4_5'Flank|EFCAB11_ENST00000538485.2_Missense_Mutation_p.A8G|EFCAB11_ENST00000267544.9_5'UTR|TDP1_ENST00000393454.2_5'Flank|EFCAB11_ENST00000555872.1_5'Flank|TDP1_ENST00000393452.3_5'Flank|EFCAB11_ENST00000556609.1_Intron|TDP1_ENST00000357382.3_5'Flank|EFCAB11_ENST00000556005.1_5'Flank|RP11-33N16.3_ENST00000555070.1_RNA	NM_001284267.1|NM_145231.3	NP_001271196.1|NP_660274.1	Q9BUY7	EFC11_HUMAN	EF-hand calcium binding domain 11	8							calcium ion binding (GO:0005509)			large_intestine(1)|lung(1)	2						CCGCGACCTGGCTCTGGCCTC	0.642																																							uc001xxt.2		NA																	0					0						c.(22-24)GCC>GGC		hypothetical protein LOC90141							53.0	45.0	47.0					14																	90420982		2203	4300	6503	SO:0001583	missense	90141						calcium ion binding	g.chr14:90420982G>C	AK094740	CCDS9887.1, CCDS61522.1, CCDS61523.1, CCDS61524.1, CCDS61525.1	14q32.11	2013-01-10	2011-01-31	2011-01-31	ENSG00000140025	ENSG00000140025		"""EF-hand domain containing"""	20357	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 143"""	C14orf143			Standard	NM_145231		Approved		uc001xxt.3	Q9BUY7	OTTHUMG00000148671	ENST00000316738.7:c.23C>G	14.37:g.90420982G>C	ENSP00000326267:p.Ala8Gly					C14orf143_uc001xxs.2_5'Flank|C14orf143_uc001xxv.1_RNA|TDP1_uc010atm.2_5'Flank|TDP1_uc001xxy.2_5'Flank|TDP1_uc001xxz.2_5'Flank|TDP1_uc010atn.2_5'Flank|TDP1_uc001xya.2_5'Flank|TDP1_uc001xyb.2_5'Flank|C14orf143_uc001xxw.1_5'Flank|C14orf143_uc001xxx.1_Missense_Mutation_p.A8G	p.A8G	NM_145231	NP_660274	Q9BUY7	EFC11_HUMAN		Epithelial(152;0.194)	1	108	-		all_cancers(154;0.136)	8					B3KT10|B7Z5G9|G3V5G1|Q86T09|Q86TV7|Q8NDQ1	Missense_Mutation	SNP	ENST00000316738.7	37	c.23C>G	CCDS9887.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192170	0.38707	.	.	ENSG00000140025	ENST00000316738;ENST00000538485	T;T	0.57595	0.39;1.54	5.51	1.7	0.24286	.	0.984871	0.08311	N	0.965354	T	0.48132	0.1483	L	0.57536	1.79	0.20403	N	0.999908	B;B	0.23058	0.079;0.016	B;B	0.19391	0.025;0.023	T	0.44922	-0.9296	10	0.72032	D	0.01	-0.0083	7.2051	0.25903	0.3497:0.0:0.6503:0.0	.	8;8	B7Z5G9;Q9BUY7	.;EFC11_HUMAN	G	8	ENSP00000326267:A8G;ENSP00000438072:A8G	ENSP00000326267:A8G	A	-	2	0	EFCAB11	89490735	0.001000	0.12720	0.000000	0.03702	0.064000	0.16182	0.612000	0.24283	0.153000	0.19213	0.561000	0.74099	GCC		0.642	EFCAB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309022.2	NM_145231		3	3	0	0	0	0.000248	0	3	3				
UNC79	57578	broad.mit.edu	37	14	94066930	94066930	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr14:94066930C>A	ENST00000393151.2	+	25	3388	c.3388C>A	c.(3388-3390)Ctt>Att	p.L1130I	UNC79_ENST00000256339.4_Missense_Mutation_p.L953I|UNC79_ENST00000553484.1_Missense_Mutation_p.L1130I|UNC79_ENST00000555664.1_Missense_Mutation_p.L1130I			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1130					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ATGTCTTTGTCTTGACTTCCA	0.378																																							uc001ybv.1		NA																	0				ovary(10)|skin(4)|large_intestine(3)	17						c.(2857-2859)CTT>ATT		hypothetical protein LOC57578							66.0	62.0	64.0					14																	94066930		2203	4300	6503	SO:0001583	missense	57578					integral to membrane		g.chr14:94066930C>A	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3388C>A	14.37:g.94066930C>A	ENSP00000376858:p.Leu1130Ile					KIAA1409_uc001ybs.1_Missense_Mutation_p.L953I	p.L953I	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	22	2940	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1130					B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37	c.2857C>A		.	.	.	.	.	.	.	.	.	.	C	20.7	4.026582	0.75390	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.29142	1.6;1.6;1.58;1.6	5.88	5.88	0.94601	.	0.064292	0.64402	D	0.000012	T	0.47303	0.1438	L	0.29908	0.895	0.42783	D	0.993879	D	0.61697	0.99	D	0.72982	0.979	T	0.43491	-0.9388	10	0.72032	D	0.01	-16.4717	20.2187	0.98312	0.0:1.0:0.0:0.0	.	1130	C9JQL1	.	I	953;1130;1130;1130;1130	ENSP00000256339:L953I;ENSP00000450868:L1130I;ENSP00000451360:L1130I;ENSP00000376858:L1130I	ENSP00000256339:L953I	L	+	1	0	KIAA1409	93136683	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.759000	0.55227	2.780000	0.95670	0.655000	0.94253	CTT		0.378	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		16	39	1	0	1.5739e-10	0.004007	2.73465e-10	16	39				
DYNC1H1	1778	broad.mit.edu	37	14	102469195	102469195	+	Silent	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr14:102469195G>C	ENST00000360184.4	+	23	4940	c.4776G>C	c.(4774-4776)ctG>ctC	p.L1592L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1592	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGGATGTTCTGAACATCCAGG	0.433																																							uc001yks.2		NA																	0				ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(4774-4776)CTG>CTC		cytoplasmic dynein 1 heavy chain 1							77.0	78.0	78.0					14																	102469195		2203	4300	6503	SO:0001819	synonymous_variant	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102469195G>C	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.4776G>C	14.37:g.102469195G>C							p.L1592L	NM_001376	NP_001367	Q14204	DYHC1_HUMAN			23	4940	+			1592			Stem (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	c.4776G>C	CCDS9966.1																																																																																				0.433	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		5	42	0	0	0	0.000602	0	5	42				
TMOD2	29767	broad.mit.edu	37	15	52065968	52065968	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr15:52065968C>T	ENST00000249700.4	+	4	564	c.343C>T	c.(343-345)Ctt>Ttt	p.L115F	TMOD2_ENST00000435126.2_Missense_Mutation_p.L115F|TMOD2_ENST00000539962.2_Missense_Mutation_p.L71F	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	115					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		AAAAGTGACCCTTGACCCAGA	0.423																																							uc002abk.2		NA																	0				ovary(2)	2						c.(343-345)CTT>TTT		neuronal tropomodulin isoform a							126.0	123.0	124.0					15																	52065968		2195	4293	6488	SO:0001583	missense	29767				nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding	g.chr15:52065968C>T	AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.343C>T	15.37:g.52065968C>T	ENSP00000249700:p.Leu115Phe					TMOD2_uc002abl.3_Missense_Mutation_p.L115F|TMOD2_uc010bfb.2_Missense_Mutation_p.L71F	p.L115F	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN		all cancers(107;0.00435)	4	564	+			115					B4DEW6	Missense_Mutation	SNP	ENST00000249700.4	37	c.343C>T	CCDS10144.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275554	0.80580	.	.	ENSG00000128872	ENST00000435126;ENST00000249700;ENST00000539962	T;T;T	0.44482	0.92;0.92;0.92	5.36	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.72479	2.2	0.58432	D	0.999991	D;D	0.89917	0.994;1.0	D;D	0.97110	0.919;1.0	T	0.60989	-0.7153	10	0.42905	T	0.14	-12.1648	11.1583	0.48501	0.0:0.8534:0.0:0.1466	.	115;115	Q9NZR1-2;Q9NZR1	.;TMOD2_HUMAN	F	115;115;71	ENSP00000404590:L115F;ENSP00000249700:L115F;ENSP00000437743:L71F	ENSP00000249700:L115F	L	+	1	0	TMOD2	49853260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.881000	0.56152	1.492000	0.48499	0.655000	0.94253	CTT		0.423	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2			35	42	0	0	0	0.002445	0	35	42				
WDR72	256764	broad.mit.edu	37	15	53907848	53907849	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr15:53907848_53907849CC>AA	ENST00000396328.1	-	15	2793_2794	c.2554_2555GG>TT	c.(2554-2556)GGa>TTa	p.G852L	WDR72_ENST00000557913.1_Missense_Mutation_p.G849L|WDR72_ENST00000360509.5_Missense_Mutation_p.G852L|WDR72_ENST00000559418.1_Missense_Mutation_p.G862L	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	852										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TTTTATCATTCCACTATTGCAT	0.351																																							uc002acj.2		NA																	0				lung(1)|skin(1)	2						c.(2554-2556)GGA>TTA		WD repeat domain 72																																				SO:0001583	missense	256764							g.chr15:53907848_53907849CC>AA	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2554_2555delinsAA	15.37:g.53907848_53907849delinsAA	ENSP00000379619:p.Gly852Leu					WDR72_uc010bfi.1_Missense_Mutation_p.G852L	p.G852L	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN		all cancers(107;0.0511)	15	2596_2597	-			852					Q7Z3I3|Q8N8X2	Missense_Mutation	DNP	ENST00000396328.1	37	c.2554_2555GG>TT	CCDS10151.1																																																																																				0.351	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758		21	35	0	0	0	0.004672	0	21	35				
RAB8B	51762	broad.mit.edu	37	15	63481946	63481946	+	Splice_Site	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr15:63481946C>T	ENST00000321437.4	+	1	279	c.123C>T	c.(121-123)atC>atT	p.I41I	RAB8B_ENST00000448330.2_Splice_Site_p.I41I	NM_016530.2	NP_057614.1	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family	41					adherens junction organization (GO:0034332)|antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|positive regulation of cell projection organization (GO:0031346)|positive regulation of corticotropin secretion (GO:0051461)|protein import into peroxisome membrane (GO:0045046)|small GTPase mediated signal transduction (GO:0007264)	cell tip (GO:0051286)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)			kidney(3)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9						TCTCCACCATCGGTGAGGGAG	0.667																																							uc002alz.2		NA																	0				ovary(1)|kidney(1)	2						c.(121-123)ATC>ATT		RAB8B, member RAS oncogene family							36.0	31.0	33.0					15																	63481946		2203	4300	6503	SO:0001630	splice_region_variant	51762				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr15:63481946C>T	AL833365	CCDS10183.1	15q22	2008-11-18			ENSG00000166128	ENSG00000166128		"""RAB, member RAS oncogene"""	30273	protein-coding gene	gene with protein product		613532				9030196, 18772196	Standard	XM_006720569		Approved		uc002alz.3	Q92930	OTTHUMG00000132862	ENST00000321437.4:c.124+1C>T	15.37:g.63481946C>T						RAB8B_uc010uih.1_Silent_p.I41I	p.I41I	NM_016530	NP_057614	Q92930	RAB8B_HUMAN			1	219	+			41			Effector region (By similarity).		Q5JPC4|Q9P293	Silent	SNP	ENST00000321437.4	37	c.123C>T	CCDS10183.1																																																																																				0.667	RAB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256336.1	NM_016530	Silent	5	20	0	0	0	0.001168	0	5	20				
NTRK3	4916	broad.mit.edu	37	15	88576139	88576139	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr15:88576139C>T	ENST00000360948.2	-	13	1695	c.1534G>A	c.(1534-1536)Gag>Aag	p.E512K	NTRK3_ENST00000357724.2_Missense_Mutation_p.E504K|NTRK3_ENST00000394480.2_Missense_Mutation_p.E512K|NTRK3_ENST00000557856.1_Missense_Mutation_p.E504K|NTRK3_ENST00000540489.2_Missense_Mutation_p.E512K|NTRK3_ENST00000317501.3_Missense_Mutation_p.E512K|NTRK3_ENST00000558676.1_Missense_Mutation_p.E504K|NTRK3_ENST00000542733.2_Missense_Mutation_p.E414K|NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000355254.2_Missense_Mutation_p.E512K	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	512					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGGGGGTTCTCAATGACAGGG	0.602			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	0				soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1534-1536)GAG>AAG		neurotrophic tyrosine kinase, receptor, type 3							106.0	77.0	87.0					15																	88576139		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88576139C>T	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1534G>A	15.37:g.88576139C>T	ENSP00000354207:p.Glu512Lys	TSP Lung(13;0.10)				NTRK3_uc002bmh.2_Missense_Mutation_p.E504K|NTRK3_uc002bmf.1_Missense_Mutation_p.E512K|NTRK3_uc010upl.1_Missense_Mutation_p.E414K|NTRK3_uc010bnh.1_Missense_Mutation_p.E504K|NTRK3_uc002bmg.2_Missense_Mutation_p.E512K|NTRK3_uc010bni.2_RNA	p.E512K	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		13	1696	-			512			Cytoplasmic (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.1534G>A	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	33	5.288840	0.95517	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000343782;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.76060	-0.83;-0.78;-0.76;-0.83;-0.71;-0.99;-0.99	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.84361	0.5455	M	0.62723	1.935	0.80722	D	1	P;D;D;D;D;P	0.69078	0.953;0.976;0.993;0.997;0.972;0.947	P;P;D;D;P;P	0.75020	0.473;0.696;0.947;0.985;0.737;0.78	D	0.86040	0.1519	10	0.87932	D	0	.	17.3	0.87180	0.0:1.0:0.0:0.0	.	414;504;504;512;512;512	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	K	512;512;504;512;414;8;512;512	ENSP00000377990:E512K;ENSP00000354207:E512K;ENSP00000350356:E504K;ENSP00000347397:E512K;ENSP00000437773:E414K;ENSP00000444673:E512K;ENSP00000318328:E512K	ENSP00000318328:E512K	E	-	1	0	NTRK3	86377143	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	7.293000	0.78740	2.546000	0.85860	0.650000	0.86243	GAG		0.602	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				6	24	0	0	0	0.001984	0	6	24				
NTRK3	4916	broad.mit.edu	37	15	88726685	88726685	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr15:88726685G>T	ENST00000360948.2	-	4	520	c.359C>A	c.(358-360)cCc>cAc	p.P120H	NTRK3_ENST00000357724.2_Missense_Mutation_p.P120H|NTRK3_ENST00000394480.2_Missense_Mutation_p.P120H|NTRK3_ENST00000557856.1_Missense_Mutation_p.P120H|NTRK3_ENST00000540489.2_Missense_Mutation_p.P120H|NTRK3_ENST00000317501.3_Missense_Mutation_p.P120H|NTRK3_ENST00000558676.1_Missense_Mutation_p.P120H|NTRK3_ENST00000542733.2_Missense_Mutation_p.P22H|NTRK3_ENST00000355254.2_Missense_Mutation_p.P120H	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	120					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AAAGGCTCTGGGCTGAATGCT	0.537			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	0				soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(358-360)CCC>CAC		neurotrophic tyrosine kinase, receptor, type 3							132.0	131.0	131.0					15																	88726685		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88726685G>T	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.359C>A	15.37:g.88726685G>T	ENSP00000354207:p.Pro120His	TSP Lung(13;0.10)				NTRK3_uc002bmh.2_Missense_Mutation_p.P120H|NTRK3_uc002bmf.1_Missense_Mutation_p.P120H|NTRK3_uc010upl.1_Missense_Mutation_p.P22H|NTRK3_uc010bnh.1_Missense_Mutation_p.P120H|NTRK3_uc002bmg.2_Missense_Mutation_p.P120H	p.P120H	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		4	521	-			120			LRR 1.|Extracellular (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.359C>A	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571953	0.65765	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3;0.3	5.34	5.34	0.76211	.	0.114965	0.64402	D	0.000012	T	0.69780	0.3149	M	0.64567	1.98	0.50313	D	0.999866	D;D;B;P;D;B	0.67145	0.996;0.992;0.01;0.808;0.965;0.041	P;P;B;P;P;B	0.62649	0.905;0.873;0.081;0.479;0.723;0.081	T	0.67444	-0.5669	10	0.33141	T	0.24	.	14.5725	0.68220	0.0:0.0:1.0:0.0	.	22;120;120;120;120;120	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	H	120;120;120;120;22;120;120	ENSP00000377990:P120H;ENSP00000354207:P120H;ENSP00000350356:P120H;ENSP00000347397:P120H;ENSP00000437773:P22H;ENSP00000444673:P120H;ENSP00000318328:P120H	ENSP00000318328:P120H	P	-	2	0	NTRK3	86527689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.179000	0.77665	2.492000	0.84095	0.655000	0.94253	CCC		0.537	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				43	51	1	0	5.73435e-26	0.00361	1.22001e-25	43	51				
PDIA2	64714	broad.mit.edu	37	16	335343	335343	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:335343T>A	ENST00000219406.6	+	6	845	c.827T>A	c.(826-828)cTc>cAc	p.L276H	PDIA2_ENST00000462950.1_3'UTR|PDIA2_ENST00000404312.1_Missense_Mutation_p.L273H	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	276					cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GCCAGGATCCTCAACCACCTG	0.647																																							uc002cgn.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(826-828)CTC>CAC		protein disulfide isomerase A2 precursor							40.0	46.0	44.0					16																	335343		2087	4212	6299	SO:0001583	missense	64714				apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding	g.chr16:335343T>A	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.827T>A	16.37:g.335343T>A	ENSP00000219406:p.Leu276His					PDIA2_uc010bqt.1_Missense_Mutation_p.L121H|PDIA2_uc002cgo.1_Missense_Mutation_p.L276H	p.L276H	NM_006849	NP_006840	Q13087	PDIA2_HUMAN			11	1935	+		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)	276					A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Missense_Mutation	SNP	ENST00000219406.6	37	c.827T>A	CCDS42089.1	.	.	.	.	.	.	.	.	.	.	t	10.60	1.394670	0.25205	.	.	ENSG00000185615	ENST00000219406;ENST00000455994;ENST00000404312	T;T	0.31769	1.48;1.48	3.97	3.97	0.46021	Thioredoxin-like fold (1);	0.587903	0.17304	N	0.179139	T	0.28665	0.0710	L	0.50333	1.59	0.31181	N	0.702016	B	0.21309	0.054	B	0.32090	0.14	T	0.31641	-0.9936	10	0.59425	D	0.04	.	5.0735	0.14618	0.0:0.218:0.0:0.7819	.	276	Q13087	PDIA2_HUMAN	H	276;245;273	ENSP00000219406:L276H;ENSP00000384410:L273H	ENSP00000219406:L276H	L	+	2	0	PDIA2	275344	0.191000	0.23288	1.000000	0.80357	0.725000	0.41563	0.624000	0.24462	1.675000	0.50919	0.454000	0.30748	CTC		0.647	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849		21	17	0	0	0	0.001882	0	21	17				
PRR35	146325	broad.mit.edu	37	16	613534	613534	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:613534C>T	ENST00000409413.3	+	2	519	c.240C>T	c.(238-240)tcC>tcT	p.S80S		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		80										central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						GCCGTGGCTCCACCACGCCTA	0.687																																							uc002chk.2		NA																	0				central_nervous_system(1)	1						c.(238-240)TCC>TCT		hypothetical protein LOC146325							62.0	63.0	62.0					16																	613534		2026	4161	6187	SO:0001819	synonymous_variant	146325							g.chr16:613534C>T																												ENST00000409413.3:c.240C>T	16.37:g.613534C>T							p.S80S	NM_145270	NP_660313	P0CG20	CP011_HUMAN			2	519	+			80					B8ZZ27|Q8N233|Q96AX3|Q96S23	Silent	SNP	ENST00000409413.3	37	c.240C>T	CCDS45365.1																																																																																				0.687	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1			4	12	0	0	0	0.000248	0	4	12				
CREBBP	1387	broad.mit.edu	37	16	3860676	3860676	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:3860676C>A	ENST00000262367.5	-	3	1712	c.903G>T	c.(901-903)caG>caT	p.Q301H	CREBBP_ENST00000382070.3_Missense_Mutation_p.Q301H	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	301	Interaction with SRCAP.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGACCATGCTCTGTTTGCTGG	0.493			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		0				haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(901-903)CAG>CAT		CREB binding protein isoform a							202.0	182.0	189.0					16																	3860676		2197	4300	6497	SO:0001583	missense	1387	Rubinstein-Taybsyndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3860676C>A	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.903G>T	16.37:g.3860676C>A	ENSP00000262367:p.Gln301His					CREBBP_uc002cvw.2_Missense_Mutation_p.Q301H	p.Q301H	NM_004380	NP_004371	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	3	1107	-		Ovarian(90;0.0266)	301			Interaction with SRCAP.		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	c.903G>T	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.468860	0.43839	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.83591	-1.74;-1.67	5.28	3.11	0.35812	.	0.083720	0.50627	D	0.000110	T	0.75324	0.3834	N	0.08118	0	0.27344	N	0.956426	D;D	0.56968	0.978;0.978	D;P	0.63192	0.912;0.887	T	0.64769	-0.6329	10	0.45353	T	0.12	-12.7802	3.776	0.08660	0.3044:0.4442:0.0:0.2514	.	369;301	Q4LE28;Q92793	.;CBP_HUMAN	H	301;369;301	ENSP00000262367:Q301H;ENSP00000371502:Q301H	ENSP00000262367:Q301H	Q	-	3	2	CREBBP	3800677	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	0.643000	0.24750	1.220000	0.43490	0.563000	0.77884	CAG		0.493	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		43	54	1	0	1.76056e-25	0.002852	3.72666e-25	43	54				
CLEC16A	23274	broad.mit.edu	37	16	11154765	11154765	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:11154765C>T	ENST00000409790.1	+	19	2232	c.2002C>T	c.(2002-2004)Cgg>Tgg	p.R668W	CLEC16A_ENST00000409552.3_Missense_Mutation_p.R650W|CLEC16A_ENST00000465491.1_3'UTR	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCAGGCCATCCGGGTGTTCTT	0.532																																							uc002dao.2		NA																	1	Whole gene deletion(1)		haematopoietic_and_lymphoid_tissue(1)	ovary(1)|central_nervous_system(1)	2						c.(2002-2004)CGG>TGG		C-type lectin domain family 16, member A							195.0	211.0	206.0					16																	11154765		2174	4284	6458	SO:0001583	missense	23274							g.chr16:11154765C>T	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.2002C>T	16.37:g.11154765C>T	ENSP00000387122:p.Arg668Trp					CLEC16A_uc002dan.3_Missense_Mutation_p.R650W	p.R668W	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN			19	2232	+			668						Missense_Mutation	SNP	ENST00000409790.1	37	c.2002C>T	CCDS45409.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.340434	0.81911	.	.	ENSG00000038532	ENST00000409790;ENST00000542102;ENST00000409552	T	0.52295	0.67	5.52	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.67767	0.2928	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.71768	-0.4493	10	0.87932	D	0	-21.0505	10.4899	0.44744	0.0:0.9104:0.0:0.0896	.	668;650	Q2KHT3;Q2KHT3-2	CL16A_HUMAN;.	W	668;668;650	ENSP00000387122:R668W	ENSP00000386495:R650W	R	+	1	2	CLEC16A	11062266	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	3.818000	0.55678	1.474000	0.48178	0.563000	0.77884	CGG		0.532	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226		23	198	0	0	0	0.00333	0	23	198				
XYLT1	64131	broad.mit.edu	37	16	17353202	17353202	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:17353202G>C	ENST00000261381.6	-	3	640	c.556C>G	c.(556-558)Ccg>Gcg	p.P186A		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	186					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGTCTACTCGGTGGCTTCTTC	0.527																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(556-558)CCG>GCG		xylosyltransferase I							132.0	130.0	131.0					16																	17353202		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17353202G>C	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.556C>G	16.37:g.17353202G>C	ENSP00000261381:p.Pro186Ala						p.P186A	NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN			3	641	-			186			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.556C>G	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	G	3.045	-0.196632	0.06259	.	.	ENSG00000103489	ENST00000261381	T	0.03920	3.76	5.43	4.46	0.54185	.	0.425465	0.28312	N	0.015802	T	0.02929	0.0087	N	0.08118	0	0.19300	N	0.999977	B	0.02656	0.0	B	0.04013	0.001	T	0.44205	-0.9343	10	0.13108	T	0.6	-7.6306	13.808	0.63246	0.0:0.2928:0.7072:0.0	.	186	Q86Y38	XYLT1_HUMAN	A	186	ENSP00000261381:P186A	ENSP00000261381:P186A	P	-	1	0	XYLT1	17260703	0.178000	0.23122	0.115000	0.21578	0.796000	0.44982	2.548000	0.45794	1.269000	0.44280	0.655000	0.94253	CCG		0.527	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		43	62	0	0	0	0.002522	0	43	62				
VWA3A	146177	broad.mit.edu	37	16	22161194	22161194	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:22161194T>C	ENST00000389398.5	+	29	3167	c.3071T>C	c.(3070-3072)aTg>aCg	p.M1024T	VWA3A_ENST00000389397.4_Missense_Mutation_p.M126T|VWA3A_ENST00000563755.1_Missense_Mutation_p.M126T	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	1024	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CATGAGGCTATGCAATGGGTG	0.552																																							uc010vbq.1		NA																	0				skin(1)	1						c.(3070-3072)ATG>ACG		von Willebrand factor A domain containing 3A							74.0	74.0	74.0					16																	22161194		2076	4201	6277	SO:0001583	missense	146177					extracellular region		g.chr16:22161194T>C	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.3071T>C	16.37:g.22161194T>C	ENSP00000374049:p.Met1024Thr					VWA3A_uc010bxd.2_RNA|VWA3A_uc002dkg.3_Missense_Mutation_p.M102T|VWA3A_uc010bxe.1_Missense_Mutation_p.M126T	p.M1024T	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN		GBM - Glioblastoma multiforme(48;0.0439)	29	3167	+			1024			VWFA 2.		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	c.3071T>C	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	T	13.42	2.233024	0.39498	.	.	ENSG00000175267	ENST00000389398;ENST00000389397;ENST00000299840	T;T	0.07444	3.19;3.19	5.57	5.57	0.84162	von Willebrand factor, type A (3);	0.115168	0.64402	D	0.000019	T	0.10035	0.0246	L	0.47716	1.5	0.35799	D	0.822965	B;B	0.15473	0.002;0.013	B;B	0.13407	0.007;0.009	T	0.08848	-1.0702	10	0.38643	T	0.18	.	13.6858	0.62515	0.0:0.0:0.0:1.0	.	1024;126	A6NCI4;A6NCI4-4	VWA3A_HUMAN;.	T	1024;126;647	ENSP00000374049:M1024T;ENSP00000374048:M126T	ENSP00000299840:M647T	M	+	2	0	VWA3A	22068695	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.401000	0.44513	2.107000	0.64212	0.533000	0.62120	ATG		0.552	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1			19	26	0	0	0	0.006122	0	19	26				
GTF3C1	2975	broad.mit.edu	37	16	27499675	27499675	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:27499675C>T	ENST00000356183.4	-	23	3588	c.3573G>A	c.(3571-3573)tgG>tgA	p.W1191*	GTF3C1_ENST00000561623.1_Nonsense_Mutation_p.W1191*	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1191					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						ACTGCTCTTCCCAGCCAGCAC	0.562																																							uc002dov.1		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(3571-3573)TGG>TGA		general transcription factor IIIC, polypeptide							139.0	145.0	143.0					16																	27499675		2197	4300	6497	SO:0001587	stop_gained	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27499675C>T	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.3573G>A	16.37:g.27499675C>T	ENSP00000348510:p.Trp1191*					GTF3C1_uc002dou.2_Nonsense_Mutation_p.W1191*	p.W1191*	NM_001520	NP_001511	Q12789	TF3C1_HUMAN			23	3613	-			1191					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Nonsense_Mutation	SNP	ENST00000356183.4	37	c.3573G>A	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	38	6.785523	0.97837	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	.	.	.	4.87	0.427	0.16489	.	1.833020	0.03044	N	0.153758	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-3.3337	6.2845	0.21025	0.0:0.6236:0.1322:0.2442	.	.	.	.	X	1191;1187	.	ENSP00000348510:W1191X	W	-	3	0	GTF3C1	27407176	0.000000	0.05858	0.001000	0.08648	0.101000	0.19017	-0.125000	0.10579	-0.155000	0.11098	0.561000	0.74099	TGG		0.562	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		6	174	0	0	0	0.001168	0	6	174				
TGFB1I1	7041	broad.mit.edu	37	16	31485687	31485687	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:31485687C>G	ENST00000394863.3	+	6	560	c.430C>G	c.(430-432)Cct>Gct	p.P144A	TGFB1I1_ENST00000394858.2_Missense_Mutation_p.P127A|TGFB1I1_ENST00000567607.1_Missense_Mutation_p.P127A|TGFB1I1_ENST00000361773.3_Missense_Mutation_p.P127A	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	144	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						CAGCCCGTCTCCTGGCCTCCC	0.557																																							uc002ecd.1		NA																	0					0						c.(430-432)CCT>GCT		transforming growth factor beta 1 induced							69.0	66.0	67.0					16																	31485687		2197	4300	6497	SO:0001583	missense	7041				androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding	g.chr16:31485687C>G	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.430C>G	16.37:g.31485687C>G	ENSP00000378332:p.Pro144Ala					TGFB1I1_uc002ece.1_Missense_Mutation_p.P127A|TGFB1I1_uc010caq.1_5'UTR	p.P144A	NM_001042454	NP_001035919	O43294	TGFI1_HUMAN			6	456	+			144			Transcription activation (By similarity).|Interaction with PTK2B.		B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	37	c.430C>G	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.638526	0.29157	.	.	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	T;T;T	0.55413	0.52;0.55;0.55	5.23	3.29	0.37713	.	0.596543	0.17004	N	0.190797	T	0.42381	0.1200	L	0.44542	1.39	0.24711	N	0.993203	B	0.22414	0.069	B	0.20955	0.032	T	0.36578	-0.9742	10	0.54805	T	0.06	.	7.6666	0.28434	0.0:0.808:0.0:0.192	.	144	O43294	TGFI1_HUMAN	A	144;127;127	ENSP00000378332:P144A;ENSP00000355117:P127A;ENSP00000378327:P127A	ENSP00000355117:P127A	P	+	1	0	TGFB1I1	31393188	0.001000	0.12720	0.541000	0.28102	0.954000	0.61252	0.651000	0.24873	0.596000	0.29794	0.655000	0.94253	CCT		0.557	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3			12	64	0	0	0	0.001368	0	12	64				
ABCC12	94160	broad.mit.edu	37	16	48122480	48122480	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:48122480C>T	ENST00000311303.3	-	24	3796	c.3451G>A	c.(3451-3453)Ggg>Agg	p.G1151R	ABCC12_ENST00000532355.1_5'Flank|ABCC12_ENST00000416054.1_3'UTR|ABCC12_ENST00000448542.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	1151	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CCAACAATCCCGACTGTCTGC	0.463																																							uc002efc.1		NA																	0				ovary(2)|skin(1)	3						c.(3451-3453)GGG>AGG		ATP-binding cassette protein C12							116.0	106.0	109.0					16																	48122480		2201	4300	6501	SO:0001583	missense	94160					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48122480C>T	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.3451G>A	16.37:g.48122480C>T	ENSP00000311030:p.Gly1151Arg					ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	p.G1151R	NM_033226	NP_150229	Q96J65	MRP9_HUMAN			24	3797	-		all_cancers(37;0.0474)|all_lung(18;0.047)	1151			ABC transporter 2.		Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	37	c.3451G>A	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421042	0.83559	.	.	ENSG00000140798	ENST00000311303	D	0.91407	-2.84	5.58	4.6	0.57074	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96380	0.8819	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97190	0.9857	10	0.87932	D	0	.	14.4802	0.67576	0.1483:0.8517:0.0:0.0	.	1151	Q96J65	MRP9_HUMAN	R	1151	ENSP00000311030:G1151R	ENSP00000311030:G1151R	G	-	1	0	ABCC12	46679981	1.000000	0.71417	0.832000	0.32986	0.879000	0.50718	5.390000	0.66261	1.291000	0.44653	0.655000	0.94253	GGG		0.463	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226		7	48	0	0	0	0.004482	0	7	48				
ZNF423	23090	broad.mit.edu	37	16	49670203	49670203	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:49670203C>A	ENST00000561648.1	-	4	2913	c.2860G>T	c.(2860-2862)Ggc>Tgc	p.G954C	ZNF423_ENST00000535559.1_Missense_Mutation_p.G837C|ZNF423_ENST00000262383.2_Missense_Mutation_p.G954C|ZNF423_ENST00000563137.2_Missense_Mutation_p.G894C|ZNF423_ENST00000567169.1_Missense_Mutation_p.G837C|ZNF423_ENST00000562871.1_Missense_Mutation_p.G894C|ZNF423_ENST00000562520.1_Missense_Mutation_p.G894C	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	954					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TTGGCAGGGCCCCGGTGCGTC	0.577																																							uc002efs.2		NA																	0				ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(2860-2862)GGC>TGC		zinc finger protein 423							71.0	54.0	60.0					16																	49670203		2198	4300	6498	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49670203C>A	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2860G>T	16.37:g.49670203C>A	ENSP00000455426:p.Gly954Cys					ZNF423_uc010vgn.1_Missense_Mutation_p.G837C	p.G954C	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			5	3158	-		all_cancers(37;0.0155)	954					O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.2860G>T	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165541	0.78339	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.26660	1.72;1.72	4.81	4.81	0.61882	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.58963	0.2159	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67780	-0.5582	9	.	.	.	-35.836	17.8857	0.88854	0.0:1.0:0.0:0.0	.	954	Q2M1K9	ZN423_HUMAN	C	954;837	ENSP00000262383:G954C;ENSP00000442321:G837C	.	G	-	1	0	ZNF423	48227704	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.234000	0.73211	0.561000	0.74099	GGC		0.577	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		17	34	1	0	0.000958276	0.007413	0.00135	17	34				
CYLD	1540	broad.mit.edu	37	16	50813827	50813827	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr16:50813827C>T	ENST00000427738.3	+	8	1595	c.1390C>T	c.(1390-1392)Cct>Tct	p.P464S	CYLD_ENST00000568704.2_Intron|CYLD_ENST00000569418.1_Missense_Mutation_p.P461S|CYLD_ENST00000564326.1_Missense_Mutation_p.P461S|CYLD_ENST00000398568.2_Missense_Mutation_p.P461S|CYLD_ENST00000311559.9_Missense_Mutation_p.P464S|CYLD_ENST00000540145.1_Missense_Mutation_p.P464S|CYLD_ENST00000566206.1_Missense_Mutation_p.P461S			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	464	Interaction with TRAF2.|Interaction with TRIP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				GGCCATGCCTCCTGGGAACTC	0.527			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																														uc002egp.1		NA	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	Mis|N|F|S	familial cylindromatosis gene			E		cylindroma	cylindroma		0				skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28						c.(1390-1392)CCT>TCT		ubiquitin carboxyl-terminal hydrolase CYLD							85.0	86.0	85.0					16																	50813827		1970	4148	6118	SO:0001583	missense	1540	Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr16:50813827C>T	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.1390C>T	16.37:g.50813827C>T	ENSP00000392025:p.Pro464Ser					CYLD_uc002ego.2_Missense_Mutation_p.P461S|CYLD_uc010cbs.1_Missense_Mutation_p.P461S|CYLD_uc002egq.1_Missense_Mutation_p.P461S|CYLD_uc002egr.1_Missense_Mutation_p.P461S|CYLD_uc002egs.1_Missense_Mutation_p.P461S	p.P464S	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN			9	1805	+		all_cancers(37;0.0156)	464			Interaction with TRAF2.|Interaction with TRIP.		O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	ENST00000427738.3	37	c.1390C>T	CCDS45482.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.343990	0.00222	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	T;T;T	0.72942	-0.7;-0.7;-0.7	5.6	-0.528	0.11905	Cytoskeleton-associated protein, Gly-rich domain (1);	0.526291	0.22078	N	0.064936	T	0.36552	0.0971	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.12041	-1.0563	10	0.10111	T	0.7	-2.1772	0.5409	0.00645	0.2307:0.29:0.205:0.2742	.	461;464;461;464	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	S	464;464;461;461	ENSP00000445447:P464S;ENSP00000308928:P464S;ENSP00000381574:P461S	ENSP00000308928:P464S	P	+	1	0	CYLD	49371328	0.002000	0.14202	0.001000	0.08648	0.133000	0.20885	0.469000	0.22067	-0.385000	0.07833	-0.302000	0.09304	CCT		0.527	CYLD-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422998.2			7	47	0	0	0	0.001984	0	7	47				
CLUH	23277	broad.mit.edu	37	17	2595924	2595924	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:2595924C>A	ENST00000570628.2	-	21	3367	c.3262G>T	c.(3262-3264)Gcc>Tcc	p.A1088S	CLUH_ENST00000538975.1_Missense_Mutation_p.A1088S|CLUH_ENST00000435359.1_Missense_Mutation_p.A1088S			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1088					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											AGGTAGCGGGCGCGGTACAGC	0.706																																							uc002fuy.1		NA																	0				breast(2)	2						c.(3262-3264)GCC>TCC		hypothetical protein LOC23277							23.0	30.0	27.0					17																	2595924		2160	4239	6399	SO:0001583	missense	23277						binding	g.chr17:2595924C>A	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3262G>T	17.37:g.2595924C>A	ENSP00000458986:p.Ala1088Ser					KIAA0664_uc002fux.1_Missense_Mutation_p.A1021S|KIAA0664_uc010ckc.1_Missense_Mutation_p.A74S	p.A1088S	NM_015229	NP_056044	O75153	K0664_HUMAN			21	3348	-			1088					Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	c.3262G>T	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	C	33	5.218177	0.95104	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.72505	-0.66;-0.66	4.65	4.65	0.58169	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.86368	0.5916	M	0.90252	3.1	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.71656	0.974;0.974	D	0.89034	0.3444	10	0.59425	D	0.04	.	16.6792	0.85287	0.0:1.0:0.0:0.0	.	1088;1089	O75153;C9J6D7	K0664_HUMAN;.	S	1088;1089;1088	ENSP00000388872:A1088S;ENSP00000439628:A1088S	ENSP00000320468:A1089S	A	-	1	0	KIAA0664	2542674	1.000000	0.71417	0.987000	0.45799	0.967000	0.64934	7.651000	0.83577	2.406000	0.81754	0.561000	0.74099	GCC		0.706	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229		10	11	1	0	6.40141e-05	0.000978	9.33353e-05	10	11				
PITPNM3	83394	broad.mit.edu	37	17	6381406	6381406	+	Silent	SNP	G	G	A	rs554495556		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:6381406G>A	ENST00000262483.8	-	8	876	c.789C>T	c.(787-789)atC>atT	p.I263I	PITPNM3_ENST00000421306.3_Silent_p.I227I	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	263					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CACAGTCCCCGATGAGACACA	0.677																																							uc002gdd.3		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(787-789)ATC>ATT		PITPNM family member 3 isoform 1							43.0	48.0	46.0					17																	6381406		2203	4300	6503	SO:0001819	synonymous_variant	83394				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding	g.chr17:6381406G>A	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.789C>T	17.37:g.6381406G>A						PITPNM3_uc010cln.2_Silent_p.I227I|PITPNM3_uc002gdc.3_5'UTR	p.I263I	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN		Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)	8	940	-			263					A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	c.789C>T	CCDS11076.1																																																																																				0.677	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		16	31	0	0	0	0.003163	0	16	31				
CTC1	80169	broad.mit.edu	37	17	8140817	8140817	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:8140817T>A	ENST00000315684.8	-	5	675	c.668A>T	c.(667-669)cAg>cTg	p.Q223L	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	223					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						CAGGTTTCGCTGCACACCTCT	0.483																																							uc002gkq.3		NA																	0					0						c.(667-669)CAG>CTG		alpha accessory factor 132							78.0	77.0	77.0					17																	8140817		1975	4148	6123	SO:0001583	missense	80169				positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding	g.chr17:8140817T>A	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.668A>T	17.37:g.8140817T>A	ENSP00000313759:p.Gln223Leu					C17orf68_uc010cnv.2_Intron	p.Q223L	NM_025099	NP_079375	Q2NKJ3	CTC1_HUMAN			5	727	-			223					B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	37	c.668A>T	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	T	15.78	2.935807	0.52972	.	.	ENSG00000178971	ENST00000315684	D	0.83335	-1.71	4.58	2.25	0.28309	.	0.644830	0.14594	N	0.310083	T	0.73063	0.3539	L	0.44542	1.39	0.09310	N	1	B	0.33238	0.403	B	0.30029	0.11	T	0.56721	-0.7932	10	0.24483	T	0.36	-0.4963	8.7563	0.34648	0.0:0.0:0.3766:0.6234	.	223	Q2NKJ3	CTC1_HUMAN	L	223	ENSP00000313759:Q223L	ENSP00000313759:Q223L	Q	-	2	0	CTC1	8081542	0.004000	0.15560	0.000000	0.03702	0.923000	0.55619	0.506000	0.22658	0.323000	0.23307	0.329000	0.21502	CAG		0.483	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099		13	14	0	0	0	0.003163	0	13	14				
MYH1	4619	broad.mit.edu	37	17	10415802	10415802	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:10415802C>G	ENST00000226207.5	-	12	1164	c.1070G>C	c.(1069-1071)gGg>gCg	p.G357A	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	357	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CATCACAGCCCCTGTGAGCTT	0.453																																							uc002gmo.2		NA																	0				ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(1069-1071)GGG>GCG		myosin, heavy chain 1, skeletal muscle, adult							134.0	123.0	127.0					17																	10415802		2203	4300	6503	SO:0001583	missense	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10415802C>G		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.1070G>C	17.37:g.10415802C>G	ENSP00000226207:p.Gly357Ala					uc002gml.1_Intron	p.G357A	NM_005963	NP_005954	P12882	MYH1_HUMAN			12	1164	-			357			Myosin head-like.		Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	c.1070G>C	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.746910	0.89663	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	T	0.79352	-1.26	5.87	5.87	0.94306	Myosin head, motor domain (2);	0.000000	0.43919	U	0.000519	T	0.63271	0.2497	N	0.02751	-0.505	0.80722	D	1	B	0.17667	0.023	B	0.32149	0.141	T	0.57791	-0.7750	10	0.22706	T	0.39	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	357	P12882	MYH1_HUMAN	A	357	ENSP00000226207:G357A	ENSP00000226207:G357A	G	-	2	0	MYH1	10356527	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	7.683000	0.84093	2.941000	0.99782	0.655000	0.94253	GGG		0.453	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		32	38	0	0	0	0.002096	0	32	38				
SYNRG	11276	broad.mit.edu	37	17	35930960	35930960	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:35930960C>T	ENST00000339208.6	-	10	1263	c.1123G>A	c.(1123-1125)Gat>Aat	p.D375N	SYNRG_ENST00000394378.2_Missense_Mutation_p.D297N|SYNRG_ENST00000346661.4_Missense_Mutation_p.D375N|SYNRG_ENST00000588194.1_5'UTR|SYNRG_ENST00000345615.4_Missense_Mutation_p.D297N|SYNRG_ENST00000591288.1_Intron|SYNRG_ENST00000585472.1_Missense_Mutation_p.D296N|SYNRG_ENST00000502449.2_Missense_Mutation_p.D297N	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	375	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TTTAAAGCATCAGGACTCATT	0.458																																							uc002hoa.2		NA																	0				ovary(2)	2						c.(1123-1125)GAT>AAT		synergin, gamma isoform 1							107.0	114.0	111.0					17																	35930960		2203	4300	6503	SO:0001583	missense	11276				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding	g.chr17:35930960C>T	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.1123G>A	17.37:g.35930960C>T	ENSP00000343610:p.Asp375Asn					SYNRG_uc010wde.1_Missense_Mutation_p.D297N|SYNRG_uc010wdf.1_Missense_Mutation_p.D297N|SYNRG_uc002hoc.2_Missense_Mutation_p.D296N|SYNRG_uc002hoe.2_Missense_Mutation_p.D297N|SYNRG_uc002hod.2_Missense_Mutation_p.D297N|SYNRG_uc010wdg.1_Intron|SYNRG_uc002hob.2_Missense_Mutation_p.D375N|SYNRG_uc002hof.2_Missense_Mutation_p.D87N|SYNRG_uc010cvd.1_Missense_Mutation_p.D175N|SYNRG_uc002hog.1_Missense_Mutation_p.D509N	p.D375N	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN			10	1206	-			375			EH.		A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	c.1123G>A	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	C	35	5.549247	0.96488	.	.	ENSG00000006114	ENST00000346661;ENST00000345615;ENST00000502449;ENST00000394378	T;T;T	0.47869	1.41;0.83;0.83	5.62	5.62	0.85841	EPS15 homology (EH) (1);EF-hand-like domain (1);	0.051152	0.85682	D	0.000000	T	0.68329	0.2989	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.991;0.995;0.999;0.999	P;P;P;D;D	0.85130	0.894;0.894;0.894;0.997;0.997	T	0.67875	-0.5557	10	0.54805	T	0.06	-14.3993	19.6741	0.95924	0.0:1.0:0.0:0.0	.	297;297;297;375;375	Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;SYNRG_HUMAN	N	375;375;297;297	ENSP00000005279:D375N;ENSP00000424893:D297N;ENSP00000377903:D297N	ENSP00000315722:D375N	D	-	1	0	SYNRG	33005073	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.997000	0.76270	2.661000	0.90470	0.650000	0.86243	GAT		0.458	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247		12	103	0	0	0	0.00245	0	12	103				
KRTAP9-2	83899	broad.mit.edu	37	17	39382920	39382920	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:39382920G>T	ENST00000377721.3	+	1	21	c.14G>T	c.(13-15)tGc>tTc	p.C5F	KRTAP9-2_ENST00000455970.2_Missense_Mutation_p.C5F	NM_031961.2	NP_114167.2	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9-2	5						keratin filament (GO:0045095)				large_intestine(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ACCCACTGTTGCTCCCCTTGC	0.582																																							uc002hwf.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(13-15)TGC>TTC		keratin associated protein 9.2							125.0	133.0	130.0					17																	39382920		2203	4298	6501	SO:0001583	missense	83899					keratin filament	protein binding	g.chr17:39382920G>T	AJ406946	CCDS32651.1	17q21.2	2013-06-25			ENSG00000239886	ENSG00000239886		"""Keratin associated proteins"""	16926	protein-coding gene	gene with protein product						11279113	Standard	NM_031961		Approved	KAP9.2	uc002hwf.3	Q9BYQ4	OTTHUMG00000133609	ENST00000377721.3:c.14G>T	17.37:g.39382920G>T	ENSP00000366950:p.Cys5Phe						p.C5F	NM_031961	NP_114167	Q9BYQ4	KRA92_HUMAN	STAD - Stomach adenocarcinoma(17;0.000397)		1	21	+		Breast(137;0.000496)	5					Q17RK8|Q2TB15|Q6ISF6	Missense_Mutation	SNP	ENST00000377721.3	37	c.14G>T	CCDS32651.1	.	.	.	.	.	.	.	.	.	.	.	11.67	1.707292	0.30322	.	.	ENSG00000239886	ENST00000377721;ENST00000455970	T;T	0.01538	5.39;4.79	3.05	3.05	0.35203	.	.	.	.	.	T	0.08179	0.0204	M	0.79258	2.445	0.40136	D	0.976778	D	0.65815	0.995	D	0.68483	0.958	T	0.02683	-1.1124	9	0.54805	T	0.06	.	9.9043	0.41366	0.0:0.0:1.0:0.0	.	5	Q9BYQ4	KRA92_HUMAN	F	5	ENSP00000366950:C5F;ENSP00000398325:C5F	ENSP00000366950:C5F	C	+	2	0	KRTAP9-2	36636446	1.000000	0.71417	0.996000	0.52242	0.551000	0.35334	4.682000	0.61671	2.020000	0.59435	0.546000	0.68486	TGC		0.582	KRTAP9-2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257717.1			42	120	1	0	1.35964e-18	0.00361	2.68706e-18	42	120				
KRTAP9-4	85280	broad.mit.edu	37	17	39405986	39405986	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:39405986G>T	ENST00000334109.2	+	1	48	c.14G>T	c.(13-15)tGc>tTc	p.C5F		NM_033191.2	NP_149461.2	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	5						keratin filament (GO:0045095)				breast(1)|large_intestine(1)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ACCCACTGTTGCTCCCCTTGC	0.577																																							uc002hwi.2		NA																	0					0						c.(13-15)TGC>TTC		keratin associated protein 9-4							148.0	120.0	130.0					17																	39405986		2203	4299	6502	SO:0001583	missense	85280					keratin filament		g.chr17:39405986G>T	AJ406948	CCDS11386.1	17q21.2	2013-06-25			ENSG00000241595	ENSG00000241595		"""Keratin associated proteins"""	18902	protein-coding gene	gene with protein product						11279113	Standard	NM_033191		Approved	KAP9.4	uc002hwi.3	Q9BYQ2	OTTHUMG00000133438	ENST00000334109.2:c.14G>T	17.37:g.39405986G>T	ENSP00000334922:p.Cys5Phe					KRTAP9-9_uc010wfq.1_Intron	p.C5F	NM_033191	NP_149461	Q9BYQ2	KRA94_HUMAN	STAD - Stomach adenocarcinoma(17;0.000397)		1	48	+		Breast(137;0.000496)	5					Q0VAE3	Missense_Mutation	SNP	ENST00000334109.2	37	c.14G>T	CCDS11386.1	.	.	.	.	.	.	.	.	.	.	.	13.79	2.342852	0.41498	.	.	ENSG00000241595;ENSG00000198083	ENST00000334109;ENST00000431129	T	0.01126	5.3	1.96	1.96	0.26148	.	.	.	.	.	T	0.04227	0.0117	M	0.62723	1.935	0.38692	D	0.952793	D	0.67145	0.996	D	0.74348	0.983	T	0.53535	-0.8425	9	0.39692	T	0.17	.	9.9692	0.41743	0.0:0.0:1.0:0.0	.	5	Q9BYQ2	KRA94_HUMAN	F	5	ENSP00000334922:C5F	ENSP00000334922:C5F	C	+	2	0	KRTAP9-4;KRTAP9-9	36659512	1.000000	0.71417	0.994000	0.49952	0.708000	0.40852	2.566000	0.45948	1.390000	0.46547	0.400000	0.26472	TGC		0.577	KRTAP9-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257306.1			8	92	1	0	2.27111e-07	0.001368	3.52064e-07	8	92				
MRPL10	124995	broad.mit.edu	37	17	45901816	45901816	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:45901816T>C	ENST00000351111.2	-	5	546	c.541A>G	c.(541-543)Att>Gtt	p.I181V	MRPL10_ENST00000290208.7_Missense_Mutation_p.I191V|OSBPL7_ENST00000392507.3_5'Flank|OSBPL7_ENST00000007414.3_5'Flank|MRPL10_ENST00000414011.1_Missense_Mutation_p.I191V	NM_145255.3	NP_660298.2	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10	181					ribosome biogenesis (GO:0042254)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|large_intestine(1)|lung(3)|ovary(1)	8						GTGTCATCAATGCAGCCACCT	0.537																																							uc002ilz.2		NA																	0				ovary(1)	1						c.(541-543)ATT>GTT		mitochondrial ribosomal protein L10 precursor							63.0	60.0	61.0					17																	45901816		2203	4300	6503	SO:0001583	missense	124995				ribosome biogenesis|translation	mitochondrial large ribosomal subunit	structural constituent of ribosome	g.chr17:45901816T>C	AB051618	CCDS11516.1, CCDS11517.1	17q21.3	2012-09-13			ENSG00000159111	ENSG00000159111		"""Mitochondrial ribosomal proteins / large subunits"""	14055	protein-coding gene	gene with protein product	"""39S ribosomal protein L10, mitochondrial"""	611825				11551941	Standard	NM_148887		Approved	RPML8, MRP-L8, L10MT, MRP-L10, MRPL8, MGC17973	uc002ily.3	Q7Z7H8	OTTHUMG00000156302	ENST00000351111.2:c.541A>G	17.37:g.45901816T>C	ENSP00000324100:p.Ile181Val					OSBPL7_uc002ilx.1_5'Flank|MRPL10_uc010wky.1_Missense_Mutation_p.I142V|MRPL10_uc002ily.2_Missense_Mutation_p.I191V	p.I181V	NM_145255	NP_660298	Q7Z7H8	RM10_HUMAN			5	567	-			181					A6NGJ4|Q96B80|Q96Q55	Missense_Mutation	SNP	ENST00000351111.2	37	c.541A>G	CCDS11516.1	.	.	.	.	.	.	.	.	.	.	T	1.236	-0.622693	0.03636	.	.	ENSG00000159111	ENST00000351111;ENST00000290208;ENST00000414011	T;T;T	0.39787	1.06;1.06;1.06	4.98	-0.0382	0.13881	.	0.213670	0.47093	N	0.000249	T	0.24160	0.0585	L	0.35249	1.045	0.40239	D	0.977934	B;B	0.12013	0.005;0.004	B;B	0.12156	0.007;0.007	T	0.33624	-0.9861	10	0.05351	T	0.99	-1.8126	10.3903	0.44164	0.0:0.5232:0.0:0.4768	.	181;191	Q7Z7H8;A6NGJ4	RM10_HUMAN;.	V	181;191;191	ENSP00000324100:I181V;ENSP00000290208:I191V;ENSP00000395870:I191V	ENSP00000290208:I191V	I	-	1	0	MRPL10	43256815	0.047000	0.20315	0.392000	0.26245	0.590000	0.36582	-0.832000	0.04400	-0.315000	0.08703	0.260000	0.18958	ATT		0.537	MRPL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343764.1	NM_145255		23	16	0	0	0	0.00333	0	23	16				
CA10	56934	broad.mit.edu	37	17	49731063	49731063	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:49731063G>A	ENST00000285273.4	-	6	1611	c.500C>T	c.(499-501)aCg>aTg	p.T167M	CA10_ENST00000571918.1_5'UTR|CA10_ENST00000570565.1_Missense_Mutation_p.T92M|CA10_ENST00000340813.6_Missense_Mutation_p.T173M|CA10_ENST00000442502.2_Missense_Mutation_p.T167M|CA10_ENST00000451037.2_Missense_Mutation_p.T167M	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	167					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	TGTGACATTCGTATATAGCTC	0.403																																							uc002itw.3		NA																	0				ovary(1)|skin(1)	2						c.(499-501)ACG>ATG		carbonic anhydrase X							105.0	98.0	101.0					17																	49731063		2203	4300	6503	SO:0001583	missense	56934				brain development			g.chr17:49731063G>A	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.500C>T	17.37:g.49731063G>A	ENSP00000285273:p.Thr167Met					CA10_uc002itu.3_Missense_Mutation_p.T96M|CA10_uc002itv.3_Missense_Mutation_p.T173M|CA10_uc002itx.3_Missense_Mutation_p.T167M|CA10_uc002ity.3_Missense_Mutation_p.T167M|CA10_uc002itz.2_Missense_Mutation_p.T167M	p.T167M	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		5	1486	-			167					B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	c.500C>T	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333007	0.81801	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.55	5.55	0.83447	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	L	0.50333	1.59	0.80722	D	1	D;D;D	0.55385	0.97;0.97;0.971	P;P;P	0.49887	0.625;0.625;0.608	T	0.68198	-0.5472	9	.	.	.	.	18.856	0.92252	0.0:0.0:1.0:0.0	.	167;173;92	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	M	167;167;167;173	ENSP00000390666:T167M;ENSP00000285273:T167M;ENSP00000405388:T167M;ENSP00000340363:T173M	.	T	-	2	0	CA10	47086062	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	9.301000	0.96167	2.753000	0.94483	0.655000	0.94253	ACG		0.403	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178		10	14	0	0	0	0.008291	0	10	14				
INTS2	57508	broad.mit.edu	37	17	59968907	59968907	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:59968907C>A	ENST00000444766.3	-	14	1941	c.1866G>T	c.(1864-1866)caG>caT	p.Q622H	INTS2_ENST00000251334.6_Missense_Mutation_p.Q614H	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	622					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TGAGTATCTCCTGTTCTGTGA	0.333																																							uc002izn.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(1864-1866)CAG>CAT		integrator complex subunit 2							160.0	156.0	157.0					17																	59968907		1851	4091	5942	SO:0001583	missense	57508				snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding	g.chr17:59968907C>A	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.1866G>T	17.37:g.59968907C>A	ENSP00000414237:p.Gln622His					INTS2_uc002izm.2_Missense_Mutation_p.Q614H	p.Q622H	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN			14	1942	-			622					Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	c.1866G>T	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.742988	0.69418	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T;T	0.47177	0.89;0.85	5.3	-1.45	0.08828	.	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	L	0.58101	1.795	0.58432	D	0.999994	D	0.60575	0.988	D	0.74674	0.984	T	0.53927	-0.8369	9	.	.	.	-7.0767	10.3991	0.44218	0.0:0.5768:0.0:0.4232	.	622	Q9H0H0	INT2_HUMAN	H	622;621	ENSP00000414237:Q622H;ENSP00000251334:Q621H	.	Q	-	3	2	INTS2	57323689	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	1.039000	0.30266	-0.141000	0.11374	-0.258000	0.10820	CAG		0.333	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748		41	67	1	0	6.31075e-24	0.00361	1.30925e-23	41	67				
KCNJ16	3773	broad.mit.edu	37	17	68128776	68128776	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr17:68128776G>T	ENST00000589377.1	+	2	711	c.548G>T	c.(547-549)cGt>cTt	p.R183L	KCNJ16_ENST00000392671.1_Missense_Mutation_p.R183L|KCNJ16_ENST00000392670.1_Missense_Mutation_p.R183L|KCNJ16_ENST00000585558.1_Missense_Mutation_p.R218L|KCNJ16_ENST00000283936.1_Missense_Mutation_p.R183L|KCNJ16_ENST00000586462.1_Missense_Mutation_p.R222L	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	183					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					CAAACCATTCGTTTCAGCTAC	0.458																																							uc002jin.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(547-549)CGT>CTT		potassium inwardly-rectifying channel J16							91.0	83.0	86.0					17																	68128776		2203	4300	6503	SO:0001583	missense	3773				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity	g.chr17:68128776G>T	AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.548G>T	17.37:g.68128776G>T	ENSP00000465967:p.Arg183Leu					KCNJ16_uc002jio.2_Missense_Mutation_p.R183L|KCNJ16_uc002jip.2_Missense_Mutation_p.R183L|KCNJ16_uc002jiq.2_Missense_Mutation_p.R215L	p.R183L	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN			5	1034	+	Breast(10;2.96e-09)		183			Cytoplasmic (By similarity).			Missense_Mutation	SNP	ENST00000589377.1	37	c.548G>T	CCDS11687.1	.	.	.	.	.	.	.	.	.	.	G	1.874	-0.459526	0.04508	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.90955	-2.76;-2.76;-2.76	5.54	4.57	0.56435	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.051336	0.85682	D	0.000000	T	0.79149	0.4397	N	0.10760	0.04	0.51233	D	0.99991	B;P	0.39964	0.01;0.697	B;B	0.33890	0.008;0.172	T	0.78568	-0.2154	9	.	.	.	.	15.7236	0.77736	0.0:0.0:0.862:0.138	.	183;183	A8K434;Q9NPI9	.;IRK16_HUMAN	L	183	ENSP00000283936:R183L;ENSP00000376439:R183L;ENSP00000376438:R183L	.	R	+	2	0	KCNJ16	65640371	1.000000	0.71417	0.284000	0.24805	0.003000	0.03518	7.716000	0.84723	1.453000	0.47775	-0.188000	0.12872	CGT		0.458	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450880.1	NM_018658		21	43	1	0	3.8784e-16	0.001882	7.38491e-16	21	43				
ANKRD30B	374860	broad.mit.edu	37	18	14851935	14851935	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr18:14851935A>T	ENST00000358984.4	+	36	3815	c.3635A>T	c.(3634-3636)cAa>cTa	p.Q1212L		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1212										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GCTCCTTTGCAAGGAATAATG	0.383																																							uc010dlo.2		NA																	0				ovary(1)|skin(1)	2						c.(3634-3636)CAA>CTA		ankyrin repeat domain 30B							45.0	34.0	37.0					18																	14851935		692	1590	2282	SO:0001583	missense	374860							g.chr18:14851935A>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3635A>T	18.37:g.14851935A>T	ENSP00000351875:p.Gln1212Leu					ANKRD30B_uc010xal.1_Missense_Mutation_p.Q354L	p.Q1212L	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN			36	3815	+			1297					B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.3635A>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	A	8.714	0.912842	0.17907	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.19394	2.15	1.39	1.39	0.22231	.	.	.	.	.	T	0.36771	0.0979	M	0.79926	2.475	0.80722	D	1	P;P	0.51653	0.947;0.945	P;P	0.56648	0.788;0.803	T	0.26710	-1.0095	9	0.72032	D	0.01	.	6.8687	0.24108	1.0:0.0:0.0:0.0	.	1297;1212	Q9BXX2;F8WAG3	AN30B_HUMAN;.	L	1212;606;632	ENSP00000351875:Q1212L	ENSP00000277669:Q632L	Q	+	2	0	ANKRD30B	14841935	0.990000	0.36364	0.387000	0.26183	0.040000	0.13550	1.758000	0.38410	0.889000	0.36185	0.145000	0.16022	CAA		0.383	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		5	4	0	0	0	0.000602	0	5	4				
DSC3	1825	broad.mit.edu	37	18	28611062	28611062	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr18:28611062C>T	ENST00000360428.4	-	3	311	c.231G>A	c.(229-231)ggG>ggA	p.G77G	DSC3_ENST00000434452.1_Silent_p.G77G	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	77					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TGTACACTGACCCATCATTTA	0.418																																							uc002kwj.3		NA																	0				ovary(2)|skin(2)	4						c.(229-231)GGG>GGA		desmocollin 3 isoform Dsc3a preproprotein							72.0	64.0	67.0					18																	28611062		2203	4300	6503	SO:0001819	synonymous_variant	1825				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding	g.chr18:28611062C>T	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.231G>A	18.37:g.28611062C>T						DSC3_uc002kwi.3_Silent_p.G77G	p.G77G	NM_001941	NP_001932	Q14574	DSC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.125)		3	386	-			77					A6NN35|Q14200|Q9HAZ9	Silent	SNP	ENST00000360428.4	37	c.231G>A	CCDS32810.1																																																																																				0.418	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423		7	18	0	0	0	0.001984	0	7	18				
CCBE1	147372	broad.mit.edu	37	18	57122083	57122083	+	Splice_Site	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr18:57122083C>A	ENST00000439986.4	-	6	691	c.654G>T	c.(652-654)aaG>aaT	p.K218N	CCBE1_ENST00000398179.2_5'UTR	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	218					lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				CGGCACGTACCTTTTGCTTCA	0.507																																					NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)	NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)	uc002lib.2		NA																	0				skin(2)|ovary(1)	3						c.(652-654)AAG>AAT		collagen and calcium binding EGF domains 1							126.0	93.0	104.0					18																	57122083		2203	4300	6503	SO:0001630	splice_region_variant	147372				lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding	g.chr18:57122083C>A	AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.654+1G>T	18.37:g.57122083C>A						CCBE1_uc010dpq.2_5'UTR|CCBE1_uc002lia.2_Missense_Mutation_p.K71N	p.K218N	NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN			6	724	-		Colorectal(73;0.175)	218					Q6MZX5|Q86SS2|Q8TF19	Missense_Mutation	SNP	ENST00000439986.4	37	c.654G>T	CCDS32838.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216658	0.79352	.	.	ENSG00000183287	ENST00000439986	T	0.70045	-0.45	5.48	5.48	0.80851	.	0.088495	0.85682	D	0.000000	T	0.79656	0.4483	L	0.58669	1.825	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.85130	0.987;0.997	T	0.78186	-0.2302	9	.	.	.	-31.9209	18.1378	0.89627	0.0:1.0:0.0:0.0	.	218;27	Q6UXH8;Q6UXH8-3	CCBE1_HUMAN;.	N	218	ENSP00000404464:K218N	.	K	-	3	2	CCBE1	55273063	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	6.142000	0.71750	2.545000	0.85829	0.561000	0.74099	AAG		0.507	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459	Missense_Mutation	22	23	1	0	1.50039e-11	0.001882	2.68525e-11	22	23				
CACTIN	58509	broad.mit.edu	37	19	3611989	3611989	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:3611989G>A	ENST00000429344.2	-	10	2261	c.2209C>T	c.(2209-2211)Cgc>Tgc	p.R737C	CACTIN_ENST00000221899.3_Missense_Mutation_p.R669C|CACTIN_ENST00000248420.5_Missense_Mutation_p.R737C|CACTIN-AS1_ENST00000592274.1_RNA	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	737					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										AACTGGCAGCGGAAGCCGTGG	0.632																																							uc002lyh.2		NA																	0					0						c.(2209-2211)CGC>TGC		chromosome 19 open reading frame 29							60.0	75.0	70.0					19																	3611989		2035	4172	6207	SO:0001583	missense	58509					catalytic step 2 spliceosome	protein binding	g.chr19:3611989G>A	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.2209C>T	19.37:g.3611989G>A	ENSP00000415078:p.Arg737Cys					C19orf29_uc010xho.1_Missense_Mutation_p.R196C|C19orf29_uc010dtn.2_Missense_Mutation_p.R585C|C19orf29_uc002lyi.3_Missense_Mutation_p.R737C|C19orf29_uc010dto.2_RNA	p.R737C	NM_001080543	NP_001074012	Q8WUQ7	CS029_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	10	2262	-		Hepatocellular(1079;0.137)	737					A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	c.2209C>T	CCDS45920.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419979	0.83559	.	.	ENSG00000105298	ENST00000429344;ENST00000248420;ENST00000221899	.	.	.	4.31	3.25	0.37280	Cactin protein, cactus-binding domain, C-terminal (1);	0.116143	0.64402	D	0.000012	T	0.73682	0.3618	M	0.65677	2.01	0.80722	D	1	D;D	0.71674	0.993;0.998	D;P	0.62955	0.909;0.833	T	0.77427	-0.2592	9	0.87932	D	0	.	13.2204	0.59883	0.0:0.1616:0.8384:0.0	.	737;737	Q8WUQ7-2;Q8WUQ7	.;CS029_HUMAN	C	737;737;669	.	ENSP00000221899:R669C	R	-	1	0	C19orf29	3562989	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.953000	0.93041	1.146000	0.42352	-0.189000	0.12847	CGC		0.632	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2			5	55	0	0	0	0.000602	0	5	55				
C3	718	broad.mit.edu	37	19	6696469	6696469	+	Silent	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:6696469C>A	ENST00000245907.6	-	23	2963	c.2871G>T	c.(2869-2871)gtG>gtT	p.V957V		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	957					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CCTCTTTCTGCACTCCTTCTG	0.572																																							uc002mfm.2		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(2869-2871)GTG>GTT		complement component 3 precursor							167.0	124.0	139.0					19																	6696469		2203	4300	6503	SO:0001819	synonymous_variant	718				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding	g.chr19:6696469C>A	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2871G>T	19.37:g.6696469C>A							p.V957V	NM_000064	NP_000055	P01024	CO3_HUMAN		GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	23	2933	-			957					A7E236	Silent	SNP	ENST00000245907.6	37	c.2871G>T	CCDS32883.1																																																																																				0.572	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064		13	16	1	0	1.5842e-08	0.001855	2.56051e-08	13	16				
FBN3	84467	broad.mit.edu	37	19	8196582	8196582	+	Missense_Mutation	SNP	C	C	A	rs201825940		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:8196582C>A	ENST00000600128.1	-	15	2260	c.1846G>T	c.(1846-1848)Gtg>Ttg	p.V616L	FBN3_ENST00000601739.1_Missense_Mutation_p.V616L|FBN3_ENST00000270509.2_Missense_Mutation_p.V616L			Q75N90	FBN3_HUMAN	fibrillin 3	616						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GTGCTGCGCACGTGGGTGTCC	0.677																																							uc002mjf.2		NA																	0				ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						c.(1846-1848)GTG>TTG		fibrillin 3 precursor							45.0	43.0	44.0					19																	8196582		2203	4300	6503	SO:0001583	missense	84467					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr19:8196582C>A		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.1846G>T	19.37:g.8196582C>A	ENSP00000470498:p.Val616Leu						p.V616L	NM_032447	NP_115823	Q75N90	FBN3_HUMAN			14	1867	-			616					Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	c.1846G>T	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	c	8.325	0.825220	0.16749	.	.	ENSG00000142449	ENST00000270509	D	0.87029	-2.2	3.02	-1.2	0.09554	Matrix fibril-associated (2);	0.159714	0.56097	U	0.000040	T	0.72716	0.3495	N	0.20986	0.625	0.25870	N	0.983729	B	0.17852	0.024	B	0.19946	0.027	T	0.56829	-0.7914	10	0.17832	T	0.49	.	7.4429	0.27194	0.0:0.3534:0.0:0.6466	.	616	Q75N90	FBN3_HUMAN	L	616	ENSP00000270509:V616L	ENSP00000270509:V616L	V	-	1	0	FBN3	8102582	0.998000	0.40836	0.752000	0.31206	0.049000	0.14656	0.491000	0.22419	-0.130000	0.11599	0.185000	0.17295	GTG		0.677	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447		10	19	1	0	0.000673444	0.008291	0.000951953	10	19				
FBXL12	54850	broad.mit.edu	37	19	9921644	9921644	+	Silent	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:9921644C>A	ENST00000247977.4	-	3	1150	c.909G>T	c.(907-909)ctG>ctT	p.L303L	FBXL12_ENST00000586651.1_3'UTR|FBXL12_ENST00000591009.1_Silent_p.L250L|FBXL12_ENST00000589626.1_3'UTR|FBXL12_ENST00000585379.1_Silent_p.L250L|FBXL12_ENST00000588922.1_3'UTR	NM_017703.1	NP_060173.1	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12	303					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)				endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(2)	10						GCCCCTTACACAGGATCTTCT	0.597																																							uc002mme.2		NA																	0				lung(1)|kidney(1)	2						c.(907-909)CTG>CTT		F-box and leucine-rich repeat protein 12							50.0	47.0	48.0					19																	9921644		2203	4300	6503	SO:0001819	synonymous_variant	54850						protein binding	g.chr19:9921644C>A	AK000195	CCDS12218.1	19p13.2	2011-06-09				ENSG00000127452		"""F-boxes / Leucine-rich repeats"""	13611	protein-coding gene	gene with protein product		609079				10531037	Standard	XM_005259964		Approved	FLJ20188, Fbl12	uc002mme.3	Q9NXK8		ENST00000247977.4:c.909G>T	19.37:g.9921644C>A						FBXL12_uc002mmd.2_Silent_p.L250L|FBXL12_uc002mmf.2_Silent_p.L250L|FBXL12_uc002mmg.2_Silent_p.L250L|FBXL12_uc002mmh.2_Silent_p.L250L	p.L303L	NM_017703	NP_060173	Q9NXK8	FXL12_HUMAN			3	1151	-			303					B3KSJ8|Q9H5K4	Silent	SNP	ENST00000247977.4	37	c.909G>T	CCDS12218.1																																																																																				0.597	FBXL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450265.1	NM_017703		16	14	1	0	1.99824e-07	0.00499	3.12084e-07	16	14				
COL5A3	50509	broad.mit.edu	37	19	10107298	10107298	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:10107298A>G	ENST00000264828.3	-	12	1416	c.1331T>C	c.(1330-1332)aTg>aCg	p.M444T	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	444	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TACCGGCATCATGATCACAGT	0.627																																							uc002mmq.1		NA																	0				ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10						c.(1330-1332)ATG>ACG		collagen, type V, alpha 3 preproprotein							55.0	54.0	54.0					19																	10107298		2203	4300	6503	SO:0001583	missense	50509				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent	g.chr19:10107298A>G	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1331T>C	19.37:g.10107298A>G	ENSP00000264828:p.Met444Thr						p.M444T	NM_015719	NP_056534	P25940	CO5A3_HUMAN	Epithelial(33;7.11e-05)		12	1417	-			444			Triple-helical region.		Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	c.1331T>C	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	A	15.03	2.712646	0.48517	.	.	ENSG00000080573	ENST00000264828	D	0.89746	-2.56	5.12	5.12	0.69794	.	0.059938	0.64402	U	0.000004	D	0.83271	0.5218	M	0.64997	1.995	0.47308	D	0.999388	P	0.35433	0.501	B	0.25140	0.058	T	0.80016	-0.1559	10	0.13108	T	0.6	.	11.355	0.49611	1.0:0.0:0.0:0.0	.	444	P25940	CO5A3_HUMAN	T	444	ENSP00000264828:M444T	ENSP00000264828:M444T	M	-	2	0	COL5A3	9968298	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.529000	0.81952	1.950000	0.56595	0.533000	0.62120	ATG		0.627	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		19	33	0	0	0	0.007413	0	19	33				
P2RY11	5032	broad.mit.edu	37	19	10224379	10224379	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:10224379C>T	ENST00000321826.4	+	2	274	c.90C>T	c.(88-90)ttC>ttT	p.F30F	PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.S471F|PPAN_ENST00000556468.1_Silent_p.F450F|PPAN-P2RY11_ENST00000393796.4_Silent_p.F450F|P2RY11_ENST00000471843.1_3'UTR	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	30					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			AGGGGGACTTCCTGTGGCCCA	0.637											OREG0025230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002mna.2		NA																	0				ovary(2)	2						c.(1348-1350)TTC>TTT		PPAN-P2RY11 protein							66.0	67.0	67.0					19																	10224379		2203	4300	6503	SO:0001819	synonymous_variant	692312				RNA splicing	nucleolus	protein binding	g.chr19:10224379C>T	AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.90C>T	19.37:g.10224379C>T			OREG0025230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	663	PPAN-P2RY11_uc010xla.1_Missense_Mutation_p.S471F|P2RY11_uc002mnc.2_Silent_p.F30F	p.F450F	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)		13	1350	+			Error:Variant_position_missing_in_Q9NQ55_after_alignment					B2R8X9|O43190|Q9BYU4|Q9H170	Silent	SNP	ENST00000321826.4	37	c.1350C>T	CCDS12226.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683699	0.47991	.	.	ENSG00000243207	ENST00000428358	T	0.34859	1.34	4.29	-1.02	0.10135	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10894	-1.0610	7	.	.	.	-6.8693	10.2187	0.43184	0.0:0.7282:0.0:0.2718	.	471	C9J3F9	.	F	471	ENSP00000411918:S471F	.	S	+	2	0	PPAN-P2RY11	10085379	0.006000	0.16342	0.992000	0.48379	0.446000	0.32137	-0.489000	0.06490	-0.021000	0.14009	0.561000	0.74099	TCC		0.637	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316664.2	NM_002566		19	18	0	0	0	0.007413	0	19	18				
KEAP1	9817	broad.mit.edu	37	19	10600474	10600474	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:10600474T>C	ENST00000171111.5	-	4	1928	c.1381A>G	c.(1381-1383)Atc>Gtc	p.I461V	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.I461V|CTC-429L19.3_ENST00000592671.1_RNA	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	461					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CCCACCCCGATCCTTCGTGTC	0.552																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1381-1383)ATC>GTC		kelch-like ECH-associated protein 1							62.0	52.0	55.0					19																	10600474		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600474T>C	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1381A>G	19.37:g.10600474T>C	ENSP00000171111:p.Ile461Val					KEAP1_uc002mop.1_Missense_Mutation_p.I179V|KEAP1_uc002mor.1_Missense_Mutation_p.I461V	p.I461V	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1537	-			461			Kelch 3.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.1381A>G	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.981953	0.74474	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.76578	-1.03;-1.03	5.79	5.79	0.91817	Kelch-type beta propeller (1);	0.054912	0.64402	D	0.000001	T	0.69504	0.3118	N	0.17901	0.54	0.43814	D	0.996375	P	0.41947	0.766	P	0.47528	0.549	T	0.65923	-0.6050	10	0.10902	T	0.67	.	14.1257	0.65219	0.0:0.0:0.0:1.0	.	461	Q14145	KEAP1_HUMAN	V	461	ENSP00000171111:I461V;ENSP00000377245:I461V	ENSP00000171111:I461V	I	-	1	0	KEAP1	10461474	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.841000	0.62824	2.221000	0.72209	0.456000	0.33151	ATC		0.552	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		12	15	0	0	0	0.001368	0	12	15				
ZNF700	90592	broad.mit.edu	37	19	12061049	12061049	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:12061049G>A	ENST00000254321.5	+	4	2353	c.2210G>A	c.(2209-2211)tGt>tAt	p.C737Y	ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000538752.1_Intron|ZNF763_ENST00000591944.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF700_ENST00000482090.1_Missense_Mutation_p.C719Y	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	737					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TGTAAGGATTGTGGGAAAGCA	0.398																																							uc002msu.2		NA																	0					0						c.(2209-2211)TGT>TAT		zinc finger protein 700							52.0	48.0	49.0					19																	12061049		2203	4300	6503	SO:0001583	missense	90592				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12061049G>A	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.2210G>A	19.37:g.12061049G>A	ENSP00000254321:p.Cys737Tyr					ZNF700_uc010xme.1_Missense_Mutation_p.C755Y|ZNF763_uc010xmf.1_Intron	p.C737Y	NM_144566	NP_653167	Q9H0M5	ZN700_HUMAN			4	2336	+			737					B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	37	c.2210G>A	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	g	12.39	1.924816	0.34002	.	.	ENSG00000196757	ENST00000254321	D	0.85861	-2.04	0.832	-0.444	0.12245	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93106	0.7805	H	0.95470	3.675	0.30111	N	0.806546	D	0.89917	1.0	D	0.87578	0.998	D	0.86739	0.1953	9	0.66056	D	0.02	.	7.6173	0.28165	0.0:0.2692:0.7307:0.0	.	737	Q9H0M5	ZN700_HUMAN	Y	737	ENSP00000254321:C737Y	ENSP00000254321:C737Y	C	+	2	0	ZNF700	11922049	0.998000	0.40836	0.001000	0.08648	0.016000	0.09150	3.495000	0.53280	-0.107000	0.12088	0.313000	0.20887	TGT		0.398	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566		11	19	0	0	0	0.001855	0	11	19				
ZNF44	51710	broad.mit.edu	37	19	12383799	12383799	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:12383799T>C	ENST00000356109.5	-	5	1533	c.1415A>G	c.(1414-1416)aAg>aGg	p.K472R	ZNF44_ENST00000355684.5_Missense_Mutation_p.K424R	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	472					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		CCCACATTGCTTGCATTCATA	0.423																																							uc010xmj.1		NA																	0				ovary(1)	1						c.(1414-1416)AAG>AGG		zinc finger protein 44 isoform 1							57.0	59.0	58.0					19																	12383799		2203	4300	6503	SO:0001583	missense	51710				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding	g.chr19:12383799T>C	X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.1415A>G	19.37:g.12383799T>C	ENSP00000348419:p.Lys472Arg					ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_RNA|ZNF44_uc002mtn.3_RNA|ZNF44_uc010dys.2_Missense_Mutation_p.K424R	p.K472R	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)	5	1620	-		Renal(1328;0.157)	472			C2H2-type 11.		B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	ENST00000356109.5	37	c.1415A>G	CCDS54223.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.982829	0.53827	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.03831	3.79;3.79;3.79	1.1	-0.0443	0.13855	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10937	0.0267	L	0.41632	1.29	.	.	.	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.19321	-1.0309	8	0.62326	D	0.03	.	6.3868	0.21566	0.0:0.0:0.4957:0.5042	.	472;424	P15621;F8W7T7	ZNF44_HUMAN;.	R	472;472;424;424	ENSP00000377008:K472R;ENSP00000348419:K472R;ENSP00000347910:K424R	ENSP00000347910:K424R	K	-	2	0	ZNF44	12244799	0.000000	0.05858	0.044000	0.18714	0.835000	0.47333	-2.333000	0.01108	-0.060000	0.13132	0.254000	0.18369	AAG		0.423	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344132.1	NM_016264		27	32	0	0	0	0.00632	0	27	32				
NCAN	1463	broad.mit.edu	37	19	19356128	19356128	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:19356128G>A	ENST00000252575.6	+	13	3598	c.3499G>A	c.(3499-3501)Gag>Aag	p.E1167K	NCAN_ENST00000538881.1_Missense_Mutation_p.E618K	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1167	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	GCAGCAATTTGAGAACTGGCG	0.607																																							uc002nlz.2		NA																	0				ovary(4)	4						c.(3499-3501)GAG>AAG		chondroitin sulfate proteoglycan 3 precursor							83.0	72.0	76.0					19																	19356128		2203	4300	6503	SO:0001583	missense	1463				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr19:19356128G>A	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3499G>A	19.37:g.19356128G>A	ENSP00000252575:p.Glu1167Lys					NCAN_uc002nma.2_Intron	p.E1167K	NM_004386	NP_004377	O14594	NCAN_HUMAN	Epithelial(12;0.00544)		13	3598	+			1167			C-type lectin.		Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	c.3499G>A	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.367758	0.82463	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.17691	2.26;2.26	4.62	4.62	0.57501	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.36303	N	0.002670	T	0.28400	0.0702	N	0.25286	0.73	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.06391	-1.0829	10	0.72032	D	0.01	.	14.9994	0.71459	0.0:0.0:1.0:0.0	.	1167	O14594	NCAN_HUMAN	K	1181;1167;618	ENSP00000252575:E1167K;ENSP00000442202:E618K	ENSP00000252575:E1167K	E	+	1	0	NCAN	19217128	1.000000	0.71417	0.986000	0.45419	0.477000	0.33069	7.595000	0.82710	2.383000	0.81215	0.453000	0.30009	GAG		0.607	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386		17	18	0	0	0	0.006122	0	17	18				
ZNF257	113835	broad.mit.edu	37	19	22271945	22271945	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:22271945G>T	ENST00000594947.1	+	4	1537	c.1393G>T	c.(1393-1395)Ggc>Tgc	p.G465C		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G465C(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGAAGAGTGTGGCAAAGCCTT	0.403																																							uc010ecx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1393-1395)GGC>TGC		zinc finger protein 257							43.0	49.0	47.0					19																	22271945		2135	4259	6394	SO:0001583	missense	113835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22271945G>T	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.1393G>T	19.37:g.22271945G>T	ENSP00000470209:p.Gly465Cys					ZNF257_uc010ecy.2_Missense_Mutation_p.G433C	p.G465C	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN			4	1562	+		all_lung(12;0.0961)|Lung NSC(12;0.103)	465			C2H2-type 11.		B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	37	c.1393G>T	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075783	0.36662	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75162	0.3812	H	0.97983	4.12	0.26130	N	0.980432	D	0.57571	0.98	P	0.54499	0.754	T	0.67389	-0.5683	8	0.87932	D	0	.	9.0461	0.36347	0.0:0.0:1.0:0.0	.	465	Q9Y2Q1	ZN257_HUMAN	C	465;437	.	ENSP00000380312:G437C	G	+	1	0	ZNF257	22063785	1.000000	0.71417	0.030000	0.17652	0.011000	0.07611	1.714000	0.37961	0.518000	0.28383	0.313000	0.20887	GGC		0.403	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1			11	27	1	0	4.68919e-08	0.008291	7.43495e-08	11	27				
ZNF99	7652	broad.mit.edu	37	19	22952782	22952782	+	Intron	SNP	C	C	G	rs372011582		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:22952782C>G	ENST00000596209.1	-	2	94				ZNF99_ENST00000397104.3_Start_Codon_SNP_p.M1I	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ACCAAAAAGACATGTTGAGTT	0.274																																							uc010xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(1-3)ATG>ATC		zinc finger protein 99							67.0	67.0	67.0					19																	22952782		1815	4061	5876	SO:0001627	intron_variant	7652							g.chr19:22952782C>G	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.4-656G>C	19.37:g.22952782C>G							p.M1I	NM_001080409	NP_001073878					1	3	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.3G>C	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	c	6.022	0.372418	0.11409	.	.	ENSG00000213973	ENST00000397104	T	0.05319	3.46	0.625	0.625	0.17665	.	.	.	.	.	T	0.04497	0.0123	.	.	.	0.80722	D	1	B	0.31931	0.347	B	0.18561	0.022	T	0.47222	-0.9134	7	0.39692	T	0.17	.	.	.	.	.	1	A8MXY4	ZNF99_HUMAN	I	1	ENSP00000380293:M1I	ENSP00000380293:M1I	M	-	3	0	ZNF99	22744622	0.008000	0.16893	0.016000	0.15963	0.070000	0.16714	0.416000	0.21198	0.624000	0.30286	0.479000	0.44913	ATG		0.274	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		7	16	0	0	0	0.00308	0	7	16				
KCNK6	9424	broad.mit.edu	37	19	38817582	38817582	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:38817582G>T	ENST00000263372.3	+	2	779	c.672G>T	c.(670-672)gaG>gaT	p.E224D		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	224					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	TGCCCGGGGAGGCCCCTGGCC	0.637																																							uc002oic.2		NA																	0				ovary(1)	1						c.(670-672)GAG>GAT		potassium channel, subfamily K, member 6	Ibutilide(DB00308)|Quinidine(DB00908)						81.0	86.0	84.0					19																	38817582		2203	4300	6503	SO:0001583	missense	9424					voltage-gated potassium channel complex	inward rectifier potassium channel activity	g.chr19:38817582G>T	AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.672G>T	19.37:g.38817582G>T	ENSP00000263372:p.Glu224Asp					KCNK6_uc002oid.2_Missense_Mutation_p.E90D	p.E224D	NM_004823	NP_004814	Q9Y257	KCNK6_HUMAN	Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		2	782	+	all_cancers(60;5.83e-07)		224					Q9HB47	Missense_Mutation	SNP	ENST00000263372.3	37	c.672G>T	CCDS12513.1	.	.	.	.	.	.	.	.	.	.	G	9.337	1.061994	0.19987	.	.	ENSG00000099337	ENST00000263372	T	0.23348	1.91	5.36	0.252	0.15545	Ion transport 2 (1);	0.123897	0.53938	D	0.000043	T	0.18467	0.0443	L	0.33339	1.005	0.38515	D	0.948579	P	0.37370	0.592	B	0.40329	0.326	T	0.08411	-1.0723	10	0.25751	T	0.34	.	9.6081	0.39645	0.3659:0.0:0.6341:0.0	.	224	Q9Y257	KCNK6_HUMAN	D	224	ENSP00000263372:E224D	ENSP00000263372:E224D	E	+	3	2	KCNK6	43509422	0.993000	0.37304	0.995000	0.50966	0.053000	0.15095	0.288000	0.18939	0.255000	0.21593	-0.327000	0.08410	GAG		0.637	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460524.1	NM_004823		43	58	1	0	1.02591e-13	0.002522	1.89293e-13	43	58				
AKT2	208	broad.mit.edu	37	19	40748459	40748459	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:40748459G>A	ENST00000392038.2	-	5	721	c.423C>T	c.(421-423)agC>agT	p.S141S	AKT2_ENST00000311278.6_Silent_p.S141S|AKT2_ENST00000424901.1_Silent_p.S141S|AKT2_ENST00000579047.1_Silent_p.S79S	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	141					activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CCCGTGCCTTGCTGACCGCCA	0.647			A		"""ovarian, pancreatic """																																		uc002onf.2		NA		Dom	yes		19	19q13.1-q13.2	208	A	v-akt murine thymoma viral oncogene homolog 2			E			ovarian|pancreatic 		0				lung(2)	2						c.(421-423)AGC>AGT		AKT2 kinase							92.0	88.0	89.0					19																	40748459		2203	4300	6503	SO:0001819	synonymous_variant	208				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr19:40748459G>A	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.423C>T	19.37:g.40748459G>A						AKT2_uc010egs.2_Silent_p.S141S|AKT2_uc010egt.2_Silent_p.S79S|AKT2_uc010xvj.1_Silent_p.S79S|AKT2_uc010egu.1_Silent_p.S79S|AKT2_uc010xvk.1_Silent_p.S141S|AKT2_uc002one.2_Silent_p.S37S	p.S141S	NM_001626	NP_001617	P31751	AKT2_HUMAN	Lung(22;0.000499)		5	685	-			141					B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Silent	SNP	ENST00000392038.2	37	c.423C>T	CCDS12552.1																																																																																				0.647	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626		56	73	0	0	0	0.00361	0	56	73				
PLD3	23646	broad.mit.edu	37	19	40884020	40884020	+	Silent	SNP	T	T	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:40884020T>G	ENST00000409587.1	+	13	1810	c.1413T>G	c.(1411-1413)ccT>ccG	p.P471P	PLD3_ENST00000409735.4_Silent_p.P471P|PLD3_ENST00000409281.1_Silent_p.P471P|PLD3_ENST00000409419.1_Silent_p.P471P|PLD3_ENST00000356508.5_Silent_p.P471P			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	471					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			GGGACTCCCCTTACAGCCATG	0.682																																							uc002onm.3		NA																	0				skin(2)|ovary(1)	3						c.(1411-1413)CCT>CCG		phospholipase D3							101.0	99.0	100.0					19																	40884020		2203	4300	6503	SO:0001819	synonymous_variant	23646				lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding	g.chr19:40884020T>G	BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.1413T>G	19.37:g.40884020T>G						PLD3_uc002onj.3_Silent_p.P471P|PLD3_uc002onk.3_Silent_p.P471P|PLD3_uc002onl.3_Silent_p.P471P|PLD3_uc002onn.2_Silent_p.P471P	p.P471P	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)		13	1811	+			471			Lumenal (Potential).		Q92853|Q9BW87	Silent	SNP	ENST00000409587.1	37	c.1413T>G	CCDS33027.1																																																																																				0.682	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327721.1	NM_012268		58	68	0	0	0	0.00361	0	58	68				
ZNF480	147657	broad.mit.edu	37	19	52825717	52825717	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:52825717G>T	ENST00000595962.1	+	5	1280	c.1214G>T	c.(1213-1215)gGa>gTa	p.G405V	CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000335090.6_Missense_Mutation_p.G328V|ZNF480_ENST00000490272.1_3'UTR|ZNF480_ENST00000334564.7_Missense_Mutation_p.G362V	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		AATGAATGTGGAAAAGTATTT	0.338																																							uc010ydl.1		NA																	0				large_intestine(1)	1						c.(1213-1215)GGA>GTA		zinc finger protein 480							70.0	75.0	73.0					19																	52825717		2203	4300	6503	SO:0001583	missense	147657				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr19:52825717G>T	AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.1214G>T	19.37:g.52825717G>T	ENSP00000471754:p.Gly405Val					ZNF480_uc002pyv.2_Missense_Mutation_p.G328V|ZNF480_uc010ydm.1_Missense_Mutation_p.G362V|ZNF480_uc010epn.2_Missense_Mutation_p.G236V|uc002pyw.1_Intron	p.G405V	NM_144684	NP_653285	Q8WV37	ZN480_HUMAN		GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)	5	1284	+			405			C2H2-type 8.		Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	ENST00000595962.1	37	c.1214G>T	CCDS12850.2	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448988	0.43531	.	.	ENSG00000198464	ENST00000468240;ENST00000334564;ENST00000335090	T;T;T	0.07444	3.19;3.19;3.19	2.21	2.21	0.28008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33352	0.0860	M	0.93420	3.415	0.40977	D	0.984744	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.944	T	0.29671	-1.0004	9	0.66056	D	0.02	.	8.254	0.31743	0.0:0.2483:0.7517:0.0	.	362;405	F8WEZ9;Q8WV37	.;ZN480_HUMAN	V	405;362;328	ENSP00000417424:G405V;ENSP00000334164:G362V;ENSP00000335670:G328V	ENSP00000334164:G362V	G	+	2	0	ZNF480	57517529	0.343000	0.24818	0.001000	0.08648	0.138000	0.21146	0.527000	0.22987	1.225000	0.43566	0.461000	0.40582	GGA		0.338	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349001.3	NM_144684		15	55	1	0	6.31663e-08	0.003163	9.93975e-08	15	55				
ZNF813	126017	broad.mit.edu	37	19	53989948	53989948	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:53989948C>G	ENST00000396403.4	+	3	206	c.78C>G	c.(76-78)gaC>gaG	p.D26E	ZNF813_ENST00000396421.4_Missense_Mutation_p.D26E	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	26	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		AATGCCTGGACCCTGCTCAGA	0.478																																							uc002qbu.2		NA																	0				large_intestine(1)	1						c.(76-78)GAC>GAG		zinc finger protein 813							59.0	65.0	63.0					19																	53989948		2193	4260	6453	SO:0001583	missense	126017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53989948C>G	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.78C>G	19.37:g.53989948C>G	ENSP00000379684:p.Asp26Glu					ZNF813_uc010eqq.1_RNA	p.D26E	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN		GBM - Glioblastoma multiforme(134;0.00619)	3	206	+			26			KRAB.			Missense_Mutation	SNP	ENST00000396403.4	37	c.78C>G	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825734	0.32237	.	.	ENSG00000198346	ENST00000396403;ENST00000490956;ENST00000396421	T;T;T	0.02606	4.23;4.23;4.23	1.05	1.05	0.20165	Krueppel-associated box (4);	.	.	.	.	T	0.07773	0.0195	M	0.85462	2.755	0.09310	N	0.999998	P	0.38473	0.633	P	0.46208	0.507	T	0.18053	-1.0349	9	0.49607	T	0.09	.	3.4979	0.07662	0.0:0.7129:0.0:0.2871	.	26	Q6ZN06	ZN813_HUMAN	E	26	ENSP00000379684:D26E;ENSP00000418289:D26E;ENSP00000379699:D26E	ENSP00000379684:D26E	D	+	3	2	ZNF813	58681760	0.000000	0.05858	0.978000	0.43139	0.873000	0.50193	-1.036000	0.03560	0.549000	0.28973	0.388000	0.25769	GAC		0.478	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301		46	95	0	0	0	0.00361	0	46	95				
NLRP12	91662	broad.mit.edu	37	19	54299200	54299200	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:54299200T>A	ENST00000324134.6	-	9	3179	c.3011A>T	c.(3010-3012)tAc>tTc	p.Y1004F	NLRP12_ENST00000351894.4_Missense_Mutation_p.Y892F|NLRP12_ENST00000354278.3_Intron|NLRP12_ENST00000391773.1_Missense_Mutation_p.Y1005F|NLRP12_ENST00000391775.3_Missense_Mutation_p.Y947F|NLRP12_ENST00000535162.1_Intron|NLRP12_ENST00000391772.1_Intron|NLRP12_ENST00000345770.5_Intron	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	1004					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GTTGGTCAGGTAAAGGTCGGT	0.557																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(3010-3012)TAC>TTC		NLR family, pyrin domain containing 12 isoform							137.0	102.0	114.0					19																	54299200		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54299200T>A	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.3011A>T	19.37:g.54299200T>A	ENSP00000319377:p.Tyr1004Phe					NLRP12_uc010eqw.2_Missense_Mutation_p.Y230F|NLRP12_uc002qci.3_Missense_Mutation_p.Y947F|NLRP12_uc002qcj.3_Missense_Mutation_p.Y1005F|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Intron	p.Y1004F	NM_144687	NP_653288	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	9	3231	-	Ovarian(34;0.19)		1004			LRR 7.		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.3011A>T	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	T	9.832	1.188605	0.21954	.	.	ENSG00000142405	ENST00000324134;ENST00000351894;ENST00000358661;ENST00000391775;ENST00000391773	T;T;T;T	0.53423	0.62;0.63;0.63;0.62	4.15	4.15	0.48705	.	0.000000	0.31612	U	0.007347	T	0.57242	0.2040	L	0.44542	1.39	0.20638	N	0.999877	P;D;D;P	0.76494	0.643;0.979;0.999;0.822	B;P;D;P	0.81914	0.245;0.89;0.995;0.535	T	0.47394	-0.9121	10	0.72032	D	0.01	.	9.8159	0.40851	0.0:0.0:0.0:1.0	.	230;1004;947;1004	P59046-5;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	F	1004;892;230;947;1005	ENSP00000319377:Y1004F;ENSP00000340473:Y892F;ENSP00000375655:Y947F;ENSP00000375653:Y1005F	ENSP00000319377:Y1004F	Y	-	2	0	NLRP12	58991012	0.325000	0.24660	0.165000	0.22776	0.027000	0.11550	1.556000	0.36288	1.899000	0.54978	0.363000	0.22086	TAC		0.557	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		20	19	0	0	0	0.008871	0	20	19				
NLRP4	147945	broad.mit.edu	37	19	56373374	56373374	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr19:56373374T>G	ENST00000301295.6	+	5	2457	c.2035T>G	c.(2035-2037)Ttt>Gtt	p.F679V	NLRP4_ENST00000346986.5_Missense_Mutation_p.F679V|NLRP4_ENST00000587891.1_Missense_Mutation_p.F604V	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	679					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TAACGTTTCCTTTTCTGGCCA	0.428																																							uc002qmd.3		NA																	0				ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(2035-2037)TTT>GTT		NLR family, pyrin domain containing 4							142.0	141.0	141.0					19																	56373374		2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56373374T>G	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2035T>G	19.37:g.56373374T>G	ENSP00000301295:p.Phe679Val					NLRP4_uc002qmf.2_Missense_Mutation_p.F604V|NLRP4_uc010etf.2_Missense_Mutation_p.F510V	p.F679V	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	5	2457	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	679					Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.2035T>G	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.328257	0.41197	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.50548	0.74;0.74	3.11	-1.73	0.08081	.	.	.	.	.	T	0.42877	0.1222	L	0.37750	1.13	0.09310	N	1	B;D;D	0.69078	0.34;0.997;0.994	B;D;P	0.64776	0.171;0.929;0.851	T	0.34204	-0.9838	9	0.13853	T	0.58	.	0.3136	0.00292	0.1918:0.242:0.1972:0.3691	.	679;604;679	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	V	679	ENSP00000301295:F679V;ENSP00000344787:F679V	ENSP00000301295:F679V	F	+	1	0	NLRP4	61065186	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-0.293000	0.08320	-0.503000	0.06586	0.460000	0.39030	TTT		0.428	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		23	45	0	0	0	0.003954	0	23	45				
MTA3	57504	broad.mit.edu	37	2	42909573	42909573	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:42909573C>T	ENST00000405094.1	+	9	735	c.735C>T	c.(733-735)agC>agT	p.S245S	MTA3_ENST00000406911.1_Silent_p.S245S|MTA3_ENST00000407270.3_Silent_p.S245S|MTA3_ENST00000405592.1_Silent_p.S189S|MTA3_ENST00000406652.1_Silent_p.S189S			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	245	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.					intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						ATAGACACAGCTATGATTTGA	0.373																																							uc002rso.1		NA																	0				ovary(2)	2						c.(565-567)AGC>AGT		metastasis associated 1 family, member 3							111.0	102.0	105.0					2																	42909573		1886	4111	5997	SO:0001819	synonymous_variant	57504					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:42909573C>T	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.735C>T	2.37:g.42909573C>T						MTA3_uc002rsp.1_Silent_p.S189S|MTA3_uc002rsq.2_Silent_p.S245S|MTA3_uc002rsr.2_Silent_p.S245S	p.S189S	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN			10	1237	+			245			ELM2.		Q9NSP2|Q9ULF4	Silent	SNP	ENST00000405094.1	37	c.567C>T																																																																																					0.373	MTA3-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318159.1	NM_020744		5	10	0	0	0	0.000602	0	5	10				
RAB11FIP5	26056	broad.mit.edu	37	2	73316265	73316265	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:73316265C>T	ENST00000258098.6	-	2	850	c.610G>A	c.(610-612)Gat>Aat	p.D204N	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	204					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						GATTCCAGATCATACTTCTTC	0.542																																							uc002siu.3		NA																	0					0						c.(610-612)GAT>AAT		RAB11 family interacting protein 5 (class I)							206.0	199.0	201.0					2																	73316265		2203	4300	6503	SO:0001583	missense	26056				protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding	g.chr2:73316265C>T	AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.610G>A	2.37:g.73316265C>T	ENSP00000258098:p.Asp204Asn					RAB11FIP5_uc002sit.3_Missense_Mutation_p.D126N	p.D204N	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN			2	851	-			204					O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	37	c.610G>A	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221080	0.58560	.	.	ENSG00000135631	ENST00000258098	T	0.51071	0.72	4.6	4.6	0.57074	.	0.194034	0.42294	D	0.000733	T	0.41328	0.1154	L	0.29908	0.895	0.58432	D	0.999999	P;P	0.47106	0.89;0.7	P;B	0.44990	0.466;0.322	T	0.16541	-1.0399	10	0.27082	T	0.32	-8.3257	16.5264	0.84332	0.0:1.0:0.0:0.0	.	204;204	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	N	204	ENSP00000258098:D204N	ENSP00000258098:D204N	D	-	1	0	RAB11FIP5	73169773	0.997000	0.39634	0.174000	0.22961	0.932000	0.56968	3.638000	0.54332	2.570000	0.86706	0.561000	0.74099	GAT		0.542	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470		20	118	0	0	0	0.008871	0	20	118				
RAB11FIP5	26056	broad.mit.edu	37	2	73316441	73316441	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:73316441C>T	ENST00000258098.6	-	2	674	c.434G>A	c.(433-435)tGg>tAg	p.W145*	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	145					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						CAGCTTGTACCACCTGTGAGA	0.607																																							uc002siu.3		NA																	0					0						c.(433-435)TGG>TAG		RAB11 family interacting protein 5 (class I)							190.0	179.0	183.0					2																	73316441		2203	4300	6503	SO:0001587	stop_gained	26056				protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding	g.chr2:73316441C>T	AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.434G>A	2.37:g.73316441C>T	ENSP00000258098:p.Trp145*					RAB11FIP5_uc002sit.3_Nonsense_Mutation_p.W67*	p.W145*	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN			2	675	-			145					O94939|Q9P0M1	Nonsense_Mutation	SNP	ENST00000258098.6	37	c.434G>A	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	C	38	6.742287	0.97805	.	.	ENSG00000135631	ENST00000258098	.	.	.	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2384	16.5264	0.84332	0.0:1.0:0.0:0.0	.	.	.	.	X	145	.	ENSP00000258098:W145X	W	-	2	0	RAB11FIP5	73169949	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.627000	0.83176	2.570000	0.86706	0.561000	0.74099	TGG		0.607	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470		27	150	0	0	0	0.004656	0	27	150				
REG3G	130120	broad.mit.edu	37	2	79253884	79253884	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:79253884C>G	ENST00000272324.5	+	3	306	c.122C>G	c.(121-123)cCc>cGc	p.P41R	REG3G_ENST00000409471.1_Missense_Mutation_p.P41R|REG3G_ENST00000393897.2_Missense_Mutation_p.P41R	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	41					acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATCAGCTGTCCCAAAGGCTCC	0.532																																							uc002snw.2		NA																	0					0						c.(121-123)CCC>CGC		regenerating islet-derived 3 gamma precursor							86.0	82.0	84.0					2																	79253884		2203	4300	6503	SO:0001583	missense	130120				acute-phase response	extracellular region	sugar binding	g.chr2:79253884C>G	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.122C>G	2.37:g.79253884C>G	ENSP00000272324:p.Pro41Arg					REG3G_uc002snx.2_Missense_Mutation_p.P41R|REG3G_uc010ffu.2_Missense_Mutation_p.P41R	p.P41R	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN			3	207	+			41					A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	ENST00000272324.5	37	c.122C>G	CCDS1962.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772919	0.49680	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.27104	3.8;3.8;1.69	5.05	4.15	0.48705	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.000000	0.53938	D	0.000048	T	0.54854	0.1884	M	0.89904	3.07	0.09310	N	1	D;D	0.89917	1.0;0.998	D;D	0.72982	0.979;0.936	T	0.53570	-0.8420	10	0.87932	D	0	.	10.7255	0.46066	0.1901:0.8099:0.0:0.0	.	41;41	Q3SYE6;Q6UW15	.;REG3G_HUMAN	R	41	ENSP00000377475:P41R;ENSP00000272324:P41R;ENSP00000387105:P41R	ENSP00000272324:P41R	P	+	2	0	REG3G	79107392	0.808000	0.29022	0.085000	0.20634	0.086000	0.17979	1.806000	0.38892	1.443000	0.47586	0.655000	0.94253	CCC		0.532	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448		30	15	0	0	0	0.007291	0	30	15				
REG3G	130120	broad.mit.edu	37	2	79253909	79253909	+	Silent	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:79253909C>A	ENST00000272324.5	+	3	331	c.147C>A	c.(145-147)tcC>tcA	p.S49S	REG3G_ENST00000409471.1_Silent_p.S49S|REG3G_ENST00000393897.2_Silent_p.S49S	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	49	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTATGGCTCCCCCTGCTATG	0.522																																							uc002snw.2		NA																	0					0						c.(145-147)TCC>TCA		regenerating islet-derived 3 gamma precursor							87.0	84.0	85.0					2																	79253909		2203	4300	6503	SO:0001819	synonymous_variant	130120				acute-phase response	extracellular region	sugar binding	g.chr2:79253909C>A	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.147C>A	2.37:g.79253909C>A						REG3G_uc002snx.2_Silent_p.S49S|REG3G_uc010ffu.2_Silent_p.S49S	p.S49S	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN			3	232	+			49			C-type lectin.		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Silent	SNP	ENST00000272324.5	37	c.147C>A	CCDS1962.1																																																																																				0.522	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448		15	32	1	0	2.32078e-09	0.003163	3.93401e-09	15	32				
CKAP2L	150468	broad.mit.edu	37	2	113513884	113513884	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:113513884T>G	ENST00000302450.6	-	4	1142	c.1064A>C	c.(1063-1065)cAg>cCg	p.Q355P	CKAP2L_ENST00000481732.1_5'Flank|CKAP2L_ENST00000541405.1_Missense_Mutation_p.Q190P	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	355						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						GCTGGACTTCTGATCTTGCTT	0.423																																							uc002tie.2		NA																	0					0						c.(1063-1065)CAG>CCG		cytoskeleton associated protein 2-like							153.0	147.0	149.0					2																	113513884		2203	4300	6503	SO:0001583	missense	150468					centrosome		g.chr2:113513884T>G	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1064A>C	2.37:g.113513884T>G	ENSP00000305204:p.Gln355Pro					CKAP2L_uc002tif.2_Intron|CKAP2L_uc010yxp.1_Missense_Mutation_p.Q190P|CKAP2L_uc010yxq.1_Missense_Mutation_p.Q190P	p.Q355P	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN			4	1143	-			355					A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	37	c.1064A>C	CCDS2100.1	.	.	.	.	.	.	.	.	.	.	T	6.171	0.399673	0.11696	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.12672	2.66;3.31	4.69	-1.87	0.07737	.	0.586122	0.15480	N	0.260164	T	0.08891	0.0220	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.23440	-1.0188	10	0.39692	T	0.17	0.0014	6.1059	0.20073	0.0:0.3179:0.1321:0.55	.	355	Q8IYA6	CKP2L_HUMAN	P	190;355	ENSP00000438763:Q190P;ENSP00000305204:Q355P	ENSP00000305204:Q355P	Q	-	2	0	CKAP2L	113230355	0.001000	0.12720	0.003000	0.11579	0.015000	0.08874	-0.518000	0.06267	-0.569000	0.06030	-2.599000	0.00162	CAG		0.423	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	NM_152515		8	92	0	0	0	0.00308	0	8	92				
ITGB6	3694	broad.mit.edu	37	2	161029180	161029180	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:161029180G>C	ENST00000283249.2	-	6	1058	c.821C>G	c.(820-822)tCt>tGt	p.S274C	ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000409967.2_Missense_Mutation_p.S274C|ITGB6_ENST00000409872.1_Missense_Mutation_p.S274C|ITGB6_ENST00000428609.2_Missense_Mutation_p.S232C	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	274	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						TCCAAAATGAGAATCAGCATC	0.453																																							uc002ubh.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(820-822)TCT>TGT		integrin, beta 6 precursor							168.0	156.0	160.0					2																	161029180		2203	4300	6503	SO:0001583	missense	3694				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity	g.chr2:161029180G>C		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.821C>G	2.37:g.161029180G>C	ENSP00000283249:p.Ser274Cys					ITGB6_uc010fow.1_RNA|ITGB6_uc010fou.2_Missense_Mutation_p.S274C|ITGB6_uc010zcq.1_Missense_Mutation_p.S232C|ITGB6_uc010fov.1_Missense_Mutation_p.S274C	p.S274C	NM_000888	NP_000879	P18564	ITB6_HUMAN			6	837	-			274			Extracellular (Potential).|VWFA.		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	c.821C>G	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766757	0.90020	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.98135	-4.74;-4.74;-4.74;-4.74	5.49	5.49	0.81192	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.98754	0.9581	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99568	1.0970	10	0.66056	D	0.02	.	19.7273	0.96170	0.0:0.0:1.0:0.0	.	232;274	E9PEE8;P18564	.;ITB6_HUMAN	C	274;232;274;274	ENSP00000283249:S274C;ENSP00000408024:S232C;ENSP00000386828:S274C;ENSP00000386367:S274C	ENSP00000283249:S274C	S	-	2	0	ITGB6	160737426	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.718000	0.92993	0.655000	0.94253	TCT		0.453	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		10	100	0	0	0	0.001855	0	10	100				
SCN3A	6328	broad.mit.edu	37	2	165947810	165947810	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:165947810G>T	ENST00000360093.3	-	28	5344	c.4853C>A	c.(4852-4854)aCc>aAc	p.T1618N	SCN3A_ENST00000283254.7_Missense_Mutation_p.T1618N|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000409101.3_Missense_Mutation_p.T1569N|SCN3A_ENST00000540861.1_Missense_Mutation_p.T101N	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1618					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCGGAACAAGGTAGGGGACAC	0.443																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(4852-4854)ACC>AAC		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						108.0	110.0	110.0					2																	165947810		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165947810G>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4853C>A	2.37:g.165947810G>T	ENSP00000353206:p.Thr1618Asn					SCN3A_uc010zcy.1_Missense_Mutation_p.T101N|SCN3A_uc002ucy.2_Missense_Mutation_p.T1569N|SCN3A_uc002ucz.2_Missense_Mutation_p.T1569N	p.T1618N	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN			28	5345	-			1618					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.4853C>A		.	.	.	.	.	.	.	.	.	.	G	20.3	3.964469	0.74131	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97553	-4.43;-4.43;-4.43;-4.43	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000003	D	0.98369	0.9458	M	0.70842	2.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.996;0.998;0.972	D	0.98808	1.0742	10	0.87932	D	0	.	20.6525	0.99598	0.0:0.0:1.0:0.0	.	1569;1569;1618	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	N	1618;1618;1569;101	ENSP00000353206:T1618N;ENSP00000283254:T1618N;ENSP00000386726:T1569N;ENSP00000439920:T101N	ENSP00000283254:T1618N	T	-	2	0	SCN3A	165656056	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.796000	0.99103	2.890000	0.99128	0.585000	0.79938	ACC		0.443	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		38	53	1	0	3.54561e-26	0.002222	7.62122e-26	38	53				
RBM45	129831	broad.mit.edu	37	2	178985109	178985109	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:178985109G>A	ENST00000286070.5	+	4	738	c.646G>A	c.(646-648)Gaa>Aaa	p.E216K		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	216					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TTTGGGACATGAACCTAGAGT	0.318																																							uc002ulv.2		NA																	0					0						c.(646-648)GAA>AAA		RNA binding motif protein 45							67.0	69.0	68.0					2																	178985109		2202	4300	6502	SO:0001583	missense	129831				cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding	g.chr2:178985109G>A	AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.646G>A	2.37:g.178985109G>A	ENSP00000286070:p.Glu216Lys						p.E216K	NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)		4	738	+			216					Q6NYL0|Q8NFC9	Missense_Mutation	SNP	ENST00000286070.5	37	c.646G>A	CCDS33335.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.495359	0.44352	.	.	ENSG00000155636	ENST00000286070	T	0.04862	3.54	6.16	6.16	0.99307	.	0.159786	0.56097	D	0.000038	T	0.08133	0.0203	L	0.29908	0.895	0.54753	D	0.999988	B	0.27732	0.187	B	0.32762	0.152	T	0.43909	-0.9362	10	0.21540	T	0.41	-25.0087	19.848	0.96722	0.0:0.0:1.0:0.0	.	216	Q8IUH3-3	.	K	216	ENSP00000286070:E216K	ENSP00000286070:E216K	E	+	1	0	RBM45	178693355	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.825000	0.69286	2.937000	0.99478	0.650000	0.86243	GAA		0.318	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	NM_152945		7	26	0	0	0	0.001984	0	7	26				
TTN	7273	broad.mit.edu	37	2	179414882	179414882	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:179414882G>C	ENST00000591111.1	-	287	86984	c.86760C>G	c.(86758-86760)ttC>ttG	p.F28920L	TTN_ENST00000460472.2_Missense_Mutation_p.F21496L|TTN_ENST00000342992.6_Missense_Mutation_p.F27993L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.F30561L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.F21688L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.F21621L|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28920	Ig-like 133.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCATCTTTGAACCAAGTTA	0.438																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(83977-83979)TTC>TTG		titin isoform N2-A							213.0	208.0	210.0					2																	179414882		1870	4108	5978	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179414882G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86760C>G	2.37:g.179414882G>C	ENSP00000465570:p.Phe28920Leu					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.F21688L|TTN_uc010zfi.1_Missense_Mutation_p.F21621L|TTN_uc010zfj.1_Missense_Mutation_p.F21496L	p.F27993L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		286	84203	-			28920					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.83979C>G		.	.	.	.	.	.	.	.	.	.	G	16.25	3.069203	0.55539	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.74	4.85	0.62838	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.26521	0.0648	N	0.11870	0.19	0.35755	D	0.819735	B;B;B;B	0.09022	0.002;0.002;0.002;0.002	B;B;B;B	0.14578	0.011;0.011;0.011;0.011	T	0.21827	-1.0234	9	0.87932	D	0	.	10.6953	0.45894	0.1434:0.0:0.8566:0.0	.	21496;21621;21688;28920	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	27993;21496;21688;21621;21493	ENSP00000343764:F27993L;ENSP00000434586:F21496L;ENSP00000340554:F21688L;ENSP00000352154:F21621L	ENSP00000340554:F21688L	F	-	3	2	TTN	179123128	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.873000	0.48475	2.873000	0.98535	0.563000	0.77884	TTC		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		21	141	0	0	0	0.004656	0	21	141				
TTN	7273	broad.mit.edu	37	2	179580343	179580343	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:179580343A>T	ENST00000591111.1	-	87	25071	c.24847T>A	c.(24847-24849)Ttc>Atc	p.F8283I	TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.F7356I|TTN_ENST00000589042.1_Missense_Mutation_p.F8600I|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12461	Ig-like 65.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTCAACGAATGACATTCTG	0.463																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(22066-22068)TTC>ATC		titin isoform N2-A							91.0	92.0	92.0					2																	179580343		2023	4193	6216	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179580343A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24847T>A	2.37:g.179580343A>T	ENSP00000465570:p.Phe8283Ile					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.F4017I	p.F7356I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		86	22290	-			8283					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.22066T>A		.	.	.	.	.	.	.	.	.	.	A	10.65	1.408650	0.25378	.	.	ENSG00000155657	ENST00000342992	T	0.66995	-0.24	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.73087	0.3542	M	0.66560	2.04	0.80722	D	1	D	0.59357	0.985	P	0.50570	0.644	T	0.77749	-0.2471	9	0.87932	D	0	.	15.5972	0.76595	1.0:0.0:0.0:0.0	.	8283	Q8WZ42	TITIN_HUMAN	I	7356	ENSP00000343764:F7356I	ENSP00000343764:F7356I	F	-	1	0	TTN	179288588	1.000000	0.71417	0.047000	0.18901	0.116000	0.19942	7.256000	0.78350	2.130000	0.65690	0.533000	0.62120	TTC		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		15	18	0	0	0	0.004007	0	15	18				
KANSL1L	151050	broad.mit.edu	37	2	211018910	211018910	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:211018910T>A	ENST00000281772.9	-	2	660	c.397A>T	c.(397-399)Atc>Ttc	p.I133F	KANSL1L_ENST00000418791.1_Missense_Mutation_p.I133F|KANSL1L_ENST00000429908.2_5'UTR|KANSL1L_ENST00000457374.1_Missense_Mutation_p.I133F|KANSL1L_ENST00000452086.1_Missense_Mutation_p.I133F	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	133						histone acetyltransferase complex (GO:0000123)											TCCTTTTTGATGAACTCTTCA	0.368																																							uc002vds.2		NA																	0				ovary(3)	3						c.(397-399)ATC>TTC		hypothetical protein LOC151050							78.0	79.0	79.0					2																	211018910		2202	4300	6502	SO:0001583	missense	151050							g.chr2:211018910T>A	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.397A>T	2.37:g.211018910T>A	ENSP00000281772:p.Ile133Phe					C2orf67_uc002vdt.2_Missense_Mutation_p.I133F|C2orf67_uc002vdw.2_Missense_Mutation_p.I133F|C2orf67_uc002vdy.1_Missense_Mutation_p.I133F|C2orf67_uc002vdv.2_Missense_Mutation_p.I133F|C2orf67_uc002vdx.1_Missense_Mutation_p.I133F	p.I133F	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)	2	605	-		Renal(323;0.202)	133					B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	37	c.397A>T	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086585	0.36855	.	.	ENSG00000144445	ENST00000281772;ENST00000418791;ENST00000457374;ENST00000452086	.	.	.	5.81	0.676	0.17958	.	0.483083	0.22220	N	0.062964	T	0.21761	0.0524	N	0.17082	0.46	0.28815	N	0.89801	B;B;B;B	0.14012	0.009;0.004;0.003;0.003	B;B;B;B	0.13407	0.009;0.009;0.006;0.006	T	0.10109	-1.0644	9	0.34782	T	0.22	.	5.5671	0.17177	0.1268:0.3589:0.0:0.5143	.	133;133;133;133	A0AUZ9-4;A0AUZ9-3;A0AUZ9-2;A0AUZ9	.;.;.;CB067_HUMAN	F	133	.	ENSP00000281772:I133F	I	-	1	0	C2orf67	210727155	0.993000	0.37304	0.997000	0.53966	0.984000	0.73092	0.450000	0.21762	-0.094000	0.12374	0.456000	0.33151	ATC		0.368	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3	NM_152519		19	24	0	0	0	0.007413	0	19	24				
CPS1	1373	broad.mit.edu	37	2	211441117	211441117	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:211441117C>A	ENST00000233072.5	+	3	480	c.284C>A	c.(283-285)aCa>aAa	p.T95K	CPS1_ENST00000430249.2_Missense_Mutation_p.T101K	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	95	Anthranilate phosphoribosyltransferase homolog.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CAGATTCTCACAATGGCCAAC	0.413																																							uc002vee.3		NA																	0				ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(283-285)ACA>AAA		carbamoyl-phosphate synthetase 1 isoform b							186.0	170.0	176.0					2																	211441117		2203	4300	6503	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211441117C>A	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.284C>A	2.37:g.211441117C>A	ENSP00000233072:p.Thr95Lys					CPS1_uc010fur.2_Missense_Mutation_p.T101K	p.T95K	NM_001875	NP_001866	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	3	416	+			95			Anthranilate phosphoribosyltransferase homolog.		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.284C>A	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450698	0.84101	.	.	ENSG00000021826	ENST00000417946;ENST00000518043;ENST00000523702;ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48	5.96	4.17	0.49024	Carbamoyl-phosphate synthase, small subunit, N-terminal (3);	0.095607	0.64402	D	0.000001	D	0.97929	0.9319	H	0.96576	3.845	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.70487	0.969;0.945	D	0.97827	1.0260	10	0.87932	D	0	-1.5146	11.336	0.49505	0.1273:0.8076:0.0:0.0651	.	105;95	Q59HF8;P31327	.;CPSM_HUMAN	K	95;95;101;101;103;95;95	ENSP00000388496:T95K;ENSP00000430697:T95K;ENSP00000430644:T101K;ENSP00000402608:T101K;ENSP00000233072:T95K	ENSP00000233072:T95K	T	+	2	0	CPS1	211149362	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	5.573000	0.67417	0.851000	0.35264	0.650000	0.86243	ACA		0.413	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			31	45	1	0	3.99451e-17	0.001786	7.71162e-17	31	45				
DGKD	8527	broad.mit.edu	37	2	234372909	234372909	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:234372909G>T	ENST00000264057.2	+	27	3298	c.3286G>T	c.(3286-3288)Gca>Tca	p.A1096S	DGKD_ENST00000409813.3_Missense_Mutation_p.A1052S	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	1096					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CTGCCAGTCCGCAGAGCCCGG	0.647																																							uc002vui.1		NA																	0				central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5						c.(3286-3288)GCA>TCA		diacylglycerol kinase, delta 130kDa isoform 2	Phosphatidylserine(DB00144)						39.0	47.0	44.0					2																	234372909		2203	4300	6503	SO:0001583	missense	8527				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity	g.chr2:234372909G>T	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.3286G>T	2.37:g.234372909G>T	ENSP00000264057:p.Ala1096Ser					DGKD_uc002vuj.1_Missense_Mutation_p.A1052S|DGKD_uc010fyi.1_RNA	p.A1096S	NM_152879	NP_690618	Q16760	DGKD_HUMAN		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	27	3298	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)	1096					Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	c.3286G>T	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	G	5.584	0.292571	0.10567	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.79454	-1.1;-1.27	4.92	-9.84	0.00479	.	4.617760	0.00702	N	0.000799	T	0.57475	0.2056	N	0.14661	0.345	0.09310	N	1	B;B	0.19331	0.035;0.01	B;B	0.22152	0.038;0.021	T	0.53229	-0.8468	10	0.19590	T	0.45	.	7.949	0.30003	0.1442:0.4498:0.3355:0.0705	.	1052;1096	Q16760-2;Q16760	.;DGKD_HUMAN	S	1096;1052	ENSP00000264057:A1096S;ENSP00000386455:A1052S	ENSP00000264057:A1096S	A	+	1	0	DGKD	234037648	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.091000	0.03369	-4.905000	0.00027	-1.299000	0.01334	GCA		0.647	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648		20	22	1	0	4.35082e-09	0.001523	7.25716e-09	20	22				
KIF1A	547	broad.mit.edu	37	2	241679756	241679756	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:241679756G>A	ENST00000320389.7	-	34	3630	c.3472C>T	c.(3472-3474)Cgt>Tgt	p.R1158C	KIF1A_ENST00000498729.2_Missense_Mutation_p.R1259C	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1158					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		ATGCCCCCACGGTGGTCCACC	0.662																																							uc002vzy.2		NA																	0				lung(1)	1						c.(3472-3474)CGT>TGT		axonal transport of synaptic vesicles							61.0	71.0	67.0					2																	241679756		2067	4191	6258	SO:0001583	missense	547				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity	g.chr2:241679756G>A	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.3472C>T	2.37:g.241679756G>A	ENSP00000322791:p.Arg1158Cys					KIF1A_uc010fzk.2_Missense_Mutation_p.R1259C|KIF1A_uc002vzz.1_Missense_Mutation_p.R1259C	p.R1158C	NM_004321	NP_004312	Q12756	KIF1A_HUMAN		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)	34	3618	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	1158					B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	c.3472C>T	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939364	0.73557	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.73681	-0.61;-0.7;-0.77	4.3	3.37	0.38596	.	0.059139	0.64402	U	0.000004	T	0.77498	0.4139	L	0.40543	1.245	0.50171	D	0.999857	D;D;D	0.89917	0.993;0.999;1.0	P;P;D	0.68192	0.84;0.736;0.956	T	0.78505	-0.2178	10	0.72032	D	0.01	.	9.3314	0.38023	0.0:0.1571:0.6803:0.1626	.	1259;1259;1158	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	C	1158;1259;1259;1259	ENSP00000322791:R1158C;ENSP00000438388:R1259C;ENSP00000384231:R1259C	ENSP00000322791:R1158C	R	-	1	0	KIF1A	241328429	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.988000	0.56951	1.940000	0.56252	0.467000	0.42956	CGT		0.662	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483		4	38	0	0	0	0.001168	0	4	38				
DDRGK1	65992	broad.mit.edu	37	20	3175885	3175885	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:3175885C>T	ENST00000354488.3	-	5	682	c.625G>A	c.(625-627)Gag>Aag	p.E209K	DDRGK1_ENST00000380201.2_Missense_Mutation_p.E209K	NM_023935.1	NP_076424.1	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1	209						endoplasmic reticulum (GO:0005783)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7						ACCTGTTCCTCAGTCATGGTC	0.642																																							uc002wic.2		NA																	0					0						c.(625-627)GAG>AAG		DDRGK domain containing 1 precursor							161.0	141.0	148.0					20																	3175885		2203	4300	6503	SO:0001583	missense	65992					endoplasmic reticulum	protein binding	g.chr20:3175885C>T	AL121891	CCDS13050.1	20p13	2011-08-18	2008-10-03	2008-10-03	ENSG00000198171	ENSG00000198171			16110	protein-coding gene	gene with protein product	"""Dashurin"""		"""chromosome 20 open reading frame 116"""	C20orf116		20036718, 20228063, 21494687	Standard	NM_023935		Approved	dJ1187M17.3	uc002wic.3	Q96HY6	OTTHUMG00000031732	ENST00000354488.3:c.625G>A	20.37:g.3175885C>T	ENSP00000346483:p.Glu209Lys					DDRGK1_uc010gaw.2_RNA|DDRGK1_uc010gax.1_Missense_Mutation_p.E209K	p.E209K	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN			5	647	-			209					A6NIU5|C9JSZ5|Q9BW47	Missense_Mutation	SNP	ENST00000354488.3	37	c.625G>A	CCDS13050.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635805	0.87760	.	.	ENSG00000198171	ENST00000354488;ENST00000380213;ENST00000380201	T	0.50813	0.73	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.65626	0.2709	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.76494	0.99;0.999	D;D	0.81914	0.917;0.995	T	0.67440	-0.5670	10	0.59425	D	0.04	-6.5127	15.5786	0.76414	0.0:1.0:0.0:0.0	.	209;209	Q96HY6-2;Q96HY6	.;DDRGK_HUMAN	K	209	ENSP00000346483:E209K	ENSP00000346483:E209K	E	-	1	0	DDRGK1	3123885	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.966000	0.70395	2.537000	0.85549	0.563000	0.77884	GAG		0.642	DDRGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077709.2	NM_023935		11	71	0	0	0	0.001855	0	11	71				
DDRGK1	65992	broad.mit.edu	37	20	3175889	3175889	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:3175889C>T	ENST00000354488.3	-	5	678	c.621G>A	c.(619-621)atG>atA	p.M207I	DDRGK1_ENST00000380201.2_Missense_Mutation_p.M207I	NM_023935.1	NP_076424.1	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1	207						endoplasmic reticulum (GO:0005783)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7						GTTCCTCAGTCATGGTCTCTC	0.637																																							uc002wic.2		NA																	0					0						c.(619-621)ATG>ATA		DDRGK domain containing 1 precursor							164.0	143.0	150.0					20																	3175889		2203	4300	6503	SO:0001583	missense	65992					endoplasmic reticulum	protein binding	g.chr20:3175889C>T	AL121891	CCDS13050.1	20p13	2011-08-18	2008-10-03	2008-10-03	ENSG00000198171	ENSG00000198171			16110	protein-coding gene	gene with protein product	"""Dashurin"""		"""chromosome 20 open reading frame 116"""	C20orf116		20036718, 20228063, 21494687	Standard	NM_023935		Approved	dJ1187M17.3	uc002wic.3	Q96HY6	OTTHUMG00000031732	ENST00000354488.3:c.621G>A	20.37:g.3175889C>T	ENSP00000346483:p.Met207Ile					DDRGK1_uc010gaw.2_RNA|DDRGK1_uc010gax.1_Missense_Mutation_p.M207I	p.M207I	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN			5	643	-			207					A6NIU5|C9JSZ5|Q9BW47	Missense_Mutation	SNP	ENST00000354488.3	37	c.621G>A	CCDS13050.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.253157	0.39797	.	.	ENSG00000198171	ENST00000354488;ENST00000380213;ENST00000380201	T	0.41758	0.99	4.8	4.8	0.61643	.	0.094454	0.85682	D	0.000000	T	0.45074	0.1324	L	0.45581	1.43	0.45139	D	0.99815	P;P	0.47910	0.902;0.522	P;B	0.48141	0.568;0.272	T	0.31503	-0.9941	10	0.37606	T	0.19	-11.6496	15.394	0.74778	0.0:1.0:0.0:0.0	.	207;207	Q96HY6-2;Q96HY6	.;DDRGK_HUMAN	I	207	ENSP00000346483:M207I	ENSP00000346483:M207I	M	-	3	0	DDRGK1	3123889	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.677000	0.46892	2.495000	0.84180	0.563000	0.77884	ATG		0.637	DDRGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077709.2	NM_023935		12	70	0	0	0	0.001855	0	12	70				
DDRGK1	65992	broad.mit.edu	37	20	3175940	3175940	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:3175940C>T	ENST00000354488.3	-	5	627	c.570G>A	c.(568-570)ctG>ctA	p.L190L	DDRGK1_ENST00000380201.2_Silent_p.L190L	NM_023935.1	NP_076424.1	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1	190						endoplasmic reticulum (GO:0005783)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7						CCTTCAGTTTCAGGTACTCCT	0.617																																							uc002wic.2		NA																	0					0						c.(568-570)CTG>CTA		DDRGK domain containing 1 precursor							153.0	126.0	135.0					20																	3175940		2203	4300	6503	SO:0001819	synonymous_variant	65992					endoplasmic reticulum	protein binding	g.chr20:3175940C>T	AL121891	CCDS13050.1	20p13	2011-08-18	2008-10-03	2008-10-03	ENSG00000198171	ENSG00000198171			16110	protein-coding gene	gene with protein product	"""Dashurin"""		"""chromosome 20 open reading frame 116"""	C20orf116		20036718, 20228063, 21494687	Standard	NM_023935		Approved	dJ1187M17.3	uc002wic.3	Q96HY6	OTTHUMG00000031732	ENST00000354488.3:c.570G>A	20.37:g.3175940C>T						DDRGK1_uc010gaw.2_RNA|DDRGK1_uc010gax.1_Silent_p.L190L	p.L190L	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN			5	592	-			190					A6NIU5|C9JSZ5|Q9BW47	Silent	SNP	ENST00000354488.3	37	c.570G>A	CCDS13050.1																																																																																				0.617	DDRGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077709.2	NM_023935		9	58	0	0	0	0.004482	0	9	58				
SLC4A11	83959	broad.mit.edu	37	20	3210254	3210254	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:3210254G>C	ENST00000380056.3	-	13	1753	c.1706C>G	c.(1705-1707)tCa>tGa	p.S569*	SLC4A11_ENST00000539553.2_Nonsense_Mutation_p.S553*|SLC4A11_ENST00000488544.1_5'UTR|SLC4A11_ENST00000380059.3_Nonsense_Mutation_p.S596*	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	569	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CGCCTGGCCTGAGTGTGTGGC	0.667																																					NSCLC(190;922 2139 10266 10292 38692)	NSCLC(190;922 2139 10266 10292 38692)	uc002wig.2		NA																	0				ovary(1)	1	GRCh37	CD070527	SLC4A11	D		c.(1705-1707)TCA>TGA		solute carrier family 4 member 11							41.0	44.0	43.0					20																	3210254		2199	4299	6498	SO:0001587	stop_gained	83959				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity	g.chr20:3210254G>C	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1706C>G	20.37:g.3210254G>C	ENSP00000369396:p.Ser569*					SLC4A11_uc010zqe.1_Nonsense_Mutation_p.S596*|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Nonsense_Mutation_p.S553*	p.S569*	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN			13	1754	-			569			Extracellular (Potential).|Membrane (bicarbonate transporter).		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Nonsense_Mutation	SNP	ENST00000380056.3	37	c.1706C>G	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965601	0.92855	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	.	.	.	4.48	2.32	0.28847	.	13.615900	0.00166	N	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	5.404	0.16310	0.1106:0.0:0.4717:0.4177	.	.	.	.	X	596;569;553	.	ENSP00000369396:S569X	S	-	2	0	SLC4A11	3158254	0.115000	0.22152	0.001000	0.08648	0.090000	0.18270	1.272000	0.33109	0.832000	0.34804	0.462000	0.41574	TCA		0.667	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			11	19	0	0	0	0.000978	0	11	19				
PLCB1	23236	broad.mit.edu	37	20	8689341	8689341	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:8689341T>A	ENST00000338037.6	+	12	1219	c.1192T>A	c.(1192-1194)Tgt>Agt	p.C398S	PLCB1_ENST00000378641.3_Missense_Mutation_p.C398S|PLCB1_ENST00000378637.2_Missense_Mutation_p.C398S	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	398	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AATTGCGGAGTGTGCATTTAA	0.343																																							uc002wnb.2		NA																	0				ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(1192-1194)TGT>AGT		phosphoinositide-specific phospholipase C beta 1							151.0	126.0	135.0					20																	8689341		2203	4300	6503	SO:0001583	missense	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8689341T>A	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1192T>A	20.37:g.8689341T>A	ENSP00000338185:p.Cys398Ser					PLCB1_uc010zrb.1_Missense_Mutation_p.C297S|PLCB1_uc002wna.2_Missense_Mutation_p.C398S|PLCB1_uc002wnc.1_Missense_Mutation_p.C297S	p.C398S	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN			12	1195	+			398			PI-PLC X-box.		D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	c.1192T>A	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	T	4.412	0.076169	0.08485	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.61274	0.12;0.12;0.12	5.2	5.2	0.72013	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.041940	0.85682	D	0.000000	T	0.23649	0.0572	N	0.00510	-1.415	0.48087	D	0.999586	B;B	0.21821	0.004;0.061	B;B	0.19946	0.017;0.027	T	0.35699	-0.9778	10	0.07175	T	0.84	.	15.2329	0.73404	0.0:0.0:0.0:1.0	.	398;398	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	S	398;398;398;318;318	ENSP00000367908:C398S;ENSP00000338185:C398S;ENSP00000367904:C398S	ENSP00000338185:C398S	C	+	1	0	PLCB1	8637341	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.785000	0.62418	2.180000	0.69256	0.533000	0.62120	TGT		0.343	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			8	18	0	0	0	0.004482	0	8	18				
KIAA1755	85449	broad.mit.edu	37	20	36841670	36841670	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:36841670G>T	ENST00000279024.4	-	14	3648	c.3377C>A	c.(3376-3378)cCa>cAa	p.P1126Q		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1126										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TTCCTGGGGTGGAGAGCCTGC	0.607																																							uc002xhy.1		NA																	0				ovary(4)|pancreas(1)	5						c.(3376-3378)CCA>CAA		hypothetical protein LOC85449							32.0	32.0	32.0					20																	36841670		2203	4300	6503	SO:0001583	missense	85449							g.chr20:36841670G>T	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3377C>A	20.37:g.36841670G>T	ENSP00000279024:p.Pro1126Gln					KIAA1755_uc002xhv.1_Missense_Mutation_p.P190Q|KIAA1755_uc002xhw.1_Missense_Mutation_p.P181Q|KIAA1755_uc002xhx.1_Missense_Mutation_p.P404Q	p.P1126Q	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN			14	3649	-		Myeloproliferative disorder(115;0.00874)	1126					Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	c.3377C>A	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	G	9.073	0.997458	0.19043	.	.	ENSG00000149633	ENST00000279024	T	0.05580	3.42	4.64	-7.71	0.01254	.	1.648390	0.04194	N	0.328810	T	0.04003	0.0112	L	0.33485	1.01	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.41360	-0.9513	10	0.20519	T	0.43	.	3.6553	0.08218	0.5856:0.1154:0.1827:0.1163	.	1126	Q5JYT7	K1755_HUMAN	Q	1126	ENSP00000279024:P1126Q	ENSP00000279024:P1126Q	P	-	2	0	KIAA1755	36275084	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.816000	0.04477	-1.021000	0.03350	0.491000	0.48974	CCA		0.607	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		6	17	1	0	3.59834e-05	0.001168	5.30214e-05	6	17				
TOX2	84969	broad.mit.edu	37	20	42694462	42694462	+	Silent	SNP	G	G	T	rs148482710	byFrequency	TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:42694462G>T	ENST00000358131.5	+	6	1225	c.1017G>T	c.(1015-1017)acG>acT	p.T339T	TOX2_ENST00000341197.4_Silent_p.T357T|TOX2_ENST00000372999.1_Silent_p.T315T|TOX2_ENST00000423191.2_Silent_p.T315T|TOX2_ENST00000435864.2_3'UTR	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	339					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCTTCCTGACGCCGTCGGACC	0.662																																							uc002xlf.3		NA																	0				ovary(1)	1						c.(1015-1017)ACG>ACT		TOX high mobility group box family member 2							78.0	83.0	81.0					20																	42694462		2203	4300	6503	SO:0001819	synonymous_variant	84969				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr20:42694462G>T	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1017G>T	20.37:g.42694462G>T						TOX2_uc010ggo.2_Silent_p.T357T|TOX2_uc002xle.3_Silent_p.T315T|TOX2_uc010ggp.2_Silent_p.T315T|TOX2_uc002xlg.2_Intron|TOX2_uc010zwk.1_Silent_p.T235T	p.T339T	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		6	1034	+		Myeloproliferative disorder(115;0.00452)	339					A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	37	c.1017G>T	CCDS42875.1																																																																																				0.662	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2			25	53	1	0	9.86323e-18	0.003954	1.91301e-17	25	53				
RTFDC1	51507	broad.mit.edu	37	20	55092258	55092258	+	Splice_Site	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:55092258G>T	ENST00000023939.4	+	8	849		c.e8+1		GCNT7_ENST00000243913.4_Intron|FAM209A_ENST00000481560.1_Splice_Site|RTFDC1_ENST00000357348.5_Splice_Site|RTFDC1_ENST00000395881.3_Splice_Site	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1																		AAAAGCACAGGTGGGTCCTGT	0.542																																							uc002xxt.2		NA																	0				ovary(1)	1						c.e8+1		hypothetical protein LOC51507							39.0	36.0	37.0					20																	55092258		2203	4300	6503	SO:0001630	splice_region_variant	51507							g.chr20:55092258G>T	AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.742+1G>T	20.37:g.55092258G>T						C20orf43_uc010zzf.1_Splice_Site_p.A278_splice|C20orf43_uc002xxu.2_Splice_Site_p.A247_splice|C20orf43_uc002xxv.2_Splice_Site_p.Q229_splice|GCNT7_uc010zzg.1_Intron	p.A248_splice	NM_016407	NP_057491	Q9BY42	CT043_HUMAN	Colorectal(105;0.202)		8	849	+								E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Splice_Site	SNP	ENST00000023939.4	37	c.742_splice	CCDS13453.1	.	.	.	.	.	.	.	.	.	.	G	9.529	1.110202	0.20714	.	.	ENSG00000022277	ENST00000023939;ENST00000395881;ENST00000357348	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1893	0.81975	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C20orf43	54525665	1.000000	0.71417	0.996000	0.52242	0.078000	0.17371	5.434000	0.66526	2.426000	0.82243	0.563000	0.77884	.		0.542	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079817.2	NM_016407	Intron	5	9	1	0	0.000602214	0.000602	0.000854161	5	9				
VAPB	9217	broad.mit.edu	37	20	57016113	57016113	+	Silent	SNP	C	C	T	rs374376908		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:57016113C>T	ENST00000475243.1	+	5	885	c.547C>T	c.(547-549)Cta>Tta	p.L183L	VAPB_ENST00000265619.2_3'UTR|VAPB_ENST00000395802.3_Intron	NM_004738.4	NP_004729.1	O95292	VAPB_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein B and C	183					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|endoplasmic reticulum unfolded protein response (GO:0030968)|modulation by virus of host morphology or physiology (GO:0019048)|positive regulation of viral genome replication (GO:0045070)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-tubulin binding (GO:0048487)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|structural molecule activity (GO:0005198)			kidney(2)|lung(3)|prostate(1)	6	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)			AGTTCAGAGGCTACGGGAGGA	0.423																																							uc002xza.2		NA																	0				kidney(1)	1						c.(547-549)CTA>TTA		VAMP-associated protein B/C		C	,	0,4406		0,0,2203	91.0	85.0	87.0		,547	4.3	1.0	20		87	1,8599		0,1,4299	no	intron,coding-synonymous	VAPB	NM_001195677.1,NM_004738.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	,183/244	57016113	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9217				cell death|endoplasmic reticulum unfolded protein response|positive regulation of viral genome replication|sphingolipid metabolic process|virus-host interaction	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	beta-tubulin binding|enzyme binding|protein heterodimerization activity|protein homodimerization activity|structural molecule activity	g.chr20:57016113C>T	AF086628	CCDS33498.1, CCDS56198.1	20q13	2014-09-17			ENSG00000124164	ENSG00000124164			12649	protein-coding gene	gene with protein product		605704				9920726	Standard	NM_004738		Approved	VAP-B, VAP-C, ALS8	uc002xza.3	O95292	OTTHUMG00000032840	ENST00000475243.1:c.547C>T	20.37:g.57016113C>T						VAPB_uc002xzb.2_RNA|VAPB_uc010zzo.1_Silent_p.L60L|VAPB_uc002xzc.2_Intron	p.L183L	NM_004738	NP_004729	O95292	VAPB_HUMAN	BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)		5	818	+	Lung NSC(12;0.000615)|all_lung(29;0.00186)		183			Potential.|Cytoplasmic (Potential).		A2A2F2|O95293|Q9P0H0	Silent	SNP	ENST00000475243.1	37	c.547C>T	CCDS33498.1																																																																																				0.423	VAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079875.2			3	9	0	0	0	0.004672	0	3	9				
PHACTR3	116154	broad.mit.edu	37	20	58348444	58348444	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:58348444C>A	ENST00000371015.1	+	6	1329	c.862C>A	c.(862-864)Ctt>Att	p.L288I	PHACTR3_ENST00000355648.4_Missense_Mutation_p.L247I|PHACTR3_ENST00000541461.1_Missense_Mutation_p.L247I|PHACTR3_ENST00000361300.4_Missense_Mutation_p.L177I|PHACTR3_ENST00000395639.4_Missense_Mutation_p.L177I|PHACTR3_ENST00000359926.3_Missense_Mutation_p.L285I|PHACTR3_ENST00000395636.2_Missense_Mutation_p.L247I	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	288						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CCACCGGCCTCTTCCCCCAAG	0.672																																							uc002yau.2		NA																	0				ovary(2)|pancreas(1)	3						c.(862-864)CTT>ATT		phosphatase and actin regulator 3 isoform 1							55.0	48.0	50.0					20																	58348444		2203	4300	6503	SO:0001583	missense	116154					nuclear matrix	actin binding|protein phosphatase inhibitor activity	g.chr20:58348444C>A	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.862C>A	20.37:g.58348444C>A	ENSP00000360054:p.Leu288Ile					PHACTR3_uc002yat.2_Missense_Mutation_p.L285I|PHACTR3_uc010zzw.1_Missense_Mutation_p.L247I|PHACTR3_uc002yav.2_Missense_Mutation_p.L247I|PHACTR3_uc002yaw.2_Missense_Mutation_p.L247I|PHACTR3_uc002yax.2_Missense_Mutation_p.L177I	p.L288I	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)		6	1329	+	all_lung(29;0.00344)		288					B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	c.862C>A	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315014	0.60524	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.39787	1.65;1.69;1.06;1.69;1.69;1.69;1.06	4.61	3.65	0.41850	.	0.000000	0.64402	D	0.000002	T	0.50973	0.1647	M	0.64997	1.995	0.45914	D	0.998756	D;P;P	0.67145	0.996;0.768;0.768	P;B;P	0.59643	0.861;0.418;0.474	T	0.50154	-0.8861	10	0.49607	T	0.09	-14.1019	6.0829	0.19950	0.0:0.7034:0.0:0.2966	.	177;288;285	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	I	285;288;177;247;247;247;177	ENSP00000353002:L285I;ENSP00000360054:L288I;ENSP00000379001:L177I;ENSP00000442483:L247I;ENSP00000347866:L247I;ENSP00000378998:L247I;ENSP00000354555:L177I	ENSP00000347866:L247I	L	+	1	0	PHACTR3	57781839	0.998000	0.40836	0.847000	0.33407	0.650000	0.38633	3.439000	0.52878	1.144000	0.42321	0.655000	0.94253	CTT		0.672	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672		20	18	1	0	4.96729e-08	0.008871	7.84606e-08	20	18				
TIAM1	7074	broad.mit.edu	37	21	32508251	32508251	+	Splice_Site	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr21:32508251C>A	ENST00000286827.3	-	24	4354	c.3883G>T	c.(3883-3885)Gtc>Ttc	p.V1295F	TIAM1_ENST00000541036.1_Splice_Site_p.V1235F	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1295	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TGATACACACCGAATGCTGCC	0.448																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(3883-3885)GTC>TTC		T-cell lymphoma invasion and metastasis 1							104.0	99.0	101.0					21																	32508251		2203	4300	6503	SO:0001630	splice_region_variant	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32508251C>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3883+1G>T	21.37:g.32508251C>A						TIAM1_uc011adk.1_Missense_Mutation_p.V1295F|TIAM1_uc011adl.1_Missense_Mutation_p.V1235F	p.V1295F	NM_003253	NP_003244	Q13009	TIAM1_HUMAN			24	4355	-			1295			PH 2.		B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.3883G>T	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034953	0.75617	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.59364	0.27;0.3	5.25	5.25	0.73442	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.76758	0.4032	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.77186	-0.2680	9	.	.	.	.	18.8713	0.92315	0.0:1.0:0.0:0.0	.	1235;1235;1295	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	F	1295;1235	ENSP00000286827:V1295F;ENSP00000441570:V1235F	.	V	-	1	0	TIAM1	31430122	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	7.773000	0.85462	2.449000	0.82847	0.655000	0.94253	GTC		0.448	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	Missense_Mutation	22	26	1	0	1.87028e-06	0.001882	2.84638e-06	22	26				
TIAM1	7074	broad.mit.edu	37	21	32638875	32638875	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr21:32638875G>A	ENST00000286827.3	-	5	885	c.414C>T	c.(412-414)gaC>gaT	p.D138D	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Silent_p.D138D	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	138					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AATATGTAGCGTCATCCCCGT	0.537																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(412-414)GAC>GAT		T-cell lymphoma invasion and metastasis 1							102.0	87.0	92.0					21																	32638875		2203	4300	6503	SO:0001819	synonymous_variant	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32638875G>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.414C>T	21.37:g.32638875G>A						TIAM1_uc011adk.1_Silent_p.D138D|TIAM1_uc011adl.1_Silent_p.D138D|TIAM1_uc002yox.1_Intron	p.D138D	NM_003253	NP_003244	Q13009	TIAM1_HUMAN			5	886	-			138					B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	c.414C>T	CCDS13609.1																																																																																				0.537	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		21	43	0	0	0	0.008871	0	21	43				
SLC25A18	83733	broad.mit.edu	37	22	18065397	18065397	+	Missense_Mutation	SNP	C	C	G	rs376253175		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr22:18065397C>G	ENST00000327451.6	+	6	806	c.268C>G	c.(268-270)Cgg>Ggg	p.R90G	SLC25A18_ENST00000497401.1_3'UTR|SLC25A18_ENST00000399813.1_Missense_Mutation_p.R90G|AC004019.13_ENST00000443935.1_RNA	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	90						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		CGACTTTTTCCGGCGGCTGCT	0.542																																					Colon(118;1560 1625 18964 29606 50093)	Colon(118;1560 1625 18964 29606 50093)	uc002zmp.1		NA																	0					0						c.(268-270)CGG>GGG		solute carrier	L-Glutamic Acid(DB00142)						46.0	40.0	42.0					22																	18065397		2203	4299	6502	SO:0001583	missense	83733					integral to membrane|mitochondrial inner membrane	binding|symporter activity	g.chr22:18065397C>G	AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.268C>G	22.37:g.18065397C>G	ENSP00000329033:p.Arg90Gly					SLC25A18_uc010gqx.2_Missense_Mutation_p.R90G|SLC25A18_uc002zmq.1_Missense_Mutation_p.R90G	p.R90G	NM_031481	NP_113669	Q9H1K4	GHC2_HUMAN		Lung(27;0.124)	6	762	+			90			Solcar 1.			Missense_Mutation	SNP	ENST00000327451.6	37	c.268C>G	CCDS13744.1	.	.	.	.	.	.	.	.	.	.	C	19.73	3.881947	0.72294	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	T;T	0.79845	-1.31;-1.31	5.18	3.06	0.35304	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.87305	0.6144	M	0.74258	2.255	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.86234	0.1639	10	0.62326	D	0.03	-13.4909	9.3674	0.38232	0.1441:0.7783:0.0:0.0776	.	90	Q9H1K4	GHC2_HUMAN	G	90	ENSP00000329033:R90G;ENSP00000382710:R90G	ENSP00000329033:R90G	R	+	1	2	SLC25A18	16445397	1.000000	0.71417	0.986000	0.45419	0.965000	0.64279	2.135000	0.42112	0.660000	0.30964	0.561000	0.74099	CGG		0.542	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316214.3	NM_031481		5	2	0	0	0	0.001168	0	5	2				
ZNF74	7625	broad.mit.edu	37	22	20755021	20755021	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr22:20755021G>C	ENST00000400451.2	+	3	734	c.220G>C	c.(220-222)Gag>Cag	p.E74Q	ZNF74_ENST00000356671.5_Missense_Mutation_p.E74Q|ZNF74_ENST00000405993.1_Missense_Mutation_p.E74Q|ZNF74_ENST00000357502.5_Missense_Mutation_p.G79A|ZNF74_ENST00000403682.3_Missense_Mutation_p.G45A	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TGTGATGTTGGAGAACTACCA	0.542																																							uc010gsm.2		NA																	0				ovary(1)	1						c.(220-222)GAG>CAG		zinc finger protein 74							108.0	124.0	119.0					22																	20755021		2200	4297	6497	SO:0001583	missense	7625				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding	g.chr22:20755021G>C	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.220G>C	22.37:g.20755021G>C	ENSP00000383301:p.Glu74Gln					ZNF74_uc002zsg.2_Missense_Mutation_p.E3Q|ZNF74_uc002zsh.2_Missense_Mutation_p.E74Q|ZNF74_uc002zsi.2_Missense_Mutation_p.E3Q|ZNF74_uc010gsn.2_Missense_Mutation_p.E3Q	p.E74Q	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)		4	432	+	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	74			KRAB.		B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	c.220G>C	CCDS42982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.82|16.82	3.227918|3.227918	0.58777|0.58777	.|.	.|.	ENSG00000185252|ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993|ENST00000403682;ENST00000357502	T;T;T|.	0.04317|.	3.65;3.65;3.65|.	3.37|3.37	3.37|3.37	0.38596|0.38596	Krueppel-associated box (4);|.	0.000000|.	0.35525|.	N|.	0.003155|.	T|T	0.76047|0.76047	0.3933|0.3933	H|H	0.94306|0.94306	3.52|3.52	0.28452|0.28452	N|N	0.916276|0.916276	D|.	0.89917|.	1.0|.	D|.	0.72982|.	0.979|.	T|T	0.72214|0.72214	-0.4358|-0.4358	10|6	0.54805|0.87932	T|D	0.06|0	.|.	13.0253|13.0253	0.58812|0.58812	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	74|.	Q16587|.	ZNF74_HUMAN|.	Q|A	74|45;79	ENSP00000383301:E74Q;ENSP00000349098:E74Q;ENSP00000385855:E74Q|.	ENSP00000349098:E74Q|ENSP00000350101:G79A	E|G	+|+	1|2	0|0	ZNF74|ZNF74	19085021|19085021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.673000|4.673000	0.61604|0.61604	2.178000|2.178000	0.69098|0.69098	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.542	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426		15	79	0	0	0	0.00245	0	15	79				
MMP11	4320	broad.mit.edu	37	22	24122785	24122785	+	Missense_Mutation	SNP	G	G	T	rs199597366	byFrequency	TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr22:24122785G>T	ENST00000215743.3	+	4	551	c.499G>T	c.(499-501)Gac>Tac	p.D167Y	MMP11_ENST00000477567.1_3'UTR	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	167					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	GCATGGGGACGACCTGCCGTT	0.647																																							uc002zxx.2		NA																	0				skin(2)|large_intestine(1)	3						c.(499-501)GAC>TAC		matrix metalloproteinase 11 preproprotein							56.0	53.0	54.0					22																	24122785		2203	4300	6503	SO:0001583	missense	4320				collagen catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr22:24122785G>T		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.499G>T	22.37:g.24122785G>T	ENSP00000215743:p.Asp167Tyr					MMP11_uc002zxy.2_RNA|MMP11_uc002zxz.2_5'Flank	p.D167Y	NM_005940	NP_005931	P24347	MMP11_HUMAN			4	521	+		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)	167					Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	37	c.499G>T	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.768223	0.31320	.	.	ENSG00000099953	ENST00000215743	T	0.14144	2.53	4.33	0.866	0.19079	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.130067	0.64402	D	0.000002	T	0.05547	0.0146	N	0.03608	-0.345	0.26917	N	0.966769	B	0.19935	0.04	B	0.20384	0.029	T	0.31194	-0.9952	10	0.49607	T	0.09	.	8.2851	0.31924	0.7555:0.0:0.2445:0.0	.	167	P24347	MMP11_HUMAN	Y	167	ENSP00000215743:D167Y	ENSP00000215743:D167Y	D	+	1	0	MMP11	22452785	1.000000	0.71417	0.973000	0.42090	0.953000	0.61014	5.125000	0.64715	0.117000	0.18138	-0.303000	0.09236	GAC		0.647	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319891.2	NM_005940		7	22	1	0	8.12818e-05	0.001984	0.000117282	7	22				
PVALB	5816	broad.mit.edu	37	22	37209698	37209698	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr22:37209698C>A	ENST00000216200.5	-	4	351	c.296G>T	c.(295-297)gGg>gTg	p.G99V	CITF22-24E5.1_ENST00000417792.1_RNA|PVALB_ENST00000404171.1_Missense_Mutation_p.G67V|PVALB_ENST00000417718.2_Missense_Mutation_p.G99V	NM_002854.2	NP_002845.1	P20472	PRVA_HUMAN	parvalbumin	99	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.			Missing (in Ref. 1; CAA45134). {ECO:0000305}.	cytosolic calcium ion homeostasis (GO:0051480)	axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)			large_intestine(1)|lung(1)|skin(1)	3						ACCGTCAACCCCAATTTTGCC	0.512																																							uc010gwz.2		NA																	0				skin(1)	1						c.(295-297)GGG>GTG		parvalbumin							159.0	138.0	145.0					22																	37209698		2203	4300	6503	SO:0001583	missense	5816						calcium ion binding	g.chr22:37209698C>A		CCDS13933.1	22q13.1	2013-01-10			ENSG00000100362	ENSG00000100362		"""EF-hand domain containing"""	9704	protein-coding gene	gene with protein product		168890				1559707, 10591208	Standard	NM_002854		Approved	D22S749	uc003apx.3	P20472	OTTHUMG00000150547	ENST00000216200.5:c.296G>T	22.37:g.37209698C>A	ENSP00000216200:p.Gly99Val					PVALB_uc003apx.2_Missense_Mutation_p.G99V	p.G99V	NM_002854	NP_002845	P20472	PRVA_HUMAN			3	326	-			99	Missing (in Ref. 1; CAA45134).		EF-hand 2.|2.		B2R4H7|P78378|Q4VB78|Q5R3Q9	Missense_Mutation	SNP	ENST00000216200.5	37	c.296G>T	CCDS13933.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	19.47|19.47	3.833519|3.833519	0.71258|0.71258	.|.	.|.	ENSG00000100362|ENSG00000100362	ENST00000417718;ENST00000216200;ENST00000404171;ENST00000443735|ENST00000406910	T;T;T;T|T	0.74315|0.74526	-0.61;-0.61;-0.61;-0.83|-0.85	5.41|5.41	5.41|5.41	0.78517|0.78517	EF-hand-like domain (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.91143|0.91143	0.7211|0.7211	H|H	0.95982|0.95982	3.75|3.75	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.85130|.	0.997|.	D|D	0.93704|0.93704	0.7018|0.7018	10|8	0.87932|0.87932	D|D	0|0	-15.0083|-15.0083	19.2254|19.2254	0.93816|0.93816	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	99|.	P20472|.	PRVA_HUMAN|.	V|W	99;99;67;99|98	ENSP00000400247:G99V;ENSP00000216200:G99V;ENSP00000386089:G67V;ENSP00000406977:G99V|ENSP00000384735:G98W	ENSP00000216200:G99V|ENSP00000384735:G98W	G|G	-|-	2|1	0|0	PVALB|PVALB	35539644|35539644	1.000000|1.000000	0.71417|0.71417	0.887000|0.887000	0.34795|0.34795	0.400000|0.400000	0.30750|0.30750	5.742000|5.742000	0.68646|0.68646	2.541000|2.541000	0.85698|0.85698	0.645000|0.645000	0.84053|0.84053	GGG|GGG		0.512	PVALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318857.1	NM_002854		52	83	1	0	1.63038e-21	0.00361	3.31643e-21	52	83				
LGALS2	3957	broad.mit.edu	37	22	37966365	37966365	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr22:37966365C>A	ENST00000215886.4	-	4	478	c.304G>T	c.(304-306)Gag>Tag	p.E102*		NM_006498.2	NP_006489.1	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2	102	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)|galactoside binding (GO:0016936)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)	11	Melanoma(58;0.0574)					AAAGTCAGCTCGTGCCCATCT	0.527																																					GBM(193;1840 2185 13711 20676 24505)	GBM(193;1840 2185 13711 20676 24505)	uc003ata.2		NA																	0				breast(1)|skin(1)	2						c.(304-306)GAG>TAG		lectin, galactoside-binding, soluble, 2							93.0	91.0	92.0					22																	37966365		2203	4300	6503	SO:0001587	stop_gained	3957							g.chr22:37966365C>A		CCDS13950.1	22q13.1	2011-08-04	2007-02-01		ENSG00000100079	ENSG00000100079		"""Lectins, galactoside-binding"""	6562	protein-coding gene	gene with protein product	"""galectin 2"""	150571				1988031, 15356130	Standard	NM_006498		Approved	HL14	uc003ata.3	P05162	OTTHUMG00000150590	ENST00000215886.4:c.304G>T	22.37:g.37966365C>A	ENSP00000215886:p.Glu102*						p.E102*	NM_006498	NP_006489	P05162	LEG2_HUMAN			4	416	-	Melanoma(58;0.0574)		102			Galectin.		Q6FGY4	Nonsense_Mutation	SNP	ENST00000215886.4	37	c.304G>T	CCDS13950.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615722	0.28801	.	.	ENSG00000100079	ENST00000215886	.	.	.	5.83	-4.59	0.03400	.	1.284180	0.04840	N	0.440320	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-7.5266	19.8599	0.96779	0.0663:0.7826:0.1512:0.0	.	.	.	.	X	102	.	ENSP00000215886:E102X	E	-	1	0	LGALS2	36296311	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-1.970000	0.01504	-0.461000	0.06993	-0.270000	0.10280	GAG		0.527	LGALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318991.1	NM_006498		7	55	1	0	8.12818e-05	0.001984	0.000117282	7	55				
TCF20	6942	broad.mit.edu	37	22	42608404	42608404	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr22:42608404C>A	ENST00000359486.3	-	1	3044	c.2908G>T	c.(2908-2910)Gca>Tca	p.A970S	TCF20_ENST00000335626.4_Missense_Mutation_p.A970S|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	970					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TCATGGGTTGCTGCTCCAGGG	0.562																																							uc003bcj.1		NA																	0				ovary(4)|skin(1)	5						c.(2908-2910)GCA>TCA		transcription factor 20 isoform 1							94.0	92.0	93.0					22																	42608404		2203	4300	6503	SO:0001583	missense	6942				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chr22:42608404C>A	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.2908G>T	22.37:g.42608404C>A	ENSP00000352463:p.Ala970Ser					TCF20_uc003bck.1_Missense_Mutation_p.A970S|TCF20_uc003bnt.2_Missense_Mutation_p.A970S	p.A970S	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN			1	3042	-			970					A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	c.2908G>T	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234786	0.58886	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.60171	0.21;0.21	5.24	5.24	0.73138	.	0.165410	0.43110	D	0.000610	T	0.54319	0.1851	N	0.19112	0.55	0.80722	D	1	D;D	0.60575	0.988;0.979	P;P	0.54815	0.761;0.581	T	0.57676	-0.7770	10	0.62326	D	0.03	-12.8079	12.3505	0.55144	0.0:0.9234:0.0:0.0766	.	970;970	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	S	970	ENSP00000352463:A970S;ENSP00000335561:A970S	ENSP00000335561:A970S	A	-	1	0	TCF20	40938348	1.000000	0.71417	0.984000	0.44739	0.925000	0.55904	2.815000	0.48018	2.728000	0.93425	0.655000	0.94253	GCA		0.562	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		27	44	1	0	7.26314e-15	0.007291	1.3767e-14	27	44				
CHL1	10752	broad.mit.edu	37	3	432804	432804	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:432804C>T	ENST00000256509.2	+	22	3395	c.2753C>T	c.(2752-2754)cCt>cTt	p.P918L	CHL1_ENST00000397491.2_Missense_Mutation_p.P902L	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GGAGCTGGTCCTGAAAGTGAG	0.383																																							uc003bou.2		NA																	0				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(2704-2706)CCT>CTT		cell adhesion molecule with homology to L1CAM							83.0	88.0	87.0					3																	432804		2203	4299	6502	SO:0001583	missense	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:432804C>T	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2753C>T	3.37:g.432804C>T	ENSP00000256509:p.Pro918Leu					CHL1_uc003bot.2_Missense_Mutation_p.P918L|CHL1_uc003bow.1_Missense_Mutation_p.P902L|CHL1_uc011asi.1_Missense_Mutation_p.P918L	p.P902L	NM_006614	NP_006605	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	21	2976	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	902			Fibronectin type-III 3.|Extracellular (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	c.2705C>T	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	C	31	5.061904	0.93846	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.59772	0.24;0.24	5.75	5.75	0.90469	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81931	0.4927	M	0.89785	3.06	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;0.999;1.0	D	0.84909	0.0847	10	0.87932	D	0	.	19.9244	0.97099	0.0:1.0:0.0:0.0	.	902;902;918	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	L	918;902	ENSP00000256509:P918L;ENSP00000380628:P902L	ENSP00000256509:P918L	P	+	2	0	CHL1	407804	1.000000	0.71417	0.968000	0.41197	0.990000	0.78478	7.087000	0.76893	2.712000	0.92718	0.655000	0.94253	CCT		0.383	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		19	27	0	0	0	0.008871	0	19	27				
CNTN4	152330	broad.mit.edu	37	3	2861215	2861215	+	Missense_Mutation	SNP	G	G	T	rs377113483		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:2861215G>T	ENST00000397461.1	+	6	788	c.404G>T	c.(403-405)cGt>cTt	p.R135L	CNTN4_ENST00000427331.1_Missense_Mutation_p.R135L|CNTN4_ENST00000418658.1_Missense_Mutation_p.R135L	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	135	Ig-like C2-type 2.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GTGTCTGTCCGTCGAGGTCAA	0.403																																							uc003bpc.2		NA																	0				large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7						c.(403-405)CGT>CTT		contactin 4 isoform a precursor							115.0	112.0	113.0					3																	2861215		1950	4144	6094	SO:0001583	missense	152330				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding	g.chr3:2861215G>T	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.404G>T	3.37:g.2861215G>T	ENSP00000380602:p.Arg135Leu					CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Missense_Mutation_p.R135L	p.R135L	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)	6	625	+		Ovarian(110;0.156)	135			Ig-like C2-type 2.		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	c.404G>T	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	G	34	5.389773	0.95988	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331	T;T;T	0.67523	-0.27;-0.27;-0.27	5.86	5.86	0.93980	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75496	0.3857	M	0.66439	2.03	0.80722	D	1	B;D	0.54207	0.427;0.965	B;P	0.52856	0.237;0.711	T	0.76948	-0.2770	10	0.59425	D	0.04	.	17.1044	0.86658	0.0:0.0:1.0:0.0	.	135;135	B3KTK4;Q8IWV2	.;CNTN4_HUMAN	L	135	ENSP00000396010:R135L;ENSP00000380602:R135L;ENSP00000413642:R135L	ENSP00000380602:R135L	R	+	2	0	CNTN4	2836215	1.000000	0.71417	0.881000	0.34555	0.996000	0.88848	7.506000	0.81665	2.765000	0.95021	0.655000	0.94253	CGT		0.403	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			19	30	1	0	1.55795e-14	0.001882	2.92641e-14	19	30				
EDEM1	9695	broad.mit.edu	37	3	5244822	5244822	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:5244822A>G	ENST00000256497.4	+	5	1163	c.1030A>G	c.(1030-1032)Aca>Gca	p.T344A	EDEM1_ENST00000445686.1_Missense_Mutation_p.T149A	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	344					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		GAGCAATGATACAGGATTACT	0.537																																							uc003bqi.2		NA																	0				ovary(2)|breast(1)	3						c.(1030-1032)ACA>GCA		ER degradation enhancer, mannosidase alpha-like							108.0	112.0	110.0					3																	5244822		2203	4300	6503	SO:0001583	missense	9695				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding	g.chr3:5244822A>G	D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1030A>G	3.37:g.5244822A>G	ENSP00000256497:p.Thr344Ala					EDEM1_uc011asz.1_Missense_Mutation_p.T122A|EDEM1_uc003bqh.2_Missense_Mutation_p.T344A	p.T344A	NM_014674	NP_055489	Q92611	EDEM1_HUMAN		Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)	5	1162	+			344			Lumenal (Potential).		A8K9C8|B4DXP3	Missense_Mutation	SNP	ENST00000256497.4	37	c.1030A>G	CCDS33686.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.672526	0.47781	.	.	ENSG00000134109	ENST00000419550;ENST00000256497;ENST00000445686	T;T	0.71698	-0.59;-0.59	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.78528	0.4297	L	0.60957	1.885	0.80722	D	1	D;P;B	0.76494	0.999;0.771;0.417	D;P;B	0.68943	0.961;0.574;0.261	T	0.74287	-0.3714	10	0.09084	T	0.74	-13.4608	15.4887	0.75587	1.0:0.0:0.0:0.0	.	149;344;122	B4DXP3;Q92611;B4DPV5	.;EDEM1_HUMAN;.	A	122;344;149	ENSP00000256497:T344A;ENSP00000394099:T149A	ENSP00000256497:T344A	T	+	1	0	EDEM1	5219822	1.000000	0.71417	0.336000	0.25522	0.399000	0.30720	8.768000	0.91737	2.048000	0.60808	0.528000	0.53228	ACA		0.537	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337566.2	NM_014674		38	55	0	0	0	0.004878	0	38	55				
DCLK3	85443	broad.mit.edu	37	3	36779795	36779795	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:36779795G>T	ENST00000416516.2	-	2	846	c.356C>A	c.(355-357)gCa>gAa	p.A119E		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	119						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						CTCTCCCCTTGCGTGCCTCTC	0.572																																							uc003cgi.2		NA																	0				lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						c.(355-357)GCA>GAA		doublecortin-like kinase 3							137.0	138.0	138.0					3																	36779795		1880	4099	5979	SO:0001583	missense	85443					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr3:36779795G>T	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.356C>A	3.37:g.36779795G>T	ENSP00000394484:p.Ala119Glu						p.A119E	NM_033403	NP_208382	Q9C098	DCLK3_HUMAN			2	847	-			119						Missense_Mutation	SNP	ENST00000416516.2	37	c.356C>A	CCDS43064.1	.	.	.	.	.	.	.	.	.	.	G	4.704	0.130833	0.08981	.	.	ENSG00000163673	ENST00000416516	T	0.67345	-0.26	4.7	2.88	0.33553	.	0.546948	0.13814	N	0.360909	T	0.50582	0.1624	L	0.32530	0.975	0.09310	N	1	B	0.18461	0.028	B	0.12156	0.007	T	0.43442	-0.9391	10	0.52906	T	0.07	.	4.1471	0.10220	0.2996:0.1747:0.5257:0.0	.	119	Q9C098	DCLK3_HUMAN	E	119	ENSP00000394484:A119E	ENSP00000394484:A119E	A	-	2	0	DCLK3	36754799	0.000000	0.05858	0.001000	0.08648	0.327000	0.28475	0.265000	0.18515	0.513000	0.28278	0.655000	0.94253	GCA		0.572	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355		66	96	1	0	1.74474e-33	0.00361	3.93275e-33	66	96				
CTNNB1	1499	broad.mit.edu	37	3	41266113	41266113	+	Missense_Mutation	SNP	C	C	T	rs121913416|rs121913403		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:41266113C>T	ENST00000349496.5	+	3	390	c.110C>T	c.(109-111)tCt>tTt	p.S37F	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S37F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S37F|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S37F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S30F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	37			S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes). {ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> C (in PTR, hepatoblastoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:9927029}.|S -> F (in PTR). {ECO:0000269|PubMed:10192393}.|S -> Y (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|SG -> W (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S37F(172)|p.S37C(141)|p.A5_A80del(53)|p.S37Y(31)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.S37_G38>W(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GGAATCCATTCTGGTGCCACT	0.498	S37C(JHUEM2_ENDOMETRIUM)|S37C(SNU398_LIVER)|S37F(HUTU80_SMALL_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)	Colon(6;3 56 14213 18255)	uc010hia.1	S37F(HUTU80_SMALL_INTESTINE)|S37C(SNU398_LIVER)|S37C(JHUEM2_ENDOMETRIUM)	15		Dom	yes		3	3p22-p21.3	1499	H|Mis|T	"""catenin (cadherin-associated protein), beta 1"""			"""E, M, O"""	PLAG1		colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma	CTNNB1/PLAG1(60)	474	Substitution - Missense(344)|Deletion - In frame(102)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	p.S37F(147)|p.S37C(124)|p.A5_A80del(63)|p.S37A(59)|p.S37Y(23)|p.S37P(16)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.Q28_H134del(5)|p.W25_I140del(4)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32_S47del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.V22_G80>NNNNN(1)|p.GIHS34?(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.V22_T102del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.E9_A80del(1)|p.G34_S37del(1)|p.I35_S37>T(1)|p.I35_K170del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.S37S(1)|p.S37T(1)|p.V22_S71>A(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.V22_Y64del(1)|p.M8_A80del(1)|p.S33_S37del(1)|p.E9_I140del(1)|p.Y30_T40del(1)|p.M1_T42del(1)|p.S37_G38>W(1)|p.A5_Q143>E(1)|p.I35_G38del(1)|p.H36_E53>L(1)|p.A5_Q72del(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.S37_A39>S(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.I35_T41del(1)|p.W25_A80del(1)|p.A20_Q72del(1)|p.A20_S111del(1)	liver(145)|endometrium(64)|stomach(38)|skin(34)|ovary(33)|central_nervous_system(28)|pancreas(28)|large_intestine(22)|pituitary(22)|lung(21)|biliary_tract(15)|thyroid(4)|soft_tissue(4)|urinary_tract(4)|small_intestine(3)|oesophagus(3)|adrenal_gland(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|bone(1)|breast(1)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166						c.(109-111)TCT>TTT		beta-catenin	Lithium(DB01356)						93.0	78.0	83.0					3																	41266113		2203	4300	6503	SO:0001583	missense	1499	Pilomatrixoma_Familial_Clustering_of	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	g.chr3:41266113C>T	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.110C>T	3.37:g.41266113C>T	ENSP00000344456:p.Ser37Phe					CTNNB1_uc003ckp.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckq.2_Missense_Mutation_p.S37F|CTNNB1_uc003ckr.2_Missense_Mutation_p.S37F|CTNNB1_uc011azf.1_Missense_Mutation_p.S30F|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	p.S37F	NM_001904	NP_001895	P35222	CTNB1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	4	266	+			37		S -> C (in PTR, hepatoblastoma and ovarian cancer).|SG -> W (in hepatocellular carcinoma).|S -> F (in PTR).|S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes).|S -> Y (in hepatocellular carcinoma).			A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	c.110C>T	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513375	0.85389	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72819	0.3508	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75297	-0.3367	10	0.87932	D	0	-15.9763	19.9596	0.97236	0.0:1.0:0.0:0.0	.	37	P35222	CTNB1_HUMAN	F	30;37;37;37;37;30;37;37;37	ENSP00000400508:S30F;ENSP00000385604:S37F;ENSP00000412219:S37F;ENSP00000379486:S37F;ENSP00000344456:S37F;ENSP00000411226:S30F;ENSP00000379488:S37F;ENSP00000409302:S37F;ENSP00000401599:S37F	ENSP00000344456:S37F	S	+	2	0	CTNNB1	41241117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210		14	19	0	0	0	0.001855	0	14	19				
ZNF35	7584	broad.mit.edu	37	3	44700297	44700297	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:44700297C>T	ENST00000396056.2	+	4	677	c.442C>T	c.(442-444)Caa>Taa	p.Q148*	ZNF35_ENST00000399560.2_Silent_p.L99L|ZNF35_ENST00000453164.1_Silent_p.L99L|ZNF35_ENST00000542250.1_5'UTR|RP11-944L7.4_ENST00000457331.1_RNA|ZNF35_ENST00000296092.3_Silent_p.L99L	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	148	Globular domain.				cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		AGCTGATCCTCAAGGACCTGA	0.388																																							uc003cnq.2		NA																	0					0						c.(442-444)CAA>TAA		zinc finger protein 35							76.0	78.0	77.0					3																	44700297		2203	4300	6503	SO:0001587	stop_gained	7584				cellular response to retinoic acid|spermatogenesis	nucleus|perinuclear region of cytoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44700297C>T	X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.442C>T	3.37:g.44700297C>T	ENSP00000379368:p.Gln148*					ZNF35_uc003cnr.2_5'UTR	p.Q148*	NM_003420	NP_003411	P13682	ZNF35_HUMAN		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	4	663	+		Ovarian(412;0.0228)	148			Globular domain.		B2RBU6|Q53Y54|Q96D01	Nonsense_Mutation	SNP	ENST00000396056.2	37	c.442C>T	CCDS2718.2	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381070	0.24944	.	.	ENSG00000169981	ENST00000396056	.	.	.	3.86	1.93	0.25924	.	0.728871	0.11917	N	0.517038	.	.	.	.	.	.	0.19300	N	0.999974	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	1.0E-4	8.1189	0.30959	0.1636:0.6074:0.229:0.0	.	.	.	.	X	148	.	ENSP00000379368:Q148X	Q	+	1	0	ZNF35	44675301	0.002000	0.14202	0.000000	0.03702	0.354000	0.29330	0.828000	0.27435	0.506000	0.28125	0.650000	0.86243	CAA		0.388	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256749.4	NM_003420		6	47	0	0	0	0.00308	0	6	47				
ZNF501	115560	broad.mit.edu	37	3	44775979	44775979	+	Silent	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:44775979A>G	ENST00000396048.2	+	3	503	c.66A>G	c.(64-66)tcA>tcG	p.S22S		NM_001258280.1|NM_145044.3	NP_001245209.1|NP_659481.2	Q96CX3	ZN501_HUMAN	zinc finger protein 501	22					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00843)|KIRC - Kidney renal clear cell carcinoma(197;0.0463)|Kidney(197;0.0579)		AGAAACCTTCAAAGTGTAGTG	0.413																																							uc003cnu.1		NA																	0					0						c.(64-66)TCA>TCG		zinc finger protein 501							100.0	101.0	101.0					3																	44775979		2105	4262	6367	SO:0001819	synonymous_variant	115560				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:44775979A>G	BC013762	CCDS2720.2	3p21.32	2013-01-08			ENSG00000186446	ENSG00000186446		"""Zinc fingers, C2H2-type"""	23717	protein-coding gene	gene with protein product			"""zinc finger protein 52"""	ZNF52		1505991	Standard	NM_145044		Approved	MGC21738	uc003cnu.2	Q96CX3	OTTHUMG00000133048	ENST00000396048.2:c.66A>G	3.37:g.44775979A>G						ZNF501_uc003cnv.1_Silent_p.S22S	p.S22S	NM_145044	NP_659481	Q96CX3	ZN501_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00843)|KIRC - Kidney renal clear cell carcinoma(197;0.0463)|Kidney(197;0.0579)	3	467	+			22			C2H2-type 1.		B4DLY7|Q96NU9	Silent	SNP	ENST00000396048.2	37	c.66A>G	CCDS2720.2																																																																																				0.413	ZNF501-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256654.4	NM_145044		15	16	0	0	0	0.008871	0	15	16				
ALS2CL	259173	broad.mit.edu	37	3	46717892	46717892	+	Splice_Site	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:46717892C>A	ENST00000318962.4	-	19	2112	c.2029G>T	c.(2029-2031)Gct>Tct	p.A677S	ALS2CL_ENST00000415953.1_Splice_Site_p.A677S|ALS2CL_ENST00000383742.3_Splice_Site_p.A24S	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	677					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		TTGCTCAGAGCCTGGGCCAGT	0.592																																							uc003cqa.1		NA																	0				breast(2)|central_nervous_system(2)|skin(1)	5						c.(2029-2031)GCT>TCT		ALS2 C-terminal like isoform 1							61.0	60.0	60.0					3																	46717892		2203	4300	6503	SO:0001630	splice_region_variant	259173				endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr3:46717892C>A	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2029-1G>T	3.37:g.46717892C>A						ALS2CL_uc003cpx.1_Missense_Mutation_p.A24S|ALS2CL_uc003cpy.1_RNA|ALS2CL_uc003cpz.1_Missense_Mutation_p.A192S|ALS2CL_uc003cqb.1_Missense_Mutation_p.A677S|ALS2CL_uc003cqc.1_RNA	p.A677S	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)	19	2219	-			677					Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	37	c.2029G>T	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802064	0.90538	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.75704	-0.96;-0.96;-0.38	4.95	4.95	0.65309	.	0.000000	0.64402	D	0.000009	D	0.84524	0.5491	M	0.68952	2.095	0.58432	D	0.999994	D	0.76494	0.999	D	0.80764	0.994	D	0.86081	0.1544	10	0.87932	D	0	.	15.7347	0.77834	0.0:1.0:0.0:0.0	.	677	Q60I27	AL2CL_HUMAN	S	677;677;24	ENSP00000313670:A677S;ENSP00000413223:A677S;ENSP00000373248:A24S	ENSP00000313670:A677S	A	-	1	0	ALS2CL	46692896	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.824000	0.69279	2.593000	0.87608	0.561000	0.74099	GCT		0.592	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	Missense_Mutation	14	25	1	0	2.31682e-05	0.003163	3.43813e-05	14	25				
CCDC51	79714	broad.mit.edu	37	3	48474184	48474184	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:48474184C>T	ENST00000395694.2	-	4	955	c.870G>A	c.(868-870)ccG>ccA	p.P290P	CCDC51_ENST00000412398.2_Silent_p.P181P|CCDC51_ENST00000395696.1_Silent_p.P290P|PLXNB1_ENST00000296440.6_5'Flank|CCDC51_ENST00000442740.1_Silent_p.P181P|CCDC51_ENST00000447018.1_Silent_p.P181P|PLXNB1_ENST00000448774.2_5'Flank	NM_001256964.1	NP_001243893.1	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	290						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				endometrium(4)|kidney(4)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGTCTCTGGTCGGGGGACTAC	0.562																																							uc003csz.2		NA																	0					0						c.(868-870)CCG>CCA		coiled-coil domain containing 51							66.0	70.0	69.0					3																	48474184		1991	4159	6150	SO:0001819	synonymous_variant	79714					integral to membrane		g.chr3:48474184C>T	AK022498	CCDS2766.2, CCDS58830.1	3p21.31	2005-12-30			ENSG00000164051	ENSG00000164051			25714	protein-coding gene	gene with protein product						12477932	Standard	NM_001256964		Approved	FLJ12436	uc003ctc.3	Q96ER9	OTTHUMG00000133534	ENST00000395694.2:c.870G>A	3.37:g.48474184C>T						PLXNB1_uc003csx.2_5'Flank|CCDC51_uc003cta.2_Silent_p.P181P|CCDC51_uc003ctb.2_Silent_p.P181P|CCDC51_uc003ctc.2_Silent_p.P290P|CCDC51_uc003ctd.2_Silent_p.P181P	p.P290P	NM_024661	NP_078937	Q96ER9	CCD51_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	4	991	-			290					Q9HA01	Silent	SNP	ENST00000395694.2	37	c.870G>A	CCDS2766.2																																																																																				0.562	CCDC51-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344599.2	NM_024661		21	57	0	0	0	0.001882	0	21	57				
P4HTM	54681	broad.mit.edu	37	3	49043295	49043295	+	Missense_Mutation	SNP	G	G	A	rs375065412		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:49043295G>A	ENST00000383729.4	+	7	1530	c.1159G>A	c.(1159-1161)Gaa>Aaa	p.E387K	WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000415265.2_5'Flank|WDR6_ENST00000608424.1_5'Flank|WDR6_ENST00000448293.1_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.E448K	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	387	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	AACCTACGATGAAATGGTAAG	0.498																																							uc003cvg.2		NA																	0				skin(1)|pancreas(1)	2						c.(1159-1161)GAA>AAA		hypoxia-inducible factor prolyl 4-hydroxylase	Vitamin C(DB00126)						116.0	117.0	117.0					3																	49043295		2203	4300	6503	SO:0001583	missense	54681					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr3:49043295G>A		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.1159G>A	3.37:g.49043295G>A	ENSP00000373235:p.Glu387Lys					P4HTM_uc003cvh.2_Missense_Mutation_p.E448K|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	p.E387K	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN			7	1508	+			387			Lumenal (Potential).|Fe2OG dioxygenase.		Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	37	c.1159G>A	CCDS43089.1	.	.	.	.	.	.	.	.	.	.	G	33	5.220831	0.95139	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	T	0.79033	-1.23	5.28	5.28	0.74379	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.84215	0.5423	L	0.44542	1.39	0.48571	D	0.999675	D;D	0.89917	0.997;1.0	D;D	0.87578	0.981;0.998	T	0.81048	-0.1109	10	0.27785	T	0.31	-16.9931	19.2637	0.93979	0.0:0.0:1.0:0.0	.	448;387	Q9NXG6-3;Q9NXG6	.;P4HTM_HUMAN	K	387;448	ENSP00000373235:E387K	ENSP00000341422:E448K	E	+	1	0	P4HTM	49018299	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.420000	0.80191	2.611000	0.88343	0.563000	0.77884	GAA		0.498	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938		10	124	0	0	0	0.000978	0	10	124				
FEZF2	55079	broad.mit.edu	37	3	62358282	62358282	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:62358282G>T	ENST00000283268.3	-	2	556	c.262C>A	c.(262-264)Ctg>Atg	p.L88M	FEZF2_ENST00000475839.1_Missense_Mutation_p.L88M|FEZF2_ENST00000486811.1_Missense_Mutation_p.L88M	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	88					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		TAACTGAGCAGTGTCTTTGAC	0.716																																					NSCLC(170;1772 2053 12525 15604 23984)	NSCLC(170;1772 2053 12525 15604 23984)	uc003dlh.2		NA																	0				lung(1)	1						c.(262-264)CTG>ATG		FEZ family zinc finger 2							30.0	33.0	32.0					3																	62358282		2203	4300	6503	SO:0001583	missense	55079				transcription, DNA-dependent	nucleus	zinc ion binding	g.chr3:62358282G>T	AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.262C>A	3.37:g.62358282G>T	ENSP00000283268:p.Leu88Met					FEZF2_uc003dli.2_Missense_Mutation_p.L88M	p.L88M	NM_018008	NP_060478	Q8TBJ5	FEZF2_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)	1	469	-		Lung SC(41;0.0262)	88					A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	ENST00000283268.3	37	c.262C>A	CCDS2897.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901218	0.52227	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	T;T;T	0.08546	3.08;3.08;3.08	5.1	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	M	0.64997	1.995	0.58432	D	0.999998	D	0.71674	0.998	D	0.80764	0.994	T	0.00373	-1.1781	10	0.34782	T	0.22	-10.3679	12.6385	0.56696	0.081:0.0:0.919:0.0	.	88	Q8TBJ5	FEZF2_HUMAN	M	88	ENSP00000418589:L88M;ENSP00000283268:L88M;ENSP00000418804:L88M	ENSP00000283268:L88M	L	-	1	2	FEZF2	62333322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.916000	0.48813	2.399000	0.81585	0.555000	0.69702	CTG		0.716	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008		15	27	1	0	1.01871e-10	0.008871	1.77742e-10	15	27				
CFAP44	55779	broad.mit.edu	37	3	113084966	113084966	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:113084966C>T	ENST00000295868.2	-	19	2797	c.2635G>A	c.(2635-2637)Gat>Aat	p.D879N	WDR52_ENST00000393845.2_Missense_Mutation_p.D879N	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						ATATTGCCATCTGCTCCAGCA	0.363																																							uc003eae.1		NA																	0				central_nervous_system(1)	1						c.(2635-2637)GAT>AAT		WD repeat domain 52 isoform 2							94.0	97.0	96.0					3																	113084966		2203	4300	6503	SO:0001583	missense	55779							g.chr3:113084966C>T																												ENST00000295868.2:c.2635G>A	3.37:g.113084966C>T	ENSP00000295868:p.Asp879Asn					WDR52_uc003ead.1_Missense_Mutation_p.D60N	p.D879N	NM_018338	NP_060808	Q96MT7	WDR52_HUMAN			19	2681	-			879			WD 9.			Missense_Mutation	SNP	ENST00000295868.2	37	c.2635G>A	CCDS2972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.44|18.44	3.623694|3.623694	0.66901|0.66901	.|.	.|.	ENSG00000206530|ENSG00000206530	ENST00000393845;ENST00000295868|ENST00000465636	T;T|.	0.26957|.	1.7;1.7|.	5.59|5.59	5.59|5.59	0.84812|0.84812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	25.513800|.	0.00166|.	U|.	0.000003|.	T|T	0.79476|0.79476	0.4452|0.4452	M|M	0.83603|0.83603	2.65|2.65	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	T|T	0.80322|0.80322	-0.1431|-0.1431	10|5	0.87932|.	D|.	0|.	-8.276|-8.276	17.733|17.733	0.88384|0.88384	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	879;879|.	Q96MT7;Q96MT7-2|.	WDR52_HUMAN;.|.	N|K	879|15	ENSP00000377428:D879N;ENSP00000295868:D879N|.	ENSP00000295868:D879N|.	D|R	-|-	1|2	0|0	WDR52|WDR52	114567656|114567656	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.101000|0.101000	0.19017|0.19017	5.523000|5.523000	0.67099|0.67099	2.793000|2.793000	0.96121|0.96121	0.650000|0.650000	0.86243|0.86243	GAT|AGA		0.363	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3			7	52	0	0	0	0.001984	0	7	52				
FGF12	2257	broad.mit.edu	37	3	192125822	192125822	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:192125822C>T	ENST00000454309.2	-	1	1016	c.191G>A	c.(190-192)cGg>cAg	p.R64Q	FGF12_ENST00000264730.3_Intron|FGF12_ENST00000445105.2_Intron|FGF12_ENST00000430714.1_Intron|FGF12_ENST00000450716.1_Intron	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	64					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)			endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		ACCTGGTCTCCGCCTCACCGG	0.667																																							uc003fsx.2		NA																	0				ovary(1)|skin(1)|lung(1)|pancreas(1)	4						c.(190-192)CGG>CAG		fibroblast growth factor 12 isoform 1							69.0	80.0	76.0					3																	192125822		2165	4224	6389	SO:0001583	missense	2257				cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding	g.chr3:192125822C>T	U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.191G>A	3.37:g.192125822C>T	ENSP00000413496:p.Arg64Gln					FGF12_uc003fsy.2_Intron	p.R64Q	NM_021032	NP_066360	P61328	FGF12_HUMAN	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)	1	1017	-	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	64					B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Missense_Mutation	SNP	ENST00000454309.2	37	c.191G>A	CCDS3301.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957372	0.73902	.	.	ENSG00000114279	ENST00000454309	T	0.77877	-1.13	5.32	5.32	0.75619	.	0.000000	0.30584	U	0.009317	T	0.75347	0.3837	M	0.64404	1.975	0.80722	D	1	P	0.46656	0.882	B	0.38156	0.266	T	0.78529	-0.2169	10	0.46703	T	0.11	.	17.9852	0.89154	0.0:1.0:0.0:0.0	.	64	P61328	FGF12_HUMAN	Q	64	ENSP00000413496:R64Q	ENSP00000413496:R64Q	R	-	2	0	FGF12	193608516	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.263000	0.78421	2.490000	0.84030	0.555000	0.69702	CGG		0.667	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032		13	112	0	0	0	0.004007	0	13	112				
ATP13A4	84239	broad.mit.edu	37	3	193132463	193132463	+	Silent	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:193132463G>C	ENST00000342695.4	-	26	3241	c.2919C>G	c.(2917-2919)ctC>ctG	p.L973L	ATP13A4_ENST00000400270.2_5'UTR|ATP13A4_ENST00000392443.3_Silent_p.L954L|ATP13A4_ENST00000482964.1_5'Flank	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	973						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		AAATCACAGAGAGTAGCAGAG	0.463																																							uc003ftd.2		NA																	0				ovary(2)	2						c.(2917-2919)CTC>CTG		ATPase type 13A4							85.0	76.0	80.0					3																	193132463		2203	4300	6503	SO:0001819	synonymous_variant	84239				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193132463G>C	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2919C>G	3.37:g.193132463G>C						ATP13A4_uc010hzi.2_RNA	p.L973L	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)	26	3027	-	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		973			Helical; (Potential).		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Silent	SNP	ENST00000342695.4	37	c.2919C>G	CCDS3304.2																																																																																				0.463	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279		6	8	0	0	0	0.001168	0	6	8				
MUC4	4585	broad.mit.edu	37	3	195489086	195489086	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:195489086C>A	ENST00000346145.4	-	13	1715	c.1676G>T	c.(1675-1677)cGc>cTc	p.R559L	MUC4_ENST00000475231.1_Missense_Mutation_p.R4743L|MUC4_ENST00000349607.4_Missense_Mutation_p.R508L|MUC4_ENST00000463781.3_Missense_Mutation_p.R4795L	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1552					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGCCGTTGCGGCTCAGGAG	0.697																																							uc011bto.1		NA																	0					0						c.(13999-14001)CGC>CTC		mucin 4 isoform a							26.0	23.0	24.0					3																	195489086		2196	4291	6487	SO:0001583	missense	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195489086C>A	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.1676G>T	3.37:g.195489086C>A	ENSP00000304207:p.Arg559Leu					MUC4_uc003fuz.2_Missense_Mutation_p.R393L|MUC4_uc003fva.2_Missense_Mutation_p.R275L|MUC4_uc003fvb.2_Missense_Mutation_p.R311L|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.R311L|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.R275L|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.R359L|MUC4_uc011bti.1_Missense_Mutation_p.R359L|MUC4_uc011btj.1_Missense_Mutation_p.R536L|MUC4_uc011btk.1_Missense_Mutation_p.R275L|MUC4_uc011btl.1_Missense_Mutation_p.R304L|MUC4_uc011btm.1_Missense_Mutation_p.R484L|MUC4_uc011btn.1_Missense_Mutation_p.R275L|MUC4_uc003fvo.2_Missense_Mutation_p.R559L|MUC4_uc003fvp.2_Missense_Mutation_p.R508L	p.R4667L	NM_018406	NP_060876	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	15	14460	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	1552			VWFD.		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	37	c.14000G>T	CCDS3310.1	.	.	.	.	.	.	.	.	.	.	.	6.020	0.372068	0.11409	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	4.78	0.261	0.15592	.	0.789651	0.11037	N	0.606505	T	0.53867	0.1823	N	0.20483	0.58	0.09310	N	1	D;P;P;P;P;P	0.63880	0.993;0.662;0.662;0.682;0.682;0.91	P;B;B;P;P;B	0.62089	0.898;0.198;0.338;0.482;0.482;0.304	T	0.46331	-0.9199	10	0.33940	T	0.23	-4.3189	7.7379	0.28825	0.0:0.4765:0.0:0.5235	.	4667;508;559;4795;4743;1500	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	L	508;559;4795;4743	ENSP00000338109:R508L;ENSP00000304207:R559L;ENSP00000417498:R4795L;ENSP00000420243:R4743L	ENSP00000304207:R559L	R	-	2	0	MUC4	196974757	0.007000	0.16637	0.316000	0.25252	0.010000	0.07245	-0.316000	0.08071	0.103000	0.17682	-0.263000	0.10527	CGC		0.697	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406		3	3	1	0	0.004672	0.004672	0.0064725	3	3				
RGS12	6002	broad.mit.edu	37	4	3319586	3319586	+	Silent	SNP	C	C	T	rs373897318		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:3319586C>T	ENST00000344733.5	+	2	2593	c.1689C>T	c.(1687-1689)ggC>ggT	p.G563G	RGS12_ENST00000336727.3_Silent_p.G563G|RGS12_ENST00000543385.1_Silent_p.G563G|RGS12_ENST00000382788.3_Silent_p.G563G	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	563					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCACCGATGGCTGGTCCAGCA	0.642																																							uc003ggw.2		NA																	0				skin(1)	1						c.(1687-1689)GGC>GGT		regulator of G-protein signalling 12 isoform 1							53.0	61.0	58.0					4																	3319586		2203	4300	6503	SO:0001819	synonymous_variant	6002					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity	g.chr4:3319586C>T	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1689C>T	4.37:g.3319586C>T						RGS12_uc003ggu.2_Silent_p.G563G|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_RNA|RGS12_uc003ggv.2_Silent_p.G563G|RGS12_uc003ggx.1_Silent_p.G563G	p.G563G	NM_198229	NP_937872	O14924	RGS12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	2	2593	+			563					B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Silent	SNP	ENST00000344733.5	37	c.1689C>T	CCDS3366.1																																																																																				0.642	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926		19	51	0	0	0	0.007413	0	19	51				
SLC2A9	56606	broad.mit.edu	37	4	9909889	9909889	+	Silent	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:9909889C>A	ENST00000264784.3	-	8	1136	c.1083G>T	c.(1081-1083)ggG>ggT	p.G361G	SLC2A9_ENST00000506583.1_Silent_p.G332G|SLC2A9_ENST00000309065.3_Silent_p.G332G	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	361					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)	p.G332G(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	TCTCGATGCCCCCTGTACTCA	0.483																																							uc003gmc.2		NA																	1	Substitution - coding silent(1)	p.G332G(1)	ovary(1)	ovary(3)	3						c.(1081-1083)GGG>GGT		solute carrier family 2, member 9 protein							141.0	122.0	129.0					4																	9909889		2203	4300	6503	SO:0001819	synonymous_variant	56606				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity	g.chr4:9909889C>A	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.1083G>T	4.37:g.9909889C>A						SLC2A9_uc003gmd.2_Silent_p.G332G	p.G361G	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN			8	1144	-			361			Helical; Name=8; (Potential).		Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Silent	SNP	ENST00000264784.3	37	c.1083G>T	CCDS3407.1																																																																																				0.483	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1			11	23	1	0	7.03913e-09	0.001368	1.15564e-08	11	23				
SLIT2	9353	broad.mit.edu	37	4	20487859	20487859	+	Silent	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:20487859G>T	ENST00000504154.1	+	7	828	c.576G>T	c.(574-576)gtG>gtT	p.V192V	SLIT2_ENST00000503837.1_Silent_p.V192V|SLIT2_ENST00000273739.5_Silent_p.V192V|SLIT2_ENST00000503823.1_Silent_p.V192V	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	192					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GACTTTCTGTGGCAAGTTTCA	0.274																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(574-576)GTG>GTT		slit homolog 2 precursor							77.0	78.0	78.0					4																	20487859		2202	4299	6501	SO:0001819	synonymous_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20487859G>T	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.576G>T	4.37:g.20487859G>T						SLIT2_uc003gps.1_Silent_p.V192V	p.V192V	NM_004787	NP_004778	O94813	SLIT2_HUMAN			7	780	+			192			LRR 6.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	c.576G>T	CCDS3426.1																																																																																				0.274	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			11	24	1	0	2.27111e-07	0.001368	3.52064e-07	11	24				
GABRA4	2557	broad.mit.edu	37	4	46994843	46994843	+	Splice_Site	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:46994843A>T	ENST00000264318.3	-	2	1188		c.e2+1		GABRA4_ENST00000509316.1_5'UTR	NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4						central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	AATCGTTCATACCCCCAAATC	0.483																																					Ovarian(6;283 369 8234 12290 33402)	Ovarian(6;283 369 8234 12290 33402)	uc003gxg.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4						c.e2+1		gamma-aminobutyric acid A receptor, alpha 4	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						138.0	123.0	128.0					4																	46994843		2203	4300	6503	SO:0001630	splice_region_variant	2557				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46994843A>T		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.205+1T>A	4.37:g.46994843A>T							p.G69_splice	NM_000809	NP_000800	P48169	GBRA4_HUMAN			2	344	-								Q8IYR7	Splice_Site	SNP	ENST00000264318.3	37	c.205_splice	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	A	11.32	1.604736	0.28623	.	.	ENSG00000109158	ENST00000264318	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1044	0.53803	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GABRA4	46689600	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	8.143000	0.89621	2.116000	0.64780	0.377000	0.23210	.		0.483	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		Intron	9	20	0	0	0	0.004482	0	9	20				
ADH4	127	broad.mit.edu	37	4	100048406	100048406	+	Silent	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:100048406T>C	ENST00000265512.7	-	7	1007	c.933A>G	c.(931-933)ccA>ccG	p.P311P	ADH4_ENST00000505590.1_Silent_p.P330P|ADH4_ENST00000423445.1_Silent_p.P330P|ADH4_ENST00000508393.1_Silent_p.P330P|RP11-696N14.1_ENST00000500358.2_RNA	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	311					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		TTAGCTCCTCTGGAAAAATAG	0.408																																							uc003hun.2		NA																	0				skin(2)	2						c.(931-933)CCA>CCG		class II alcohol dehydrogenase, pi subunit	NADH(DB00157)						88.0	88.0	88.0					4																	100048406		2203	4300	6503	SO:0001819	synonymous_variant	127				alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding	g.chr4:100048406T>C	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.933A>G	4.37:g.100048406T>C						uc003hum.1_Intron|ADH4_uc011ced.1_Silent_p.P330P	p.P311P	NM_000670	NP_000661	P08319	ADH4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	7	1009	-			311					A8K470|B4DIE7|C9J4A9|Q8TCD7	Silent	SNP	ENST00000265512.7	37	c.933A>G	CCDS34032.1																																																																																				0.408	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670		19	26	0	0	0	0.001523	0	19	26				
DNAJB14	79982	broad.mit.edu	37	4	100822192	100822192	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:100822192C>T	ENST00000442697.2	-	8	1287	c.1133G>A	c.(1132-1134)gGa>gAa	p.G378E		NM_001031723.2|NM_001278310.1	NP_001026893.1|NP_001265239.1	Q8TBM8	DJB14_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 14	378						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(123;4.59e-09)		AGTTCATCCTCCTTTATAAAG	0.378																																							uc003hvl.2		NA																	0					0						c.(1132-1134)GGA>GAA		DnaJ (Hsp40) homolog, subfamily B, member 14							81.0	80.0	80.0					4																	100822192		2203	4300	6503	SO:0001583	missense	79982				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding	g.chr4:100822192C>T	BC022248	CCDS34035.1, CCDS75171.1	4q23	2011-09-02			ENSG00000164031	ENSG00000164031		"""Heat shock proteins / DNAJ (HSP40)"""	25881	protein-coding gene	gene with protein product							Standard	NM_001031723		Approved	FLJ14281	uc003hvl.4	Q8TBM8	OTTHUMG00000131049	ENST00000442697.2:c.1133G>A	4.37:g.100822192C>T	ENSP00000404381:p.Gly378Glu					DNAJB14_uc003hvk.2_Missense_Mutation_p.G293E|DNAJB14_uc010ili.2_Missense_Mutation_p.G311E	p.G378E	NM_001031723	NP_001026893	Q8TBM8	DJB14_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.59e-09)	8	1284	-			378					Q6UXN1|Q7Z3P0|Q86TA7|Q86TM0|Q9GZU9	Missense_Mutation	SNP	ENST00000442697.2	37	c.1133G>A	CCDS34035.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484700	0.84854	.	.	ENSG00000164031	ENST00000442697	T	0.64803	-0.12	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.78805	0.4341	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.79607	-0.1733	10	0.87932	D	0	.	19.8579	0.96771	0.0:1.0:0.0:0.0	.	378;293	Q8TBM8;Q8TBM8-2	DJB14_HUMAN;.	E	378	ENSP00000404381:G378E	ENSP00000404381:G378E	G	-	2	0	DNAJB14	101041215	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.001000	0.76297	2.687000	0.91594	0.655000	0.94253	GGA		0.378	DNAJB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253696.2	NM_001031723.2		4	49	0	0	0	0.000602	0	4	49				
SEC24B	10427	broad.mit.edu	37	4	110394165	110394165	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:110394165G>A	ENST00000265175.5	+	3	938	c.883G>A	c.(883-885)Gat>Aat	p.D295N	SEC24B_ENST00000399100.2_Missense_Mutation_p.D295N|SEC24B_ENST00000504968.2_Missense_Mutation_p.D326N	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	295					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTCAGTTGCAGATTCTTTATC	0.338																																							uc003hzk.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(883-885)GAT>AAT		SEC24 (S. cerevisiae) homolog B isoform a							122.0	107.0	111.0					4																	110394165		1829	4090	5919	SO:0001583	missense	10427				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding	g.chr4:110394165G>A	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.883G>A	4.37:g.110394165G>A	ENSP00000265175:p.Asp295Asn					SEC24B_uc003hzl.2_Missense_Mutation_p.D295N|SEC24B_uc011cfp.1_Missense_Mutation_p.D326N|SEC24B_uc011cfq.1_Missense_Mutation_p.D295N|SEC24B_uc011cfr.1_Missense_Mutation_p.D295N	p.D295N	NM_006323	NP_006314	O95487	SC24B_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)	3	938	+		Hepatocellular(203;0.217)	295					B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	c.883G>A	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755082	0.31046	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.78364	-0.96;-1.17;-1.14	5.58	5.58	0.84498	.	3.151410	0.01104	N	0.005443	T	0.72748	0.3499	N	0.14661	0.345	0.32175	N	0.581082	B;B;B;B	0.29301	0.155;0.155;0.241;0.155	B;B;B;B	0.36845	0.117;0.117;0.234;0.117	T	0.54344	-0.8308	10	0.16896	T	0.51	-4.1998	16.3071	0.82852	0.0:0.0:1.0:0.0	.	245;326;295;295	B4DTM6;B7ZKM8;O95487-2;O95487	.;.;.;SC24B_HUMAN	N	326;295;295	ENSP00000428564:D326N;ENSP00000382051:D295N;ENSP00000265175:D295N	ENSP00000265175:D295N	D	+	1	0	SEC24B	110613614	1.000000	0.71417	0.986000	0.45419	0.503000	0.33858	5.483000	0.66838	2.611000	0.88343	0.655000	0.94253	GAT		0.338	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2			7	52	0	0	0	0.00308	0	7	52				
KIAA0922	23240	broad.mit.edu	37	4	154556719	154556719	+	Missense_Mutation	SNP	C	C	G	rs201480266		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:154556719C>G	ENST00000409663.3	+	34	4602	c.4550C>G	c.(4549-4551)tCt>tGt	p.S1517C	KIAA0922_ENST00000440693.1_Missense_Mutation_p.S1434C|KIAA0922_ENST00000409959.3_Missense_Mutation_p.S1518C	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1517						integral component of membrane (GO:0016021)		p.S1518F(1)|p.S1370F(1)		breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TTCATCAGCTCTCCGGTCAGT	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		19543	0.0		0.001	False		,,,				2504	0.0						uc003inm.3		NA																	2	Substitution - Missense(2)		breast(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(4549-4551)TCT>TGT		hypothetical protein LOC23240 isoform 2							106.0	76.0	86.0					4																	154556719		2203	4300	6503	SO:0001583	missense	23240					integral to membrane		g.chr4:154556719C>G	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4550C>G	4.37:g.154556719C>G	ENSP00000386574:p.Ser1517Cys					KIAA0922_uc010ipp.2_Missense_Mutation_p.S1518C|KIAA0922_uc010ipq.2_Missense_Mutation_p.S1286C	p.S1517C	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN			34	4602	+	all_hematologic(180;0.093)	Renal(120;0.118)	1517			Cytoplasmic (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	c.4550C>G	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611828	0.46631	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.25250	2.06;1.81;2.06;1.81	5.62	3.87	0.44632	.	0.493763	0.24942	N	0.034372	T	0.42810	0.1219	L	0.48642	1.525	0.43099	D	0.994781	D;D;D	0.76494	0.999;0.995;0.992	D;P;P	0.71656	0.974;0.839;0.695	T	0.31447	-0.9943	10	0.72032	D	0.01	-4.5687	13.7198	0.62720	0.405:0.595:0.0:0.0	.	1434;1518;1517	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	C	1517;1434;1518;1295	ENSP00000386574:S1517C;ENSP00000409663:S1434C;ENSP00000386787:S1518C;ENSP00000240487:S1295C	ENSP00000240487:S1295C	S	+	2	0	KIAA0922	154776169	0.366000	0.25014	0.983000	0.44433	0.983000	0.72400	1.367000	0.34204	0.692000	0.31613	0.655000	0.94253	TCT		0.532	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		8	20	0	0	0	0.00308	0	8	20				
TLL1	7092	broad.mit.edu	37	4	166999170	166999170	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:166999170C>T	ENST00000061240.2	+	18	3077	c.2430C>T	c.(2428-2430)caC>caT	p.H810H	TLL1_ENST00000507499.1_Silent_p.H833H	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	810	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CTCCTGGCCACCGAATCAAAT	0.463																																							uc003irh.1		NA																	0				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(2428-2430)CAC>CAT		tolloid-like 1 precursor							118.0	101.0	106.0					4																	166999170		2203	4300	6503	SO:0001819	synonymous_variant	7092				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr4:166999170C>T	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2430C>T	4.37:g.166999170C>T						TLL1_uc011cjn.1_Silent_p.H833H|TLL1_uc011cjo.1_Silent_p.H634H	p.H810H	NM_012464	NP_036596	O43897	TLL1_HUMAN		GBM - Glioblastoma multiforme(119;0.103)	18	3077	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	810			CUB 4.		B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	37	c.2430C>T	CCDS3811.1																																																																																				0.463	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1			18	24	0	0	0	0.006122	0	18	24				
ASB5	140458	broad.mit.edu	37	4	177136761	177136761	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr4:177136761T>A	ENST00000296525.3	-	7	1093	c.980A>T	c.(979-981)cAg>cTg	p.Q327L	ASB5_ENST00000512254.1_Missense_Mutation_p.Q274L	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	327	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		TTATCGATACTGTAAGAAATT	0.333																																							uc003iuq.1		NA																	0				skin(2)	2						c.(979-981)CAG>CTG		ankyrin repeat and SOCS box-containing protein							96.0	89.0	92.0					4																	177136761		2203	4300	6503	SO:0001583	missense	140458				intracellular signal transduction			g.chr4:177136761T>A	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.980A>T	4.37:g.177136761T>A	ENSP00000296525:p.Gln327Leu					ASB5_uc003iup.1_Missense_Mutation_p.Q274L	p.Q327L	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)	7	996	-		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	327			SOCS box.		Q8N7B5	Missense_Mutation	SNP	ENST00000296525.3	37	c.980A>T	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.306794	0.40795	.	.	ENSG00000164122	ENST00000296525;ENST00000512254	T;T	0.36699	1.24;1.24	5.26	5.26	0.73747	SOCS protein, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.41419	0.1158	N	0.17278	0.47	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.69824	0.966;0.966	T	0.23797	-1.0178	10	0.19590	T	0.45	-19.1762	15.1775	0.72924	0.0:0.0:0.0:1.0	.	327;274	Q8WWX0;Q8N7B5	ASB5_HUMAN;.	L	327;274	ENSP00000296525:Q327L;ENSP00000422877:Q274L	ENSP00000296525:Q327L	Q	-	2	0	ASB5	177373755	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.176000	0.65026	1.983000	0.57843	0.482000	0.46254	CAG		0.333	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1			8	13	0	0	0	0.00308	0	8	13				
ICE1	23379	broad.mit.edu	37	5	5457453	5457453	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:5457453G>T	ENST00000296564.7	+	12	922	c.700G>T	c.(700-702)Gcc>Tcc	p.A234S		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		234					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGAAAAACCTGCCAAAGCAAT	0.428																																							uc003jdm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(700-702)GCC>TCC		hypothetical protein LOC23379							35.0	35.0	35.0					5																	5457453		1965	4159	6124	SO:0001583	missense	23379							g.chr5:5457453G>T																												ENST00000296564.7:c.700G>T	5.37:g.5457453G>T	ENSP00000296564:p.Ala234Ser						p.A234S	NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN			12	922	+			234					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	c.700G>T	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	9.036	0.988529	0.18966	.	.	ENSG00000164151	ENST00000296564	T	0.11063	2.81	5.14	2.34	0.29019	.	0.508601	0.19914	N	0.103230	T	0.07863	0.0197	L	0.29908	0.895	0.21527	N	0.999652	B	0.30937	0.301	B	0.34489	0.184	T	0.30504	-0.9976	10	0.40728	T	0.16	-3.7942	5.072	0.14611	0.1775:0.0:0.6579:0.1645	.	234	Q9Y2F5	K0947_HUMAN	S	234	ENSP00000296564:A234S	ENSP00000296564:A234S	A	+	1	0	KIAA0947	5510453	0.990000	0.36364	0.537000	0.28052	0.102000	0.19082	1.158000	0.31737	0.182000	0.20032	-0.320000	0.08662	GCC		0.428	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			10	12	1	0	7.03913e-09	0.001368	1.15564e-08	10	12				
NSUN2	54888	broad.mit.edu	37	5	6605502	6605502	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:6605502G>A	ENST00000264670.6	-	15	1932	c.1621C>T	c.(1621-1623)Cct>Tct	p.P541S	NSUN2_ENST00000539938.1_Missense_Mutation_p.P305S|NSUN2_ENST00000506139.1_Missense_Mutation_p.P506S	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	541					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						GGGAATGAAGGATCCAAAGCA	0.383																																							uc003jdu.2		NA																	0				ovary(1)	1						c.(1621-1623)CCT>TCT		NOL1/NOP2/Sun domain family, member 2							126.0	131.0	129.0					5																	6605502		2203	4300	6503	SO:0001583	missense	54888					cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding	g.chr5:6605502G>A	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.1621C>T	5.37:g.6605502G>A	ENSP00000264670:p.Pro541Ser					NSUN2_uc003jds.2_5'Flank|NSUN2_uc003jdt.2_Missense_Mutation_p.P305S|NSUN2_uc011cmk.1_Missense_Mutation_p.P506S|NSUN2_uc003jdv.2_Missense_Mutation_p.P305S	p.P541S	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN			15	1686	-			541					A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	c.1621C>T	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	G	7.267	0.606450	0.14002	.	.	ENSG00000037474	ENST00000264670;ENST00000539938;ENST00000506139	T;T;T	0.55052	1.28;0.54;1.29	5.36	3.47	0.39725	.	0.093898	0.85682	N	0.000000	T	0.47432	0.1445	M	0.75447	2.3	0.58432	D	0.999999	B;B	0.25563	0.129;0.021	B;B	0.16289	0.014;0.015	T	0.35051	-0.9804	10	0.17369	T	0.5	-12.7902	10.2027	0.43094	0.077:0.1354:0.7876:0.0	.	506;541	B4DQW2;Q08J23	.;NSUN2_HUMAN	S	541;305;506	ENSP00000264670:P541S;ENSP00000444338:P305S;ENSP00000420957:P506S	ENSP00000264670:P541S	P	-	1	0	NSUN2	6658502	1.000000	0.71417	0.016000	0.15963	0.052000	0.14988	3.941000	0.56607	0.666000	0.31087	0.563000	0.77884	CCT		0.383	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755		7	69	0	0	0	0.00308	0	7	69				
CDH12	1010	broad.mit.edu	37	5	21783516	21783516	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:21783516G>T	ENST00000382254.1	-	11	2430	c.1344C>A	c.(1342-1344)gaC>gaA	p.D448E	CDH12_ENST00000504376.2_Missense_Mutation_p.D448E|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Missense_Mutation_p.D408E	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	448	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TGCTTTCTCTGTCTAGTAATT	0.368										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(1342-1344)GAC>GAA		cadherin 12, type 2 preproprotein							203.0	196.0	199.0					5																	21783516		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21783516G>T	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1344C>A	5.37:g.21783516G>T	ENSP00000371689:p.Asp448Glu	HNSCC(59;0.17)				CDH12_uc011cno.1_Missense_Mutation_p.D408E|CDH12_uc003jgk.2_Missense_Mutation_p.D448E	p.D448E	NM_004061	NP_004052	P55289	CAD12_HUMAN			8	1802	-			448			Extracellular (Potential).|Cadherin 4.		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.1344C>A	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.432220	0.83776	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.63255	-0.03;-0.03;-0.03	5.54	4.67	0.58626	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.86847	0.6031	H	0.98426	4.23	0.54753	D	0.99998	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.994	D	0.91590	0.5286	10	0.87932	D	0	.	14.2425	0.65966	0.0716:0.0:0.9284:0.0	.	408;448	B7Z2U6;P55289	.;CAD12_HUMAN	E	448;448;408	ENSP00000423577:D448E;ENSP00000371689:D448E;ENSP00000428786:D408E	ENSP00000371689:D448E	D	-	3	2	CDH12	21819273	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.754000	0.55189	1.338000	0.45544	0.655000	0.94253	GAC		0.368	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		32	75	1	0	2.61193e-14	0.001786	4.8842e-14	32	75				
ADAMTS12	81792	broad.mit.edu	37	5	33577084	33577084	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:33577084G>T	ENST00000504830.1	-	19	3382	c.3047C>A	c.(3046-3048)cCa>cAa	p.P1016Q	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.P931Q	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1016	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P1016Q(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TAGTGTTGGTGGGTTTTTTCC	0.537										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(3046-3048)CCA>CAA		ADAM metallopeptidase with thrombospondin type 1							150.0	144.0	146.0					5																	33577084		2203	4300	6503	SO:0001583	missense	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33577084G>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3047C>A	5.37:g.33577084G>T	ENSP00000422554:p.Pro1016Gln	HNSCC(64;0.19)				ADAMTS12_uc010iuq.1_Missense_Mutation_p.P931Q	p.P1016Q	NM_030955	NP_112217	P58397	ATS12_HUMAN			19	3210	-			1016			Spacer 2.		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	c.3047C>A	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	1.080	-0.667348	0.03428	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.58358	0.34;0.34	5.3	-2.13	0.07144	.	0.911979	0.09488	N	0.795396	T	0.26738	0.0654	N	0.14661	0.345	0.09310	N	0.999996	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.001	T	0.20706	-1.0267	10	0.12766	T	0.61	.	4.5171	0.11940	0.3425:0.0:0.3926:0.2649	.	931;1016	P58397-3;P58397	.;ATS12_HUMAN	Q	1016;931	ENSP00000422554:P1016Q;ENSP00000344847:P931Q	ENSP00000344847:P931Q	P	-	2	0	ADAMTS12	33612841	0.000000	0.05858	0.004000	0.12327	0.010000	0.07245	-0.095000	0.11077	-0.523000	0.06409	-0.345000	0.07892	CCA		0.537	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		43	66	1	0	1.96642e-18	0.006999	3.86791e-18	43	66				
BDP1	55814	broad.mit.edu	37	5	70785481	70785481	+	Silent	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:70785481G>C	ENST00000358731.4	+	10	1727	c.1464G>C	c.(1462-1464)gcG>gcC	p.A488A	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	488					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CTGTTCAGGCGGGTCCTTCTA	0.348																																							uc003kbp.1		NA																	0				skin(2)	2						c.(1462-1464)GCG>GCC		transcription factor-like nuclear regulator							65.0	63.0	64.0					5																	70785481		1839	4075	5914	SO:0001819	synonymous_variant	55814				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding	g.chr5:70785481G>C	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.1464G>C	5.37:g.70785481G>C						BDP1_uc003kbn.1_Silent_p.A488A|BDP1_uc003kbo.2_Silent_p.A488A	p.A488A	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)	10	1727	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	488					Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Silent	SNP	ENST00000358731.4	37	c.1464G>C	CCDS43328.1																																																																																				0.348	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429		17	28	0	0	0	0.007413	0	17	28				
FNIP1	96459	broad.mit.edu	37	5	131008179	131008179	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:131008179G>A	ENST00000510461.1	-	14	2053	c.1958C>T	c.(1957-1959)tCt>tTt	p.S653F	FNIP1_ENST00000307954.8_Missense_Mutation_p.S608F|CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307968.7_Missense_Mutation_p.S625F	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	653					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TTGGCAGTCAGAAGGAGAAAT	0.383																																							uc003kvs.1		NA																	0				pancreas(1)|skin(1)	2						c.(1957-1959)TCT>TTT		folliculin interacting protein 1 isoform 1							122.0	126.0	124.0					5																	131008179		2203	4300	6503	SO:0001583	missense	96459				regulation of protein phosphorylation	cytoplasm	protein binding	g.chr5:131008179G>A	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1958C>T	5.37:g.131008179G>A	ENSP00000421985:p.Ser653Phe					RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Missense_Mutation_p.S625F|FNIP1_uc010jdm.1_Missense_Mutation_p.S608F	p.S653F	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)	14	2100	-		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	653					D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	c.1958C>T	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185066	0.38609	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.14022	2.54;2.54;2.54	5.64	5.64	0.86602	.	.	.	.	.	T	0.12817	0.0311	L	0.36672	1.1	0.80722	D	1	B;B;B	0.29590	0.25;0.25;0.25	B;B;B	0.33960	0.173;0.173;0.098	T	0.08289	-1.0729	9	0.09843	T	0.71	-0.0383	15.4152	0.74960	0.0:0.0:0.8525:0.1475	.	653;625;653	A8K8V8;Q8TF40-3;Q8TF40	.;.;FNIP1_HUMAN	F	625;608;405;653	ENSP00000309266:S625F;ENSP00000310453:S608F;ENSP00000421985:S653F	ENSP00000310453:S608F	S	-	2	0	FNIP1	131036078	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.224000	0.42945	2.665000	0.90641	0.655000	0.94253	TCT		0.383	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372		9	115	0	0	0	0.004482	0	9	115				
P4HA2	8974	broad.mit.edu	37	5	131543483	131543483	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:131543483C>G	ENST00000401867.1	-	9	1566	c.998G>C	c.(997-999)tGg>tCg	p.W333S	P4HA2_ENST00000360568.3_Missense_Mutation_p.W333S|P4HA2_ENST00000166534.4_Missense_Mutation_p.W333S|P4HA2_ENST00000379086.1_Missense_Mutation_p.W333S|P4HA2_ENST00000379104.2_Missense_Mutation_p.W333S|P4HA2_ENST00000379100.2_Missense_Mutation_p.W333S			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	333					peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CGGGCTGTCCCACTCGTCCTC	0.527																																					Esophageal Squamous(68;117 1135 17362 19256 34242)	Esophageal Squamous(68;117 1135 17362 19256 34242)	uc003kwh.2		NA																	0					0						c.(997-999)TGG>TCG		prolyl 4-hydroxylase, alpha II subunit isoform 1	L-Proline(DB00172)|Succinic acid(DB00139)						210.0	185.0	194.0					5																	131543483		2203	4300	6503	SO:0001583	missense	8974					endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding	g.chr5:131543483C>G	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.998G>C	5.37:g.131543483C>G	ENSP00000384999:p.Trp333Ser					P4HA2_uc003kwg.2_Missense_Mutation_p.W333S|P4HA2_uc003kwi.2_Missense_Mutation_p.W333S|P4HA2_uc003kwk.2_Missense_Mutation_p.W333S|P4HA2_uc003kwl.2_Missense_Mutation_p.W333S|P4HA2_uc003kwj.2_Missense_Mutation_p.W333S	p.W333S	NM_004199	NP_004190	O15460	P4HA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		8	1562	-		all_cancers(142;0.103)|Breast(839;0.198)	333					D3DQ85|D3DQ86|Q8WWN0	Missense_Mutation	SNP	ENST00000401867.1	37	c.998G>C	CCDS4151.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888979	0.91814	.	.	ENSG00000072682	ENST00000401867;ENST00000379086;ENST00000166534;ENST00000360568;ENST00000379104;ENST00000379100	T;T;T;T;T;T	0.40476	1.05;1.03;1.05;1.03;1.05;1.03	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.61986	0.2391	L	0.52126	1.63	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.75484	0.943;0.986	T	0.57294	-0.7836	10	0.51188	T	0.08	-13.9135	20.5827	0.99408	0.0:1.0:0.0:0.0	.	333;333	O15460;O15460-2	P4HA2_HUMAN;.	S	333	ENSP00000384999:W333S;ENSP00000368379:W333S;ENSP00000166534:W333S;ENSP00000353772:W333S;ENSP00000368398:W333S;ENSP00000368394:W333S	ENSP00000166534:W333S	W	-	2	0	P4HA2	131571382	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	TGG		0.527	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199		43	66	0	0	0	0.002522	0	43	66				
PCDHA4	56144	broad.mit.edu	37	5	140188067	140188067	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:140188067C>A	ENST00000530339.1	+	1	1295	c.1295C>A	c.(1294-1296)tCg>tAg	p.S432*	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Nonsense_Mutation_p.S432*|PCDHA4_ENST00000356878.4_Nonsense_Mutation_p.S432*|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	432	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S432L(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGGGGGCTCGCCTTCGCTG	0.617																																							uc003lhi.2		NA																	2	Substitution - Missense(2)		haematopoietic_and_lymphoid_tissue(2)	ovary(4)|skin(2)	6						c.(1294-1296)TCG>TAG		protocadherin alpha 4 isoform 1 precursor							105.0	105.0	105.0					5																	140188067		2203	4300	6503	SO:0001587	stop_gained	56144				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140188067C>A	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1295C>A	5.37:g.140188067C>A	ENSP00000435300:p.Ser432*					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Nonsense_Mutation_p.S432*|PCDHA4_uc011daa.1_Nonsense_Mutation_p.S432*	p.S432*	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1396	+			432			Cadherin 4.|Extracellular (Potential).		O75285|Q2M253	Nonsense_Mutation	SNP	ENST00000530339.1	37	c.1295C>A	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	c	15.48	2.845774	0.51164	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	.	.	.	4.5	0.142	0.14816	.	0.942549	0.08589	U	0.923331	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.2126	0.06687	0.1188:0.5495:0.1159:0.2158	.	.	.	.	X	432	.	ENSP00000349344:S432X	S	+	2	0	PCDHA4	140168251	0.000000	0.05858	0.425000	0.26659	0.600000	0.36913	-0.599000	0.05700	0.098000	0.17522	-0.232000	0.12228	TCG		0.617	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		59	64	1	0	4.6707e-30	0.00361	1.03052e-29	59	64				
PCDHB7	56129	broad.mit.edu	37	5	140553265	140553265	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:140553265C>T	ENST00000231137.3	+	1	1023	c.849C>T	c.(847-849)taC>taT	p.Y283Y		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	283	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y283Y(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATTTTCTTACGCCACTGAAA	0.428																																							uc003lit.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(847-849)TAC>TAT		protocadherin beta 7 precursor							81.0	85.0	84.0					5																	140553265		2203	4300	6503	SO:0001819	synonymous_variant	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553265C>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.849C>T	5.37:g.140553265C>T							p.Y283Y	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1023	+			283			Extracellular (Potential).|Cadherin 3.		A1L3Y8	Silent	SNP	ENST00000231137.3	37	c.849C>T	CCDS4249.1																																																																																				0.428	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		32	35	0	0	0	0.002096	0	32	35				
PCDH12	51294	broad.mit.edu	37	5	141335212	141335212	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:141335212C>G	ENST00000231484.3	-	1	3415	c.2205G>C	c.(2203-2205)ttG>ttC	p.L735F	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	735					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACATGAACAAAGCCAGGA	0.592																																							uc003llx.2		NA																	0				ovary(3)	3						c.(2203-2205)TTG>TTC		protocadherin 12 precursor							66.0	57.0	60.0					5																	141335212		2203	4300	6503	SO:0001583	missense	51294				neuron recognition	integral to plasma membrane	calcium ion binding	g.chr5:141335212C>G	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2205G>C	5.37:g.141335212C>G	ENSP00000231484:p.Leu735Phe						p.L735F	NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	3416	-		all_hematologic(541;0.0999)	735			Helical; (Potential).		Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	c.2205G>C	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.073533	0.36566	.	.	ENSG00000113555	ENST00000231484	T	0.56103	0.48	5.01	4.11	0.48088	.	0.000000	0.64402	D	0.000004	T	0.68540	0.3012	M	0.68952	2.095	0.43628	D	0.996015	D	0.89917	1.0	D	0.85130	0.997	T	0.71358	-0.4617	10	0.72032	D	0.01	.	11.8274	0.52275	0.0:0.5746:0.4254:0.0	.	735	Q9NPG4	PCD12_HUMAN	F	735	ENSP00000231484:L735F	ENSP00000231484:L735F	L	-	3	2	PCDH12	141315396	0.020000	0.18652	0.999000	0.59377	0.951000	0.60555	-0.571000	0.05889	1.251000	0.43983	0.561000	0.74099	TTG		0.592	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580		12	25	0	0	0	0.000978	0	12	25				
DPYSL3	1809	broad.mit.edu	37	5	146780289	146780289	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:146780289T>A	ENST00000398514.3	-	10	1447	c.1076A>T	c.(1075-1077)gAg>gTg	p.E359V	DPYSL3_ENST00000534907.1_Intron|CTB-108O6.2_ENST00000607270.1_RNA|DPYSL3_ENST00000343218.5_Missense_Mutation_p.E473V	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	359					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATCCGCTCCTCCACACCATT	0.567																																							uc003lon.1		NA																	0				ovary(1)	1						c.(1075-1077)GAG>GTG		dihydropyrimidinase-like 3							112.0	118.0	116.0					5																	146780289		2203	4300	6503	SO:0001583	missense	1809				axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity	g.chr5:146780289T>A	D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.1076A>T	5.37:g.146780289T>A	ENSP00000381526:p.Glu359Val					DPYSL3_uc003loo.2_Missense_Mutation_p.E473V	p.E359V	NM_001387	NP_001378	Q14195	DPYL3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		10	1186	-			359					B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	37	c.1076A>T	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.898362	0.91962	.	.	ENSG00000113657	ENST00000398514;ENST00000343218	D;D	0.92699	-3.09;-3.09	5.53	5.53	0.82687	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.97508	0.9184	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.98905	1.0778	10	0.87932	D	0	-0.3572	15.9488	0.79817	0.0:0.0:0.0:1.0	.	473;359	B3SXQ8;Q14195	.;DPYL3_HUMAN	V	359;473	ENSP00000381526:E359V;ENSP00000343690:E473V	ENSP00000343690:E473V	E	-	2	0	DPYSL3	146760482	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.913000	0.87471	2.228000	0.72767	0.528000	0.53228	GAG		0.567	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387		27	25	0	0	0	0.00632	0	27	25				
TNIP1	10318	broad.mit.edu	37	5	150422465	150422465	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:150422465C>T	ENST00000389378.2	-	10	1582	c.994G>A	c.(994-996)Gag>Aag	p.E332K	TNIP1_ENST00000524280.1_Missense_Mutation_p.E332K|TNIP1_ENST00000315050.7_Missense_Mutation_p.E332K|TNIP1_ENST00000518977.1_Missense_Mutation_p.E332K|TNIP1_ENST00000523200.1_Missense_Mutation_p.E332K|TNIP1_ENST00000523338.1_Missense_Mutation_p.E332K|TNIP1_ENST00000521423.1_Intron|TNIP1_ENST00000520931.1_Missense_Mutation_p.E279K|TNIP1_ENST00000521591.1_Missense_Mutation_p.E332K|TNIP1_ENST00000522226.1_Missense_Mutation_p.E332K	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	332	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCTTCTGCTCATACTGCTGC	0.567																																							uc003ltf.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(994-996)GAG>AAG		TNFAIP3 interacting protein 1							309.0	275.0	286.0					5																	150422465		2203	4300	6503	SO:0001583	missense	10318				defense response|glycoprotein biosynthetic process|negative regulation of viral genome replication|translation	cytoplasm|nucleus	protein binding	g.chr5:150422465C>T	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.994G>A	5.37:g.150422465C>T	ENSP00000374029:p.Glu332Lys					TNIP1_uc010jhl.2_RNA|TNIP1_uc010jhm.2_Missense_Mutation_p.E332K|TNIP1_uc010jhn.2_Missense_Mutation_p.E332K|TNIP1_uc011dco.1_Missense_Mutation_p.E332K|TNIP1_uc003lth.2_RNA|TNIP1_uc003lti.2_Missense_Mutation_p.E332K|TNIP1_uc003ltg.2_Missense_Mutation_p.E279K|TNIP1_uc003ltj.2_Missense_Mutation_p.E332K|TNIP1_uc010jho.1_RNA|TNIP1_uc010jhq.1_Missense_Mutation_p.E279K|TNIP1_uc010jhp.1_Missense_Mutation_p.E279K|TNIP1_uc010jhr.1_Missense_Mutation_p.E332K|TNIP1_uc003ltk.2_Missense_Mutation_p.E332K	p.E332K	NM_006058	NP_006049	Q15025	TNIP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		10	1583	-		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	332			Potential.|Interacts with Nef.		A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	c.994G>A	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	C	36	5.679744	0.96774	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840	T;T;T;T;T;T;T;T;T	0.60171	2.32;2.35;2.35;2.35;2.35;2.35;2.35;0.21;2.38	5.47	5.47	0.80525	.	0.096519	0.64402	D	0.000001	T	0.76744	0.4030	M	0.74389	2.26	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.998;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.994;0.998;0.999;0.999;0.999	T	0.76016	-0.3113	10	0.42905	T	0.14	-32.2719	18.9226	0.92530	0.0:1.0:0.0:0.0	.	332;286;286;332;332;332;332	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	K	279;332;332;332;289;289;294;332;332;332;332;332;289	ENSP00000429891:E279K;ENSP00000374029:E332K;ENSP00000317891:E332K;ENSP00000428243:E332K;ENSP00000428187:E332K;ENSP00000430760:E332K;ENSP00000430971:E332K;ENSP00000429912:E332K;ENSP00000431105:E332K	ENSP00000317891:E332K	E	-	1	0	TNIP1	150402658	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.544000	0.82117	2.561000	0.86390	0.650000	0.86243	GAG		0.567	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058		13	231	0	0	0	0.001855	0	13	231				
ADAM19	8728	broad.mit.edu	37	5	156946889	156946889	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr5:156946889C>A	ENST00000517905.1	-	6	602	c.558G>T	c.(556-558)tgG>tgT	p.W186C	ADAM19_ENST00000430702.2_5'UTR|ADAM19_ENST00000257527.4_Missense_Mutation_p.W186C|ADAM19_ENST00000394020.1_Missense_Mutation_p.W188C			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	186					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTGAAGAGCCCAGTCCCTGG	0.552																																							uc003lwz.2		NA																	0				ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(556-558)TGG>TGT		ADAM metallopeptidase domain 19 preproprotein							108.0	114.0	112.0					5																	156946889		2203	4300	6503	SO:0001583	missense	8728				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding	g.chr5:156946889C>A	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.558G>T	5.37:g.156946889C>A	ENSP00000428654:p.Trp186Cys					ADAM19_uc003lww.1_5'UTR|ADAM19_uc011ddr.1_Missense_Mutation_p.W117C	p.W186C	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		6	622	-	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	186					Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37	c.558G>T		.	.	.	.	.	.	.	.	.	.	C	15.25	2.777142	0.49786	.	.	ENSG00000135074	ENST00000257527;ENST00000394020;ENST00000517905	T;T;T	0.01647	4.72;4.75;4.71	5.67	3.87	0.44632	.	0.098626	0.46442	D	0.000292	T	0.03564	0.0102	L	0.56769	1.78	0.53688	D	0.999975	D	0.56968	0.978	P	0.48901	0.594	T	0.55939	-0.8061	10	0.37606	T	0.19	.	8.8936	0.35449	0.0:0.7705:0.1496:0.0799	.	186	Q9H013-2	.	C	186;188;186	ENSP00000257527:W186C;ENSP00000377588:W188C;ENSP00000428654:W186C	ENSP00000257527:W186C	W	-	3	0	ADAM19	156879467	0.997000	0.39634	0.698000	0.30274	0.973000	0.67179	4.572000	0.60886	0.739000	0.32628	0.655000	0.94253	TGG		0.552	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274		61	73	1	0	7.73544e-29	0.00361	1.68884e-28	61	73				
FARS2	10667	broad.mit.edu	37	6	5613521	5613521	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:5613521G>C	ENST00000324331.6	+	6	1521	c.1185G>C	c.(1183-1185)aaG>aaC	p.K395N	FARS2_ENST00000274680.4_Missense_Mutation_p.K395N			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	395	FDX-ACB. {ECO:0000255|PROSITE- ProRule:PRU00778}.				gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	TGGTGGAAAAGGTTGATCTCA	0.378																																							uc010jnv.1		NA																	0					0						c.(1183-1185)AAG>AAC		phenylalanyl-tRNA synthetase 2 precursor	L-Phenylalanine(DB00120)						115.0	112.0	113.0					6																	5613521		2203	4300	6503	SO:0001583	missense	10667				phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding	g.chr6:5613521G>C	AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.1185G>C	6.37:g.5613521G>C	ENSP00000316335:p.Lys395Asn					FARS2_uc003mwr.2_Missense_Mutation_p.K395N	p.K395N	NM_006567	NP_006558	O95363	SYFM_HUMAN			6	1521	+	Ovarian(93;0.11)	all_hematologic(90;0.0104)	395			FDX-ACB.		B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Missense_Mutation	SNP	ENST00000324331.6	37	c.1185G>C	CCDS4494.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953305	0.34471	.	.	ENSG00000145982	ENST00000274680;ENST00000324331	T;T	0.75938	-0.98;-0.98	5.23	3.38	0.38709	Phenylalanyl-tRNA synthetase, beta subunit, ferrodoxin-fold anticodon-binding (5);	0.127455	0.52532	D	0.000074	T	0.40932	0.1137	N	0.25201	0.72	0.51767	D	0.999937	B	0.15473	0.013	B	0.12156	0.007	T	0.28490	-1.0042	10	0.34782	T	0.22	-0.0422	9.0806	0.36550	0.2889:0.0:0.7111:0.0	.	395	O95363	SYFM_HUMAN	N	395	ENSP00000274680:K395N;ENSP00000316335:K395N	ENSP00000274680:K395N	K	+	3	2	FARS2	5558520	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.852000	0.27764	0.640000	0.30582	0.655000	0.94253	AAG		0.378	FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467790.1	NM_006567		12	64	0	0	0	0.000978	0	12	64				
BMP6	654	broad.mit.edu	37	6	7845379	7845379	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:7845379A>G	ENST00000283147.6	+	2	830	c.671A>G	c.(670-672)tAc>tGc	p.Y224C		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	224					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					ATAGTGGAGTACGACAAGGAG	0.483																																							uc003mxu.3		NA																	0				large_intestine(2)|ovary(1)	3						c.(670-672)TAC>TGC		bone morphogenetic protein 6 preproprotein							116.0	114.0	114.0					6																	7845379		2203	4300	6503	SO:0001583	missense	654				BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity	g.chr6:7845379A>G	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.671A>G	6.37:g.7845379A>G	ENSP00000283147:p.Tyr224Cys						p.Y224C	NM_001718	NP_001709	P22004	BMP6_HUMAN			2	849	+	Ovarian(93;0.0721)		224					Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	c.671A>G	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.333079	0.60853	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.64438	-0.1	5.41	4.23	0.50019	Transforming growth factor-beta, N-terminal (1);	0.411423	0.27262	N	0.020161	T	0.58666	0.2138	L	0.40543	1.245	0.35852	D	0.826873	D	0.76494	0.999	D	0.65140	0.932	T	0.65721	-0.6099	10	0.72032	D	0.01	.	11.6513	0.51290	0.8668:0.0:0.0:0.1332	.	224	P22004	BMP6_HUMAN	C	146;224;187	ENSP00000283147:Y224C	ENSP00000283147:Y224C	Y	+	2	0	BMP6	7790378	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.629000	0.67798	0.858000	0.35431	0.455000	0.32223	TAC		0.483	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718		28	63	0	0	0	0.001786	0	28	63				
CDKAL1	54901	broad.mit.edu	37	6	21108643	21108643	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:21108643G>C	ENST00000378610.1	+	11	1258	c.1248G>C	c.(1246-1248)agG>agC	p.R416S	CDKAL1_ENST00000378624.4_Intron|CDKAL1_ENST00000274695.4_Missense_Mutation_p.R416S			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	416					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			AAAAGCAAAGGACAAAAGATC	0.299																																							uc003ndc.1		NA																	0				ovary(2)	2						c.(1246-1248)AGG>AGC		CDK5 regulatory subunit associated protein							55.0	55.0	55.0					6																	21108643		2203	4293	6496	SO:0001583	missense	54901				RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity	g.chr6:21108643G>C	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1248G>C	6.37:g.21108643G>C	ENSP00000367873:p.Arg416Ser					CDKAL1_uc003ndd.1_Missense_Mutation_p.R416S|CDKAL1_uc003nde.1_Intron|CDKAL1_uc003ndf.1_Missense_Mutation_p.R12S	p.R416S	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)		13	1422	+	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		416					A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	c.1248G>C	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708392	0.68615	.	.	ENSG00000145996	ENST00000274695;ENST00000378610	T;T	0.26660	1.72;1.72	5.87	-0.825	0.10809	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);	0.040272	0.85682	D	0.000000	T	0.59376	0.2189	H	0.99794	4.785	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.73757	-0.3882	10	0.87932	D	0	.	11.6751	0.51425	0.6597:0.0:0.3403:0.0	.	416	Q5VV42	CDKAL_HUMAN	S	416	ENSP00000274695:R416S;ENSP00000367873:R416S	ENSP00000274695:R416S	R	+	3	2	CDKAL1	21216622	0.998000	0.40836	0.998000	0.56505	0.995000	0.86356	0.613000	0.24299	-0.022000	0.13986	0.650000	0.86243	AGG		0.299	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774		8	30	0	0	0	0.004482	0	8	30				
LRRC16A	55604	broad.mit.edu	37	6	25600552	25600552	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:25600552A>T	ENST00000329474.6	+	33	3498	c.3130A>T	c.(3130-3132)Aca>Tca	p.T1044S		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1044	Inhibits capping activity of CAPZA2. {ECO:0000250}.				actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						GAAATGGTCAACAAGAGGCTC	0.373																																							uc011djw.1		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						c.(3130-3132)ACA>TCA		leucine rich repeat containing 16A							76.0	73.0	74.0					6																	25600552		1855	4103	5958	SO:0001583	missense	55604				actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus		g.chr6:25600552A>T	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3130A>T	6.37:g.25600552A>T	ENSP00000331983:p.Thr1044Ser					LRRC16A_uc010jpx.2_Missense_Mutation_p.T1044S|LRRC16A_uc010jpy.2_Missense_Mutation_p.T1044S	p.T1044S	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN			33	3506	+			1044			Inhibits capping activity of CAPZA2 (By similarity).		B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	ENST00000329474.6	37	c.3130A>T	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	A	7.982	0.751344	0.15778	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.14893	2.47	4.94	-9.89	0.00464	.	1.375470	0.04224	N	0.333980	T	0.01730	0.0055	N	0.08118	0	0.09310	N	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.33343	-0.9872	10	0.30854	T	0.27	.	5.8225	0.18536	0.3529:0.0:0.2686:0.3785	.	1044;1044;1044	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	S	1044	ENSP00000331983:T1044S	ENSP00000331983:T1044S	T	+	1	0	LRRC16A	25708531	0.000000	0.05858	0.000000	0.03702	0.962000	0.63368	-2.265000	0.01172	-1.705000	0.01406	0.379000	0.24179	ACA		0.373	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640		31	64	0	0	0	0.003755	0	31	64				
TNXB	7148	broad.mit.edu	37	6	32036264	32036264	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:32036264G>A	ENST00000375244.3	-	17	6324	c.6123C>T	c.(6121-6123)acC>acT	p.T2041T	TNXB_ENST00000375247.2_Silent_p.T2041T			P22105	TENX_HUMAN	tenascin XB	2123	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGCCCGAGATGGTGACCCCTT	0.607																																							uc003nzl.2		NA																	0					0						c.(6121-6123)ACC>ACT		tenascin XB isoform 1 precursor							42.0	45.0	44.0					6																	32036264		1983	4172	6155	SO:0001819	synonymous_variant	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32036264G>A	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6123C>T	6.37:g.32036264G>A							p.T2041T	NM_019105	NP_061978	P22105	TENX_HUMAN			17	6325	-			2123			Fibronectin type-III 13.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37	c.6123C>T																																																																																					0.607	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		28	26	0	0	0	0.00632	0	28	26				
SLC22A7	10864	broad.mit.edu	37	6	43270461	43270461	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:43270461G>T	ENST00000372585.5	+	9	1440	c.1345G>T	c.(1345-1347)Gcc>Tcc	p.A449S	SLC22A7_ENST00000372589.3_Missense_Mutation_p.A447S|SLC22A7_ENST00000372574.3_Missense_Mutation_p.A447S	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	449					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CTTCACCACTGCCTACCTGTT	0.532																																							uc003out.2		NA																	0					0						c.(1345-1347)GCC>TCC		solute carrier family 22 member 7 isoform b							86.0	72.0	77.0					6																	43270461		2203	4300	6503	SO:0001583	missense	10864					basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity	g.chr6:43270461G>T	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1345G>T	6.37:g.43270461G>T	ENSP00000361666:p.Ala449Ser					SLC22A7_uc010jyl.1_Missense_Mutation_p.A450S|SLC22A7_uc003ous.2_Missense_Mutation_p.A447S	p.A449S	NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		9	1444	+			449			Helical; (Potential).		B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	37	c.1345G>T	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054954	0.75960	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;T	0.74737	0.37;0.37;0.37;-0.87	5.17	5.17	0.71159	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.228499	0.43919	D	0.000509	T	0.73249	0.3563	L	0.45285	1.41	0.80722	D	1	B;B;B	0.29508	0.101;0.083;0.246	P;B;P	0.48598	0.51;0.376;0.583	T	0.74856	-0.3522	10	0.51188	T	0.08	.	15.9352	0.79698	0.0:0.0:1.0:0.0	.	449;447;447	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	S	447;449;447;142	ENSP00000361670:A447S;ENSP00000361666:A449S;ENSP00000361655:A447S;ENSP00000393836:A142S	ENSP00000361655:A447S	A	+	1	0	SLC22A7	43378439	0.856000	0.29760	0.989000	0.46669	0.792000	0.44763	2.973000	0.49264	2.584000	0.87258	0.462000	0.41574	GCC		0.532	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1			5	12	1	0	1.26484e-09	0.00308	2.15282e-09	5	12				
AARS2	57505	broad.mit.edu	37	6	44272162	44272162	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:44272162C>A	ENST00000244571.4	-	13	1863	c.1861G>T	c.(1861-1863)Gat>Tat	p.D621Y	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTTACCTCATCCACATGCAGC	0.592											OREG0017473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010jza.1		NA																	0				ovary(1)	1						c.(1861-1863)GAT>TAT		alanyl-tRNA synthetase 2, mitochondrial	L-Alanine(DB00160)						87.0	78.0	81.0					6																	44272162		2203	4300	6503	SO:0001583	missense	57505				alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding	g.chr6:44272162C>A	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1861G>T	6.37:g.44272162C>A	ENSP00000244571:p.Asp621Tyr		OREG0017473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	922	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	p.D621Y	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		13	1864	-	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		621						Missense_Mutation	SNP	ENST00000244571.4	37	c.1861G>T	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170756	0.57584	.	.	ENSG00000124608	ENST00000244571	T	0.80738	-1.41	5.74	5.74	0.90152	Alanyl-tRNA synthetase, class IIc, core domain (1);Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.224065	0.45606	D	0.000355	D	0.93028	0.7781	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.94483	0.7695	10	0.87932	D	0	-16.6206	19.9144	0.97043	0.0:1.0:0.0:0.0	.	621	Q5JTZ9	SYAM_HUMAN	Y	621	ENSP00000244571:D621Y	ENSP00000244571:D621Y	D	-	1	0	AARS2	44380140	1.000000	0.71417	0.983000	0.44433	0.275000	0.26752	5.866000	0.69590	2.710000	0.92621	0.609000	0.83330	GAT		0.592	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745		27	37	1	0	9.39395e-14	0.00632	1.74101e-13	27	37				
MUT	4594	broad.mit.edu	37	6	49426796	49426796	+	Splice_Site	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:49426796C>A	ENST00000274813.3	-	2	511	c.384G>T	c.(382-384)aaG>aaT	p.K128N		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	128					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAATCTCACCCTTAATGTTGT	0.353																																							uc003ozg.3		NA																	0					0						c.(382-384)AAG>AAT		methylmalonyl Coenzyme A mutase precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						63.0	64.0	64.0					6																	49426796		2203	4300	6503	SO:0001630	splice_region_variant	4594				fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity	g.chr6:49426796C>A		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.385+1G>T	6.37:g.49426796C>A							p.K128N	NM_000255	NP_000246	P22033	MUTA_HUMAN			2	639	-	Lung NSC(77;0.0376)		128					A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	ENST00000274813.3	37	c.384G>T	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.205515	0.58234	.	.	ENSG00000146085	ENST00000274813	D	0.98362	-4.89	5.73	0.983	0.19767	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.96947	0.9003	L	0.50993	1.605	0.80722	D	1	P	0.43477	0.808	P	0.57960	0.83	D	0.95730	0.8774	10	0.72032	D	0.01	-11.523	9.2324	0.37446	0.0:0.5556:0.0:0.4444	.	128	P22033	MUTA_HUMAN	N	128	ENSP00000274813:K128N	ENSP00000274813:K128N	K	-	3	2	MUT	49534755	0.998000	0.40836	0.999000	0.59377	0.656000	0.38851	0.509000	0.22707	0.162000	0.19483	0.655000	0.94253	AAG		0.353	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1		Missense_Mutation	17	17	1	0	7.05477e-17	0.00499	1.34947e-16	17	17				
POPDC3	64208	broad.mit.edu	37	6	105609469	105609469	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr6:105609469G>A	ENST00000254765.3	-	2	594	c.316C>T	c.(316-318)Cga>Tga	p.R106*	BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA|POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000369120.2_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	106			R -> Q (in dbSNP:rs11961225).		regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)		p.R106R(1)		NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TGGAATTCTCGGGCAAAGGTT	0.438																																							uc003prb.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)	5						c.(316-318)CGA>TGA		popeye protein 3							163.0	174.0	171.0					6																	105609469		2203	4300	6503	SO:0001587	stop_gained	64208					integral to membrane		g.chr6:105609469G>A	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.316C>T	6.37:g.105609469G>A	ENSP00000254765:p.Arg106*					uc003pqz.2_Intron|POPDC3_uc003pra.2_Intron	p.R106*	NM_022361	NP_071756	Q9HBV1	POPD3_HUMAN			2	718	-		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)	106					B2RA98|Q5T3Y8|Q8TBW6	Nonsense_Mutation	SNP	ENST00000254765.3	37	c.316C>T	CCDS5052.1	.	.	.	.	.	.	.	.	.	.	G	38	6.698305	0.97772	.	.	ENSG00000132429	ENST00000254765	.	.	.	5.72	3.76	0.43208	.	0.309977	0.32785	N	0.005656	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-7.4986	13.6489	0.62299	0.0:0.0:0.5776:0.4223	.	.	.	.	X	106	.	ENSP00000254765:R106X	R	-	1	2	POPDC3	105716162	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.557000	0.36299	1.411000	0.46957	0.655000	0.94253	CGA		0.438	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361		12	75	0	0	0	0.00245	0	12	75				
PMS2	5395	broad.mit.edu	37	7	6018269	6018269	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:6018269T>C	ENST00000265849.7	-	13	2338	c.2233A>G	c.(2233-2235)Ata>Gta	p.I745V	PMS2_ENST00000382321.4_Missense_Mutation_p.I344V|PMS2_ENST00000406569.3_Intron|PMS2_ENST00000441476.2_Missense_Mutation_p.I639V	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	745					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TTTCTAAATATTTCCAGATTT	0.358			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc003spl.2		NA	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	Mis|N|F	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)			E		colorectal|endometrial|ovarian|medulloblastoma|glioma			0				lung(1)|central_nervous_system(1)	2						c.(2233-2235)ATA>GTA	Direct_reversal_of_damage|MMR	PMS2 postmeiotic segregation increased 2 isoform							75.0	63.0	67.0					7																	6018269		2197	4283	6480	SO:0001583	missense	5395	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding	g.chr7:6018269T>C		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2233A>G	7.37:g.6018269T>C	ENSP00000265849:p.Ile745Val					PMS2_uc003spj.2_Missense_Mutation_p.I639V|PMS2_uc003spk.2_Missense_Mutation_p.I610V|PMS2_uc011jwl.1_Missense_Mutation_p.I610V|PMS2_uc010ktg.2_Missense_Mutation_p.I434V|PMS2_uc010kte.2_Missense_Mutation_p.I344V|PMS2_uc010ktf.1_Intron	p.I745V	NM_000535	NP_000526	P54278	PMS2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)	13	2320	-		Ovarian(82;0.0694)	745					B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	c.2233A>G	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.269081	0.40095	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000382321;ENST00000441476	T;T;T	0.74002	-0.8;-0.8;-0.8	5.73	3.36	0.38483	MutL, C-terminal, dimerisation (2);	0.050846	0.85682	D	0.000000	T	0.71443	0.3340	N	0.20483	0.58	0.48632	D	0.999685	B;B;D	0.67145	0.003;0.226;0.996	B;P;D	0.80764	0.002;0.549;0.994	T	0.64071	-0.6493	10	0.12766	T	0.61	-11.1146	9.3461	0.38109	0.0:0.145:0.0:0.855	.	344;745;639	P54278-2;P54278;C9J167	.;PMS2_HUMAN;.	V	745;698;344;639	ENSP00000265849:I745V;ENSP00000371758:I344V;ENSP00000392843:I639V	ENSP00000265849:I745V	I	-	1	0	PMS2	5984795	1.000000	0.71417	0.994000	0.49952	0.972000	0.66771	3.829000	0.55760	0.449000	0.26747	0.454000	0.30748	ATA		0.358	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535		5	9	0	0	0	0.004482	0	5	9				
DPY19L1	23333	broad.mit.edu	37	7	35050942	35050942	+	Splice_Site	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:35050942C>A	ENST00000310974.4	-	5	595	c.451G>T	c.(451-453)Gga>Tga	p.G151*		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	151						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						AGAAACTTACCTTCACAGCTT	0.338																																							uc003tem.3		NA																	0					0						c.(451-453)GGA>TGA		dpy-19-like 1							94.0	86.0	88.0					7																	35050942		1841	4087	5928	SO:0001630	splice_region_variant	23333					integral to membrane		g.chr7:35050942C>A	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.451+1G>T	7.37:g.35050942C>A							p.G151*	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN			5	596	-			151					O94954|Q4G151	Nonsense_Mutation	SNP	ENST00000310974.4	37	c.451G>T	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	C	35	5.483902	0.96307	.	.	ENSG00000173852	ENST00000310974	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.7668	17.7588	0.88457	0.0:1.0:0.0:0.0	.	.	.	.	X	151	.	.	G	-	1	0	DPY19L1	35017467	1.000000	0.71417	0.999000	0.59377	0.650000	0.38633	7.580000	0.82523	2.430000	0.82344	0.650000	0.86243	GGA		0.338	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		Nonsense_Mutation	12	23	1	0	3.27435e-08	0.00245	5.21147e-08	12	23				
ABCA13	154664	broad.mit.edu	37	7	48443409	48443409	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:48443409G>T	ENST00000435803.1	+	39	12027	c.12003G>T	c.(12001-12003)gaG>gaT	p.E4001D		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4001	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTCTGGATGAGCCCACCAGTG	0.577																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(12001-12003)GAG>GAT		ATP binding cassette, sub-family A (ABC1),							76.0	78.0	78.0					7																	48443409		2016	4176	6192	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48443409G>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12003G>T	7.37:g.48443409G>T	ENSP00000411096:p.Glu4001Asp					ABCA13_uc010kys.1_Missense_Mutation_p.E1075D|ABCA13_uc003tos.1_Missense_Mutation_p.E827D|ABCA13_uc010kyt.1_RNA	p.E4001D	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			39	12028	+			4001			ABC transporter 1.		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.12003G>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510441	0.85389	.	.	ENSG00000179869	ENST00000435803	D	0.98602	-5.02	6.11	4.31	0.51392	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.49916	D	0.000126	D	0.99155	0.9708	H	0.96398	3.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.98925	1.0785	10	0.87932	D	0	.	9.3894	0.38363	0.2146:0.0:0.7854:0.0	.	1703;4001	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	D	4001	ENSP00000411096:E4001D	ENSP00000411096:E4001D	E	+	3	2	ABCA13	48413955	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.186000	0.42593	0.916000	0.36871	0.655000	0.94253	GAG		0.577	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		11	15	1	0	3.86212e-05	0.008291	5.67079e-05	11	15				
EGFR	1956	broad.mit.edu	37	7	55266427	55266427	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:55266427T>A	ENST00000275493.2	+	23	2896	c.2719T>A	c.(2719-2721)Ttg>Atg	p.L907M	EGFR_ENST00000454757.2_Missense_Mutation_p.L854M|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.L862M	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	907	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGTTTGGGAGTTGATGACCTT	0.488		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		0				lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2719-2721)TTG>ATG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						162.0	142.0	149.0					7																	55266427		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55266427T>A		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2719T>A	7.37:g.55266427T>A	ENSP00000275493:p.Leu907Met	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.L862M|EGFR_uc011kco.1_Missense_Mutation_p.L854M	p.L907M	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		23	2965	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		907			Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2719T>A	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	15.38	2.816228	0.50527	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.66815	-0.23;-0.23;-0.23	5.13	-3.63	0.04529	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65333	0.2681	N	0.21545	0.675	0.39720	D	0.971456	B;D	0.65815	0.441;0.995	B;D	0.70016	0.192;0.967	T	0.63708	-0.6576	10	0.42905	T	0.14	.	14.107	0.65096	0.0:0.2664:0.0:0.7336	.	862;907	Q504U8;P00533	.;EGFR_HUMAN	M	862;777;907;854	ENSP00000415559:L862M;ENSP00000275493:L907M;ENSP00000395243:L854M	ENSP00000275493:L907M	L	+	1	2	EGFR	55233921	0.024000	0.19004	0.869000	0.34112	0.795000	0.44927	-0.700000	0.05081	-1.080000	0.03109	-0.464000	0.05259	TTG		0.488	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		46	58	0	0	0	0.00361	0	46	58				
SEMA3C	10512	broad.mit.edu	37	7	80433566	80433566	+	Splice_Site	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:80433566T>C	ENST00000265361.3	-	8	1220		c.e8-2		SEMA3C_ENST00000536800.1_Splice_Site|SEMA3C_ENST00000544525.1_Splice_Site|SEMA3C_ENST00000419255.2_Splice_Site	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C						axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						ACATAGGTTCTAGAAAAAAAG	0.373																																							uc003uhj.2		NA																	0				ovary(1)	1						c.e8-1		semaphorin 3C precursor							78.0	75.0	76.0					7																	80433566		2203	4300	6503	SO:0001630	splice_region_variant	10512				immune response|response to drug	membrane	receptor activity	g.chr7:80433566T>C	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.659-2A>G	7.37:g.80433566T>C						SEMA3C_uc011kgw.1_Splice_Site_p.E238_splice|SEMA3C_uc011kgx.1_Splice_Site_p.E72_splice	p.E220_splice	NM_006379	NP_006370	Q99985	SEM3C_HUMAN			8	1221	-								B4DRL8	Splice_Site	SNP	ENST00000265361.3	37	c.659_splice	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.585952	0.66105	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525;ENST00000536800	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3678	0.83341	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEMA3C	80271502	1.000000	0.71417	0.940000	0.37924	0.663000	0.39108	8.015000	0.88690	2.254000	0.74563	0.528000	0.53228	.		0.373	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	Intron	10	16	0	0	0	0.008291	0	10	16				
ABCB1	5243	broad.mit.edu	37	7	87199522	87199522	+	Missense_Mutation	SNP	C	C	A	rs199607036		TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:87199522C>A	ENST00000265724.3	-	6	721	c.304G>T	c.(304-306)Ggg>Tgg	p.G102W	ABCB1_ENST00000543898.1_Missense_Mutation_p.G102W	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	102	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ATGAAGAACCCTGTATCATTG	0.308																																							uc003uiz.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(304-306)GGG>TGG		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						155.0	150.0	152.0					7																	87199522		2203	4296	6499	SO:0001583	missense	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87199522C>A	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.304G>T	7.37:g.87199522C>A	ENSP00000265724:p.Gly102Trp					ABCB1_uc011khc.1_Missense_Mutation_p.G102W	p.G102W	NM_000927	NP_000918	P08183	MDR1_HUMAN			6	722	-	Esophageal squamous(14;0.00164)		102			ABC transmembrane type-1 1.		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	c.304G>T	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710980	0.30322	.	.	ENSG00000085563	ENST00000265724;ENST00000543898	D;D	0.97772	-2.25;-4.53	4.23	-2.75	0.05914	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	9.195180	0.00166	N	0.000000	D	0.96144	0.8743	L	0.33339	1.005	0.09310	N	1	P;B	0.36222	0.544;0.393	P;P	0.49421	0.61;0.468	D	0.90034	0.4137	10	0.66056	D	0.02	18.7451	1.6787	0.02827	0.1273:0.2646:0.3538:0.2544	.	102;102	B5AK60;P08183	.;MDR1_HUMAN	W	102	ENSP00000265724:G102W;ENSP00000444095:G102W	ENSP00000265724:G102W	G	-	1	0	ABCB1	87037458	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.338000	0.00506	-0.600000	0.05790	-0.211000	0.12701	GGG		0.308	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		11	32	1	0	0.000978159	0.000978	0.00136877	11	32				
STEAP1	26872	broad.mit.edu	37	7	89790150	89790150	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:89790150A>G	ENST00000297205.2	+	3	316	c.116A>G	c.(115-117)aAa>aGa	p.K39R	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	39					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					AGCATGCTAAAAAGACCTGTG	0.408																																							uc003ujx.2		NA																	0					0						c.(115-117)AAA>AGA		six transmembrane epithelial antigen of the							107.0	105.0	106.0					7																	89790150		2203	4300	6503	SO:0001583	missense	26872				electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity	g.chr7:89790150A>G	AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.116A>G	7.37:g.89790150A>G	ENSP00000297205:p.Lys39Arg					STEAP1_uc010lem.2_Missense_Mutation_p.K39R	p.K39R	NM_012449	NP_036581	Q9UHE8	STEA1_HUMAN			3	316	+	all_hematologic(106;0.112)		39					A4D1E0|O95034	Missense_Mutation	SNP	ENST00000297205.2	37	c.116A>G	CCDS5614.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.320453	0.41096	.	.	ENSG00000164647	ENST00000297205	T	0.07444	3.19	5.02	2.5	0.30297	.	0.399930	0.23879	N	0.043667	T	0.09113	0.0225	M	0.73598	2.24	0.24909	N	0.992059	B;B	0.24258	0.1;0.1	B;B	0.19148	0.024;0.024	T	0.22941	-1.0202	10	0.40728	T	0.16	-2.2512	2.8799	0.05644	0.6306:0.1477:0.0795:0.1421	.	39;39	B4E221;Q9UHE8	.;STEA1_HUMAN	R	39	ENSP00000297205:K39R	ENSP00000297205:K39R	K	+	2	0	STEAP1	89628086	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	2.446000	0.44908	0.927000	0.37143	0.533000	0.62120	AAA		0.408	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059327.3	NM_012449		25	52	0	0	0	0.004656	0	25	52				
PPP1R3A	5506	broad.mit.edu	37	7	113519846	113519846	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:113519846C>A	ENST00000284601.3	-	4	1369	c.1301G>T	c.(1300-1302)aGc>aTc	p.S434I		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	434					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GACTTCTTTGCTGCCAGTATG	0.423																																							uc010ljy.1		NA																	0				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(1300-1302)AGC>ATC		protein phosphatase 1, regulatory (inhibitor)							134.0	121.0	126.0					7																	113519846		2203	4299	6502	SO:0001583	missense	5506				glycogen metabolic process	integral to membrane		g.chr7:113519846C>A	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1301G>T	7.37:g.113519846C>A	ENSP00000284601:p.Ser434Ile						p.S434I	NM_002711	NP_002702	Q16821	PPR3A_HUMAN			4	1332	-			434					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	c.1301G>T	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	0.781	-0.762400	0.02996	.	.	ENSG00000154415	ENST00000284601;ENST00000449795	T;T	0.31510	2.34;1.49	5.25	2.22	0.28083	.	0.660669	0.15601	N	0.253930	T	0.22589	0.0545	L	0.50333	1.59	0.09310	N	1	B	0.17465	0.022	B	0.13407	0.009	T	0.27739	-1.0065	10	0.54805	T	0.06	-1.8579	1.4045	0.02278	0.1513:0.4459:0.147:0.2559	.	434	Q16821	PPR3A_HUMAN	I	434;113	ENSP00000284601:S434I;ENSP00000401278:S113I	ENSP00000284601:S434I	S	-	2	0	PPP1R3A	113307082	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.051000	0.11885	0.685000	0.31468	-0.304000	0.09214	AGC		0.423	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		50	54	1	0	6.03219e-31	0.00361	1.33799e-30	50	54				
OPN1SW	611	broad.mit.edu	37	7	128413907	128413907	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:128413907C>G	ENST00000249389.2	-	4	722	c.723G>C	c.(721-723)caG>caC	p.Q241H		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	241					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						GTTCAGCCTTCTGGGTCGTAG	0.547																																							uc003vnt.3		NA																	0					0						c.(721-723)CAG>CAC		opsin 1 (cone pigments), short-wave-sensitive							124.0	91.0	103.0					7																	128413907		2203	4300	6503	SO:0001583	missense	611				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity	g.chr7:128413907C>G	U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.723G>C	7.37:g.128413907C>G	ENSP00000249389:p.Gln241His						p.Q241H	NM_001708	NP_001699	P03999	OPSB_HUMAN			4	723	-			241			Cytoplasmic (Potential).		Q13877	Missense_Mutation	SNP	ENST00000249389.2	37	c.723G>C	CCDS5806.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.821491	0.71028	.	.	ENSG00000128617	ENST00000249389	T	0.38401	1.14	5.03	3.18	0.36537	GPCR, rhodopsin-like superfamily (1);	0.060923	0.64402	N	0.000002	T	0.67107	0.2858	H	0.96048	3.76	0.58432	D	0.999994	D	0.76494	0.999	D	0.91635	0.999	T	0.69577	-0.5108	10	0.87932	D	0	.	7.1253	0.25469	0.1715:0.736:0.0:0.0925	.	241	P03999	OPSB_HUMAN	H	241	ENSP00000249389:Q241H	ENSP00000249389:Q241H	Q	-	3	2	OPN1SW	128201143	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.874000	0.56101	0.678000	0.31325	-0.182000	0.12963	CAG		0.547	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350655.1	NM_001708		24	25	0	0	0	0.005443	0	24	25				
MKLN1	4289	broad.mit.edu	37	7	131113898	131113898	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:131113898A>T	ENST00000352689.6	+	9	994	c.954A>T	c.(952-954)gaA>gaT	p.E318D	MKLN1_ENST00000421797.2_Missense_Mutation_p.E226D	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	318					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					GAGACACTGAAAAAGAGGCAA	0.413																																							uc011kpm.1		NA																	0				breast(1)	1						c.(952-954)GAA>GAT		muskelin 1, intracellular mediator containing							79.0	75.0	77.0					7																	131113898		2203	4300	6503	SO:0001583	missense	4289				signal transduction	cytoplasm	protein binding	g.chr7:131113898A>T	AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.954A>T	7.37:g.131113898A>T	ENSP00000323527:p.Glu318Asp					MKLN1_uc011kpl.1_Missense_Mutation_p.E295D|MKLN1_uc010lmh.2_Missense_Mutation_p.E318D|MKLN1_uc003vqs.2_Missense_Mutation_p.E111D	p.E318D	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN			9	1018	+	Melanoma(18;0.162)		318			Kelch 1.		A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Missense_Mutation	SNP	ENST00000352689.6	37	c.954A>T	CCDS34754.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002005	0.74932	.	.	ENSG00000128585	ENST00000421797;ENST00000352689	T;T	0.48522	1.79;0.81	6.16	2.4	0.29515	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.56171	0.1967	L	0.49126	1.545	0.58432	D	0.999995	P;D;D	0.67145	0.952;0.996;0.996	P;D;D	0.67900	0.886;0.954;0.954	T	0.48636	-0.9018	10	0.38643	T	0.18	-20.3801	9.4248	0.38572	0.4212:0.0:0.5788:0.0	.	318;295;226	Q9UL63;B4DG30;C9J7E8	MKLN1_HUMAN;.;.	D	226;318	ENSP00000398094:E226D;ENSP00000323527:E318D	ENSP00000323527:E318D	E	+	3	2	MKLN1	130764438	0.999000	0.42202	1.000000	0.80357	0.981000	0.71138	0.616000	0.24344	0.173000	0.19788	-0.248000	0.11899	GAA		0.413	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337473.4	NM_013255		15	25	0	0	0	0.00245	0	15	25				
OR9A4	130075	broad.mit.edu	37	7	141619371	141619371	+	Silent	SNP	T	T	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:141619371T>G	ENST00000548136.1	+	1	755	c.696T>G	c.(694-696)tcT>tcG	p.S232S	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					CGTCATCCTCTGGCCGGAGGA	0.483																																							uc003vwu.1		NA																	0				skin(1)	1						c.(694-696)TCT>TCG		olfactory receptor, family 9, subfamily A,							109.0	115.0	113.0					7																	141619371		2203	4300	6503	SO:0001819	synonymous_variant	130075				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:141619371T>G		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.696T>G	7.37:g.141619371T>G							p.S232S	NM_001001656	NP_001001656	Q8NGU2	OR9A4_HUMAN			1	696	+	Melanoma(164;0.0171)		232			Cytoplasmic (Potential).		B9EGV6|Q6IFI4	Silent	SNP	ENST00000548136.1	37	c.696T>G	CCDS43661.1																																																																																				0.483	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656		31	59	0	0	0	0.002445	0	31	59				
CLCN1	1180	broad.mit.edu	37	7	143029565	143029565	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:143029565C>A	ENST00000343257.2	+	11	1307	c.1220C>A	c.(1219-1221)cCa>cAa	p.P407Q		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	407					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTCACCTTCCCACCAGGAATG	0.483																																							uc003wcr.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(1219-1221)CCA>CAA		chloride channel 1, skeletal muscle							155.0	142.0	147.0					7																	143029565		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143029565C>A	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1220C>A	7.37:g.143029565C>A	ENSP00000339867:p.Pro407Gln					CLCN1_uc011ktc.1_Missense_Mutation_p.P69Q	p.P407Q	NM_000083	NP_000074	P35523	CLCN1_HUMAN			11	1307	+	Melanoma(164;0.205)		407					A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.1220C>A	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002838	0.93287	.	.	ENSG00000188037	ENST00000343257	D	0.95885	-3.84	5.29	5.29	0.74685	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.98264	0.9425	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99167	1.0863	10	0.72032	D	0.01	.	18.9352	0.92583	0.0:1.0:0.0:0.0	.	407	P35523	CLCN1_HUMAN	Q	407	ENSP00000339867:P407Q	ENSP00000339867:P407Q	P	+	2	0	CLCN1	142739687	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.480000	0.81109	2.476000	0.83614	0.643000	0.83706	CCA		0.483	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		38	44	1	0	3.38236e-24	0.006999	7.05221e-24	38	44				
CSMD1	64478	broad.mit.edu	37	8	2813272	2813272	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:2813272G>T	ENST00000520002.1	-	65	10391	c.9836C>A	c.(9835-9837)cCa>cAa	p.P3279Q	CSMD1_ENST00000537824.1_Missense_Mutation_p.P3278Q|CSMD1_ENST00000542608.1_Missense_Mutation_p.P3101Q|CSMD1_ENST00000602557.1_Missense_Mutation_p.P3279Q|CSMD1_ENST00000602723.1_Missense_Mutation_p.P3102Q|CSMD1_ENST00000400186.3_Missense_Mutation_p.P3102Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3279	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGGGGTTTCTGGCTGTCTGCA	0.448																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(9835-9837)CCA>CAA		CUB and Sushi multiple domains 1 precursor							115.0	115.0	115.0					8																	2813272		1964	4155	6119	SO:0001583	missense	64478					integral to membrane		g.chr8:2813272G>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9836C>A	8.37:g.2813272G>T	ENSP00000430733:p.Pro3279Gln					CSMD1_uc011kwj.1_Missense_Mutation_p.P2608Q|CSMD1_uc010lrg.2_Missense_Mutation_p.P1170Q	p.P3279Q	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	64	10226	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	3279			Sushi 28.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.9836C>A		.	.	.	.	.	.	.	.	.	.	G	19.97	3.925522	0.73213	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91	5.64	5.64	0.86602	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.95326	0.8483	H	0.96080	3.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96349	0.9257	10	0.87932	D	0	.	19.7147	0.96110	0.0:0.0:1.0:0.0	.	3279;3279;3101	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	Q	3102;3279;3140;3278;3101	ENSP00000383047:P3102Q;ENSP00000430733:P3279Q;ENSP00000441462:P3278Q;ENSP00000446243:P3101Q	ENSP00000320445:P3140Q	P	-	2	0	CSMD1	2800679	1.000000	0.71417	0.976000	0.42696	0.663000	0.39108	7.844000	0.86867	2.656000	0.90262	0.460000	0.39030	CCA		0.448	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		53	39	1	0	1.54043e-34	0.00361	3.49109e-34	53	39				
CSMD1	64478	broad.mit.edu	37	8	3000123	3000123	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:3000123G>T	ENST00000520002.1	-	42	6663	c.6108C>A	c.(6106-6108)taC>taA	p.Y2036*	CSMD1_ENST00000537824.1_Nonsense_Mutation_p.Y2035*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.Y2035*|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.Y2036*|CSMD1_ENST00000602723.1_Nonsense_Mutation_p.Y2036*|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000539096.1_Nonsense_Mutation_p.Y2035*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.Y2036*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2036	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCTGGTGTGGTAAGGTCCAT	0.438																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(6106-6108)TAC>TAA		CUB and Sushi multiple domains 1 precursor							148.0	150.0	150.0					8																	3000123		1912	4113	6025	SO:0001587	stop_gained	64478					integral to membrane		g.chr8:3000123G>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6108C>A	8.37:g.3000123G>T	ENSP00000430733:p.Tyr2036*					CSMD1_uc011kwj.1_Nonsense_Mutation_p.Y1428*|CSMD1_uc010lrg.2_Nonsense_Mutation_p.Y104*	p.Y2036*	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	41	6498	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2036			Extracellular (Potential).|CUB 12.		Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	ENST00000520002.1	37	c.6108C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	45|45	11.736991|11.736991	0.99597|0.99597	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|.	.|.	.|.	5.24|5.24	-0.898|-0.898	0.10550|0.10550	.|.	.|0.256444	.|0.33110	.|N	.|0.005272	T|.	0.14056|.	0.0340|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.40831|.	-0.9542|.	3|.	.|0.02654	.|T	.|1	.|.	6.3789|6.3789	0.21523|0.21523	0.3145:0.3502:0.3353:0.0|0.3145:0.3502:0.3353:0.0	.|.	.|.	.|.	.|.	T|X	1516|2036;2036;1897;2035;2035;2035	.|.	.|ENSP00000320445:Y1897X	P|Y	-|-	1|3	0|2	CSMD1|CSMD1	2987530|2987530	0.968000|0.968000	0.33430|0.33430	0.000000|0.000000	0.03702|0.03702	0.175000|0.175000	0.22909|0.22909	0.585000|0.585000	0.23879|0.23879	-0.296000|-0.296000	0.08947|0.08947	0.591000|0.591000	0.81541|0.81541	CCA|TAC		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		67	48	1	0	5.10652e-33	0.00361	1.14485e-32	67	48				
MFHAS1	9258	broad.mit.edu	37	8	8748915	8748915	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:8748915G>A	ENST00000276282.6	-	1	2240	c.1654C>T	c.(1654-1656)Ctg>Ttg	p.L552L		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	552	Roc. {ECO:0000255|PROSITE- ProRule:PRU00758}.									endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		TGAATGTCCAGACATTTCTCC	0.657																																					Melanoma(103;1201 2045 17515 28966)	Melanoma(103;1201 2045 17515 28966)	uc003wsj.1		NA																	0					0						c.(1654-1656)CTG>TTG		malignant fibrous histiocytoma amplified							43.0	38.0	40.0					8																	8748915		2203	4300	6503	SO:0001819	synonymous_variant	9258							g.chr8:8748915G>A	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.1654C>T	8.37:g.8748915G>A							p.L552L	NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN		COAD - Colon adenocarcinoma(149;0.124)	1	2217	-		Hepatocellular(245;0.217)	552			Roc.		Q96CI0	Silent	SNP	ENST00000276282.6	37	c.1654C>T	CCDS34844.1																																																																																				0.657	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225		7	16	0	0	0	0.00308	0	7	16				
VPS37A	137492	broad.mit.edu	37	8	17132344	17132344	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:17132344A>T	ENST00000324849.4	+	5	1193	c.519A>T	c.(517-519)ttA>ttT	p.L173F	VPS37A_ENST00000521829.1_Missense_Mutation_p.L148F|VPS37A_ENST00000324815.3_Missense_Mutation_p.I183F	NM_001145152.1|NM_152415.2	NP_001138624.1|NP_689628.2	Q8NEZ2	VP37A_HUMAN	vacuolar protein sorting 37 homolog A (S. cerevisiae)	173					cell death (GO:0008219)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	10				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		TCACTTCTTTATCTGTTGCTG	0.438																																							uc003wxj.2		NA																	0					0						c.(517-519)TTA>TTT		hepatocellular carcinoma related protein 1							130.0	110.0	117.0					8																	17132344		2203	4300	6503	SO:0001583	missense	137492				cellular membrane organization|endosome transport|protein transport	centrosome|late endosome membrane|nucleus		g.chr8:17132344A>T		CCDS6001.1, CCDS47811.1	8p22	2012-06-29	2006-04-04		ENSG00000155975	ENSG00000155975			24928	protein-coding gene	gene with protein product	"""hepatocellular carcinoma related protein 1"""	609927	"""vacuolar protein sorting 37A (yeast)"", ""polyglutamine binding protein 2"""	PQBP2		15240819, 15218037, 22717650	Standard	NM_152415		Approved	FLJ32642, HCRP1, SPG53	uc003wxj.3	Q8NEZ2	OTTHUMG00000130785	ENST00000324849.4:c.519A>T	8.37:g.17132344A>T	ENSP00000318629:p.Leu173Phe					VPS37A_uc003wxk.2_Missense_Mutation_p.L148F|VPS37A_uc003wxl.2_5'UTR	p.L173F	NM_152415	NP_689628	Q8NEZ2	VP37A_HUMAN		Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)	5	872	+			173					Q336D5|Q6NW27|Q8N3D7|Q8TBL7|Q96DL9	Missense_Mutation	SNP	ENST00000324849.4	37	c.519A>T	CCDS6001.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.13|10.13	1.264735|1.264735	0.23136|0.23136	.|.	.|.	ENSG00000155975|ENSG00000155975	ENST00000324815|ENST00000324849;ENST00000521829	.|T;T	.|0.57107	.|0.42;0.43	4.05|4.05	-6.0|-6.0	0.02206|0.02206	.|.	.|1.397930	.|0.05083	.|N	.|0.483859	T|T	0.23249|0.23249	0.0562|0.0562	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|B;P	.|0.34780	.|0.302;0.468	.|B;B	.|0.30646	.|0.076;0.118	T|T	0.14200|0.14200	-1.0481|-1.0481	6|9	0.87932|.	D|.	0|.	-0.0847|-0.0847	8.8935|8.8935	0.35449|0.35449	0.1421:0.1088:0.6415:0.1075|0.1421:0.1088:0.6415:0.1075	.|.	.|148;173	.|Q8NEZ2-2;Q8NEZ2	.|.;VP37A_HUMAN	F|F	183|173;148	.|ENSP00000318629:L173F;ENSP00000429680:L148F	ENSP00000318173:I183F|.	I|L	+|+	1|3	0|2	VPS37A|VPS37A	17176715|17176715	0.953000|0.953000	0.32496|0.32496	0.030000|0.030000	0.17652|0.17652	0.950000|0.950000	0.60333|0.60333	-0.077000|-0.077000	0.11394|0.11394	-1.296000|-1.296000	0.02353|0.02353	0.472000|0.472000	0.43445|0.43445	ATC|TTA		0.438	VPS37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253301.2	NM_152415		22	6	0	0	0	0.00278	0	22	6				
DUSP26	78986	broad.mit.edu	37	8	33454976	33454976	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:33454976T>C	ENST00000256261.4	-	2	575	c.58A>G	c.(58-60)Agt>Ggt	p.S20G	DUSP26_ENST00000523956.1_Missense_Mutation_p.S20G	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	20					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		CTTGAGCTACTCCGGGAGAAG	0.552																																							uc003xjp.2		NA																	0					0						c.(58-60)AGT>GGT		dual specificity phosphatase 26							71.0	66.0	68.0					8																	33454976		2203	4300	6503	SO:0001583	missense	78986					Golgi apparatus|nucleus	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr8:33454976T>C	AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.58A>G	8.37:g.33454976T>C	ENSP00000256261:p.Ser20Gly					DUSP26_uc003xjq.2_Missense_Mutation_p.S20G	p.S20G	NM_024025	NP_076930	Q9BV47	DUS26_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)	2	391	-			20					D3DSV8|Q9BTW0	Missense_Mutation	SNP	ENST00000256261.4	37	c.58A>G	CCDS6092.1	.	.	.	.	.	.	.	.	.	.	T	9.981	1.228143	0.22542	.	.	ENSG00000133878	ENST00000256261;ENST00000523956;ENST00000522982	T;T;T	0.20200	3.88;3.88;2.09	5.5	0.178	0.15058	.	1.050610	0.07314	N	0.876309	T	0.09335	0.0230	N	0.03608	-0.345	0.23204	N	0.998129	B	0.02656	0.0	B	0.01281	0.0	T	0.38585	-0.9654	10	0.20519	T	0.43	-6.26	9.3329	0.38032	0.0:0.3802:0.0:0.6198	.	20	Q9BV47	DUS26_HUMAN	G	20	ENSP00000256261:S20G;ENSP00000429176:S20G;ENSP00000430922:S20G	ENSP00000256261:S20G	S	-	1	0	DUSP26	33574518	0.998000	0.40836	0.094000	0.20943	0.656000	0.38851	1.357000	0.34090	0.050000	0.15949	0.459000	0.35465	AGT		0.552	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025		36	23	0	0	0	0.006999	0	36	23				
PXDNL	137902	broad.mit.edu	37	8	52321891	52321891	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:52321891G>T	ENST00000356297.4	-	17	2393	c.2293C>A	c.(2293-2295)Cgc>Agc	p.R765S	PXDNL_ENST00000543296.1_Missense_Mutation_p.R765S	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	765					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCGAGCCCGCGGGGCGCGCGG	0.786																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(2293-2295)CGC>AGC		peroxidasin homolog-like precursor							3.0	4.0	4.0					8																	52321891		1314	2995	4309	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52321891G>T		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2293C>A	8.37:g.52321891G>T	ENSP00000348645:p.Arg765Ser					PXDNL_uc003xqt.3_RNA	p.R765S	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN			17	2394	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	765					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.2293C>A	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.335738	0.41398	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.74632	-0.86;-0.86	3.62	0.373	0.16178	.	.	.	.	.	D	0.82412	0.5031	M	0.85945	2.785	0.09310	N	1	D	0.67145	0.996	D	0.68943	0.961	T	0.67868	-0.5559	9	0.38643	T	0.18	.	3.61	0.08057	0.233:0.0:0.4755:0.2915	.	765	A1KZ92	PXDNL_HUMAN	S	765	ENSP00000348645:R765S;ENSP00000444865:R765S	ENSP00000348645:R765S	R	-	1	0	PXDNL	52484444	0.009000	0.17119	0.000000	0.03702	0.004000	0.04260	0.092000	0.15066	0.160000	0.19432	-0.350000	0.07774	CGC		0.786	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		6	2	1	0	0.00116845	0.001168	0.00162957	6	2				
CHD7	55636	broad.mit.edu	37	8	61748737	61748737	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:61748737T>A	ENST00000423902.2	+	16	4363	c.3884T>A	c.(3883-3885)aTt>aAt	p.I1295N	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1295	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CTAGTGCTGATTGACAAGCTG	0.473																																							uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(3883-3885)ATT>AAT		chromodomain helicase DNA binding protein 7							60.0	59.0	59.0					8																	61748737		2017	4195	6212	SO:0001583	missense	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61748737T>A	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.3884T>A	8.37:g.61748737T>A	ENSP00000392028:p.Ile1295Asn						p.I1295N	NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		16	4361	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	1295			Helicase C-terminal.		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	c.3884T>A	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577955	0.86645	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.70869	-0.52	5.8	5.8	0.92144	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.82107	0.4965	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	D	0.83972	0.0327	10	0.87932	D	0	-16.5452	16.1549	0.81657	0.0:0.0:0.0:1.0	.	1295	Q9P2D1	CHD7_HUMAN	N	1295	ENSP00000392028:I1295N	ENSP00000307304:I1295N	I	+	2	0	CHD7	61911291	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.209000	0.71365	0.533000	0.62120	ATT		0.473	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		15	22	0	0	0	0.003163	0	15	22				
ZFHX4	79776	broad.mit.edu	37	8	77619931	77619931	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:77619931C>T	ENST00000521891.2	+	3	3189	c.2741C>T	c.(2740-2742)tCt>tTt	p.S914F	ZFHX4_ENST00000455469.2_Missense_Mutation_p.S888F|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S888F|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S888F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	888					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAATTCACCTCTGACAGCCTG	0.522										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(2662-2664)TCT>TTT		zinc finger homeodomain 4							76.0	74.0	75.0					8																	77619931		2171	4272	6443	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77619931C>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2741C>T	8.37:g.77619931C>T	ENSP00000430497:p.Ser914Phe	HNSCC(33;0.089)				ZFHX4_uc003yat.1_Missense_Mutation_p.S888F|ZFHX4_uc003yau.1_Missense_Mutation_p.S914F|ZFHX4_uc003yaw.1_Missense_Mutation_p.S888F	p.S888F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		3	3050	+			888					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.2663C>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470195	0.43839	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);	0.000000	0.42964	U	0.000631	T	0.66436	0.2789	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.71674	0.99;0.998;0.994;0.997	P;P;P;D	0.65443	0.797;0.858;0.9;0.935	T	0.68842	-0.5302	10	0.87932	D	0	.	18.8842	0.92368	0.0:1.0:0.0:0.0	.	888;888;914;888	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	F	914;914;888;888;888	ENSP00000430497:S914F;ENSP00000399605:S888F;ENSP00000050961:S888F;ENSP00000430848:S888F	ENSP00000050961:S888F	S	+	2	0	ZFHX4	77782486	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.705000	0.92388	0.585000	0.79938	TCT		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		29	15	0	0	0	0.001786	0	29	15				
RAD21	5885	broad.mit.edu	37	8	117874162	117874162	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:117874162C>G	ENST00000297338.2	-	4	579	c.292G>C	c.(292-294)Gag>Cag	p.E98Q	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	98					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					CGATTTTCCTCAGGCAGGTCA	0.388																																							uc003yod.2		NA																	0				lung(1)|skin(1)	2						c.(292-294)GAG>CAG		RAD21 homolog							127.0	125.0	126.0					8																	117874162		2203	4300	6503	SO:0001583	missense	5885				apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding	g.chr8:117874162C>G	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.292G>C	8.37:g.117874162C>G	ENSP00000297338:p.Glu98Gln						p.E98Q	NM_006265	NP_006256	O60216	RAD21_HUMAN			4	580	-	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)		98					A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	c.292G>C	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361298	0.82353	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485;ENST00000519837;ENST00000522699	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	5.52	5.52	0.82312	Rad21/Rec8-like protein, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56262	0.1973	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.48990	-0.8985	10	0.18710	T	0.47	-13.7873	19.4233	0.94730	0.0:1.0:0.0:0.0	.	98	O60216	RAD21_HUMAN	Q	98	ENSP00000297338:E98Q;ENSP00000429342:E98Q;ENSP00000427923:E98Q;ENSP00000430524:E98Q;ENSP00000428158:E98Q	ENSP00000297338:E98Q	E	-	1	0	RAD21	117943343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.081000	0.71309	2.576000	0.86940	0.585000	0.79938	GAG		0.388	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265		10	25	0	0	0	0.000978	0	10	25				
KIAA2026	158358	broad.mit.edu	37	9	5921057	5921057	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:5921057C>T	ENST00000399933.3	-	8	4938	c.4939G>A	c.(4939-4941)Gca>Aca	p.A1647T	KIAA2026_ENST00000381461.2_Missense_Mutation_p.A1617T	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1647										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACTGCTCTTGCTGAAGAAACC	0.423																																							uc003zjq.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(4939-4941)GCA>ACA		hypothetical protein LOC158358							99.0	94.0	96.0					9																	5921057		1855	4099	5954	SO:0001583	missense	158358							g.chr9:5921057C>T	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4939G>A	9.37:g.5921057C>T	ENSP00000382815:p.Ala1647Thr					KIAA2026_uc010mht.2_Missense_Mutation_p.A822T	p.A1647T	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	8	5155	-		Acute lymphoblastic leukemia(23;0.158)	1647					A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37	c.4939G>A		.	.	.	.	.	.	.	.	.	.	C	9.741	1.164782	0.21538	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.85	-0.623	0.11556	.	0.297154	0.28166	N	0.016342	T	0.13372	0.0324	N	0.14661	0.345	0.25024	N	0.99132	B	0.10296	0.003	B	0.09377	0.004	T	0.30357	-0.9981	9	0.02654	T	1	-6.6261	4.9221	0.13874	0.225:0.4472:0.0:0.3278	.	1647	Q5HYC2	K2026_HUMAN	T	1647;1617	.	ENSP00000370870:A1617T	A	-	1	0	KIAA2026	5911057	0.758000	0.28405	0.991000	0.47740	0.796000	0.44982	-0.271000	0.08572	-0.032000	0.13758	-0.218000	0.12543	GCA		0.423	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		19	31	0	0	0	0.006122	0	19	31				
PTPRD	5789	broad.mit.edu	37	9	8518092	8518092	+	Silent	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:8518092G>A	ENST00000381196.4	-	18	1842	c.1299C>T	c.(1297-1299)acC>acT	p.T433T	PTPRD_ENST00000537002.1_Silent_p.T430T|PTPRD_ENST00000360074.4_Silent_p.T420T|PTPRD_ENST00000397606.3_Silent_p.T423T|PTPRD_ENST00000355233.5_Silent_p.T433T|PTPRD_ENST00000397617.3_Silent_p.T423T|PTPRD_ENST00000358503.5_Silent_p.T420T|PTPRD_ENST00000486161.1_Silent_p.T433T|PTPRD_ENST00000397611.3_Silent_p.T430T|PTPRD_ENST00000540109.1_Silent_p.T433T|PTPRD_ENST00000356435.5_Silent_p.T433T	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	433	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GTACCAAAATGGTGGTCGAAC	0.507										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(1297-1299)ACC>ACT		protein tyrosine phosphatase, receptor type, D							235.0	216.0	222.0					9																	8518092		2203	4300	6503	SO:0001819	synonymous_variant	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8518092G>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1299C>T	9.37:g.8518092G>A		TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Silent_p.T433T|PTPRD_uc003zkq.2_Silent_p.T433T|PTPRD_uc003zkr.2_Silent_p.T427T|PTPRD_uc003zks.2_Silent_p.T423T|PTPRD_uc003zkl.2_Silent_p.T433T|PTPRD_uc003zkm.2_Silent_p.T420T|PTPRD_uc003zkn.2_Silent_p.T433T|PTPRD_uc003zko.2_Silent_p.T430T	p.T433T	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	20	2010	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	433			Fibronectin type-III 2.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	c.1299C>T	CCDS43786.1																																																																																				0.507	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			42	72	0	0	0	0.00874	0	42	72				
TAF1L	138474	broad.mit.edu	37	9	32633465	32633466	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:32633465_32633466CC>AA	ENST00000242310.4	-	1	2201_2202	c.2112_2113GG>TT	c.(2110-2115)gaGGaa>gaTTaa	p.704_705EE>D*	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	704					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GGTCCATTTTCCTCACTATATT	0.431																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(2110-2115)GAGGAA>GATTAA		TBP-associated factor RNA polymerase 1-like																																				SO:0001587	stop_gained	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32633465_32633466CC>AA	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2112_2113delinsAA	9.37:g.32633465_32633466delinsAA	ENSP00000418379:p.E704_E705delinsD*					uc003zrh.1_RNA	p.704_705EE>D*	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	2202_2203	-			704_705					Q0VG57	Nonsense_Mutation	DNP	ENST00000242310.4	37	c.2112_2113GG>TT	CCDS35003.1																																																																																				0.431	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			31	54	0	0	0	0.004672	0	31	54				
GADD45G	10912	broad.mit.edu	37	9	92220729	92220729	+	Silent	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:92220729G>T	ENST00000252506.6	+	3	412	c.303G>T	c.(301-303)ctG>ctT	p.L101L	GADD45G_ENST00000494726.1_3'UTR|GADD45G_ENST00000375769.1_Silent_p.L83L	NM_006705.3	NP_006696.1	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma	101					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)	2						TGCAGCGGCTGGCGGCTATCG	0.652																																					Colon(131;320 2336 18973 23919)	Colon(131;320 2336 18973 23919)	uc004aqq.2		NA																	0					0						c.(301-303)CTG>CTT		growth arrest and DNA-damage-inducible, gamma							34.0	29.0	31.0					9																	92220729		2203	4300	6503	SO:0001819	synonymous_variant	10912				activation of MAPKKK activity|apoptosis|cell differentiation|DNA repair|multicellular organismal development		protein binding	g.chr9:92220729G>T	D83023	CCDS6686.1	9q22.1-q22.2	2008-07-21			ENSG00000130222	ENSG00000130222			4097	protein-coding gene	gene with protein product	"""gadd-related protein, 17 kD"", ""growth arrest and DNA-damage-inducible gamma"""	604949				9827804, 10496071	Standard	NM_006705		Approved	DDIT2, GADD45gamma, GRP17, CR6	uc004aqq.3	O95257	OTTHUMG00000020187	ENST00000252506.6:c.303G>T	9.37:g.92220729G>T						GADD45G_uc004aqr.2_Silent_p.L83L	p.L101L	NM_006705	NP_006696	O95257	GA45G_HUMAN			3	413	+			101					Q5VZ87|Q9C076	Silent	SNP	ENST00000252506.6	37	c.303G>T	CCDS6686.1																																																																																				0.652	GADD45G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053000.1	NM_006705		10	12	1	0	0.00621372	0.006214	0.00855155	10	12				
ZNF367	195828	broad.mit.edu	37	9	99160522	99160522	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:99160522G>T	ENST00000375256.4	-	2	791	c.495C>A	c.(493-495)agC>agA	p.S165R		NM_153695.3	NP_710162.1	Q7RTV3	ZN367_HUMAN	zinc finger protein 367	165					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(4)|large_intestine(3)|lung(3)|prostate(1)	12		Acute lymphoblastic leukemia(62;0.0167)				AACGGATTCTGCTGGATGAAT	0.413																																							uc004awf.2		NA																	0					0						c.(493-495)AGC>AGA		zinc finger protein 367							188.0	186.0	186.0					9																	99160522		2203	4300	6503	SO:0001583	missense	195828				regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:99160522G>T	AK091289	CCDS6718.1	9q22	2008-05-02			ENSG00000165244	ENSG00000165244		"""Zinc fingers, C2H2-type"""	18320	protein-coding gene	gene with protein product		610160					Standard	NM_153695		Approved	FLJ33970	uc004awf.3	Q7RTV3	OTTHUMG00000020295	ENST00000375256.4:c.495C>A	9.37:g.99160522G>T	ENSP00000364405:p.Ser165Arg					ZNF367_uc004awg.2_Missense_Mutation_p.S165R	p.S165R	NM_153695	NP_710162	Q7RTV3	ZN367_HUMAN			2	850	-		Acute lymphoblastic leukemia(62;0.0167)	165					Q6Q7C8	Missense_Mutation	SNP	ENST00000375256.4	37	c.495C>A	CCDS6718.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414972	0.83449	.	.	ENSG00000165244	ENST00000375256	T	0.05580	3.42	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.22085	0.0532	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.00009	-1.2459	10	0.72032	D	0.01	-18.5362	13.8854	0.63706	0.0722:0.0:0.9278:0.0	.	165;165	Q7RTV3-2;Q7RTV3	.;ZN367_HUMAN	R	165	ENSP00000364405:S165R	ENSP00000364405:S165R	S	-	3	2	ZNF367	98200343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.094000	0.50227	2.880000	0.98712	0.650000	0.86243	AGC		0.413	ZNF367-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053266.1			40	73	1	0	4.67007e-22	0.00874	9.54616e-22	40	73				
C9orf84	158401	broad.mit.edu	37	9	114470151	114470151	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:114470151C>T	ENST00000318737.4	-	17	2478	c.2350G>A	c.(2350-2352)Gaa>Aaa	p.E784K	C9orf84_ENST00000394777.4_Missense_Mutation_p.E710K|C9orf84_ENST00000394779.3_Missense_Mutation_p.E745K|C9orf84_ENST00000374287.3_Missense_Mutation_p.E784K	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	784										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						AAAACACCTTCAGATTCCAGA	0.328																																							uc004bfr.2		NA																	0				ovary(2)	2						c.(2350-2352)GAA>AAA		hypothetical protein LOC158401 isoform 1							96.0	112.0	106.0					9																	114470151		2202	4298	6500	SO:0001583	missense	158401							g.chr9:114470151C>T	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.2350G>A	9.37:g.114470151C>T	ENSP00000322108:p.Glu784Lys					C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_Missense_Mutation_p.E745K|C9orf84_uc010mug.2_Missense_Mutation_p.E695K	p.E784K	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN			17	2485	-			784					A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	37	c.2350G>A	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	C	3.868	-0.028495	0.07589	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.03745	3.84;3.82;3.85;3.85	4.46	-0.426	0.12314	.	1.637940	0.03428	N	0.207291	T	0.03477	0.0100	L	0.27053	0.805	0.09310	N	1	B;B;B	0.11235	0.0;0.004;0.0	B;B;B	0.11329	0.002;0.006;0.002	T	0.46484	-0.9188	10	0.18710	T	0.47	7.0E-4	7.7195	0.28723	0.0:0.2272:0.0:0.7728	.	710;784;745	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	K	745;710;398;784;784	ENSP00000378259:E745K;ENSP00000378257:E710K;ENSP00000363405:E784K;ENSP00000322108:E784K	ENSP00000322108:E784K	E	-	1	0	C9orf84	113509972	0.000000	0.05858	0.003000	0.11579	0.925000	0.55904	0.100000	0.15231	-0.145000	0.11294	-0.251000	0.11542	GAA		0.328	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521		10	103	0	0	0	0.000978	0	10	103				
PTGS1	5742	broad.mit.edu	37	9	125145816	125145816	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:125145816C>A	ENST00000362012.2	+	8	796	c.791C>A	c.(790-792)tCg>tAg	p.S264*	PTGS1_ENST00000223423.4_Nonsense_Mutation_p.S264*|PTGS1_ENST00000540753.1_Nonsense_Mutation_p.S239*|PTGS1_ENST00000373698.5_Nonsense_Mutation_p.S155*	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	264					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TACCCGCCCTCGGTAGAAGAG	0.647																																							uc004bmg.1		NA																	0				ovary(1)|skin(1)	2						c.(790-792)TCG>TAG		prostaglandin-endoperoxide synthase 1 isoform 1	Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dipyrone(DB04817)|Etodolac(DB00749)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Mesalazine(DB00244)|Minoxidil(DB00350)|Nabumetone(DB00461)|Naproxen(DB00788)|Phenacetin(DB03783)|Piroxicam(DB00554)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Tolmetin(DB00500)						48.0	48.0	48.0					9																	125145816		2203	4300	6503	SO:0001587	stop_gained	5742				cyclooxygenase pathway|hormone biosynthetic process|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum membrane|Golgi apparatus|microsome|plasma membrane	heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity	g.chr9:125145816C>A	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.791C>A	9.37:g.125145816C>A	ENSP00000354612:p.Ser264*					PTGS1_uc011lys.1_Nonsense_Mutation_p.S239*|PTGS1_uc010mwb.1_Nonsense_Mutation_p.S155*|PTGS1_uc004bmf.1_Nonsense_Mutation_p.S264*|PTGS1_uc004bmh.1_Nonsense_Mutation_p.S155*|PTGS1_uc011lyt.1_Nonsense_Mutation_p.S155*	p.S264*	NM_000962	NP_000953	P23219	PGH1_HUMAN			8	926	+			264					A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Nonsense_Mutation	SNP	ENST00000362012.2	37	c.791C>A	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	C	9.789	1.177422	0.21787	.	.	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000373698	.	.	.	5.17	5.17	0.71159	.	0.254416	0.39407	N	0.001361	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-11.1698	13.0529	0.58964	0.0:0.92:0.0:0.08	.	.	.	.	X	239;264;264;155	.	ENSP00000223423:S264X	S	+	2	0	PTGS1	124185637	0.083000	0.21467	0.073000	0.20177	0.026000	0.11368	2.068000	0.41471	2.388000	0.81334	0.561000	0.74099	TCG		0.647	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1			15	13	1	0	4.7546e-09	0.004007	7.89908e-09	15	13				
DENND1A	57706	broad.mit.edu	37	9	126144289	126144289	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:126144289G>A	ENST00000373624.2	-	22	2653	c.2452C>T	c.(2452-2454)Ccc>Tcc	p.P818S	DENND1A_ENST00000542603.1_Missense_Mutation_p.P603S|DENND1A_ENST00000394219.3_Missense_Mutation_p.P829S|DENND1A_ENST00000473039.1_5'UTR	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	818	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CCTGCAGGGGGGAAGCTGAAT	0.672																																							uc004bnz.1		NA																	0				ovary(2)	2						c.(2452-2454)CCC>TCC		DENN/MADD domain containing 1A isoform 1							6.0	9.0	8.0					9																	126144289		1996	4122	6118	SO:0001583	missense	57706					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity	g.chr9:126144289G>A	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.2452C>T	9.37:g.126144289G>A	ENSP00000362727:p.Pro818Ser					DENND1A_uc011lzl.1_Missense_Mutation_p.P636S|DENND1A_uc004bny.1_Missense_Mutation_p.P600S|DENND1A_uc011lzm.1_Missense_Mutation_p.P829S|DENND1A_uc010mwh.1_Missense_Mutation_p.P239S	p.P818S	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN			22	2685	-			818			Pro-rich.		A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	37	c.2452C>T	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232993	0.39498	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219	T;T;T	0.25579	3.31;1.79;3.09	4.5	3.59	0.41128	.	0.215214	0.39759	N	0.001273	T	0.38108	0.1028	L	0.29908	0.895	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;1.0;0.926	D;D;D;P	0.87578	0.998;0.998;0.996;0.454	T	0.21655	-1.0239	10	0.72032	D	0.01	-8.5823	13.6854	0.62513	0.0:0.0:0.8442:0.1558	.	829;819;818;681	Q8TEH3-6;Q8TEH3-7;Q8TEH3;Q9HCG4	.;.;DEN1A_HUMAN;.	S	818;603;829	ENSP00000362727:P818S;ENSP00000437457:P603S;ENSP00000377766:P829S	ENSP00000362727:P818S	P	-	1	0	DENND1A	125184110	0.983000	0.35010	0.710000	0.30468	0.257000	0.26127	3.392000	0.52537	0.861000	0.35504	0.455000	0.32223	CCC		0.672	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820		5	13	0	0	0	0.000602	0	5	13				
LRSAM1	90678	broad.mit.edu	37	9	130257628	130257628	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:130257628G>T	ENST00000323301.4	+	21	2233	c.1629G>T	c.(1627-1629)agG>agT	p.R543S	LRSAM1_ENST00000373322.1_Missense_Mutation_p.R543S|LRSAM1_ENST00000373324.4_Missense_Mutation_p.R516S|LRSAM1_ENST00000300417.6_Missense_Mutation_p.R543S|LRSAM1_ENST00000483302.1_3'UTR	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	543					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GTGAAACCAGGCAGGAAAATT	0.468																																							uc004brb.1		NA																	0					0						c.(1627-1629)AGG>AGT		leucine rich repeat and sterile alpha motif							84.0	80.0	81.0					9																	130257628		2203	4300	6503	SO:0001583	missense	90678				negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:130257628G>T	AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.1629G>T	9.37:g.130257628G>T	ENSP00000322937:p.Arg543Ser					LRSAM1_uc010mxk.1_Missense_Mutation_p.R516S|LRSAM1_uc004brc.1_Missense_Mutation_p.R543S|LRSAM1_uc004brd.1_Missense_Mutation_p.R543S|LRSAM1_uc004bre.1_Missense_Mutation_p.R123S|uc004brf.1_5'Flank|LRSAM1_uc004brg.1_5'UTR	p.R543S	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN			22	1974	+			543			Potential.		Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	ENST00000323301.4	37	c.1629G>T	CCDS6873.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.113945	0.37339	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.75821	1.47;-0.97;1.47;1.47	5.73	2.91	0.33838	.	0.089764	0.85682	D	0.000000	T	0.52996	0.1769	N	0.08118	0	0.26454	N	0.975569	B;B	0.11235	0.004;0.002	B;B	0.12837	0.008;0.006	T	0.48445	-0.9035	10	0.54805	T	0.06	-38.0744	9.7142	0.40265	0.2287:0.0:0.7713:0.0	.	516;543	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	S	543;516;543;543	ENSP00000300417:R543S;ENSP00000362421:R516S;ENSP00000322937:R543S;ENSP00000362419:R543S	ENSP00000300417:R543S	R	+	3	2	LRSAM1	129297449	0.790000	0.28787	1.000000	0.80357	0.977000	0.68977	-0.289000	0.08365	0.439000	0.26476	-0.140000	0.14226	AGG		0.468	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054164.1	NM_138361		12	19	1	0	2.80697e-09	0.000978	4.70084e-09	12	19				
TOR1A	1861	broad.mit.edu	37	9	132576287	132576287	+	Silent	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:132576287C>A	ENST00000351698.4	-	5	1011	c.963G>T	c.(961-963)acG>acT	p.T321T		NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	321	Interaction with KLC1.|Interaction with SYNE3.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				TGGTGAACACCGTTTTGCAGC	0.438																																							uc004byl.2		NA																	0				central_nervous_system(1)	1						c.(961-963)ACG>ACT		torsin A precursor							156.0	147.0	150.0					9																	132576287		2203	4300	6503	SO:0001819	synonymous_variant	1861				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding	g.chr9:132576287C>A	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.963G>T	9.37:g.132576287C>A						TOR1A_uc004bym.2_RNA	p.T321T	NM_000113	NP_000104	O14656	TOR1A_HUMAN			5	1040	-		Ovarian(14;0.00556)	321					B2RB58|Q53Y64|Q96CA0	Silent	SNP	ENST00000351698.4	37	c.963G>T	CCDS6930.1																																																																																				0.438	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054611.1	NM_000113		20	27	1	0	5.03518e-11	0.007413	8.85937e-11	20	27				
PNPLA4	8228	broad.mit.edu	37	X	7889850	7889850	+	Silent	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:7889850C>T	ENST00000381042.4	-	4	485	c.315G>A	c.(313-315)gaG>gaA	p.E105E	PNPLA4_ENST00000537427.1_Silent_p.E18E|PNPLA4_ENST00000444736.1_Silent_p.E105E	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	105	Patatin.				lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TCTGGGCCAGCTCGTGAGCGC	0.443																																							uc011mhq.1		NA																	0					0						c.(313-315)GAG>GAA		patatin-like phospholipase domain containing 4							113.0	95.0	101.0					X																	7889850		2203	4299	6502	SO:0001819	synonymous_variant	8228				lipid catabolic process		triglyceride lipase activity	g.chrX:7889850C>T	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.315G>A	X.37:g.7889850C>T						PNPLA4_uc011mhr.1_Silent_p.E105E|PNPLA4_uc011mhs.1_Silent_p.E18E	p.E105E	NM_004650	NP_004641	P41247	PLPL4_HUMAN			4	477	-		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)	105			Patatin.		A8K1H3|B4E362|Q8WW83	Silent	SNP	ENST00000381042.4	37	c.315G>A	CCDS14129.1																																																																																				0.443	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055687.1	NM_004650		11	22	0	0	0	0.008291	0	11	22				
AMELX	265	broad.mit.edu	37	X	11316772	11316772	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:11316772C>A	ENST00000380714.3	+	5	317	c.249C>A	c.(247-249)caC>caA	p.H83Q	ARHGAP6_ENST00000380718.1_Intron|ARHGAP6_ENST00000413512.3_Intron|ARHGAP6_ENST00000337414.4_Intron|AMELX_ENST00000380712.3_Missense_Mutation_p.H97Q|AMELX_ENST00000348912.4_Missense_Mutation_p.H67Q|ARHGAP6_ENST00000380732.3_Intron|ARHGAP6_ENST00000380736.1_Intron	NM_001142.2	NP_001133.1	Q99217	AMELX_HUMAN	amelogenin, X-linked	83					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|enamel mineralization (GO:0070166)|epithelial to mesenchymal transition (GO:0001837)|ion homeostasis (GO:0050801)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of tooth mineralization (GO:0070172)|signal transduction (GO:0007165)|tooth mineralization (GO:0034505)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|structural constituent of tooth enamel (GO:0030345)			endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	15						AGCCTCATCACCACATCCCAG	0.602																																							uc004cut.2		NA																	0					0						c.(247-249)CAC>CAA		amelogenin (X chromosome) isoform 1 precursor							147.0	124.0	131.0					X																	11316772		2203	4300	6503	SO:0001583	missense	265				cell adhesion|cell proliferation|chondrocyte differentiation|enamel mineralization|epithelial to mesenchymal transition|ion homeostasis|odontogenesis of dentine-containing tooth|osteoblast differentiation|positive regulation of collagen biosynthetic process|positive regulation of tooth mineralization|signal transduction	proteinaceous extracellular matrix	cell surface binding|growth factor activity|hydroxyapatite binding|identical protein binding|structural constituent of tooth enamel	g.chrX:11316772C>A		CCDS14144.1, CCDS14145.1, CCDS14146.1	Xp22.31-p22.1	2010-04-20	2010-04-20		ENSG00000125363	ENSG00000125363			461	protein-coding gene	gene with protein product	"""amelogenesis imperfecta 1"""	300391	"""amelogenin (X chromosome, amelogenesis imperfecta 1)"""	AMG, AIH1		1734713	Standard	NM_182680		Approved		uc004cus.3	Q99217	OTTHUMG00000021130	ENST00000380714.3:c.249C>A	X.37:g.11316772C>A	ENSP00000370090:p.His83Gln					ARHGAP6_uc004cup.1_Intron|ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_Missense_Mutation_p.H97Q|AMELX_uc004cuu.2_Missense_Mutation_p.H67Q	p.H83Q	NM_001142	NP_001133	Q99217	AMELX_HUMAN			5	317	+			83					Q96NW6|Q9UCA7	Missense_Mutation	SNP	ENST00000380714.3	37	c.249C>A	CCDS14144.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014950	0.35511	.	.	ENSG00000125363	ENST00000380714;ENST00000380712;ENST00000348912	D;D;D	0.92099	-2.97;-2.97;-2.97	5.07	3.28	0.37604	.	0.000000	0.64402	D	0.000015	D	0.90511	0.7027	M	0.83223	2.63	0.29527	N	0.85306	B;B;B	0.21606	0.058;0.026;0.021	B;B;B	0.19666	0.026;0.025;0.015	D	0.84347	0.0530	10	0.46703	T	0.11	-1.0752	6.863	0.24077	0.1735:0.7327:0.0:0.0937	.	67;83;97	Q99217-2;Q99217;Q99217-3	.;AMELX_HUMAN;.	Q	83;97;67	ENSP00000370090:H83Q;ENSP00000370088:H97Q;ENSP00000335312:H67Q	ENSP00000335312:H67Q	H	+	3	2	AMELX	11226693	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.037000	0.30241	0.388000	0.25054	0.415000	0.27848	CAC		0.602	AMELX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055746.1	NM_001142		50	74	1	0	1.46357e-32	0.00361	3.26369e-32	50	74				
GPM6B	2824	broad.mit.edu	37	X	13795473	13795473	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:13795473C>T	ENST00000356942.5	-	5	1090	c.649G>A	c.(649-651)Gag>Aag	p.E217K	GPM6B_ENST00000454189.2_Missense_Mutation_p.E198K|GPM6B_ENST00000398361.3_Missense_Mutation_p.E131K|GPM6B_ENST00000493677.1_Missense_Mutation_p.E231K|GPM6B_ENST00000355135.2_Missense_Mutation_p.E257K|GPM6B_ENST00000316715.4_Missense_Mutation_p.E257K	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B	217					cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						GAGTTTACCTCGTTTGTGTTG	0.433																																							uc004cvz.2		NA																	0					0						c.(649-651)GAG>AAG		glycoprotein M6B isoform 3							174.0	144.0	154.0					X																	13795473		2203	4300	6503	SO:0001583	missense	2824				cell differentiation|nervous system development	integral to membrane		g.chrX:13795473C>T		CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.649G>A	X.37:g.13795473C>T	ENSP00000349420:p.Glu217Lys					GPM6B_uc004cvx.2_Missense_Mutation_p.E198K|GPM6B_uc011min.1_Missense_Mutation_p.E131K|GPM6B_uc004cwa.2_Missense_Mutation_p.E198K|GPM6B_uc004cvw.2_Missense_Mutation_p.E257K|GPM6B_uc011mim.1_Missense_Mutation_p.E231K|GPM6B_uc004cvy.2_Missense_Mutation_p.E257K	p.E217K	NM_005278	NP_005269	Q13491	GPM6B_HUMAN			5	940	-			217					O76077|Q86X43|Q8N956	Missense_Mutation	SNP	ENST00000356942.5	37	c.649G>A	CCDS14158.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.146975|5.146975	0.94603|0.94603	.|.	.|.	ENSG00000046653|ENSG00000046653	ENST00000316715;ENST00000454189;ENST00000493677;ENST00000355135;ENST00000356942;ENST00000398361;ENST00000495211|ENST00000472735	D;D;D;D;D;D;D|.	0.99422|.	-5.88;-5.88;-5.88;-5.88;-5.88;-5.88;-5.88|.	5.41|5.41	5.41|5.41	0.78517|0.78517	Myelin proteolipid protein PLP, conserved site (1);|.	0.043886|.	0.85682|.	D|.	0.000000|.	D|D	0.82632|0.82632	0.5079|0.5079	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;0.999;1.0;0.999;1.0;1.0|.	D;D;D;D;D;D|.	0.87578|.	0.966;0.917;0.99;0.951;0.985;0.998|.	D|D	0.84405|0.84405	0.0562|0.0562	10|5	0.54805|.	T|.	0.06|.	-4.3165|-4.3165	18.5277|18.5277	0.90978|0.90978	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	231;198;217;257;209;257|.	B7Z613;Q13491-2;Q13491;Q13491-3;Q59FD5;Q8N956|.	.;.;GPM6B_HUMAN;.;.;.|.	K|Q	257;198;231;257;217;131;182|112	ENSP00000316861:E257K;ENSP00000389915:E198K;ENSP00000419904:E231K;ENSP00000347258:E257K;ENSP00000349420:E217K;ENSP00000381402:E131K;ENSP00000419409:E182K|.	ENSP00000316861:E257K|.	E|R	-|-	1|2	0|0	GPM6B|GPM6B	13705394|13705394	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.827000|0.827000	0.46813|0.46813	7.101000|7.101000	0.76997|0.76997	2.405000|2.405000	0.81733|0.81733	0.600000|0.600000	0.82982|0.82982	GAG|CGA		0.433	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055822.1	NM_001001995		5	28	0	0	0	0.000602	0	5	28				
MOSPD2	158747	broad.mit.edu	37	X	14915307	14915307	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:14915307G>T	ENST00000380492.3	+	5	512	c.424G>T	c.(424-426)Ggg>Tgg	p.G142W	MOSPD2_ENST00000495110.1_3'UTR|MOSPD2_ENST00000482354.1_Missense_Mutation_p.G142W	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	142	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					GAGGGAAAATGGGAAACCTGT	0.378																																							uc004cwi.2		NA																	0				lung(1)	1						c.(424-426)GGG>TGG		motile sperm domain containing 2							176.0	167.0	170.0					X																	14915307		2203	4300	6503	SO:0001583	missense	158747					integral to membrane	structural molecule activity	g.chrX:14915307G>T	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.424G>T	X.37:g.14915307G>T	ENSP00000369860:p.Gly142Trp					MOSPD2_uc004cwj.2_Missense_Mutation_p.G79W	p.G142W	NM_152581	NP_689794	Q8NHP6	MSPD2_HUMAN			5	512	+	Hepatocellular(33;0.183)		142			CRAL-TRIO.		Q8N3H2|Q8NA83	Missense_Mutation	SNP	ENST00000380492.3	37	c.424G>T	CCDS14162.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359992	0.82353	.	.	ENSG00000130150	ENST00000380492	T	0.75260	-0.92	5.23	5.23	0.72850	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	D	0.86611	0.5974	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87284	0.2294	10	0.51188	T	0.08	.	18.2	0.89834	0.0:0.0:1.0:0.0	.	142	Q8NHP6	MSPD2_HUMAN	W	142	ENSP00000369860:G142W	ENSP00000369860:G142W	G	+	1	0	MOSPD2	14825228	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.290000	0.96065	2.322000	0.78497	0.529000	0.55759	GGG		0.378	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581		34	55	1	0	6.97489e-18	0.004878	1.36551e-17	34	55				
ZFX	7543	broad.mit.edu	37	X	24197628	24197628	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:24197628G>T	ENST00000379177.1	+	6	814	c.387G>T	c.(385-387)atG>atT	p.M129I	ZFX_ENST00000338565.3_Missense_Mutation_p.M129I|ZFX_ENST00000540034.1_Missense_Mutation_p.M168I|ZFX_ENST00000379188.3_Missense_Mutation_p.M129I|ZFX_ENST00000459724.1_Intron|ZFX_ENST00000539115.1_Intron|ZFX_ENST00000304543.5_Missense_Mutation_p.M129I	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	129					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						CAATGTCTATGCCAGAACACG	0.428																																					Esophageal Squamous(20;306 562 7346 32868 37983)	Esophageal Squamous(20;306 562 7346 32868 37983)	uc004dbf.2		NA																	0				ovary(2)	2						c.(385-387)ATG>ATT		zinc finger protein, X-linked							371.0	282.0	312.0					X																	24197628		2203	4300	6503	SO:0001583	missense	7543				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chrX:24197628G>T		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.387G>T	X.37:g.24197628G>T	ENSP00000368475:p.Met129Ile					ZFX_uc004dbd.1_Missense_Mutation_p.M129I|ZFX_uc010nfx.1_Intron|ZFX_uc004dbe.2_Missense_Mutation_p.M129I|ZFX_uc011mjv.1_Missense_Mutation_p.M168I|ZFX_uc010nfy.1_Missense_Mutation_p.M129I	p.M129I	NM_003410	NP_003401	P17010	ZFX_HUMAN			4	645	+			129					B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	ENST00000379177.1	37	c.387G>T	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	G	8.387	0.838918	0.16891	.	.	ENSG00000005889	ENST00000428571;ENST00000379188;ENST00000536464;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11	5.97	2.7	0.31948	Transcriptional activator, Zfx / Zfy domain (1);	0.278401	0.34777	N	0.003698	T	0.20700	0.0498	N	0.16656	0.425	0.80722	D	1	B;B;B;B	0.10296	0.0;0.003;0.0;0.001	B;B;B;B	0.10450	0.001;0.004;0.0;0.005	T	0.06752	-1.0809	10	0.27082	T	0.32	-0.0384	2.7943	0.05397	0.3782:0.2306:0.3911:0.0	.	168;129;129;133	B9EG97;F5H6Z8;P17010;Q59EB9	.;.;ZFX_HUMAN;.	I	129;129;129;129;129;168;129	ENSP00000411637:M129I;ENSP00000368486:M129I;ENSP00000368475:M129I;ENSP00000304985:M129I;ENSP00000441382:M168I;ENSP00000343384:M129I	ENSP00000304985:M129I	M	+	3	0	ZFX	24107549	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	1.461000	0.35255	1.158000	0.42547	0.600000	0.82982	ATG		0.428	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410		83	133	1	0	3.89792e-41	0.00361	8.88216e-41	83	133				
RBM10	8241	broad.mit.edu	37	X	47045157	47045157	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:47045157G>T	ENST00000377604.3	+	21	3140	c.2398G>T	c.(2398-2400)Gag>Tag	p.E800*	RBM10_ENST00000329236.7_Nonsense_Mutation_p.E722*|RBM10_ENST00000345781.6_Nonsense_Mutation_p.E723*	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	800					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GTCAGAAAACGAGCTAGAAGC	0.572																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(2398-2400)GAG>TAG		RNA binding motif protein 10 isoform 1							74.0	65.0	68.0					X																	47045157		2203	4300	6503	SO:0001587	stop_gained	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47045157G>T	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.2398G>T	X.37:g.47045157G>T	ENSP00000366829:p.Glu800*					RBM10_uc004dhg.2_Nonsense_Mutation_p.E722*|RBM10_uc004dhh.2_Nonsense_Mutation_p.E799*|RBM10_uc010nhq.2_Nonsense_Mutation_p.E723*|RBM10_uc004dhi.2_Nonsense_Mutation_p.E865*	p.E800*	NM_005676	NP_005667	P98175	RBM10_HUMAN			21	2777	+			800					C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Nonsense_Mutation	SNP	ENST00000377604.3	37	c.2398G>T	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	42	9.335801	0.99140	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-23.0352	15.1092	0.72343	0.0:0.0:1.0:0.0	.	.	.	.	X	800;722;723	.	ENSP00000328848:E722X	E	+	1	0	RBM10	46930101	1.000000	0.71417	0.411000	0.26484	0.971000	0.66376	9.448000	0.97600	2.244000	0.73946	0.468000	0.43344	GAG		0.572	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		8	13	1	0	1.11149e-13	0.008291	2.04181e-13	8	13				
TBC1D25	4943	broad.mit.edu	37	X	48418002	48418002	+	Splice_Site	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:48418002G>T	ENST00000376771.4	+	6	1047	c.706G>T	c.(706-708)Gtg>Ttg	p.V236L	TBC1D25_ENST00000537536.1_5'UTR|snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000476141.1_3'UTR	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	236	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CCCTGGGCAGGTGGTGTGGCG	0.567																																							uc004dka.1		NA																	0				ovary(1)	1						c.(706-708)GTG>TTG		TBC1 domain family, member 25							54.0	51.0	52.0					X																	48418002		2203	4300	6503	SO:0001630	splice_region_variant	4943					intracellular	Rab GTPase activator activity	g.chrX:48418002G>T	L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.706-1G>T	X.37:g.48418002G>T						TBC1D25_uc011mly.1_Missense_Mutation_p.V178L|TBC1D25_uc004dkb.1_5'UTR|TBC1D25_uc011mlz.1_5'UTR|TBC1D25_uc011mma.1_5'UTR|TBC1D25_uc004dkc.1_5'UTR|TBC1D25_uc011mmb.1_Missense_Mutation_p.V240L|TBC1D25_uc011mmc.1_5'UTR|TBC1D25_uc011mmd.1_5'UTR	p.V236L	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN			6	817	+			236			Rab-GAP TBC.		Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	37	c.706G>T	CCDS35242.1	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434390	0.62955	.	.	ENSG00000068354	ENST00000376771	T	0.10573	2.86	5.59	5.59	0.84812	Rab-GAP/TBC domain (4);	0.217632	0.38492	N	0.001676	T	0.23492	0.0568	L	0.58510	1.815	0.80722	D	1	D;D;B	0.65815	0.995;0.985;0.383	P;P;B	0.54965	0.765;0.765;0.242	T	0.00284	-1.1848	9	.	.	.	-0.8566	15.9341	0.79688	0.0:0.0:1.0:0.0	.	240;178;236	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	L	236	ENSP00000365962:V236L	.	V	+	1	0	TBC1D25	48302946	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	8.840000	0.92125	2.363000	0.80096	0.468000	0.43344	GTG		0.567	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536	Missense_Mutation	11	15	1	0	0.000978159	0.000978	0.00136877	11	15				
OTUD5	55593	broad.mit.edu	37	X	48781242	48781242	+	Silent	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:48781242G>T	ENST00000156084.4	-	7	1426	c.1366C>A	c.(1366-1368)Cgg>Agg	p.R456R	OTUD5_ENST00000428668.2_Silent_p.R234R|OTUD5_ENST00000484499.1_5'Flank|OTUD5_ENST00000376488.3_Silent_p.R451R|OTUD5_ENST00000396743.3_Silent_p.R451R	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	456					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)	p.R427G(1)|p.R456G(1)		endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						GCTGAACTCCGCTGCCGCGGG	0.637																																							uc004dlu.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1366-1368)CGG>AGG		OTU domain containing 5 isoform a							42.0	40.0	41.0					X																	48781242		2202	4300	6502	SO:0001819	synonymous_variant	55593				negative regulation of type I interferon production		cysteine-type peptidase activity	g.chrX:48781242G>T		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.1366C>A	X.37:g.48781242G>T						OTUD5_uc004dlt.3_Silent_p.R451R|OTUD5_uc004dlv.2_Silent_p.R451R|OTUD5_uc011mmp.1_Silent_p.R234R	p.R456R	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN			7	1427	-			456					B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Silent	SNP	ENST00000156084.4	37	c.1366C>A	CCDS14313.1																																																																																				0.637	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602		7	13	1	0	2.0095e-06	0.001984	3.04713e-06	7	13				
RIBC1	158787	broad.mit.edu	37	X	53457342	53457342	+	Splice_Site	SNP	A	A	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:53457342A>G	ENST00000375327.3	+	7	816		c.e7-1		HSD17B10_ENST00000495986.1_5'Flank|RP3-339A18.6_ENST00000418049.1_RNA|RIBC1_ENST00000414955.2_Splice_Site	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1											lung(2)	2						GGGCTCCACCAGGCAGCTGTG	0.587																																							uc004dsk.2		NA																	0					0						c.e7-2		RIB43A domain with coiled-coils 1 isoform 1							24.0	20.0	21.0					X																	53457342		2191	4267	6458	SO:0001630	splice_region_variant	158787							g.chrX:53457342A>G	AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.664-1A>G	X.37:g.53457342A>G						RIBC1_uc011mog.1_Splice_Site_p.A107_splice	p.A222_splice	NM_001031745	NP_001026915	Q8N443	RIBC1_HUMAN			7	817	+								B4E297|E9PDU2|Q5H931|Q96A80	Splice_Site	SNP	ENST00000375327.3	37	c.664_splice	CCDS35299.1	.	.	.	.	.	.	.	.	.	.	A	9.816	1.184434	0.21870	.	.	ENSG00000158423	ENST00000414955;ENST00000375327	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9043	0.58143	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIBC1	53474067	1.000000	0.71417	0.829000	0.32907	0.022000	0.10575	4.805000	0.62561	1.963000	0.57068	0.430000	0.28490	.		0.587	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056762.1	NM_144968	Intron	12	10	0	0	0	0.001368	0	12	10				
ZCCHC13	389874	broad.mit.edu	37	X	73524388	73524388	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:73524388G>T	ENST00000339534.2	+	1	364	c.287G>T	c.(286-288)aGa>aTa	p.R96I		NM_203303.2	NP_976048.1	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	96							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	8						ACCTGCGGCAGACTAGGACAT	0.517																																							uc004ebs.3		NA																	0					0						c.(286-288)AGA>ATA		zinc finger, CCHC domain containing 13							113.0	92.0	99.0					X																	73524388		2203	4300	6503	SO:0001583	missense	389874						nucleic acid binding|zinc ion binding	g.chrX:73524388G>T	BC021176	CCDS14425.1	Xq13.2	2008-02-05			ENSG00000187969	ENSG00000187969		"""Zinc fingers, CCHC domain containing"""	31749	protein-coding gene	gene with protein product							Standard	NM_203303		Approved	4930513O09RIK, Cnbp2, ZNF9L	uc004ebs.4	Q8WW36	OTTHUMG00000021851	ENST00000339534.2:c.287G>T	X.37:g.73524388G>T	ENSP00000345633:p.Arg96Ile						p.R96I	NM_203303	NP_976048	Q8WW36	ZCH13_HUMAN			1	364	+			96			CCHC-type 4.			Missense_Mutation	SNP	ENST00000339534.2	37	c.287G>T	CCDS14425.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.691340	0.30052	.	.	ENSG00000187969	ENST00000339534	.	.	.	4.32	-2.86	0.05717	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (3);	0.219039	0.36591	U	0.002520	T	0.38453	0.1041	L	0.52573	1.65	0.09310	N	1	B	0.24186	0.099	B	0.25506	0.061	T	0.32903	-0.9889	9	0.87932	D	0	.	11.9661	0.53035	0.7266:0.0:0.2734:0.0	.	96	Q8WW36	ZCH13_HUMAN	I	96	.	ENSP00000345633:R96I	R	+	2	0	ZCCHC13	73441113	1.000000	0.71417	0.000000	0.03702	0.036000	0.12997	1.813000	0.38962	-0.925000	0.03775	0.529000	0.55759	AGA		0.517	ZCCHC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057260.1	NM_203303		34	39	1	0	2.48696e-23	0.003271	5.13397e-23	34	39				
BRWD3	254065	broad.mit.edu	37	X	79932688	79932688	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:79932688C>A	ENST00000373275.4	-	41	5045	c.4829G>T	c.(4828-4830)gGa>gTa	p.G1610V	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1610					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TAAACTGGATCCTAACTCTCC	0.388																																							uc004edt.2		NA																	0				ovary(4)	4						c.(4828-4830)GGA>GTA		bromodomain and WD repeat domain containing 3							130.0	115.0	120.0					X																	79932688		2203	4300	6503	SO:0001583	missense	254065							g.chrX:79932688C>A		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4829G>T	X.37:g.79932688C>A	ENSP00000362372:p.Gly1610Val					BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.G1206V|BRWD3_uc004edp.2_Missense_Mutation_p.G1439V|BRWD3_uc004edq.2_Missense_Mutation_p.G1206V|BRWD3_uc010nmj.1_Missense_Mutation_p.G1206V|BRWD3_uc004edr.2_Missense_Mutation_p.G1280V|BRWD3_uc004eds.2_Missense_Mutation_p.G1206V|BRWD3_uc004edu.2_Missense_Mutation_p.G1280V|BRWD3_uc004edv.2_Missense_Mutation_p.G1206V|BRWD3_uc004edw.2_Missense_Mutation_p.G1206V|BRWD3_uc004edx.2_Missense_Mutation_p.G1206V|BRWD3_uc004edy.2_Missense_Mutation_p.G1206V|BRWD3_uc004edz.2_Missense_Mutation_p.G1280V|BRWD3_uc004eea.2_Missense_Mutation_p.G1280V|BRWD3_uc004eeb.2_Missense_Mutation_p.G1206V|uc004edn.1_5'Flank	p.G1610V	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN			41	5092	-			1610					C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	c.4829G>T	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	C	6.801	0.516875	0.13005	.	.	ENSG00000165288	ENST00000373275	T	0.77489	-1.1	3.57	2.71	0.32032	.	0.579633	0.17035	N	0.189553	T	0.52773	0.1755	N	0.08118	0	0.49483	D	0.999799	P	0.48911	0.917	B	0.38655	0.278	T	0.46020	-0.9221	9	.	.	.	-5.2132	8.0011	0.30297	0.0:0.7982:0.0:0.2018	.	1610	Q6RI45	BRWD3_HUMAN	V	1610	ENSP00000362372:G1610V	.	G	-	2	0	BRWD3	79819344	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.847000	0.27696	0.884000	0.36064	0.506000	0.49869	GGA		0.388	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		43	57	1	0	9.14704e-12	0.00874	1.6441e-11	43	57				
POU3F4	5456	broad.mit.edu	37	X	82763435	82763435	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:82763435C>A	ENST00000373200.2	+	1	167	c.103C>A	c.(103-105)Cag>Aag	p.Q35K	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	35					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CCGCAACCCTCAGAAACTTCT	0.597																																							uc004eeg.2		NA																	0				ovary(1)	1						c.(103-105)CAG>AAG		POU domain, class 3, transcription factor 4							49.0	37.0	41.0					X																	82763435		2203	4300	6503	SO:0001583	missense	5456				sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity	g.chrX:82763435C>A	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.103C>A	X.37:g.82763435C>A	ENSP00000362296:p.Gln35Lys						p.Q35K	NM_000307	NP_000298	P49335	PO3F4_HUMAN			1	167	+			35					B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	c.103C>A	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172373	0.38315	.	.	ENSG00000196767	ENST00000373200	D	0.85484	-1.99	4.46	4.46	0.54185	.	0.064895	0.64402	D	0.000007	D	0.83257	0.5215	M	0.64404	1.975	0.52501	D	0.999956	P	0.41313	0.745	B	0.38562	0.276	D	0.85433	0.1150	10	0.52906	T	0.07	.	15.2276	0.73361	0.0:1.0:0.0:0.0	.	35	P49335	PO3F4_HUMAN	K	35	ENSP00000362296:Q35K	ENSP00000362296:Q35K	Q	+	1	0	POU3F4	82650091	1.000000	0.71417	0.995000	0.50966	0.591000	0.36615	4.941000	0.63540	2.187000	0.69744	0.597000	0.82753	CAG		0.597	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307		9	16	1	0	3.09899e-07	0.004482	4.78621e-07	9	16				
POU3F4	5456	broad.mit.edu	37	X	82764250	82764251	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:82764250_82764251GG>TT	ENST00000373200.2	+	1	982_983	c.918_919GG>TT	c.(916-921)caGGag>caTTag	p.306_307QE>H*	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	306					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CTGCCGCGCAGGAGATCTCCTC	0.569																																							uc004eeg.2		NA																	0				ovary(1)	1						c.(916-921)CAGGAG>CATTAG		POU domain, class 3, transcription factor 4																																				SO:0001587	stop_gained	5456				sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity	g.chrX:82764250_82764251GG>TT	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	Exception_encountered	X.37:g.82764250_82764251delinsTT	ENSP00000362296:p.Q306_E307delinsH*						p.306_307QE>H*	NM_000307	NP_000298	P49335	PO3F4_HUMAN			1	982_983	+			306_307			Homeobox.		B2RC71|Q5H9G9|Q99410	Nonsense_Mutation	DNP	ENST00000373200.2	37	c.918_919GG>TT	CCDS14450.1																																																																																				0.569	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307		13	7	0	0	0	0.004672	0	13	7				
TEX13B	56156	broad.mit.edu	37	X	107224606	107224606	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:107224606G>T	ENST00000302917.1	-	3	735	c.643C>A	c.(643-645)Cag>Aag	p.Q215K		NM_031273.2	NP_112563.1	Q9BXU2	TX13B_HUMAN	testis expressed 13B	215										breast(1)|endometrium(5)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28						CCCAGCCCCTGCAAGACCTCT	0.597																																							uc004enn.1		NA																	0				ovary(1)	1						c.(643-645)CAG>AAG		testis expressed 13B							99.0	108.0	105.0					X																	107224606		2200	4300	6500	SO:0001583	missense	56156							g.chrX:107224606G>T	AF285598	CCDS14534.1	Xq23	2008-02-05	2007-03-13		ENSG00000170925	ENSG00000170925			11736	protein-coding gene	gene with protein product		300313	"""testis expressed sequence 13B"""			11279525	Standard	NM_031273		Approved	TSGA5, TGC3B	uc004enn.1	Q9BXU2	OTTHUMG00000022174	ENST00000302917.1:c.643C>A	X.37:g.107224606G>T	ENSP00000303777:p.Gln215Lys						p.Q215K	NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN			3	736	-			215					Q5JYF6	Missense_Mutation	SNP	ENST00000302917.1	37	c.643C>A	CCDS14534.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.770095	0.00645	.	.	ENSG00000170925	ENST00000302917	.	.	.	3.39	-6.78	0.01721	.	.	.	.	.	T	0.12390	0.0301	N	0.04880	-0.145	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.23440	-1.0188	8	0.15952	T	0.53	.	4.9549	0.14035	0.0963:0.5121:0.1999:0.1918	.	215	Q9BXU2	TX13B_HUMAN	K	215	.	ENSP00000303777:Q215K	Q	-	1	0	TEX13B	107111262	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.589000	0.05767	-2.262000	0.00690	-0.225000	0.12378	CAG		0.597	TEX13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057857.1			51	152	1	0	6.08268e-21	0.00361	1.22535e-20	51	152				
NKRF	55922	broad.mit.edu	37	X	118724577	118724577	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:118724577C>G	ENST00000371527.1	-	2	1463	c.811G>C	c.(811-813)Gta>Cta	p.V271L	NKRF_ENST00000542113.1_Missense_Mutation_p.V286L|NKRF_ENST00000487600.1_Intron|NKRF_ENST00000304449.5_Missense_Mutation_p.V271L	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	271	Active repression domain.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						AAGAGTTTTACAGCTAGCTCT	0.453																																							uc004erq.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(811-813)GTA>CTA		transcription factor NRF							96.0	95.0	95.0					X																	118724577		2203	4300	6503	SO:0001583	missense	55922				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding	g.chrX:118724577C>G	AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.811G>C	X.37:g.118724577C>G	ENSP00000360582:p.Val271Leu					NKRF_uc004err.2_Missense_Mutation_p.V271L	p.V271L	NM_017544	NP_060014	O15226	NKRF_HUMAN			2	1464	-			271			Active repression domain.		G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	ENST00000371527.1	37	c.811G>C	CCDS35375.1	.	.	.	.	.	.	.	.	.	.	C	9.502	1.103363	0.20632	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	T;T;T	0.68903	-0.36;-0.36;-0.36	5.81	2.64	0.31445	.	0.119136	0.56097	D	0.000027	T	0.52322	0.1727	L	0.38531	1.155	0.48830	D	0.99971	B	0.25772	0.134	B	0.18561	0.022	T	0.43442	-0.9391	10	0.30854	T	0.27	-5.9955	11.1117	0.48237	0.0:0.7527:0.0:0.2473	.	271	O15226	NKRF_HUMAN	L	271;271;286	ENSP00000360582:V271L;ENSP00000304803:V271L;ENSP00000442308:V286L	ENSP00000304803:V271L	V	-	1	0	NKRF	118608605	0.817000	0.29147	0.999000	0.59377	0.995000	0.86356	1.526000	0.35964	0.590000	0.29694	0.600000	0.82982	GTA		0.453	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058044.1	NM_017544		49	64	0	0	0	0.00361	0	49	64				
SOX3	6658	broad.mit.edu	37	X	139586865	139586865	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:139586865C>A	ENST00000370536.2	-	1	360	c.361G>T	c.(361-363)Ggc>Tgc	p.G121C		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	121					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					CTGCTGCCGCCGCCCGAGTTC	0.726																																							uc004fbd.1		NA																	0				pancreas(1)	1						c.(361-363)GGC>TGC		SRY (sex determining region Y)-box 3							12.0	14.0	14.0					X																	139586865		2195	4280	6475	SO:0001583	missense	6658				face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding	g.chrX:139586865C>A		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.361G>T	X.37:g.139586865C>A	ENSP00000359567:p.Gly121Cys						p.G121C	NM_005634	NP_005625	P41225	SOX3_HUMAN			1	361	-	Acute lymphoblastic leukemia(192;7.65e-05)		121					P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	ENST00000370536.2	37	c.361G>T	CCDS14669.1	.	.	.	.	.	.	.	.	.	.	c	16.65	3.181404	0.57800	.	.	ENSG00000134595	ENST00000370536	D	0.87334	-2.24	4.39	2.54	0.30619	High mobility group, superfamily (1);	.	.	.	.	T	0.80924	0.4717	N	0.19112	0.55	0.37908	D	0.931278	P	0.51933	0.949	P	0.51550	0.673	T	0.76898	-0.2789	8	.	.	.	.	7.2548	0.26171	0.0:0.769:0.0:0.231	.	121	P41225	SOX3_HUMAN	C	121	ENSP00000359567:G121C	.	G	-	1	0	SOX3	139414531	1.000000	0.71417	0.692000	0.30179	0.562000	0.35680	3.174000	0.50847	0.646000	0.30693	0.525000	0.51046	GGC		0.726	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1			10	12	1	0	0.00621372	0.006214	0.00855155	10	12				
FMR1	2332	broad.mit.edu	37	X	147011469	147011469	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:147011469G>T	ENST00000370475.4	+	6	550	c.422G>T	c.(421-423)tGt>tTt	p.C141F	FMR1_ENST00000218200.8_Missense_Mutation_p.C141F|FMR1_ENST00000370470.1_Missense_Mutation_p.C141F|FMR1_ENST00000439526.2_Missense_Mutation_p.C141F|FMR1_ENST00000370477.1_Missense_Mutation_p.C141F|FMR1_ENST00000370471.3_Missense_Mutation_p.C141F|FMR1_ENST00000440235.2_5'Flank|FMR1_ENST00000334557.6_Missense_Mutation_p.C141F	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	141					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					atttCTAGGTGTGCCAAAGAG	0.323									Fragile X syndrome																														uc010nst.2		NA																	0				ovary(2)|pancreas(1)	3						c.(421-423)TGT>TTT		fragile X mental retardation 1							51.0	47.0	48.0					X																	147011469		2203	4298	6501	SO:0001583	missense	2332	Fragile_X_syndrome	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	mRNA transport|negative regulation of translational initiation	cytoplasm|mRNA cap binding complex|nucleolus|nucleoplasm|soluble fraction	mRNA binding|protein binding	g.chrX:147011469G>T	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.422G>T	X.37:g.147011469G>T	ENSP00000359506:p.Cys141Phe					FMR1_uc011mwz.1_Missense_Mutation_p.C141F|FMR1_uc004fcj.2_Missense_Mutation_p.C141F|FMR1_uc004fck.3_Missense_Mutation_p.C141F|FMR1_uc004fcl.3_Missense_Mutation_p.C2F|FMR1_uc011mxa.1_5'Flank	p.C141F	NM_002024	NP_002015	Q06787	FMR1_HUMAN			6	611	+	Acute lymphoblastic leukemia(192;6.56e-05)		141					A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	37	c.422G>T	CCDS14682.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217384	0.58560	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.58060	1.1;0.36;1.14;1.12;1.42;1.14;1.16	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.70954	0.3283	M	0.66439	2.03	0.80722	D	1	P;B;D;D;D	0.89917	0.591;0.264;1.0;1.0;0.999	P;B;D;D;D	0.91635	0.533;0.167;0.996;0.999;0.997	T	0.71196	-0.4664	10	0.44086	T	0.13	-13.9618	17.0099	0.86403	0.0:0.0:1.0:0.0	.	141;141;57;141;141	Q8IXW7;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	F	141	ENSP00000218200:C141F;ENSP00000359502:C141F;ENSP00000359508:C141F;ENSP00000359506:C141F;ENSP00000355115:C141F;ENSP00000395923:C141F;ENSP00000359501:C141F	ENSP00000218200:C141F	C	+	2	0	FMR1	146819161	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.735000	0.98825	2.312000	0.78011	0.600000	0.82982	TGT		0.323	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024		14	16	1	0	9.31168e-06	0.001855	1.39175e-05	14	16				
AFF2	2334	broad.mit.edu	37	X	147743891	147743891	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:147743891T>C	ENST00000370460.2	+	3	1122	c.643T>C	c.(643-645)Tct>Cct	p.S215P	AFF2_ENST00000370457.5_Missense_Mutation_p.S211P|AFF2_ENST00000342251.3_Missense_Mutation_p.S211P|AFF2_ENST00000370458.1_Missense_Mutation_p.S211P	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	215					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GTCAAACCCATCTGCAAAGGA	0.453																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(643-645)TCT>CCT		fragile X mental retardation 2							166.0	164.0	164.0					X																	147743891		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:147743891T>C	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.643T>C	X.37:g.147743891T>C	ENSP00000359489:p.Ser215Pro					AFF2_uc004fco.2_Missense_Mutation_p.S211P|AFF2_uc004fcq.2_Missense_Mutation_p.S211P|AFF2_uc004fcr.2_Missense_Mutation_p.S211P|AFF2_uc011mxb.1_Missense_Mutation_p.S215P|AFF2_uc004fcs.2_Missense_Mutation_p.S211P	p.S215P	NM_002025	NP_002016	P51816	AFF2_HUMAN			3	1122	+	Acute lymphoblastic leukemia(192;6.56e-05)		215					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.643T>C	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	T	0.611	-0.825190	0.02755	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.82	0.447	0.16608	.	0.730054	0.13289	N	0.399135	T	0.45458	0.1343	L	0.35542	1.07	0.09310	N	1	B;B;B;B;B;B	0.11235	0.003;0.003;0.003;0.003;0.004;0.001	B;B;B;B;B;B	0.12156	0.004;0.004;0.004;0.004;0.007;0.002	T	0.27905	-1.0060	10	0.33141	T	0.24	.	6.412	0.21696	0.0:0.4519:0.1458:0.4023	.	215;211;211;211;215;211	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	P	215;211;211;211	ENSP00000359489:S215P;ENSP00000359486:S211P;ENSP00000345459:S211P;ENSP00000359487:S211P	ENSP00000345459:S211P	S	+	1	0	AFF2	147551583	0.000000	0.05858	0.491000	0.27477	0.039000	0.13416	-0.332000	0.07904	0.020000	0.15106	-0.314000	0.08810	TCT		0.453	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		9	222	0	0	0	0.004482	0	9	222				
CNGA2	1260	broad.mit.edu	37	X	150912084	150912084	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:150912084A>T	ENST00000329903.4	+	6	1142	c.1109A>T	c.(1108-1110)aAt>aTt	p.N370I		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	370					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					ATCGTGGGAAATGTGGGCTCC	0.512																																							uc004fey.1		NA																	0				breast(3)	3						c.(1108-1110)AAT>ATT		cyclic nucleotide gated channel alpha 2							126.0	119.0	121.0					X																	150912084		2203	4300	6503	SO:0001583	missense	1260				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	g.chrX:150912084A>T	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1109A>T	X.37:g.150912084A>T	ENSP00000328478:p.Asn370Ile						p.N370I	NM_005140	NP_005131	Q16280	CNGA2_HUMAN			7	1333	+	Acute lymphoblastic leukemia(192;6.56e-05)		370			Helical; Name=H5; (Potential).		A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	c.1109A>T	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531900	0.64972	.	.	ENSG00000183862	ENST00000329903	D	0.98249	-4.82	4.96	4.96	0.65561	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99251	0.9739	H	0.96833	3.89	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.98948	1.0793	10	0.87932	D	0	.	11.7614	0.51905	1.0:0.0:0.0:0.0	.	370	Q16280	CNGA2_HUMAN	I	370	ENSP00000328478:N370I	ENSP00000328478:N370I	N	+	2	0	CNGA2	150662740	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	8.910000	0.92685	1.749000	0.51849	0.430000	0.28490	AAT		0.512	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140		48	60	0	0	0	0.00361	0	48	60				
MAGEA4	4103	broad.mit.edu	37	X	151092682	151092682	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:151092682C>A	ENST00000360243.2	+	3	813	c.546C>A	c.(544-546)tgC>tgA	p.C182*	MAGEA4_ENST00000276344.2_Nonsense_Mutation_p.C182*|MAGEA4_ENST00000370337.4_Nonsense_Mutation_p.C182*|MAGEA4_ENST00000370340.3_Nonsense_Mutation_p.C182*|MAGEA4_ENST00000393920.1_Nonsense_Mutation_p.C182*|MAGEA4_ENST00000370335.1_Nonsense_Mutation_p.C182*|MAGEA4_ENST00000393921.1_Nonsense_Mutation_p.C182*	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	182	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					TTGTCACCTGCCTGGGCCTTT	0.532																																							uc004fez.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(544-546)TGC>TGA		melanoma antigen family A, 4							101.0	102.0	102.0					X																	151092682		2203	4300	6503	SO:0001587	stop_gained	4103						protein binding	g.chrX:151092682C>A		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.546C>A	X.37:g.151092682C>A	ENSP00000353379:p.Cys182*					MAGEA4_uc004ffa.2_Nonsense_Mutation_p.C182*|MAGEA4_uc004ffb.2_Nonsense_Mutation_p.C182*|MAGEA4_uc004ffc.2_Nonsense_Mutation_p.C182*|MAGEA4_uc004ffd.2_Nonsense_Mutation_p.C182*	p.C182*	NM_002362	NP_002353	P43358	MAGA4_HUMAN			3	702	+	Acute lymphoblastic leukemia(192;6.56e-05)		182			MAGE.		Q14798	Nonsense_Mutation	SNP	ENST00000360243.2	37	c.546C>A	CCDS14702.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665249	0.67700	.	.	ENSG00000147381	ENST00000276344;ENST00000448295;ENST00000393921;ENST00000430273;ENST00000370337;ENST00000441865;ENST00000393920;ENST00000370340;ENST00000416020;ENST00000425182;ENST00000457310;ENST00000370335;ENST00000360243;ENST00000431971	.	.	.	2.37	1.48	0.22813	.	0.977037	0.08417	N	0.948976	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7769	0.18283	0.3137:0.6863:0.0:0.0	.	.	.	.	X	182	.	.	C	+	3	2	MAGEA4	150843338	0.000000	0.05858	0.001000	0.08648	0.311000	0.27955	-0.384000	0.07389	0.423000	0.26033	0.292000	0.19580	TGC		0.532	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362		64	89	1	0	7.05995e-25	0.00361	1.4794e-24	64	89				
PNMA5	114824	broad.mit.edu	37	X	152159340	152159340	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:152159340G>T	ENST00000439251.1	-	2	1241	c.803C>A	c.(802-804)cCc>cAc	p.P268H	PNMA5_ENST00000452693.1_Missense_Mutation_p.P268H|PNMA5_ENST00000535214.1_Missense_Mutation_p.P268H|PNMA5_ENST00000361887.5_Missense_Mutation_p.P268H	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	268					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CTGCAGCAGGGGCTCTAAGCG	0.537																																							uc010ntw.2		NA																	0				ovary(1)|skin(1)	2						c.(802-804)CCC>CAC		paraneoplastic antigen like 5							60.0	59.0	59.0					X																	152159340		2203	4299	6502	SO:0001583	missense	114824				apoptosis			g.chrX:152159340G>T	AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.803C>A	X.37:g.152159340G>T	ENSP00000388850:p.Pro268His					PNMA5_uc004fha.3_Missense_Mutation_p.P268H|PNMA5_uc010ntx.2_Missense_Mutation_p.P268H|PNMA5_uc004fgy.3_Missense_Mutation_p.P268H	p.P268H	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN			3	1142	-	Acute lymphoblastic leukemia(192;6.56e-05)		268					B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	ENST00000439251.1	37	c.803C>A	CCDS14718.1	.	.	.	.	.	.	.	.	.	.	g	15.43	2.830024	0.50845	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.10668	2.85;2.85;2.85;2.85	3.07	2.18	0.27775	.	.	.	.	.	T	0.26882	0.0658	M	0.66939	2.045	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.03493	-1.1031	9	0.59425	D	0.04	-0.1263	7.3725	0.26810	0.0:0.2655:0.7345:0.0	.	268	Q96PV4	PNMA5_HUMAN	H	268	ENSP00000354834:P268H;ENSP00000445775:P268H;ENSP00000388850:P268H;ENSP00000392342:P268H	ENSP00000354834:P268H	P	-	2	0	PNMA5	151909996	0.224000	0.23674	0.446000	0.26920	0.432000	0.31715	0.560000	0.23500	0.695000	0.31675	0.287000	0.19450	CCC		0.537	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	NM_052926		21	46	1	0	1.22574e-08	0.002299	1.99661e-08	21	46				
DUSP9	1852	broad.mit.edu	37	X	152914840	152914840	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:152914840C>A	ENST00000342782.3	+	3	792	c.527C>A	c.(526-528)tCc>tAc	p.S176Y	DUSP9_ENST00000370167.4_Missense_Mutation_p.S176Y			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	176					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GATGCGGAATCCGAGGCTGAC	0.701																																							uc004fhx.3		NA																	0				ovary(2)	2						c.(526-528)TCC>TAC		dual specificity phosphatase 9							41.0	35.0	37.0					X																	152914840		2203	4299	6502	SO:0001583	missense	1852				inactivation of MAPK activity|JNK cascade	cytosol|endoplasmic reticulum|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chrX:152914840C>A	Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.527C>A	X.37:g.152914840C>A	ENSP00000345853:p.Ser176Tyr					DUSP9_uc004fhy.3_Missense_Mutation_p.S176Y	p.S176Y	NM_001395	NP_001386	Q99956	DUS9_HUMAN			3	731	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		176					D3DWU5	Missense_Mutation	SNP	ENST00000342782.3	37	c.527C>A	CCDS14724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	21.6|21.6	4.176408|4.176408	0.78564|0.78564	.|.	.|.	ENSG00000130829|ENSG00000130829	ENST00000433144|ENST00000370167;ENST00000342782	.|T;T	.|0.51574	.|0.7;0.7	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	.|0.242933	.|0.28398	.|N	.|0.015483	T|T	0.65312|0.65312	0.2679|0.2679	M|M	0.64404|0.64404	1.975|1.975	0.53688|0.53688	D|D	0.999975|0.999975	.|D	.|0.69078	.|0.997	.|D	.|0.66847	.|0.947	T|T	0.69258|0.69258	-0.5192|-0.5192	5|10	.|0.72032	.|D	.|0.01	.|.	16.1181|16.1181	0.81324|0.81324	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|176	.|Q99956	.|DUS9_HUMAN	T|Y	147|176	.|ENSP00000359186:S176Y;ENSP00000345853:S176Y	.|ENSP00000345853:S176Y	P|S	+|+	1|2	0|0	DUSP9|DUSP9	152568034|152568034	0.998000|0.998000	0.40836|0.40836	0.020000|0.020000	0.16555|0.16555	0.743000|0.743000	0.42351|0.42351	4.900000|4.900000	0.63252|0.63252	2.054000|2.054000	0.61138|0.61138	0.529000|0.529000	0.55759|0.55759	CCG|TCC		0.701	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061022.3	NM_001395		21	16	1	0	2.89027e-11	0.002299	5.12869e-11	21	16				
FUNDC2	65991	broad.mit.edu	37	X	154261779	154261779	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chrX:154261779G>A	ENST00000369498.3	+	2	489	c.235G>A	c.(235-237)Gaa>Aaa	p.E79K	FUNDC2_ENST00000484175.1_3'UTR	NM_023934.3	NP_076423.2	Q9BWH2	FUND2_HUMAN	FUN14 domain containing 2	79						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACCTTCAGCAGAAAAGTATAG	0.463																																							uc004fmw.2		NA																	0					0						c.(235-237)GAA>AAA		FUN14 domain containing 2							148.0	128.0	135.0					X																	154261779		2203	4300	6503	SO:0001583	missense	65991					mitochondrion		g.chrX:154261779G>A	AF267862	CCDS14763.1	Xq28	2010-03-12			ENSG00000165775	ENSG00000165775			24925	protein-coding gene	gene with protein product						12477932	Standard	NM_023934		Approved	HCBP6, DC44	uc004fmw.3	Q9BWH2	OTTHUMG00000013504	ENST00000369498.3:c.235G>A	X.37:g.154261779G>A	ENSP00000358510:p.Glu79Lys						p.E79K	NM_023934	NP_076423	Q9BWH2	FUND2_HUMAN			2	385	+	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		79					B2R7W5|D3DWY5|Q8NHX8|Q9H2I6	Missense_Mutation	SNP	ENST00000369498.3	37	c.235G>A	CCDS14763.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.649212	0.67358	.	.	ENSG00000165775	ENST00000369498	.	.	.	5.28	5.28	0.74379	.	0.186479	0.45126	D	0.000388	T	0.61502	0.2352	M	0.66297	2.02	0.44816	D	0.997821	B	0.13145	0.007	B	0.14023	0.01	T	0.58775	-0.7577	9	0.37606	T	0.19	.	15.4824	0.75537	0.0:0.0:1.0:0.0	.	79	Q9BWH2	FUND2_HUMAN	K	79	.	ENSP00000358510:E79K	E	+	1	0	FUNDC2	153914973	1.000000	0.71417	0.875000	0.34327	0.926000	0.56050	6.769000	0.74985	2.337000	0.79520	0.594000	0.82650	GAA		0.463	FUNDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037641.3	NM_023934		6	127	0	0	0	0.001984	0	6	127				
MSH4	4438	broad.mit.edu	37	1	76347047	76347047	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:76347047delC	ENST00000263187.3	+	14	2002	c.1898delC	c.(1897-1899)tctfs	p.S633fs		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	633					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						TGCACTCTTTCTGACTATGGT	0.299								Mismatch excision repair (MMR)																															uc001dhd.1		NA																	0				lung(3)|ovary(2)	5						c.(1897-1899)TCTfs	MMR	mutS homolog 4							177.0	165.0	169.0					1																	76347047		2203	4300	6503	SO:0001589	frameshift_variant	4438				chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding	g.chr1:76347047delC	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.1898delC	1.37:g.76347047delC	ENSP00000263187:p.Ser633fs						p.S633fs	NM_002440	NP_002431	O15457	MSH4_HUMAN			14	1939	+			633					Q5T4U6|Q8NEB3|Q9UNP8	Frame_Shift_Del	DEL	ENST00000263187.3	37	c.1898delC	CCDS670.1																																																																																				0.299	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440		29	31	NA	NA	NA	NA	NA	29	31	---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152079960	152079960	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr1:152079960delC	ENST00000368804.1	-	2	5732	c.5733delG	c.(5731-5733)cggfs	p.R1911fs		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1911					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCCAGAAGCCGCCCATGGC	0.567																																							uc001ezp.2		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(5731-5733)CGGfs		trichohyalin							127.0	130.0	129.0					1																	152079960		1954	4131	6085	SO:0001589	frameshift_variant	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152079960delC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5733delG	1.37:g.152079960delC	ENSP00000357794:p.Arg1911fs					TCHH_uc009wne.1_Frame_Shift_Del_p.R1911fs	p.R1911fs	NM_007113	NP_009044	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	5733	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1911					Q5VUI3	Frame_Shift_Del	DEL	ENST00000368804.1	37	c.5733delG	CCDS41396.1																																																																																				0.567	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		35	122	NA	NA	NA	NA	NA	35	122	---	---	---	---
GAS2	2620	broad.mit.edu	37	11	22747844	22747844	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr11:22747844delC	ENST00000454584.2	+	4	579	c.274delC	c.(274-276)ccgfs	p.P92fs	GAS2_ENST00000433790.1_Frame_Shift_Del_p.P92fs|GAS2_ENST00000278187.3_Frame_Shift_Del_p.P92fs	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	92	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						TCAGAATCTACCGTTGAAGAA	0.383																																							uc009yie.2		NA																	0				ovary(1)|skin(1)	2						c.(274-276)CCGfs		growth arrest-specific 2							88.0	91.0	90.0					11																	22747844		2203	4300	6503	SO:0001589	frameshift_variant	2620				cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane		g.chr11:22747844delC	BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.274delC	11.37:g.22747844delC	ENSP00000401145:p.Pro92fs					GAS2_uc001mqm.2_Frame_Shift_Del_p.P92fs|GAS2_uc001mqn.2_RNA|GAS2_uc001mqo.2_Frame_Shift_Del_p.P92fs	p.P92fs	NM_001143830	NP_001137302	O43903	GAS2_HUMAN			4	580	+			92			CH.		B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Frame_Shift_Del	DEL	ENST00000454584.2	37	c.274delC	CCDS7858.1																																																																																				0.383	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387717.1	NM_177553		23	37	NA	NA	NA	NA	NA	23	37	---	---	---	---
ADNP2	22850	broad.mit.edu	37	18	77895677	77895681	+	Frame_Shift_Del	DEL	TGGGG	TGGGG	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	TGGGG	TGGGG	-	-	TGGGG	TGGGG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr18:77895677_77895681delTGGGG	ENST00000262198.4	+	4	2836_2840	c.2381_2385delTGGGG	c.(2380-2385)ctggggfs	p.LG794fs		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	794					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		AATAGGCACCTGGGGAAGAAGAAGT	0.459																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(2380-2385)CTGGGGfs		ADNP homeobox 2																																				SO:0001589	frameshift_variant	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77895677_77895681delTGGGG	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2381_2385delTGGGG	18.37:g.77895677_77895681delTGGGG	ENSP00000262198:p.Leu794fs						p.L794fs	NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	2836_2840	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	794_795					A8K951|O94943|Q9H9P3	Frame_Shift_Del	DEL	ENST00000262198.4	37	c.2381_2385delTGGGG	CCDS32853.1																																																																																				0.459	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		24	76	NA	NA	NA	NA	NA	24	76	---	---	---	---
NEB	4703	broad.mit.edu	37	2	152512848	152512870	+	Frame_Shift_Del	DEL	TTTTTCTTGTACTCCCGATCAGA	TTTTTCTTGTACTCCCGATCAGA	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	TTTTTCTTGTACTCCCGATCAGA	TTTTTCTTGTACTCCCGATCAGA	-	-	TTTTTCTTGTACTCCCGATCAGA	TTTTTCTTGTACTCCCGATCAGA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr2:152512848_152512870delTTTTTCTTGTACTCCCGATCAGA	ENST00000172853.10	-	49	6439_6461	c.6292_6314delTCTGATCGGGAGTACAAGAAAAA	c.(6292-6315)tctgatcgggagtacaagaaaaacfs	p.SDREYKKN2098fs	NEB_ENST00000603639.1_Frame_Shift_Del_p.SDREYKKN2098fs|NEB_ENST00000427231.2_Frame_Shift_Del_p.SDREYKKN2098fs|NEB_ENST00000409198.1_Frame_Shift_Del_p.SDREYKKN2098fs|NEB_ENST00000604864.1_Frame_Shift_Del_p.SDREYKKN2098fs|NEB_ENST00000397345.3_Frame_Shift_Del_p.SDREYKKN2098fs			P20929	NEBU_HUMAN	nebulin	2098					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.R2100L(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTTCTCATAGTTTTTCTTGTACTCCCGATCAGATTGCATCTTA	0.466																																							uc010fnx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(6292-6315)TCTGATCGGGAGTACAAGAAAAACfs		nebulin isoform 3																																				SO:0001589	frameshift_variant	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152512848_152512870delTTTTTCTTGTACTCCCGATCAGA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6292_6314delTCTGATCGGGAGTACAAGAAAAA	2.37:g.152512848_152512870delTTTTTCTTGTACTCCCGATCAGA	ENSP00000172853:p.Ser2098fs						p.S2098fs	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	49	6483_6505	-			2098_2105			Nebulin 55.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Frame_Shift_Del	DEL	ENST00000172853.10	37	c.6292_6314delTCTGATCGGGAGTACAAGAAAAA																																																																																					0.466	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		17	94	NA	NA	NA	NA	NA	17	94	---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60581656	60581656	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr20:60581656delG	ENST00000252996.4	-	7	2132	c.2133delC	c.(2131-2133)gccfs	p.A711fs		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	711					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TGGTCACGGTGGCCGCCGTCT	0.721																																							uc002ybs.2		NA																	0				ovary(2)|pancreas(1)	3						c.(2131-2133)GCCfs		TBP-associated factor 4							15.0	17.0	16.0					20																	60581656		2189	4269	6458	SO:0001589	frameshift_variant	6874				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr20:60581656delG	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2133delC	20.37:g.60581656delG	ENSP00000252996:p.Ala711fs						p.A711fs	NM_003185	NP_003176	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)		7	2133	-	Breast(26;1e-08)		711					A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Frame_Shift_Del	DEL	ENST00000252996.4	37	c.2133delC	CCDS33500.1																																																																																				0.721	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		7	9	NA	NA	NA	NA	NA	7	9	---	---	---	---
ZIC4	84107	broad.mit.edu	37	3	147114028	147114028	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr3:147114028delC	ENST00000383075.3	-	3	811	c.299delG	c.(298-300)ggcfs	p.G100fs	ZIC4_ENST00000484399.1_Frame_Shift_Del_p.G100fs|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000525172.2_Frame_Shift_Del_p.G150fs|ZIC4_ENST00000473123.1_Frame_Shift_Del_p.G100fs|ZIC4_ENST00000425731.3_Frame_Shift_Del_p.G138fs	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	100				G -> V (in Ref. 1; BAG57350). {ECO:0000305}.		nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CAGGTTCATGCCCCCGTAGCC	0.687																																							uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(298-300)GGCfs		zinc finger protein of the cerebellum 4							18.0	23.0	21.0					3																	147114028		2161	4275	6436	SO:0001589	frameshift_variant	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147114028delC	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.299delG	3.37:g.147114028delC	ENSP00000372553:p.Gly100fs					ZIC4_uc003ewc.1_Frame_Shift_Del_p.G30fs|ZIC4_uc011bno.1_Frame_Shift_Del_p.G150fs	p.G100fs	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN			3	572	-			100					A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Frame_Shift_Del	DEL	ENST00000383075.3	37	c.299delG	CCDS43160.1																																																																																				0.687	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			14	16	NA	NA	NA	NA	NA	14	16	---	---	---	---
NYAP1	222950	broad.mit.edu	37	7	100084609	100084609	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr7:100084609delG	ENST00000300179.2	+	3	393	c.234delG	c.(232-234)atgfs	p.M78fs	NYAP1_ENST00000454988.1_Frame_Shift_Del_p.M21fs|NYAP1_ENST00000423930.1_Frame_Shift_Del_p.M78fs	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	78	Involved in CYFIP1- and NCKAP1-binding. {ECO:0000250}.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GCAGCGCCATGGCCCCACGCT	0.721																																							uc003uvd.1		NA																	0				skin(1)	1						c.(232-234)ATGfs		hypothetical protein FLJ37538							11.0	14.0	13.0					7																	100084609		2171	4256	6427	SO:0001589	frameshift_variant	222950							g.chr7:100084609delG	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.234delG	7.37:g.100084609delG	ENSP00000300179:p.Met78fs					C7orf51_uc003uve.1_5'Flank	p.M78fs	NM_173564	NP_775835	Q6ZVC0	CG051_HUMAN			3	393	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		78					Q6U9Y3|Q8N1V0	Frame_Shift_Del	DEL	ENST00000300179.2	37	c.234delG	CCDS5696.1																																																																																				0.721	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564		5	8	NA	NA	NA	NA	NA	5	8	---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113694670	113694671	+	Splice_Site	DEL	CC	CC	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr8:113694670_113694671delCC	ENST00000297405.5	-	16	2921_2922	c.2677_2678delGG	c.(2677-2679)ggc>c	p.G893fs	CSMD3_ENST00000343508.3_Splice_Site_p.G853fs|CSMD3_ENST00000352409.3_Splice_Site_p.G893fs|CSMD3_ENST00000455883.2_Splice_Site_p.G789fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	893	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACTACACTTACCTCCACATTTT	0.351										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.e16+1		CUB and Sushi multiple domains 3 isoform 1																																				SO:0001630	splice_region_variant	114788					integral to membrane|plasma membrane		g.chr8:113694670_113694671delCC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2677+1GG>-	8.37:g.113694670_113694671delCC		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Splice_Site_p.A165_splice|CSMD3_uc003ynt.2_Splice_Site_p.A853_splice|CSMD3_uc011lhx.1_Splice_Site_p.A789_splice	p.A893_splice	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			16	2836	-								Q96PZ3	Splice_Site	DEL	ENST00000297405.5	37	c.2677_splice	CCDS6315.1																																																																																				0.351	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Frame_Shift_Del	11	77	NA	NA	NA	NA	NA	11	77	---	---	---	---
SPATA31C1	441452	broad.mit.edu	37	9	90537868	90537868	+	RNA	DEL	G	G	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:90537868delG	ENST00000602681.1	+	0	1927							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AAGCCACTTTGGAGAAAACAT	0.428																																							uc010mqi.2		NA																	0					0						c.(3046-3048)GGAfs		family with sequence similarity 75, member C1							23.0	40.0	34.0					9																	90537868		669	1337	2006			441452							g.chr9:90537868delG	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90537868delG						FAM75C1_uc004apq.3_Frame_Shift_Del_p.G999fs	p.G1016fs	NM_001145124	NP_001138596					4	3075	+									Frame_Shift_Del	DEL	ENST00000602681.1	37	c.3046delG																																																																																					0.428	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124		23	21	NA	NA	NA	NA	NA	23	21	---	---	---	---
SPATA31C2	645961	broad.mit.edu	37	9	90744923	90744923	+	IGR	DEL	C	C	-			TCGA-78-7158-01A-11D-2036-08	TCGA-78-7158-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	199bbb0f-996c-40c1-b06d-2066f04be778	3f4bced4-f89a-43d2-9c5f-6f9683897fa7	g.chr9:90744923delC								U6 (131673 upstream) : U3 (244260 downstream)																							GATGTTTTCTCCAAAGTGGCT	0.433																																							uc011lti.1		NA																	0					NA						c.(3028-3030)GGAfs		SubName: Full=cDNA FLJ59639;							138.0	114.0	121.0					9																	90744923		692	1591	2283	SO:0001628	intergenic_variant	0							g.chr9:90744923delC																													9.37:g.90744923delC						uc004apx.1_5'Flank	p.G1010fs							4	3058	-									Frame_Shift_Del	DEL		37	c.3029delG																																																																																				0	0.433									36	202	NA	NA	NA	NA	NA	36	202	---	---	---	---
